>Feature sequence01 272 1003 gene locus_tag LOCUS_00010 272 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1160 1777 gene locus_tag LOCUS_00020 1160 1777 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702119.1 protein_id gnl|my_center|LOCUS_00020 1774 2778 gene locus_tag LOCUS_00030 1774 2778 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887496.1 protein_id gnl|my_center|LOCUS_00030 2782 4506 gene locus_tag LOCUS_00040 2782 4506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975722.1 protein_id gnl|my_center|LOCUS_00040 4503 5621 gene locus_tag LOCUS_00050 4503 5621 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529050.1 protein_id gnl|my_center|LOCUS_00050 5626 6732 gene locus_tag LOCUS_00060 5626 6732 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061625.1 protein_id gnl|my_center|LOCUS_00060 7563 6739 gene locus_tag LOCUS_00070 gene ppk2 7563 6739 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921245.1 protein_id gnl|my_center|LOCUS_00070 7706 8281 gene locus_tag LOCUS_00080 gene sigH 7706 8281 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 protein_id gnl|my_center|LOCUS_00080 8529 8317 gene locus_tag LOCUS_00090 8529 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9603 8554 gene locus_tag LOCUS_00100 9603 8554 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064727.1 protein_id gnl|my_center|LOCUS_00100 10577 9660 gene locus_tag LOCUS_00110 10577 9660 CDS product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946758.1 protein_id gnl|my_center|LOCUS_00110 12112 10574 gene locus_tag LOCUS_00120 12112 10574 CDS product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWR3 protein_id gnl|my_center|LOCUS_00120 13473 12109 gene locus_tag LOCUS_00130 13473 12109 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_00130 14894 13560 gene locus_tag LOCUS_00140 14894 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15043 16632 gene locus_tag LOCUS_00150 15043 16632 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 protein_id gnl|my_center|LOCUS_00150 19080 16687 gene locus_tag LOCUS_00160 19080 16687 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021360.1 protein_id gnl|my_center|LOCUS_00160 20095 19166 gene locus_tag LOCUS_00170 20095 19166 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IV9 protein_id gnl|my_center|LOCUS_00170 20451 21137 gene locus_tag LOCUS_00180 20451 21137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21153 22901 gene locus_tag LOCUS_00190 21153 22901 CDS product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071701.1 protein_id gnl|my_center|LOCUS_00190 22898 24112 gene locus_tag LOCUS_00200 22898 24112 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250510.1 protein_id gnl|my_center|LOCUS_00200 24257 26677 gene locus_tag LOCUS_00210 gene ppsA 24257 26677 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3G7 protein_id gnl|my_center|LOCUS_00210 26674 27675 gene locus_tag LOCUS_00220 gene ldhA 26674 27675 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522216.1 protein_id gnl|my_center|LOCUS_00220 29386 27680 gene locus_tag LOCUS_00230 gene pbpA 29386 27680 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337401.1 protein_id gnl|my_center|LOCUS_00230 30563 29841 gene locus_tag LOCUS_00240 gene plsC 30563 29841 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084210.1 protein_id gnl|my_center|LOCUS_00240 31061 30795 gene locus_tag LOCUS_00250 31061 30795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 31182 31364 gene locus_tag LOCUS_00260 31182 31364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 31653 33074 gene locus_tag LOCUS_00270 gene cls 31653 33074 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039099.1 protein_id gnl|my_center|LOCUS_00270 41403 33184 gene locus_tag LOCUS_00280 41403 33184 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816923.1 protein_id gnl|my_center|LOCUS_00280 41954 41403 gene locus_tag LOCUS_00290 41954 41403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 42054 42410 gene locus_tag LOCUS_00300 42054 42410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 43013 42792 gene locus_tag LOCUS_00310 43013 42792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 43355 43825 gene locus_tag LOCUS_00320 43355 43825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 43877 44098 gene locus_tag LOCUS_00330 43877 44098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 44801 44148 gene locus_tag LOCUS_00340 44801 44148 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090714.1 protein_id gnl|my_center|LOCUS_00340 45085 44804 gene locus_tag LOCUS_00350 45085 44804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 45401 46654 gene locus_tag LOCUS_00360 45401 46654 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_00360 48679 47039 gene locus_tag LOCUS_00370 48679 47039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 49765 49022 gene locus_tag LOCUS_00380 49765 49022 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722809.1 protein_id gnl|my_center|LOCUS_00380 50341 49814 gene locus_tag LOCUS_00390 50341 49814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 52114 50480 gene locus_tag LOCUS_00400 52114 50480 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057811.1 protein_id gnl|my_center|LOCUS_00400 54001 52187 gene locus_tag LOCUS_00410 gene edd 54001 52187 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_00410 55673 54072 gene locus_tag LOCUS_00420 55673 54072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 55938 56843 gene locus_tag LOCUS_00430 55938 56843 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031409.1 protein_id gnl|my_center|LOCUS_00430 57703 56888 gene locus_tag LOCUS_00440 57703 56888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200938.1 protein_id gnl|my_center|LOCUS_00440 57992 59191 gene locus_tag LOCUS_00450 gene pgk 57992 59191 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIJ2 protein_id gnl|my_center|LOCUS_00450 62029 59273 gene locus_tag LOCUS_00460 62029 59273 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331363.1 protein_id gnl|my_center|LOCUS_00460 62806 62036 gene locus_tag LOCUS_00470 62806 62036 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434817.1 protein_id gnl|my_center|LOCUS_00470 63225 64097 gene locus_tag LOCUS_00480 63225 64097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 64960 64073 gene locus_tag LOCUS_00490 64960 64073 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533547.1 protein_id gnl|my_center|LOCUS_00490 65539 64994 gene locus_tag LOCUS_00500 65539 64994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 65980 65609 gene locus_tag LOCUS_00510 65980 65609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 66503 67015 gene locus_tag LOCUS_00520 66503 67015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 67027 68472 gene locus_tag LOCUS_00530 67027 68472 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707752.1 protein_id gnl|my_center|LOCUS_00530 68512 69741 gene locus_tag LOCUS_00540 gene arcA 68512 69741 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13981 protein_id gnl|my_center|LOCUS_00540 69780 70781 gene locus_tag LOCUS_00550 gene arcB 69780 70781 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UK00 protein_id gnl|my_center|LOCUS_00550 70786 71739 gene locus_tag LOCUS_00560 70786 71739 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UK01 protein_id gnl|my_center|LOCUS_00560 71904 72482 gene locus_tag LOCUS_00570 71904 72482 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH6 protein_id gnl|my_center|LOCUS_00570 73401 72733 gene locus_tag LOCUS_00580 73401 72733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 73745 74653 gene locus_tag LOCUS_00590 73745 74653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393794.1 protein_id gnl|my_center|LOCUS_00590 76061 74727 gene locus_tag LOCUS_00600 gene hipA 76061 74727 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084785.1 protein_id gnl|my_center|LOCUS_00600 76310 76062 gene locus_tag LOCUS_00610 76310 76062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 77240 76506 gene locus_tag LOCUS_00620 77240 76506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 77785 77264 gene locus_tag LOCUS_00630 77785 77264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 78922 77807 gene locus_tag LOCUS_00640 gene pcoB 78922 77807 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 protein_id gnl|my_center|LOCUS_00640 80751 78922 gene locus_tag LOCUS_00650 80751 78922 CDS product multicopper oxidase PcoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265648.1 protein_id gnl|my_center|LOCUS_00650 81369 80809 gene locus_tag LOCUS_00660 81369 80809 CDS product putative alternative RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705660.1 protein_id gnl|my_center|LOCUS_00660 81756 81376 gene locus_tag LOCUS_00670 81756 81376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 81688 82041 gene locus_tag LOCUS_00680 81688 82041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 82303 82884 gene locus_tag LOCUS_00690 82303 82884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 82885 83571 gene locus_tag LOCUS_00700 82885 83571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 83568 84035 gene locus_tag LOCUS_00710 83568 84035 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403905.1 protein_id gnl|my_center|LOCUS_00710 84071 84337 gene locus_tag LOCUS_00720 84071 84337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 84582 84385 gene locus_tag LOCUS_00730 84582 84385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 84776 85048 gene locus_tag LOCUS_00740 84776 85048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 85061 85945 gene locus_tag LOCUS_00750 85061 85945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 86098 88308 gene locus_tag LOCUS_00760 86098 88308 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_00760 88429 89802 gene locus_tag LOCUS_00770 88429 89802 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_00770 90099 90842 gene locus_tag LOCUS_00780 90099 90842 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945820.1 protein_id gnl|my_center|LOCUS_00780 90839 91252 gene locus_tag LOCUS_00790 90839 91252 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_00790 91249 91776 gene locus_tag LOCUS_00800 91249 91776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_00800 91773 92261 gene locus_tag LOCUS_00810 91773 92261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 92354 93058 gene locus_tag LOCUS_00820 92354 93058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 93130 94482 gene locus_tag LOCUS_00830 93130 94482 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_00830 94877 94674 gene locus_tag LOCUS_00840 94877 94674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 95048 94887 gene locus_tag LOCUS_00850 95048 94887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 95204 96439 gene locus_tag LOCUS_00860 95204 96439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 96436 97929 gene locus_tag LOCUS_00870 96436 97929 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817192.1 protein_id gnl|my_center|LOCUS_00870 97926 101093 gene locus_tag LOCUS_00880 gene cusA 97926 101093 CDS product cation efflux system protein CusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38054 protein_id gnl|my_center|LOCUS_00880 101072 101455 gene locus_tag LOCUS_00890 101072 101455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 101512 103062 gene locus_tag LOCUS_00900 101512 103062 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600173.1 protein_id gnl|my_center|LOCUS_00900 103075 103371 gene locus_tag LOCUS_00910 103075 103371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 103767 103327 gene locus_tag LOCUS_00920 103767 103327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 104148 103861 gene locus_tag LOCUS_00930 104148 103861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 104372 104761 gene locus_tag LOCUS_00940 104372 104761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 104995 105642 gene locus_tag LOCUS_00950 104995 105642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 106274 106531 gene locus_tag LOCUS_00960 106274 106531 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974003.1 protein_id gnl|my_center|LOCUS_00960 106626 106814 gene locus_tag LOCUS_00970 106626 106814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00970 106875 107183 gene locus_tag LOCUS_00980 106875 107183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00980 107187 107477 gene locus_tag LOCUS_00990 107187 107477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 107669 108001 gene locus_tag LOCUS_01000 107669 108001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 109221 108040 gene locus_tag LOCUS_01010 109221 108040 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_01010 109319 109504 gene locus_tag LOCUS_01020 109319 109504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 110019 109558 gene locus_tag LOCUS_01030 110019 109558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 111968 110754 gene locus_tag LOCUS_01040 gene argG 111968 110754 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYJ1 protein_id gnl|my_center|LOCUS_01040 113312 112065 gene locus_tag LOCUS_01050 113312 112065 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 protein_id gnl|my_center|LOCUS_01050 114086 113346 gene locus_tag LOCUS_01060 114086 113346 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531947.1 protein_id gnl|my_center|LOCUS_01060 114745 114083 gene locus_tag LOCUS_01070 114745 114083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531946.1 protein_id gnl|my_center|LOCUS_01070 115420 114761 gene locus_tag LOCUS_01080 115420 114761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 115991 115626 gene locus_tag LOCUS_01090 115991 115626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 117334 116105 gene locus_tag LOCUS_01100 gene rlmN 117334 116105 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X03 protein_id gnl|my_center|LOCUS_01100 117915 117403 gene locus_tag LOCUS_01110 117915 117403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 118468 117983 gene locus_tag LOCUS_01120 gene greB 118468 117983 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFI0 protein_id gnl|my_center|LOCUS_01120 120455 118488 gene locus_tag LOCUS_01130 120455 118488 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338564.1 protein_id gnl|my_center|LOCUS_01130 120561 121439 gene locus_tag LOCUS_01140 gene dapA 120561 121439 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R55 protein_id gnl|my_center|LOCUS_01140 121508 121990 gene locus_tag LOCUS_01150 gene smpB 121508 121990 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RH74 protein_id gnl|my_center|LOCUS_01150 122151 122726 gene locus_tag LOCUS_01160 122151 122726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_01160 122723 125155 gene locus_tag LOCUS_01170 122723 125155 CDS product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531860.1 protein_id gnl|my_center|LOCUS_01170 125268 126332 gene locus_tag LOCUS_01180 gene recA 125268 126332 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH9 protein_id gnl|my_center|LOCUS_01180 126478 127302 gene locus_tag LOCUS_01190 126478 127302 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971751.1 protein_id gnl|my_center|LOCUS_01190 127374 130025 gene locus_tag LOCUS_01200 gene alaS 127374 130025 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9N4 protein_id gnl|my_center|LOCUS_01200 131820 130048 gene locus_tag LOCUS_01210 131820 130048 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_01210 133487 131874 gene locus_tag LOCUS_01220 gene yhcX 133487 131874 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_01220 134734 133520 gene locus_tag LOCUS_01230 gene icdA 134734 133520 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CII8 protein_id gnl|my_center|LOCUS_01230 135004 134930 gene locus_tag LOCUS_t00010 135004 134930 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 135493 135119 gene locus_tag LOCUS_01240 135493 135119 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006199474.1 protein_id gnl|my_center|LOCUS_01240 135680 136648 gene locus_tag LOCUS_01250 135680 136648 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529713.1 protein_id gnl|my_center|LOCUS_01250 137684 136896 gene locus_tag LOCUS_01260 137684 136896 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 protein_id gnl|my_center|LOCUS_01260 139223 137775 gene locus_tag LOCUS_01270 139223 137775 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921218.1 protein_id gnl|my_center|LOCUS_01270 139412 140038 gene locus_tag LOCUS_01280 139412 140038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 140228 141628 gene locus_tag LOCUS_01290 140228 141628 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531373.1 protein_id gnl|my_center|LOCUS_01290 141727 142536 gene locus_tag LOCUS_01300 141727 142536 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530156.1 protein_id gnl|my_center|LOCUS_01300 144827 142563 gene locus_tag LOCUS_01310 gene pcrA 144827 142563 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CXZ3 protein_id gnl|my_center|LOCUS_01310 144983 146272 gene locus_tag LOCUS_01320 144983 146272 CDS product membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522316.1 protein_id gnl|my_center|LOCUS_01320 146305 146646 gene locus_tag LOCUS_01330 146305 146646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 147198 146656 gene locus_tag LOCUS_01340 147198 146656 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388411.1 protein_id gnl|my_center|LOCUS_01340 148007 147195 gene locus_tag LOCUS_01350 148007 147195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 148129 149838 gene locus_tag LOCUS_01360 148129 149838 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_01360 151192 149846 gene locus_tag LOCUS_01370 gene folC 151192 149846 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_01370 152085 151237 gene locus_tag LOCUS_01380 gene accD 152085 151237 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBE1 protein_id gnl|my_center|LOCUS_01380 152870 152082 gene locus_tag LOCUS_01390 gene trpA 152870 152082 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B60 protein_id gnl|my_center|LOCUS_01390 154099 152867 gene locus_tag LOCUS_01400 gene trpB 154099 152867 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS4 protein_id gnl|my_center|LOCUS_01400 154751 154110 gene locus_tag LOCUS_01410 gene trpF 154751 154110 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS6 protein_id gnl|my_center|LOCUS_01410 155467 154790 gene locus_tag LOCUS_01420 gene pyrF 155467 154790 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS7 protein_id gnl|my_center|LOCUS_01420 155838 155464 gene locus_tag LOCUS_01430 155838 155464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 157245 155935 gene locus_tag LOCUS_01440 157245 155935 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCK6 protein_id gnl|my_center|LOCUS_01440 158106 157336 gene locus_tag LOCUS_01450 158106 157336 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEZ6 protein_id gnl|my_center|LOCUS_01450 158279 161404 gene locus_tag LOCUS_01460 158279 161404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 161404 161604 gene locus_tag LOCUS_01470 161404 161604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 161604 161990 gene locus_tag LOCUS_01480 161604 161990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 162195 162512 gene locus_tag LOCUS_01490 162195 162512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 162589 163383 gene locus_tag LOCUS_01500 gene atpB 162589 163383 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA4 protein_id gnl|my_center|LOCUS_01500 163419 163652 gene locus_tag LOCUS_01510 163419 163652 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707029.1 protein_id gnl|my_center|LOCUS_01510 163746 164240 gene locus_tag LOCUS_01520 163746 164240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 164233 164841 gene locus_tag LOCUS_01530 164233 164841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 165697 164909 gene locus_tag LOCUS_01540 165697 164909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726862.1 protein_id gnl|my_center|LOCUS_01540 167530 165824 gene locus_tag LOCUS_01550 167530 165824 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9B0 protein_id gnl|my_center|LOCUS_01550 168408 167788 gene locus_tag LOCUS_01560 gene cmk 168408 167788 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2H3 protein_id gnl|my_center|LOCUS_01560 168671 168405 gene locus_tag LOCUS_01570 168671 168405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 170074 168668 gene locus_tag LOCUS_01580 gene aroA 170074 168668 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW89 protein_id gnl|my_center|LOCUS_01580 170209 170535 gene locus_tag LOCUS_01590 170209 170535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 170697 170772 gene locus_tag LOCUS_t00020 170697 170772 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 170927 172405 gene locus_tag LOCUS_01600 gene ffh 170927 172405 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV60 protein_id gnl|my_center|LOCUS_01600 172439 172987 gene locus_tag LOCUS_01610 172439 172987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 172991 173482 gene locus_tag LOCUS_01620 gene rimM 172991 173482 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X39 protein_id gnl|my_center|LOCUS_01620 173980 173498 gene locus_tag LOCUS_01630 173980 173498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 174028 174774 gene locus_tag LOCUS_01640 gene trmD 174028 174774 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIW8 protein_id gnl|my_center|LOCUS_01640 174771 175139 gene locus_tag LOCUS_01650 gene rplS 174771 175139 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X35 protein_id gnl|my_center|LOCUS_01650 175274 176476 gene locus_tag LOCUS_01660 175274 176476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 176555 177580 gene locus_tag LOCUS_01670 gene asd 176555 177580 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY28 protein_id gnl|my_center|LOCUS_01670 179189 177603 gene locus_tag LOCUS_01680 179189 177603 CDS product EmrB/QacA family drug resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337338.1 protein_id gnl|my_center|LOCUS_01680 180285 179194 gene locus_tag LOCUS_01690 180285 179194 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532371.1 protein_id gnl|my_center|LOCUS_01690 180730 180278 gene locus_tag LOCUS_01700 180730 180278 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337336.1 protein_id gnl|my_center|LOCUS_01700 180837 181595 gene locus_tag LOCUS_01710 180837 181595 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225205.1 protein_id gnl|my_center|LOCUS_01710 182314 181682 gene locus_tag LOCUS_01720 gene rplI 182314 181682 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVN4 protein_id gnl|my_center|LOCUS_01720 182553 182329 gene locus_tag LOCUS_01730 gene rpsR 182553 182329 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q2 protein_id gnl|my_center|LOCUS_01730 182918 182556 gene locus_tag LOCUS_01740 182918 182556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 184527 183100 gene locus_tag LOCUS_01750 gene murC 184527 183100 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDM9 protein_id gnl|my_center|LOCUS_01750 184653 185411 gene locus_tag LOCUS_01760 184653 185411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 185440 186375 gene locus_tag LOCUS_01770 185440 186375 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC5 protein_id gnl|my_center|LOCUS_01770 186393 187142 gene locus_tag LOCUS_01780 gene fabG 186393 187142 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_01780 187287 188414 gene locus_tag LOCUS_01790 gene dnaN 187287 188414 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W64 protein_id gnl|my_center|LOCUS_01790 189758 188439 gene locus_tag LOCUS_01800 189758 188439 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887141.1 protein_id gnl|my_center|LOCUS_01800 190554 189841 gene locus_tag LOCUS_01810 gene phaD 190554 189841 CDS product poly(3-hydroxyalkanoic acid) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_01810 190971 193694 gene locus_tag LOCUS_01820 190971 193694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 193782 195989 gene locus_tag LOCUS_01830 193782 195989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 196123 197940 gene locus_tag LOCUS_01840 gene lepA 196123 197940 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9F4 protein_id gnl|my_center|LOCUS_01840 198098 198847 gene locus_tag LOCUS_01850 198098 198847 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_01850 198891 199331 gene locus_tag LOCUS_01860 198891 199331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 199419 200231 gene locus_tag LOCUS_01870 gene bamD 199419 200231 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8V9 protein_id gnl|my_center|LOCUS_01870 201813 200254 gene locus_tag LOCUS_01880 201813 200254 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729521.1 protein_id gnl|my_center|LOCUS_01880 201906 203000 gene locus_tag LOCUS_01890 201906 203000 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031180.1 protein_id gnl|my_center|LOCUS_01890 203414 203013 gene locus_tag LOCUS_01900 203414 203013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 204186 203503 gene locus_tag LOCUS_01910 204186 203503 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63L05 protein_id gnl|my_center|LOCUS_01910 206504 204204 gene locus_tag LOCUS_01920 206504 204204 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073660.1 protein_id gnl|my_center|LOCUS_01920 206698 208362 gene locus_tag LOCUS_01930 206698 208362 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV4 protein_id gnl|my_center|LOCUS_01930 208362 210533 gene locus_tag LOCUS_01940 gene ligA 208362 210533 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF64 protein_id gnl|my_center|LOCUS_01940 210538 211038 gene locus_tag LOCUS_01950 210538 211038 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090633.1 protein_id gnl|my_center|LOCUS_01950 212136 211129 gene locus_tag LOCUS_01960 gene prmA 212136 211129 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F3 protein_id gnl|my_center|LOCUS_01960 212247 212627 gene locus_tag LOCUS_01970 gene sdhC 212247 212627 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310797.1 protein_id gnl|my_center|LOCUS_01970 212641 213024 gene locus_tag LOCUS_01980 212641 213024 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709623.1 protein_id gnl|my_center|LOCUS_01980 213026 214849 gene locus_tag LOCUS_01990 gene sdhA 213026 214849 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6R5 protein_id gnl|my_center|LOCUS_01990 215142 214933 gene locus_tag LOCUS_02000 215142 214933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521228.1 protein_id gnl|my_center|LOCUS_02000 217309 215225 gene locus_tag LOCUS_02010 217309 215225 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140315.1 protein_id gnl|my_center|LOCUS_02010 218694 217546 gene locus_tag LOCUS_02020 218694 217546 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067711.1 protein_id gnl|my_center|LOCUS_02020 218819 220231 gene locus_tag LOCUS_02030 218819 220231 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971435.1 protein_id gnl|my_center|LOCUS_02030 220926 220228 gene locus_tag LOCUS_02040 220926 220228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 221773 220886 gene locus_tag LOCUS_02050 221773 220886 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_02050 221988 223445 gene locus_tag LOCUS_02060 gene guaB 221988 223445 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N70 protein_id gnl|my_center|LOCUS_02060 223467 224651 gene locus_tag LOCUS_02070 223467 224651 CDS product rRNA cytosine-C5-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_02070 224665 225216 gene locus_tag LOCUS_02080 224665 225216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 225753 225271 gene locus_tag LOCUS_02090 gene ialA 225753 225271 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5P3 protein_id gnl|my_center|LOCUS_02090 225941 227803 gene locus_tag LOCUS_02100 gene korA 225941 227803 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222472.1 protein_id gnl|my_center|LOCUS_02100 227809 228837 gene locus_tag LOCUS_02110 227809 228837 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 protein_id gnl|my_center|LOCUS_02110 228910 229911 gene locus_tag LOCUS_02120 228910 229911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 229901 231298 gene locus_tag LOCUS_02130 gene phrA 229901 231298 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJC9 protein_id gnl|my_center|LOCUS_02130 231382 232650 gene locus_tag LOCUS_02140 231382 232650 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971979.1 protein_id gnl|my_center|LOCUS_02140 233002 232655 gene locus_tag LOCUS_02150 233002 232655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 233849 233118 gene locus_tag LOCUS_02160 233849 233118 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 protein_id gnl|my_center|LOCUS_02160 235342 233849 gene locus_tag LOCUS_02170 gene purF 235342 233849 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ7 protein_id gnl|my_center|LOCUS_02170 235480 236721 gene locus_tag LOCUS_02180 235480 236721 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975111.1 protein_id gnl|my_center|LOCUS_02180 236714 237388 gene locus_tag LOCUS_02190 gene lolD1 236714 237388 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU16 protein_id gnl|my_center|LOCUS_02190 237486 237722 gene locus_tag LOCUS_02200 237486 237722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 238946 237774 gene locus_tag LOCUS_02210 238946 237774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 239123 242614 gene locus_tag LOCUS_02220 239123 242614 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU13 protein_id gnl|my_center|LOCUS_02220 243166 242705 gene locus_tag LOCUS_02230 243166 242705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 243830 243303 gene locus_tag LOCUS_02240 243830 243303 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_02240 245640 243820 gene locus_tag LOCUS_02250 245640 243820 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_02250 246440 245637 gene locus_tag LOCUS_02260 246440 245637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 246539 248185 gene locus_tag LOCUS_02270 gene fzeA 246539 248185 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919211.1 protein_id gnl|my_center|LOCUS_02270 248195 249007 gene locus_tag LOCUS_02280 gene ispE 248195 249007 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S79 protein_id gnl|my_center|LOCUS_02280 249004 249729 gene locus_tag LOCUS_02290 249004 249729 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973301.1 protein_id gnl|my_center|LOCUS_02290 249783 251639 gene locus_tag LOCUS_02300 gene ilvD 249783 251639 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H367 protein_id gnl|my_center|LOCUS_02300 251639 252031 gene locus_tag LOCUS_02310 251639 252031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 252009 253421 gene locus_tag LOCUS_02320 252009 253421 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU48 protein_id gnl|my_center|LOCUS_02320 253702 253331 gene locus_tag LOCUS_02330 253702 253331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 253646 254635 gene locus_tag LOCUS_02340 253646 254635 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919203.1 protein_id gnl|my_center|LOCUS_02340 255382 254585 gene locus_tag LOCUS_02350 255382 254585 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_02350 256065 255382 gene locus_tag LOCUS_02360 256065 255382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 256380 256075 gene locus_tag LOCUS_02370 256380 256075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_02370 257496 256432 gene locus_tag LOCUS_02380 257496 256432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 257455 258981 gene locus_tag LOCUS_02390 257455 258981 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_02390 258978 260228 gene locus_tag LOCUS_02400 258978 260228 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_02400 260477 261121 gene locus_tag LOCUS_02410 260477 261121 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_02410 261137 262654 gene locus_tag LOCUS_02420 261137 262654 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_02420 262668 263735 gene locus_tag LOCUS_02430 262668 263735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 263739 265409 gene locus_tag LOCUS_02440 263739 265409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 265424 266662 gene locus_tag LOCUS_02450 265424 266662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 266677 267549 gene locus_tag LOCUS_02460 266677 267549 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_02460 267546 268613 gene locus_tag LOCUS_02470 267546 268613 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_02470 268610 269884 gene locus_tag LOCUS_02480 268610 269884 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_02480 269874 271439 gene locus_tag LOCUS_02490 269874 271439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 271449 273344 gene locus_tag LOCUS_02500 271449 273344 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_02500 273498 274454 gene locus_tag LOCUS_02510 gene rpfF 273498 274454 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037027.1 protein_id gnl|my_center|LOCUS_02510 275203 274502 gene locus_tag LOCUS_02520 275203 274502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090296.1 protein_id gnl|my_center|LOCUS_02520 276408 275251 gene locus_tag LOCUS_02530 276408 275251 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_02530 276869 276405 gene locus_tag LOCUS_02540 276869 276405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 277669 276887 gene locus_tag LOCUS_02550 gene sdhB 277669 276887 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V5 protein_id gnl|my_center|LOCUS_02550 277849 278481 gene locus_tag LOCUS_02560 277849 278481 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921310.1 protein_id gnl|my_center|LOCUS_02560 281351 278577 gene locus_tag LOCUS_02570 gene rne 281351 278577 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4J9 protein_id gnl|my_center|LOCUS_02570 281911 282810 gene locus_tag LOCUS_02580 281911 282810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 282920 285445 gene locus_tag LOCUS_02590 282920 285445 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 protein_id gnl|my_center|LOCUS_02590 285559 286686 gene locus_tag LOCUS_02600 gene prfB 285559 286686 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLD6 protein_id gnl|my_center|LOCUS_02600 286683 287435 gene locus_tag LOCUS_02610 286683 287435 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087755.1 protein_id gnl|my_center|LOCUS_02610 287461 288867 gene locus_tag LOCUS_02620 287461 288867 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_02620 289358 288897 gene locus_tag LOCUS_02630 289358 288897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 290823 289474 gene locus_tag LOCUS_02640 290823 289474 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9V9 protein_id gnl|my_center|LOCUS_02640 291896 290913 gene locus_tag LOCUS_02650 291896 290913 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_02650 292062 292544 gene locus_tag LOCUS_02660 292062 292544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 293783 292587 gene locus_tag LOCUS_02670 293783 292587 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918779.1 protein_id gnl|my_center|LOCUS_02670 294085 294459 gene locus_tag LOCUS_02680 gene nuoA 294085 294459 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT8 protein_id gnl|my_center|LOCUS_02680 294450 295001 gene locus_tag LOCUS_02690 gene nuoB1 294450 295001 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3G0 protein_id gnl|my_center|LOCUS_02690 294998 295189 gene locus_tag LOCUS_02700 294998 295189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 295186 295947 gene locus_tag LOCUS_02710 295186 295947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 295944 297158 gene locus_tag LOCUS_02720 gene nuoD1 295944 297158 CDS product NADH-quinone oxidoreductase subunit D 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56907 protein_id gnl|my_center|LOCUS_02720 297155 297337 gene locus_tag LOCUS_02730 297155 297337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 297330 298001 gene locus_tag LOCUS_02740 297330 298001 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087680.1 protein_id gnl|my_center|LOCUS_02740 297998 298189 gene locus_tag LOCUS_02750 297998 298189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 298176 299483 gene locus_tag LOCUS_02760 298176 299483 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531094.1 protein_id gnl|my_center|LOCUS_02760 299483 299881 gene locus_tag LOCUS_02770 299483 299881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 299874 301895 gene locus_tag LOCUS_02780 299874 301895 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU34 protein_id gnl|my_center|LOCUS_02780 301892 302956 gene locus_tag LOCUS_02790 gene nuoH1 301892 302956 CDS product NADH-quinone oxidoreductase subunit H 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QP5 protein_id gnl|my_center|LOCUS_02790 302953 303438 gene locus_tag LOCUS_02800 gene nuoI 302953 303438 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU32 protein_id gnl|my_center|LOCUS_02800 303454 304071 gene locus_tag LOCUS_02810 gene nuoJ 303454 304071 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707629.1 protein_id gnl|my_center|LOCUS_02810 304068 304373 gene locus_tag LOCUS_02820 gene nuoK1 304068 304373 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QP2 protein_id gnl|my_center|LOCUS_02820 304382 306376 gene locus_tag LOCUS_02830 304382 306376 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531100.1 protein_id gnl|my_center|LOCUS_02830 306376 307953 gene locus_tag LOCUS_02840 306376 307953 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_02840 307953 309416 gene locus_tag LOCUS_02850 gene nuoN 307953 309416 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU27 protein_id gnl|my_center|LOCUS_02850 309419 310132 gene locus_tag LOCUS_02860 309419 310132 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_02860 310147 310929 gene locus_tag LOCUS_02870 gene coaX 310147 310929 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9A7 protein_id gnl|my_center|LOCUS_02870 310926 312572 gene locus_tag LOCUS_02880 310926 312572 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_02880 312578 312880 gene locus_tag LOCUS_02890 312578 312880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 315569 312903 gene locus_tag LOCUS_02900 315569 312903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 315643 315945 gene locus_tag LOCUS_02910 315643 315945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 316032 317249 gene locus_tag LOCUS_02920 316032 317249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 317273 318238 gene locus_tag LOCUS_02930 317273 318238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 318240 319607 gene locus_tag LOCUS_02940 318240 319607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 319807 319604 gene locus_tag LOCUS_02950 319807 319604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 321118 319832 gene locus_tag LOCUS_02960 321118 319832 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8L5 protein_id gnl|my_center|LOCUS_02960 322570 321146 gene locus_tag LOCUS_02970 gene gltX2 322570 321146 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 protein_id gnl|my_center|LOCUS_02970 322692 324794 gene locus_tag LOCUS_02980 322692 324794 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087598.1 protein_id gnl|my_center|LOCUS_02980 325541 324840 gene locus_tag LOCUS_02990 gene lexA 325541 324840 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9K1 protein_id gnl|my_center|LOCUS_02990 326864 325665 gene locus_tag LOCUS_03000 gene moeA 326864 325665 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_03000 327334 326861 gene locus_tag LOCUS_03010 gene moaC 327334 326861 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWX1 protein_id gnl|my_center|LOCUS_03010 328119 327331 gene locus_tag LOCUS_03020 gene trpC 328119 327331 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT48 protein_id gnl|my_center|LOCUS_03020 329108 328116 gene locus_tag LOCUS_03030 gene trpD 329108 328116 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A728 protein_id gnl|my_center|LOCUS_03030 329689 329105 gene locus_tag LOCUS_03040 329689 329105 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_03040 330495 329686 gene locus_tag LOCUS_03050 330495 329686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532085.1 protein_id gnl|my_center|LOCUS_03050 332060 330510 gene locus_tag LOCUS_03060 332060 330510 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_03060 333988 332057 gene locus_tag LOCUS_03070 333988 332057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389643.1 protein_id gnl|my_center|LOCUS_03070 334245 335003 gene locus_tag LOCUS_03080 gene tpiA 334245 335003 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KU3 protein_id gnl|my_center|LOCUS_03080 335140 335535 gene locus_tag LOCUS_03090 335140 335535 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531735.1 protein_id gnl|my_center|LOCUS_03090 335658 337289 gene locus_tag LOCUS_03100 gene pyrG 335658 337289 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8E2 protein_id gnl|my_center|LOCUS_03100 338097 337612 gene locus_tag LOCUS_03110 338097 337612 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635612.1 protein_id gnl|my_center|LOCUS_03110 338276 338539 gene locus_tag LOCUS_03120 gene grxC 338276 338539 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970079.1 protein_id gnl|my_center|LOCUS_03120 338546 339373 gene locus_tag LOCUS_03130 338546 339373 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529450.1 protein_id gnl|my_center|LOCUS_03130 339370 339879 gene locus_tag LOCUS_03140 339370 339879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083044.1 protein_id gnl|my_center|LOCUS_03140 339918 339994 gene locus_tag LOCUS_t00030 339918 339994 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 340066 340674 gene locus_tag LOCUS_03150 gene folE 340066 340674 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2W9H7 protein_id gnl|my_center|LOCUS_03150 341223 340744 gene locus_tag LOCUS_03160 341223 340744 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_03160 341416 341886 gene locus_tag LOCUS_03170 341416 341886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 342090 344432 gene locus_tag LOCUS_03180 342090 344432 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 protein_id gnl|my_center|LOCUS_03180 344429 344872 gene locus_tag LOCUS_03190 344429 344872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 344869 345870 gene locus_tag LOCUS_03200 344869 345870 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_03200 345874 346602 gene locus_tag LOCUS_03210 345874 346602 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_03210 346595 349603 gene locus_tag LOCUS_03220 346595 349603 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_03220 349600 353091 gene locus_tag LOCUS_03230 349600 353091 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_03230 353161 353481 gene locus_tag LOCUS_03240 353161 353481 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2L8 protein_id gnl|my_center|LOCUS_03240 354290 353478 gene locus_tag LOCUS_03250 354290 353478 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314084.1 protein_id gnl|my_center|LOCUS_03250 355516 354290 gene locus_tag LOCUS_03260 gene argJ 355516 354290 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE6 protein_id gnl|my_center|LOCUS_03260 355567 355887 gene locus_tag LOCUS_03270 355567 355887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 356001 358742 gene locus_tag LOCUS_03280 gene secA 356001 358742 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAK0 protein_id gnl|my_center|LOCUS_03280 358886 359155 gene locus_tag LOCUS_03290 358886 359155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 359217 359291 gene locus_tag LOCUS_t00040 359217 359291 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 360039 359356 gene locus_tag LOCUS_03300 gene nadK 360039 359356 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7K4 protein_id gnl|my_center|LOCUS_03300 359977 360270 gene locus_tag LOCUS_03310 359977 360270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 360311 361645 gene locus_tag LOCUS_03320 360311 361645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 365127 361642 gene locus_tag LOCUS_03330 gene mfd 365127 361642 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9F5 protein_id gnl|my_center|LOCUS_03330 365454 365185 gene locus_tag LOCUS_03340 365454 365185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 365900 365493 gene locus_tag LOCUS_03350 gene atsE 365900 365493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974418.1 protein_id gnl|my_center|LOCUS_03350 366001 368058 gene locus_tag LOCUS_03360 366001 368058 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_03360 368180 368104 gene locus_tag LOCUS_t00050 368180 368104 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 368283 369239 gene locus_tag LOCUS_03370 gene thyA 368283 369239 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W9 protein_id gnl|my_center|LOCUS_03370 369717 369247 gene locus_tag LOCUS_03380 369717 369247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 369922 369998 gene locus_tag LOCUS_t00060 369922 369998 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 370282 370070 gene locus_tag LOCUS_03390 370282 370070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 370869 370282 gene locus_tag LOCUS_03400 370869 370282 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG0 protein_id gnl|my_center|LOCUS_03400 371473 371126 gene locus_tag LOCUS_03410 371473 371126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 371711 371511 gene locus_tag LOCUS_03420 371711 371511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 371945 373945 gene locus_tag LOCUS_03430 gene tklB 371945 373945 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX58 protein_id gnl|my_center|LOCUS_03430 373961 374968 gene locus_tag LOCUS_03440 373961 374968 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921081.1 protein_id gnl|my_center|LOCUS_03440 374970 375428 gene locus_tag LOCUS_03450 374970 375428 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_03450 375425 376624 gene locus_tag LOCUS_03460 gene pgk 375425 376624 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCV3 protein_id gnl|my_center|LOCUS_03460 376638 377063 gene locus_tag LOCUS_03470 376638 377063 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_03470 377151 378038 gene locus_tag LOCUS_03480 377151 378038 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_03480 378054 378677 gene locus_tag LOCUS_03490 gene thiE 378054 378677 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 protein_id gnl|my_center|LOCUS_03490 378788 379351 gene locus_tag LOCUS_03500 gene efp 378788 379351 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_03500 379355 379765 gene locus_tag LOCUS_03510 379355 379765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 379835 380659 gene locus_tag LOCUS_03520 379835 380659 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_03520 380700 380784 gene locus_tag LOCUS_t00070 380700 380784 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 380893 382698 gene locus_tag LOCUS_03530 380893 382698 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_03530 383276 382734 gene locus_tag LOCUS_03540 383276 382734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 383461 383769 gene locus_tag LOCUS_03550 383461 383769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 383928 385316 gene locus_tag LOCUS_03560 383928 385316 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_03560 385313 387433 gene locus_tag LOCUS_03570 385313 387433 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_03570 387433 388830 gene locus_tag LOCUS_03580 387433 388830 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_03580 388862 390649 gene locus_tag LOCUS_03590 388862 390649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 390862 391842 gene locus_tag LOCUS_03600 390862 391842 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228161.1 protein_id gnl|my_center|LOCUS_03600 392898 391834 gene locus_tag LOCUS_03610 392898 391834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887933.1 protein_id gnl|my_center|LOCUS_03610 393786 392914 gene locus_tag LOCUS_03620 gene panB 393786 392914 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEL6 protein_id gnl|my_center|LOCUS_03620 393882 395321 gene locus_tag LOCUS_03630 393882 395321 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_03630 395453 396175 gene locus_tag LOCUS_03640 395453 396175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 396108 397670 gene locus_tag LOCUS_03650 396108 397670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970471.1 protein_id gnl|my_center|LOCUS_03650 397722 398204 gene locus_tag LOCUS_03660 397722 398204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 398288 401731 gene locus_tag LOCUS_03670 gene dnaE2 398288 401731 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3J3 protein_id gnl|my_center|LOCUS_03670 401834 402235 gene locus_tag LOCUS_03680 401834 402235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 403156 402239 gene locus_tag LOCUS_03690 403156 402239 CDS product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089797.1 protein_id gnl|my_center|LOCUS_03690 403932 403243 gene locus_tag LOCUS_03700 gene phoB 403932 403243 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_03700 404690 404010 gene locus_tag LOCUS_03710 404690 404010 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT9 protein_id gnl|my_center|LOCUS_03710 405541 404690 gene locus_tag LOCUS_03720 gene pstB 405541 404690 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAT6 protein_id gnl|my_center|LOCUS_03720 406785 405535 gene locus_tag LOCUS_03730 406785 405535 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_03730 408163 406778 gene locus_tag LOCUS_03740 408163 406778 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_03740 409244 408195 gene locus_tag LOCUS_03750 409244 408195 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_03750 410524 409331 gene locus_tag LOCUS_03760 410524 409331 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391290.1 protein_id gnl|my_center|LOCUS_03760 411420 410602 gene locus_tag LOCUS_03770 411420 410602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 412457 411417 gene locus_tag LOCUS_03780 412457 411417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 412554 413996 gene locus_tag LOCUS_03790 412554 413996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 414012 415268 gene locus_tag LOCUS_03800 414012 415268 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896890.1 protein_id gnl|my_center|LOCUS_03800 415381 415307 gene locus_tag LOCUS_t00080 415381 415307 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 417272 415452 gene locus_tag LOCUS_03810 417272 415452 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_03810 417346 417819 gene locus_tag LOCUS_03820 417346 417819 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821327.1 protein_id gnl|my_center|LOCUS_03820 417935 418735 gene locus_tag LOCUS_03830 417935 418735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 418732 419292 gene locus_tag LOCUS_03840 418732 419292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 421032 419347 gene locus_tag LOCUS_03850 gene leuA 421032 419347 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUD3 protein_id gnl|my_center|LOCUS_03850 421969 421295 gene locus_tag LOCUS_03860 421969 421295 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038690.1 protein_id gnl|my_center|LOCUS_03860 423056 422037 gene locus_tag LOCUS_03870 gene ilvC 423056 422037 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXW2 protein_id gnl|my_center|LOCUS_03870 423695 423180 gene locus_tag LOCUS_03880 gene ilvH 423695 423180 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_03880 425451 423709 gene locus_tag LOCUS_03890 425451 423709 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA17 protein_id gnl|my_center|LOCUS_03890 426590 425613 gene locus_tag LOCUS_03900 gene miaA 426590 425613 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NR2 protein_id gnl|my_center|LOCUS_03900 426583 427455 gene locus_tag LOCUS_03910 gene serB 426583 427455 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089245.1 protein_id gnl|my_center|LOCUS_03910 427776 428426 gene locus_tag LOCUS_03920 427776 428426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 428683 429171 gene locus_tag LOCUS_03930 428683 429171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 429222 429836 gene locus_tag LOCUS_03940 429222 429836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113479.1 protein_id gnl|my_center|LOCUS_03940 429859 430875 gene locus_tag LOCUS_03950 429859 430875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 431017 431724 gene locus_tag LOCUS_03960 431017 431724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113481.1 protein_id gnl|my_center|LOCUS_03960 431736 432644 gene locus_tag LOCUS_03970 431736 432644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 432665 433270 gene locus_tag LOCUS_03980 432665 433270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 433372 434625 gene locus_tag LOCUS_03990 433372 434625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088309.1 protein_id gnl|my_center|LOCUS_03990 436913 434688 gene locus_tag LOCUS_04000 gene purL 436913 434688 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI3 protein_id gnl|my_center|LOCUS_04000 436978 437229 gene locus_tag LOCUS_04010 gene xseB 436978 437229 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHG6 protein_id gnl|my_center|LOCUS_04010 437232 438140 gene locus_tag LOCUS_04020 437232 438140 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 protein_id gnl|my_center|LOCUS_04020 438140 438652 gene locus_tag LOCUS_04030 gene coaD 438140 438652 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J263 protein_id gnl|my_center|LOCUS_04030 438753 439439 gene locus_tag LOCUS_04040 438753 439439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 439456 440490 gene locus_tag LOCUS_04050 gene queA 439456 440490 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB05 protein_id gnl|my_center|LOCUS_04050 440554 441492 gene locus_tag LOCUS_04060 gene yadG 440554 441492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038743.1 protein_id gnl|my_center|LOCUS_04060 441492 442265 gene locus_tag LOCUS_04070 441492 442265 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGP9 protein_id gnl|my_center|LOCUS_04070 442284 443405 gene locus_tag LOCUS_04080 gene tgt 442284 443405 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2H4 protein_id gnl|my_center|LOCUS_04080 444435 443431 gene locus_tag LOCUS_04090 444435 443431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403214.1 protein_id gnl|my_center|LOCUS_04090 445171 444557 gene locus_tag LOCUS_04100 gene rpsD 445171 444557 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PG9 protein_id gnl|my_center|LOCUS_04100 446059 445325 gene locus_tag LOCUS_04110 gene rrm2 446059 445325 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Y8 protein_id gnl|my_center|LOCUS_04110 446516 446052 gene locus_tag LOCUS_04120 gene nrdR 446516 446052 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB9 protein_id gnl|my_center|LOCUS_04120 447851 446541 gene locus_tag LOCUS_04130 gene glyA1 447851 446541 CDS product serine hydroxymethyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG75 protein_id gnl|my_center|LOCUS_04130 448299 447856 gene locus_tag LOCUS_04140 448299 447856 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 protein_id gnl|my_center|LOCUS_04140 450461 448458 gene locus_tag LOCUS_04150 gene rpoD 450461 448458 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59753 protein_id gnl|my_center|LOCUS_04150 452379 450436 gene locus_tag LOCUS_04160 452379 450436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 452843 452391 gene locus_tag LOCUS_04170 452843 452391 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_04170 453020 454201 gene locus_tag LOCUS_04180 gene carA 453020 454201 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB3 protein_id gnl|my_center|LOCUS_04180 455049 454711 gene locus_tag LOCUS_04190 455049 454711 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035690.1 protein_id gnl|my_center|LOCUS_04190 455111 458461 gene locus_tag LOCUS_04200 455111 458461 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB2 protein_id gnl|my_center|LOCUS_04200 458630 459097 gene locus_tag LOCUS_04210 gene greA 458630 459097 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H1V7 protein_id gnl|my_center|LOCUS_04210 459400 459173 gene locus_tag LOCUS_04220 459400 459173 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313175.1 protein_id gnl|my_center|LOCUS_04220 459963 459439 gene locus_tag LOCUS_04230 459963 459439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 460343 459963 gene locus_tag LOCUS_04240 460343 459963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 460722 460309 gene locus_tag LOCUS_04250 460722 460309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 461294 460755 gene locus_tag LOCUS_04260 461294 460755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 461465 462751 gene locus_tag LOCUS_04270 gene eno 461465 462751 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAG3 protein_id gnl|my_center|LOCUS_04270 463197 462778 gene locus_tag LOCUS_04280 gene ribH2 463197 462778 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I8 protein_id gnl|my_center|LOCUS_04280 464540 463278 gene locus_tag LOCUS_04290 gene ribBA 464540 463278 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZU9 protein_id gnl|my_center|LOCUS_04290 464752 464525 gene locus_tag LOCUS_04300 464752 464525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 464669 465166 gene locus_tag LOCUS_04310 464669 465166 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888077.1 protein_id gnl|my_center|LOCUS_04310 465342 465193 gene locus_tag LOCUS_04320 465342 465193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 465652 465485 gene locus_tag LOCUS_04330 465652 465485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 466685 465768 gene locus_tag LOCUS_04340 466685 465768 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266814.1 protein_id gnl|my_center|LOCUS_04340 466805 467653 gene locus_tag LOCUS_04350 466805 467653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 468001 467750 gene locus_tag LOCUS_04360 468001 467750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 470101 468311 gene locus_tag LOCUS_04370 gene deaD 470101 468311 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088310.1 protein_id gnl|my_center|LOCUS_04370 471330 470152 gene locus_tag LOCUS_04380 471330 470152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 protein_id gnl|my_center|LOCUS_04380 471528 471346 gene locus_tag LOCUS_04390 471528 471346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 471724 471649 gene locus_tag LOCUS_t00090 471724 471649 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 472960 471845 gene locus_tag LOCUS_04400 gene rodA 472960 471845 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_04400 475101 472957 gene locus_tag LOCUS_04410 gene pbpA 475101 472957 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337401.1 protein_id gnl|my_center|LOCUS_04410 475658 475101 gene locus_tag LOCUS_04420 475658 475101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 476605 475658 gene locus_tag LOCUS_04430 gene mreC 476605 475658 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFA8 protein_id gnl|my_center|LOCUS_04430 477710 476664 gene locus_tag LOCUS_04440 477710 476664 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388229.1 protein_id gnl|my_center|LOCUS_04440 477813 479744 gene locus_tag LOCUS_04450 gene mutL 477813 479744 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H173 protein_id gnl|my_center|LOCUS_04450 480541 479741 gene locus_tag LOCUS_04460 480541 479741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 481408 480602 gene locus_tag LOCUS_04470 481408 480602 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 protein_id gnl|my_center|LOCUS_04470 481907 481425 gene locus_tag LOCUS_04480 481907 481425 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902978.1 protein_id gnl|my_center|LOCUS_04480 483004 481928 gene locus_tag LOCUS_04490 483004 481928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 484701 483601 gene locus_tag LOCUS_04500 gene ychF 484701 483601 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DK0 protein_id gnl|my_center|LOCUS_04500 485420 484776 gene locus_tag LOCUS_04510 gene pth 485420 484776 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN0 protein_id gnl|my_center|LOCUS_04510 486113 485442 gene locus_tag LOCUS_04520 gene rplY 486113 485442 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI50 protein_id gnl|my_center|LOCUS_04520 487152 486244 gene locus_tag LOCUS_04530 487152 486244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 488093 487152 gene locus_tag LOCUS_04540 488093 487152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_04540 488200 489099 gene locus_tag LOCUS_04550 gene glyQ 488200 489099 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 protein_id gnl|my_center|LOCUS_04550 489096 491393 gene locus_tag LOCUS_04560 gene glyS 489096 491393 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ43 protein_id gnl|my_center|LOCUS_04560 491478 494144 gene locus_tag LOCUS_04570 491478 494144 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919346.1 protein_id gnl|my_center|LOCUS_04570 495065 494160 gene locus_tag LOCUS_04580 495065 494160 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066732.1 protein_id gnl|my_center|LOCUS_04580 495407 495805 gene locus_tag LOCUS_04590 495407 495805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 496205 496579 gene locus_tag LOCUS_04600 gene hisI 496205 496579 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEK7 protein_id gnl|my_center|LOCUS_04600 496668 498470 gene locus_tag LOCUS_04610 496668 498470 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968641.1 protein_id gnl|my_center|LOCUS_04610 498490 498732 gene locus_tag LOCUS_04620 498490 498732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 499658 498741 gene locus_tag LOCUS_04630 gene cysK 499658 498741 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5G2 protein_id gnl|my_center|LOCUS_04630 500839 499655 gene locus_tag LOCUS_04640 500839 499655 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265542.1 protein_id gnl|my_center|LOCUS_04640 501344 501009 gene locus_tag LOCUS_04650 501344 501009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 502684 501452 gene locus_tag LOCUS_04660 gene tyrS 502684 501452 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR3 protein_id gnl|my_center|LOCUS_04660 502733 503269 gene locus_tag LOCUS_04670 502733 503269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 503266 504468 gene locus_tag LOCUS_04680 503266 504468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_04680 505115 504465 gene locus_tag LOCUS_04690 505115 504465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 506293 505112 gene locus_tag LOCUS_04700 506293 505112 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_04700 506524 506297 gene locus_tag LOCUS_04710 506524 506297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 507369 506521 gene locus_tag LOCUS_04720 507369 506521 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_04720 507487 508227 gene locus_tag LOCUS_04730 507487 508227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 508266 508514 gene locus_tag LOCUS_04740 508266 508514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 508839 508495 gene locus_tag LOCUS_04750 508839 508495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 508924 510165 gene locus_tag LOCUS_04760 508924 510165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 512202 510196 gene locus_tag LOCUS_04770 gene parE 512202 510196 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQT8 protein_id gnl|my_center|LOCUS_04770 513415 512270 gene locus_tag LOCUS_04780 513415 512270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 513418 514284 gene locus_tag LOCUS_04790 gene rsmI 513418 514284 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFQ0 protein_id gnl|my_center|LOCUS_04790 514281 514637 gene locus_tag LOCUS_04800 514281 514637 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WK9 protein_id gnl|my_center|LOCUS_04800 514654 515604 gene locus_tag LOCUS_04810 gene gshB 514654 515604 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WL0 protein_id gnl|my_center|LOCUS_04810 516508 515612 gene locus_tag LOCUS_04820 gene xerC 516508 515612 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E8 protein_id gnl|my_center|LOCUS_04820 517656 516505 gene locus_tag LOCUS_04830 517656 516505 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706596.1 protein_id gnl|my_center|LOCUS_04830 518307 517666 gene locus_tag LOCUS_04840 518307 517666 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_04840 519017 518304 gene locus_tag LOCUS_04850 gene rph 519017 518304 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW5 protein_id gnl|my_center|LOCUS_04850 519086 520147 gene locus_tag LOCUS_04860 gene hrcA 519086 520147 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP3 protein_id gnl|my_center|LOCUS_04860 520162 520740 gene locus_tag LOCUS_04870 gene grpE 520162 520740 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SK0 protein_id gnl|my_center|LOCUS_04870 521188 520685 gene locus_tag LOCUS_04880 521188 520685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 521672 521223 gene locus_tag LOCUS_04890 521672 521223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 522208 521729 gene locus_tag LOCUS_04900 522208 521729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 522387 524312 gene locus_tag LOCUS_04910 gene dnaK 522387 524312 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TER2 protein_id gnl|my_center|LOCUS_04910 524393 525532 gene locus_tag LOCUS_04920 gene dnaJ 524393 525532 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50018 protein_id gnl|my_center|LOCUS_04920 527872 525548 gene locus_tag LOCUS_04930 527872 525548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 527980 529347 gene locus_tag LOCUS_04940 gene radA 527980 529347 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJI4 protein_id gnl|my_center|LOCUS_04940 529359 529892 gene locus_tag LOCUS_04950 529359 529892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 529894 530313 gene locus_tag LOCUS_04960 529894 530313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 530365 531972 gene locus_tag LOCUS_04970 530365 531972 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064062.1 protein_id gnl|my_center|LOCUS_04970 531962 533017 gene locus_tag LOCUS_04980 gene alr 531962 533017 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3L4 protein_id gnl|my_center|LOCUS_04980 533099 533653 gene locus_tag LOCUS_04990 533099 533653 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709752.1 protein_id gnl|my_center|LOCUS_04990 533787 535331 gene locus_tag LOCUS_05000 gene proS 533787 535331 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ7 protein_id gnl|my_center|LOCUS_05000 535333 537609 gene locus_tag LOCUS_05010 gene rnr 535333 537609 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QM0 protein_id gnl|my_center|LOCUS_05010 538058 537606 gene locus_tag LOCUS_05020 538058 537606 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706625.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence02 1452 1527 gene locus_tag LOCUS_t00100 1452 1527 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2606 1575 gene locus_tag LOCUS_05030 2606 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 3223 2681 gene locus_tag LOCUS_05040 3223 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532774.1 protein_id gnl|my_center|LOCUS_05040 4546 3257 gene locus_tag LOCUS_05050 gene purA 4546 3257 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9F8 protein_id gnl|my_center|LOCUS_05050 4680 5648 gene locus_tag LOCUS_05060 4680 5648 CDS product UPF0176 protein R02887 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LX6 protein_id gnl|my_center|LOCUS_05060 5641 6258 gene locus_tag LOCUS_05070 5641 6258 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_05070 7367 6255 gene locus_tag LOCUS_05080 gene hisZ 7367 6255 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD9 protein_id gnl|my_center|LOCUS_05080 8979 7396 gene locus_tag LOCUS_05090 gene serA 8979 7396 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 protein_id gnl|my_center|LOCUS_05090 10266 9106 gene locus_tag LOCUS_05100 gene serC 10266 9106 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090137.1 protein_id gnl|my_center|LOCUS_05100 10739 10416 gene locus_tag LOCUS_05110 10739 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 11323 10736 gene locus_tag LOCUS_05120 11323 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 11504 12166 gene locus_tag LOCUS_05130 11504 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 12952 12182 gene locus_tag LOCUS_05140 12952 12182 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531816.1 protein_id gnl|my_center|LOCUS_05140 13812 12997 gene locus_tag LOCUS_05150 13812 12997 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976011.1 protein_id gnl|my_center|LOCUS_05150 14777 13833 gene locus_tag LOCUS_05160 14777 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531818.1 protein_id gnl|my_center|LOCUS_05160 16251 14791 gene locus_tag LOCUS_05170 16251 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384497.1 protein_id gnl|my_center|LOCUS_05170 17097 16306 gene locus_tag LOCUS_05180 17097 16306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 17829 17278 gene locus_tag LOCUS_05190 17829 17278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 17980 20166 gene locus_tag LOCUS_05200 17980 20166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05200 20166 20702 gene locus_tag LOCUS_05210 20166 20702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 22614 20620 gene locus_tag LOCUS_05220 22614 20620 CDS product thio:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918106.1 protein_id gnl|my_center|LOCUS_05220 22770 23987 gene locus_tag LOCUS_05230 22770 23987 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336782.1 protein_id gnl|my_center|LOCUS_05230 25000 24026 gene locus_tag LOCUS_05240 25000 24026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 25729 25034 gene locus_tag LOCUS_05250 25729 25034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 26616 25726 gene locus_tag LOCUS_05260 gene hemC 26616 25726 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J029 protein_id gnl|my_center|LOCUS_05260 26714 27760 gene locus_tag LOCUS_05270 gene tsaD 26714 27760 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJV5 protein_id gnl|my_center|LOCUS_05270 27764 28765 gene locus_tag LOCUS_05280 gene gpsA 27764 28765 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4E8 protein_id gnl|my_center|LOCUS_05280 28762 30276 gene locus_tag LOCUS_05290 28762 30276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 30413 32077 gene locus_tag LOCUS_05300 30413 32077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638263.2 protein_id gnl|my_center|LOCUS_05300 32171 32914 gene locus_tag LOCUS_05310 32171 32914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 33053 33691 gene locus_tag LOCUS_05320 33053 33691 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529735.1 protein_id gnl|my_center|LOCUS_05320 34182 34042 gene locus_tag LOCUS_05330 34182 34042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05330 34667 34203 gene locus_tag LOCUS_05340 34667 34203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 35186 37672 gene locus_tag LOCUS_05350 35186 37672 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460890.1 protein_id gnl|my_center|LOCUS_05350 38527 37697 gene locus_tag LOCUS_05360 38527 37697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 40040 38640 gene locus_tag LOCUS_05370 40040 38640 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707979.1 protein_id gnl|my_center|LOCUS_05370 40238 41833 gene locus_tag LOCUS_05380 40238 41833 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707978.1 protein_id gnl|my_center|LOCUS_05380 41895 42047 gene locus_tag LOCUS_05390 41895 42047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 42746 42495 gene locus_tag LOCUS_05400 42746 42495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 43231 43016 gene locus_tag LOCUS_05410 43231 43016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 43517 43305 gene locus_tag LOCUS_05420 gene cspA 43517 43305 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383667.1 protein_id gnl|my_center|LOCUS_05420 44447 43785 gene locus_tag LOCUS_05430 44447 43785 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918096.1 protein_id gnl|my_center|LOCUS_05430 45151 44444 gene locus_tag LOCUS_05440 45151 44444 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 protein_id gnl|my_center|LOCUS_05440 45511 46107 gene locus_tag LOCUS_05450 45511 46107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 47597 46131 gene locus_tag LOCUS_05460 47597 46131 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887698.1 protein_id gnl|my_center|LOCUS_05460 48696 47602 gene locus_tag LOCUS_05470 48696 47602 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887493.1 protein_id gnl|my_center|LOCUS_05470 49854 48697 gene locus_tag LOCUS_05480 49854 48697 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887494.1 protein_id gnl|my_center|LOCUS_05480 51587 49851 gene locus_tag LOCUS_05490 51587 49851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887495.1 protein_id gnl|my_center|LOCUS_05490 52594 51596 gene locus_tag LOCUS_05500 gene ybhG 52594 51596 CDS product UPF0194 membrane protein YbhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z879 protein_id gnl|my_center|LOCUS_05500 53214 52591 gene locus_tag LOCUS_05510 53214 52591 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975724.1 protein_id gnl|my_center|LOCUS_05510 53417 53926 gene locus_tag LOCUS_05520 gene msrA1 53417 53926 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W179 protein_id gnl|my_center|LOCUS_05520 54000 55178 gene locus_tag LOCUS_05530 54000 55178 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_05530 55245 56813 gene locus_tag LOCUS_05540 55245 56813 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729521.1 protein_id gnl|my_center|LOCUS_05540 58388 56784 gene locus_tag LOCUS_05550 58388 56784 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730667.1 protein_id gnl|my_center|LOCUS_05550 59370 58420 gene locus_tag LOCUS_05560 59370 58420 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225962.1 protein_id gnl|my_center|LOCUS_05560 59810 59367 gene locus_tag LOCUS_05570 59810 59367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 60810 59797 gene locus_tag LOCUS_05580 60810 59797 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_05580 61574 60807 gene locus_tag LOCUS_05590 61574 60807 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897035.1 protein_id gnl|my_center|LOCUS_05590 62427 61582 gene locus_tag LOCUS_05600 62427 61582 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807577.1 protein_id gnl|my_center|LOCUS_05600 62704 64323 gene locus_tag LOCUS_05610 62704 64323 CDS product steroid monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728756.1 protein_id gnl|my_center|LOCUS_05610 65243 64347 gene locus_tag LOCUS_05620 65243 64347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 65390 67558 gene locus_tag LOCUS_05630 65390 67558 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265515.1 protein_id gnl|my_center|LOCUS_05630 67651 67578 gene locus_tag LOCUS_t00110 67651 67578 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 68548 67730 gene locus_tag LOCUS_05640 gene citE 68548 67730 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083330.1 protein_id gnl|my_center|LOCUS_05640 68933 70531 gene locus_tag LOCUS_05650 68933 70531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 71602 70604 gene locus_tag LOCUS_05660 71602 70604 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057042.1 protein_id gnl|my_center|LOCUS_05660 72883 71630 gene locus_tag LOCUS_05670 gene bioA 72883 71630 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709025.1 protein_id gnl|my_center|LOCUS_05670 73500 72880 gene locus_tag LOCUS_05680 gene bioD 73500 72880 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8T9 protein_id gnl|my_center|LOCUS_05680 74636 73497 gene locus_tag LOCUS_05690 gene bioF 74636 73497 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709027.1 protein_id gnl|my_center|LOCUS_05690 74825 75610 gene locus_tag LOCUS_05700 gene purC 74825 75610 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD65 protein_id gnl|my_center|LOCUS_05700 75675 78569 gene locus_tag LOCUS_05710 75675 78569 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_05710 78701 78955 gene locus_tag LOCUS_05720 gene purS 78701 78955 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K3 protein_id gnl|my_center|LOCUS_05720 78952 79632 gene locus_tag LOCUS_05730 gene purQ 78952 79632 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFC6 protein_id gnl|my_center|LOCUS_05730 82012 79640 gene locus_tag LOCUS_05740 82012 79640 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265609.1 protein_id gnl|my_center|LOCUS_05740 83950 82127 gene locus_tag LOCUS_05750 gene glmS 83950 82127 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59362 protein_id gnl|my_center|LOCUS_05750 85403 84048 gene locus_tag LOCUS_05760 gene glmU 85403 84048 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 protein_id gnl|my_center|LOCUS_05760 85463 86143 gene locus_tag LOCUS_05770 85463 86143 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708236.1 protein_id gnl|my_center|LOCUS_05770 87629 86235 gene locus_tag LOCUS_05780 87629 86235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918795.1 protein_id gnl|my_center|LOCUS_05780 88177 87821 gene locus_tag LOCUS_05790 88177 87821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721547.1 protein_id gnl|my_center|LOCUS_05790 88902 88177 gene locus_tag LOCUS_05800 gene cysE 88902 88177 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_05800 89559 88933 gene locus_tag LOCUS_05810 89559 88933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974992.1 protein_id gnl|my_center|LOCUS_05810 90778 89564 gene locus_tag LOCUS_05820 90778 89564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 90986 92098 gene locus_tag LOCUS_05830 gene purM 90986 92098 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKG8 protein_id gnl|my_center|LOCUS_05830 92088 92696 gene locus_tag LOCUS_05840 gene purN 92088 92696 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7M0 protein_id gnl|my_center|LOCUS_05840 93452 92715 gene locus_tag LOCUS_05850 93452 92715 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084036.1 protein_id gnl|my_center|LOCUS_05850 93836 93588 gene locus_tag LOCUS_05860 93836 93588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 94401 93979 gene locus_tag LOCUS_05870 gene ndk 94401 93979 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKJ9 protein_id gnl|my_center|LOCUS_05870 94939 94502 gene locus_tag LOCUS_05880 94939 94502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 96542 95082 gene locus_tag LOCUS_05890 gene pepA 96542 95082 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MT4 protein_id gnl|my_center|LOCUS_05890 96673 98943 gene locus_tag LOCUS_05900 gene lptD 96673 98943 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA6 protein_id gnl|my_center|LOCUS_05900 99078 100451 gene locus_tag LOCUS_05910 99078 100451 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7N3 protein_id gnl|my_center|LOCUS_05910 100459 101499 gene locus_tag LOCUS_05920 gene pdxA 100459 101499 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKN3 protein_id gnl|my_center|LOCUS_05920 101496 102326 gene locus_tag LOCUS_05930 gene rsmA 101496 102326 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6X4 protein_id gnl|my_center|LOCUS_05930 104447 102336 gene locus_tag LOCUS_05940 gene glcB 104447 102336 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 protein_id gnl|my_center|LOCUS_05940 104748 105017 gene locus_tag LOCUS_05950 104748 105017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 105031 105738 gene locus_tag LOCUS_05960 105031 105738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 106653 106312 gene locus_tag LOCUS_05970 106653 106312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 107098 106661 gene locus_tag LOCUS_05980 gene mscL 107098 106661 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JH4 protein_id gnl|my_center|LOCUS_05980 107293 107895 gene locus_tag LOCUS_05990 107293 107895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402887.1 protein_id gnl|my_center|LOCUS_05990 107909 108682 gene locus_tag LOCUS_06000 107909 108682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 108687 109373 gene locus_tag LOCUS_06010 108687 109373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 109370 109933 gene locus_tag LOCUS_06020 109370 109933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 109930 110400 gene locus_tag LOCUS_06030 109930 110400 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_06030 110534 111760 gene locus_tag LOCUS_06040 gene metK2 110534 111760 CDS product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 protein_id gnl|my_center|LOCUS_06040 111800 113212 gene locus_tag LOCUS_06050 gene ahcY 111800 113212 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBF2 protein_id gnl|my_center|LOCUS_06050 113604 114719 gene locus_tag LOCUS_06060 gene gcvT 113604 114719 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4D6 protein_id gnl|my_center|LOCUS_06060 114731 115102 gene locus_tag LOCUS_06070 gene gcvH 114731 115102 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD42 protein_id gnl|my_center|LOCUS_06070 115065 116495 gene locus_tag LOCUS_06080 gene gcvPA 115065 116495 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4V4 protein_id gnl|my_center|LOCUS_06080 116492 118051 gene locus_tag LOCUS_06090 116492 118051 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPV2 protein_id gnl|my_center|LOCUS_06090 118073 119059 gene locus_tag LOCUS_06100 118073 119059 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706276.1 protein_id gnl|my_center|LOCUS_06100 119150 119347 gene locus_tag LOCUS_06110 119150 119347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 119865 119380 gene locus_tag LOCUS_06120 gene queF 119865 119380 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H0X4 protein_id gnl|my_center|LOCUS_06120 120420 120190 gene locus_tag LOCUS_06130 120420 120190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 120474 121271 gene locus_tag LOCUS_06140 120474 121271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 121314 122552 gene locus_tag LOCUS_06150 gene metC 121314 122552 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087217.1 protein_id gnl|my_center|LOCUS_06150 122549 123634 gene locus_tag LOCUS_06160 122549 123634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 123721 124503 gene locus_tag LOCUS_06170 123721 124503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 124500 124799 gene locus_tag LOCUS_06180 124500 124799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 124799 126433 gene locus_tag LOCUS_06190 gene cysI 124799 126433 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315345.1 protein_id gnl|my_center|LOCUS_06190 126426 126866 gene locus_tag LOCUS_06200 126426 126866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 126859 127704 gene locus_tag LOCUS_06210 126859 127704 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A973 protein_id gnl|my_center|LOCUS_06210 128151 127711 gene locus_tag LOCUS_06220 gene cheY 128151 127711 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007600538.1 protein_id gnl|my_center|LOCUS_06220 128606 128220 gene locus_tag LOCUS_06230 128606 128220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 129634 128723 gene locus_tag LOCUS_06240 129634 128723 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919048.1 protein_id gnl|my_center|LOCUS_06240 130764 129631 gene locus_tag LOCUS_06250 gene proB 130764 129631 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLY8 protein_id gnl|my_center|LOCUS_06250 131865 130807 gene locus_tag LOCUS_06260 gene obg 131865 130807 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X89 protein_id gnl|my_center|LOCUS_06260 132301 132226 gene locus_tag LOCUS_t00120 132301 132226 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 133211 132444 gene locus_tag LOCUS_06270 133211 132444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 134129 133383 gene locus_tag LOCUS_06280 134129 133383 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709723.1 protein_id gnl|my_center|LOCUS_06280 135129 134326 gene locus_tag LOCUS_06290 gene proC2 135129 134326 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFJ1 protein_id gnl|my_center|LOCUS_06290 135712 135203 gene locus_tag LOCUS_06300 135712 135203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_06300 137835 135892 gene locus_tag LOCUS_06310 137835 135892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 139601 137937 gene locus_tag LOCUS_06320 139601 137937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 141018 139735 gene locus_tag LOCUS_06330 gene ftsA 141018 139735 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF59 protein_id gnl|my_center|LOCUS_06330 141938 141018 gene locus_tag LOCUS_06340 141938 141018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 142915 141935 gene locus_tag LOCUS_06350 gene ddl 142915 141935 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L8 protein_id gnl|my_center|LOCUS_06350 143873 142929 gene locus_tag LOCUS_06360 gene murB 143873 142929 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU6 protein_id gnl|my_center|LOCUS_06360 145300 143870 gene locus_tag LOCUS_06370 gene murC 145300 143870 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU8 protein_id gnl|my_center|LOCUS_06370 146499 145297 gene locus_tag LOCUS_06380 gene murG 146499 145297 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU4 protein_id gnl|my_center|LOCUS_06380 147728 146496 gene locus_tag LOCUS_06390 gene ftsW 147728 146496 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708634.1 protein_id gnl|my_center|LOCUS_06390 149083 147725 gene locus_tag LOCUS_06400 gene murD 149083 147725 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A597 protein_id gnl|my_center|LOCUS_06400 150150 149080 gene locus_tag LOCUS_06410 gene mraY 150150 149080 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4M8 protein_id gnl|my_center|LOCUS_06410 151622 150150 gene locus_tag LOCUS_06420 gene murF 151622 150150 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9K8 protein_id gnl|my_center|LOCUS_06420 153113 151623 gene locus_tag LOCUS_06430 gene murE 153113 151623 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU2 protein_id gnl|my_center|LOCUS_06430 154834 153113 gene locus_tag LOCUS_06440 154834 153113 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_06440 155406 154831 gene locus_tag LOCUS_06450 155406 154831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 156380 155403 gene locus_tag LOCUS_06460 gene rsmH 156380 155403 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQJ6 protein_id gnl|my_center|LOCUS_06460 156883 156377 gene locus_tag LOCUS_06470 156883 156377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 157969 157223 gene locus_tag LOCUS_06480 157969 157223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 158417 158004 gene locus_tag LOCUS_06490 158417 158004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 159483 158449 gene locus_tag LOCUS_06500 gene cysK 159483 158449 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 protein_id gnl|my_center|LOCUS_06500 159894 159577 gene locus_tag LOCUS_06510 159894 159577 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887567.1 protein_id gnl|my_center|LOCUS_06510 159995 160612 gene locus_tag LOCUS_06520 159995 160612 CDS product DNA-3-methyladenine glycosylase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920062.1 protein_id gnl|my_center|LOCUS_06520 160642 161454 gene locus_tag LOCUS_06530 160642 161454 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920803.1 protein_id gnl|my_center|LOCUS_06530 161763 161476 gene locus_tag LOCUS_06540 161763 161476 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC0 protein_id gnl|my_center|LOCUS_06540 161841 162449 gene locus_tag LOCUS_06550 gene ccmA 161841 162449 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF0 protein_id gnl|my_center|LOCUS_06550 162446 163117 gene locus_tag LOCUS_06560 162446 163117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 163957 163133 gene locus_tag LOCUS_06570 gene map 163957 163133 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9X3 protein_id gnl|my_center|LOCUS_06570 164813 164010 gene locus_tag LOCUS_06580 164813 164010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036601.1 protein_id gnl|my_center|LOCUS_06580 164899 166296 gene locus_tag LOCUS_06590 164899 166296 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_06590 166434 166769 gene locus_tag LOCUS_06600 166434 166769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 166766 167695 gene locus_tag LOCUS_06610 gene argC 166766 167695 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H5 protein_id gnl|my_center|LOCUS_06610 167997 168335 gene locus_tag LOCUS_06620 gene glnB 167997 168335 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 protein_id gnl|my_center|LOCUS_06620 168410 169819 gene locus_tag LOCUS_06630 gene glnA3 168410 169819 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCG7 protein_id gnl|my_center|LOCUS_06630 169966 170748 gene locus_tag LOCUS_06640 gene bdhA 169966 170748 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948022.1 protein_id gnl|my_center|LOCUS_06640 170830 171468 gene locus_tag LOCUS_06650 170830 171468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 175682 171462 gene locus_tag LOCUS_06660 175682 171462 CDS product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389851.1 protein_id gnl|my_center|LOCUS_06660 177901 175682 gene locus_tag LOCUS_06670 177901 175682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 178853 177999 gene locus_tag LOCUS_06680 gene ate 178853 177999 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J340 protein_id gnl|my_center|LOCUS_06680 180402 179149 gene locus_tag LOCUS_06690 180402 179149 CDS product L-threonine dehydratase catabolic TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CE74 protein_id gnl|my_center|LOCUS_06690 180630 181814 gene locus_tag LOCUS_06700 180630 181814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 182641 181817 gene locus_tag LOCUS_06710 gene tatC 182641 181817 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KZ9 protein_id gnl|my_center|LOCUS_06710 183057 182653 gene locus_tag LOCUS_06720 183057 182653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 183306 183079 gene locus_tag LOCUS_06730 gene tatA 183306 183079 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3D6 protein_id gnl|my_center|LOCUS_06730 184044 183358 gene locus_tag LOCUS_06740 184044 183358 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8N3 protein_id gnl|my_center|LOCUS_06740 184877 184041 gene locus_tag LOCUS_06750 184877 184041 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531293.1 protein_id gnl|my_center|LOCUS_06750 185899 184874 gene locus_tag LOCUS_06760 185899 184874 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389530.1 protein_id gnl|my_center|LOCUS_06760 186727 185969 gene locus_tag LOCUS_06770 186727 185969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 188491 186731 gene locus_tag LOCUS_06780 gene argS 188491 186731 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3V3 protein_id gnl|my_center|LOCUS_06780 189219 188569 gene locus_tag LOCUS_06790 189219 188569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 189342 190325 gene locus_tag LOCUS_06800 gene ispH 189342 190325 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCC9 protein_id gnl|my_center|LOCUS_06800 190335 191309 gene locus_tag LOCUS_06810 gene thrB 190335 191309 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHA8 protein_id gnl|my_center|LOCUS_06810 191361 191816 gene locus_tag LOCUS_06820 gene rnhA 191361 191816 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RG0 protein_id gnl|my_center|LOCUS_06820 192062 191886 gene locus_tag LOCUS_06830 192062 191886 CDS product DUF1508 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920802.1 protein_id gnl|my_center|LOCUS_06830 193305 192190 gene locus_tag LOCUS_06840 193305 192190 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061599.1 protein_id gnl|my_center|LOCUS_06840 194264 193305 gene locus_tag LOCUS_06850 194264 193305 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529715.1 protein_id gnl|my_center|LOCUS_06850 194401 194895 gene locus_tag LOCUS_06860 194401 194895 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533685.1 protein_id gnl|my_center|LOCUS_06860 194982 196025 gene locus_tag LOCUS_06870 194982 196025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 196105 197643 gene locus_tag LOCUS_06880 196105 197643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55702 protein_id gnl|my_center|LOCUS_06880 197658 198299 gene locus_tag LOCUS_06890 197658 198299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 198312 199607 gene locus_tag LOCUS_06900 198312 199607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 199696 200667 gene locus_tag LOCUS_06910 199696 200667 CDS product secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920778.1 protein_id gnl|my_center|LOCUS_06910 200687 201685 gene locus_tag LOCUS_06920 gene ctpI 200687 201685 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310061.1 protein_id gnl|my_center|LOCUS_06920 202651 201773 gene locus_tag LOCUS_06930 gene mtnP 202651 201773 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9H5 protein_id gnl|my_center|LOCUS_06930 202796 205816 gene locus_tag LOCUS_06940 gene btuB 202796 205816 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 protein_id gnl|my_center|LOCUS_06940 208462 205883 gene locus_tag LOCUS_06950 gene clpB 208462 205883 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UL2 protein_id gnl|my_center|LOCUS_06950 208739 209524 gene locus_tag LOCUS_06960 208739 209524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 209542 210237 gene locus_tag LOCUS_06970 209542 210237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 210272 210793 gene locus_tag LOCUS_06980 210272 210793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 211097 210798 gene locus_tag LOCUS_06990 211097 210798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 212213 211251 gene locus_tag LOCUS_07000 212213 211251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 212779 212210 gene locus_tag LOCUS_07010 212779 212210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 213317 212856 gene locus_tag LOCUS_07020 213317 212856 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHA9 protein_id gnl|my_center|LOCUS_07020 214835 213339 gene locus_tag LOCUS_07030 gene gatB 214835 213339 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U821 protein_id gnl|my_center|LOCUS_07030 215558 214848 gene locus_tag LOCUS_07040 215558 214848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 protein_id gnl|my_center|LOCUS_07040 216599 215652 gene locus_tag LOCUS_07050 216599 215652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 217263 216706 gene locus_tag LOCUS_07060 217263 216706 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0T8 protein_id gnl|my_center|LOCUS_07060 218735 217254 gene locus_tag LOCUS_07070 gene gatA 218735 217254 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5L0 protein_id gnl|my_center|LOCUS_07070 219037 218735 gene locus_tag LOCUS_07080 gene gatC 219037 218735 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QK8 protein_id gnl|my_center|LOCUS_07080 219651 219136 gene locus_tag LOCUS_07090 219651 219136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 220037 219792 gene locus_tag LOCUS_07100 gene rpsU 220037 219792 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK1 protein_id gnl|my_center|LOCUS_07100 220255 221571 gene locus_tag LOCUS_07110 220255 221571 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 protein_id gnl|my_center|LOCUS_07110 221643 222044 gene locus_tag LOCUS_07120 gene crcB 221643 222044 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6V2 protein_id gnl|my_center|LOCUS_07120 222041 223315 gene locus_tag LOCUS_07130 222041 223315 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 protein_id gnl|my_center|LOCUS_07130 223331 223951 gene locus_tag LOCUS_07140 223331 223951 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920422.1 protein_id gnl|my_center|LOCUS_07140 223951 224607 gene locus_tag LOCUS_07150 223951 224607 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385291.1 protein_id gnl|my_center|LOCUS_07150 224604 224843 gene locus_tag LOCUS_07160 224604 224843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 224840 225541 gene locus_tag LOCUS_07170 224840 225541 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971649.1 protein_id gnl|my_center|LOCUS_07170 226258 225674 gene locus_tag LOCUS_07180 226258 225674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 226339 226773 gene locus_tag LOCUS_07190 226339 226773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 227585 226950 gene locus_tag LOCUS_07200 227585 226950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 228562 227603 gene locus_tag LOCUS_07210 228562 227603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 229449 228601 gene locus_tag LOCUS_07220 229449 228601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_07220 230615 229446 gene locus_tag LOCUS_07230 230615 229446 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937915.1 protein_id gnl|my_center|LOCUS_07230 230670 233603 gene locus_tag LOCUS_07240 gene valS 230670 233603 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C981 protein_id gnl|my_center|LOCUS_07240 233796 234530 gene locus_tag LOCUS_07250 233796 234530 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_07250 236379 234595 gene locus_tag LOCUS_07260 236379 234595 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086599.1 protein_id gnl|my_center|LOCUS_07260 237225 236473 gene locus_tag LOCUS_07270 237225 236473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533664.1 protein_id gnl|my_center|LOCUS_07270 238136 237222 gene locus_tag LOCUS_07280 238136 237222 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKV0 protein_id gnl|my_center|LOCUS_07280 239387 238194 gene locus_tag LOCUS_07290 239387 238194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 240796 239384 gene locus_tag LOCUS_07300 240796 239384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 240894 242120 gene locus_tag LOCUS_07310 gene nhaA1 240894 242120 CDS product Na(+)/H(+) antiporter NhaA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WL3 protein_id gnl|my_center|LOCUS_07310 242599 242156 gene locus_tag LOCUS_07320 242599 242156 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720555.1 protein_id gnl|my_center|LOCUS_07320 243521 242778 gene locus_tag LOCUS_07330 243521 242778 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811028.1 protein_id gnl|my_center|LOCUS_07330 243745 244557 gene locus_tag LOCUS_07340 243745 244557 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390859.1 protein_id gnl|my_center|LOCUS_07340 244615 245907 gene locus_tag LOCUS_07350 gene ugdH 244615 245907 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313911.1 protein_id gnl|my_center|LOCUS_07350 246948 245947 gene locus_tag LOCUS_07360 246948 245947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 248264 247542 gene locus_tag LOCUS_07370 gene aqpZ2 248264 247542 CDS product aquaporin Z 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJW4 protein_id gnl|my_center|LOCUS_07370 249106 248396 gene locus_tag LOCUS_07380 249106 248396 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 protein_id gnl|my_center|LOCUS_07380 249780 249139 gene locus_tag LOCUS_07390 249780 249139 CDS product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084981.1 protein_id gnl|my_center|LOCUS_07390 250274 249843 gene locus_tag LOCUS_07400 250274 249843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 250255 251205 gene locus_tag LOCUS_07410 250255 251205 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAY9 protein_id gnl|my_center|LOCUS_07410 251325 252245 gene locus_tag LOCUS_07420 gene rpoH1 251325 252245 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3R3 protein_id gnl|my_center|LOCUS_07420 252369 253040 gene locus_tag LOCUS_07430 gene mtgA 252369 253040 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABA6 protein_id gnl|my_center|LOCUS_07430 254164 253061 gene locus_tag LOCUS_07440 254164 253061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 254265 255209 gene locus_tag LOCUS_07450 gene czcD 254265 255209 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 protein_id gnl|my_center|LOCUS_07450 256535 255264 gene locus_tag LOCUS_07460 gene clpX 256535 255264 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7D2 protein_id gnl|my_center|LOCUS_07460 257404 256697 gene locus_tag LOCUS_07470 gene clpP 257404 256697 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU45 protein_id gnl|my_center|LOCUS_07470 258157 257513 gene locus_tag LOCUS_07480 258157 257513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 259841 258249 gene locus_tag LOCUS_07490 gene tig 259841 258249 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEU0 protein_id gnl|my_center|LOCUS_07490 259985 259901 gene locus_tag LOCUS_t00130 259985 259901 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 260156 260482 gene locus_tag LOCUS_07500 260156 260482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 261055 260483 gene locus_tag LOCUS_07510 261055 260483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 261222 262607 gene locus_tag LOCUS_07520 gene engA 261222 262607 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y567 protein_id gnl|my_center|LOCUS_07520 263346 262624 gene locus_tag LOCUS_07530 263346 262624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 264318 263437 gene locus_tag LOCUS_07540 264318 263437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 264855 264583 gene locus_tag LOCUS_07550 264855 264583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 265356 264871 gene locus_tag LOCUS_07560 gene bfr 265356 264871 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD63 protein_id gnl|my_center|LOCUS_07560 265753 265493 gene locus_tag LOCUS_07570 265753 265493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 267012 265750 gene locus_tag LOCUS_07580 267012 265750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918600.1 protein_id gnl|my_center|LOCUS_07580 268192 267065 gene locus_tag LOCUS_07590 268192 267065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 268467 269192 gene locus_tag LOCUS_07600 268467 269192 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088682.1 protein_id gnl|my_center|LOCUS_07600 269203 269871 gene locus_tag LOCUS_07610 269203 269871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 269916 271331 gene locus_tag LOCUS_07620 269916 271331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 272645 271404 gene locus_tag LOCUS_07630 gene pyrC 272645 271404 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF9 protein_id gnl|my_center|LOCUS_07630 273688 272642 gene locus_tag LOCUS_07640 gene pyrB 273688 272642 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ49 protein_id gnl|my_center|LOCUS_07640 273844 275772 gene locus_tag LOCUS_07650 273844 275772 CDS product protease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLH7 protein_id gnl|my_center|LOCUS_07650 275881 275955 gene locus_tag LOCUS_t00140 275881 275955 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 276211 277371 gene locus_tag LOCUS_07660 276211 277371 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089764.1 protein_id gnl|my_center|LOCUS_07660 279044 277440 gene locus_tag LOCUS_07670 279044 277440 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525090.1 protein_id gnl|my_center|LOCUS_07670 279216 279860 gene locus_tag LOCUS_07680 gene gst 279216 279860 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971183.1 protein_id gnl|my_center|LOCUS_07680 279995 280186 gene locus_tag LOCUS_07690 279995 280186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_07690 280490 280209 gene locus_tag LOCUS_07700 280490 280209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 280608 281888 gene locus_tag LOCUS_07710 gene serS 280608 281888 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEQ2 protein_id gnl|my_center|LOCUS_07710 281911 282684 gene locus_tag LOCUS_07720 gene surE 281911 282684 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GX52 protein_id gnl|my_center|LOCUS_07720 282699 283949 gene locus_tag LOCUS_07730 282699 283949 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087511.1 protein_id gnl|my_center|LOCUS_07730 284000 285016 gene locus_tag LOCUS_07740 284000 285016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524032.1 protein_id gnl|my_center|LOCUS_07740 285427 285023 gene locus_tag LOCUS_07750 285427 285023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 285497 286921 gene locus_tag LOCUS_07760 gene rimO 285497 286921 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI7 protein_id gnl|my_center|LOCUS_07760 286952 287800 gene locus_tag LOCUS_07770 286952 287800 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_07770 288005 289444 gene locus_tag LOCUS_07780 gene zwf 288005 289444 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM53 protein_id gnl|my_center|LOCUS_07780 289437 291248 gene locus_tag LOCUS_07790 289437 291248 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538199.1 protein_id gnl|my_center|LOCUS_07790 291254 292228 gene locus_tag LOCUS_07800 gene glk 291254 292228 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXA8 protein_id gnl|my_center|LOCUS_07800 292225 292860 gene locus_tag LOCUS_07810 292225 292860 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_07810 292860 295634 gene locus_tag LOCUS_07820 292860 295634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 295756 296481 gene locus_tag LOCUS_07830 295756 296481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 297478 296492 gene locus_tag LOCUS_07840 297478 296492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 298484 297438 gene locus_tag LOCUS_07850 298484 297438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 299501 298665 gene locus_tag LOCUS_07860 299501 298665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 302206 299936 gene locus_tag LOCUS_07870 gene ptsP 302206 299936 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083049.1 protein_id gnl|my_center|LOCUS_07870 302536 302381 gene locus_tag LOCUS_07880 302536 302381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 302761 302958 gene locus_tag LOCUS_07890 302761 302958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_07890 303076 303555 gene locus_tag LOCUS_07900 303076 303555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 305043 303571 gene locus_tag LOCUS_07910 gene glpK 305043 303571 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RST6 protein_id gnl|my_center|LOCUS_07910 305129 306004 gene locus_tag LOCUS_07920 305129 306004 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_07920 306086 307075 gene locus_tag LOCUS_07930 gene nadA 306086 307075 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_07930 307133 308452 gene locus_tag LOCUS_07940 307133 308452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_07940 308737 308462 gene locus_tag LOCUS_07950 308737 308462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 309456 308734 gene locus_tag LOCUS_07960 309456 308734 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_07960 310419 309637 gene locus_tag LOCUS_07970 310419 309637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 310979 311383 gene locus_tag LOCUS_07980 310979 311383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 311459 311953 gene locus_tag LOCUS_07990 311459 311953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 311950 312981 gene locus_tag LOCUS_08000 gene holA 311950 312981 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_08000 313158 314570 gene locus_tag LOCUS_08010 313158 314570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 314787 315365 gene locus_tag LOCUS_08020 314787 315365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 315328 316008 gene locus_tag LOCUS_08030 315328 316008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 316005 317024 gene locus_tag LOCUS_08040 316005 317024 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920281.1 protein_id gnl|my_center|LOCUS_08040 317295 317059 gene locus_tag LOCUS_08050 317295 317059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 317611 317390 gene locus_tag LOCUS_08060 317611 317390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 320466 317608 gene locus_tag LOCUS_08070 gene fdsA 320466 317608 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709576.1 protein_id gnl|my_center|LOCUS_08070 321281 320469 gene locus_tag LOCUS_08080 gene fdhD 321281 320469 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P888 protein_id gnl|my_center|LOCUS_08080 322819 321278 gene locus_tag LOCUS_08090 gene nuoF 322819 321278 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085921.1 protein_id gnl|my_center|LOCUS_08090 323247 322816 gene locus_tag LOCUS_08100 gene fdsG 323247 322816 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530346.1 protein_id gnl|my_center|LOCUS_08100 324088 323252 gene locus_tag LOCUS_08110 324088 323252 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H09 protein_id gnl|my_center|LOCUS_08110 324486 324094 gene locus_tag LOCUS_08120 324486 324094 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038652.1 protein_id gnl|my_center|LOCUS_08120 325637 324525 gene locus_tag LOCUS_08130 gene adhC 325637 324525 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GY0 protein_id gnl|my_center|LOCUS_08130 326013 326927 gene locus_tag LOCUS_08140 326013 326927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 327272 328084 gene locus_tag LOCUS_08150 327272 328084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 329388 328102 gene locus_tag LOCUS_08160 329388 328102 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529846.1 protein_id gnl|my_center|LOCUS_08160 330464 329385 gene locus_tag LOCUS_08170 330464 329385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 332611 330461 gene locus_tag LOCUS_08180 332611 330461 CDS product Fe3+/spermidine/putrescine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529845.1 protein_id gnl|my_center|LOCUS_08180 334136 332736 gene locus_tag LOCUS_08190 334136 332736 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529844.1 protein_id gnl|my_center|LOCUS_08190 334861 334154 gene locus_tag LOCUS_08200 334861 334154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 <337507 334879 gene locus_tag LOCUS_08210 <337507 334879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980931.1:FrpA/C >Feature sequence03 430 1077 gene locus_tag LOCUS_08220 430 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1269 2024 gene locus_tag LOCUS_08230 1269 2024 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083367.1 protein_id gnl|my_center|LOCUS_08230 2847 2035 gene locus_tag LOCUS_08240 2847 2035 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640150.1 protein_id gnl|my_center|LOCUS_08240 3399 2902 gene locus_tag LOCUS_08250 3399 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 4101 3400 gene locus_tag LOCUS_08260 4101 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 5527 4145 gene locus_tag LOCUS_08270 gene metZ 5527 4145 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S95 protein_id gnl|my_center|LOCUS_08270 5541 6788 gene locus_tag LOCUS_08280 5541 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 7907 6804 gene locus_tag LOCUS_08290 7907 6804 CDS product dolichol monophosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_08290 8995 7937 gene locus_tag LOCUS_08300 gene leuB 8995 7937 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JL2 protein_id gnl|my_center|LOCUS_08300 9630 8992 gene locus_tag LOCUS_08310 9630 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 9932 9684 gene locus_tag LOCUS_08320 9932 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969867.1 protein_id gnl|my_center|LOCUS_08320 10548 9994 gene locus_tag LOCUS_08330 gene crtK 10548 9994 CDS product sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537438.1 protein_id gnl|my_center|LOCUS_08330 11452 10715 gene locus_tag LOCUS_08340 11452 10715 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_08340 11689 12060 gene locus_tag LOCUS_08350 11689 12060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 12523 13620 gene locus_tag LOCUS_08360 gene ilvE 12523 13620 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC47 protein_id gnl|my_center|LOCUS_08360 14632 13604 gene locus_tag LOCUS_08370 14632 13604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 14774 15619 gene locus_tag LOCUS_08380 14774 15619 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339567.1 protein_id gnl|my_center|LOCUS_08380 15702 15776 gene locus_tag LOCUS_t00150 15702 15776 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 16607 18871 gene locus_tag LOCUS_08390 16607 18871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 20689 18965 gene locus_tag LOCUS_08400 20689 18965 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_08400 22709 20682 gene locus_tag LOCUS_08410 22709 20682 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528563.1 protein_id gnl|my_center|LOCUS_08410 23646 22714 gene locus_tag LOCUS_08420 23646 22714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 25011 23665 gene locus_tag LOCUS_08430 25011 23665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 26746 25004 gene locus_tag LOCUS_08440 26746 25004 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_08440 26920 27669 gene locus_tag LOCUS_08450 26920 27669 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929678.1 protein_id gnl|my_center|LOCUS_08450 27666 28391 gene locus_tag LOCUS_08460 27666 28391 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566502.1 protein_id gnl|my_center|LOCUS_08460 30725 28398 gene locus_tag LOCUS_08470 30725 28398 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705583.1 protein_id gnl|my_center|LOCUS_08470 33231 30799 gene locus_tag LOCUS_08480 33231 30799 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268745.1 protein_id gnl|my_center|LOCUS_08480 33453 34370 gene locus_tag LOCUS_08490 33453 34370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 34485 35360 gene locus_tag LOCUS_08500 34485 35360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 35374 36573 gene locus_tag LOCUS_08510 35374 36573 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_08510 37049 36570 gene locus_tag LOCUS_08520 37049 36570 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_08520 39399 37054 gene locus_tag LOCUS_08530 39399 37054 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096675.1 protein_id gnl|my_center|LOCUS_08530 39882 39412 gene locus_tag LOCUS_08540 39882 39412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 40513 39992 gene locus_tag LOCUS_08550 40513 39992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 42193 40727 gene locus_tag LOCUS_08560 42193 40727 CDS product adeC/adeK/oprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943333.1 protein_id gnl|my_center|LOCUS_08560 45354 42190 gene locus_tag LOCUS_08570 45354 42190 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703631.1 protein_id gnl|my_center|LOCUS_08570 46509 45361 gene locus_tag LOCUS_08580 gene acrA 46509 45361 CDS product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_08580 46659 47276 gene locus_tag LOCUS_08590 46659 47276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 47931 47368 gene locus_tag LOCUS_08600 47931 47368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 48119 47928 gene locus_tag LOCUS_08610 48119 47928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 48272 49012 gene locus_tag LOCUS_08620 48272 49012 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_08620 49773 49036 gene locus_tag LOCUS_08630 49773 49036 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_08630 50592 49777 gene locus_tag LOCUS_08640 gene pcaD 50592 49777 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223755.1 protein_id gnl|my_center|LOCUS_08640 51774 50623 gene locus_tag LOCUS_08650 51774 50623 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701280.1 protein_id gnl|my_center|LOCUS_08650 51928 52803 gene locus_tag LOCUS_08660 51928 52803 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085343.1 protein_id gnl|my_center|LOCUS_08660 55322 52881 gene locus_tag LOCUS_08670 55322 52881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 56411 55545 gene locus_tag LOCUS_08680 56411 55545 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814178.1 protein_id gnl|my_center|LOCUS_08680 57388 56426 gene locus_tag LOCUS_08690 57388 56426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 58671 57466 gene locus_tag LOCUS_08700 58671 57466 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728130.1 protein_id gnl|my_center|LOCUS_08700 59219 58686 gene locus_tag LOCUS_08710 59219 58686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 61410 59335 gene locus_tag LOCUS_08720 61410 59335 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 protein_id gnl|my_center|LOCUS_08720 62135 61443 gene locus_tag LOCUS_08730 62135 61443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 64536 62182 gene locus_tag LOCUS_08740 gene gcd-1 64536 62182 CDS product quinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104090.1 protein_id gnl|my_center|LOCUS_08740 67191 64711 gene locus_tag LOCUS_08750 67191 64711 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639902.1 protein_id gnl|my_center|LOCUS_08750 68494 67379 gene locus_tag LOCUS_08760 68494 67379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 69651 68512 gene locus_tag LOCUS_08770 69651 68512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 70891 69662 gene locus_tag LOCUS_08780 70891 69662 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089277.1 protein_id gnl|my_center|LOCUS_08780 71580 70888 gene locus_tag LOCUS_08790 71580 70888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 71809 73002 gene locus_tag LOCUS_08800 71809 73002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08800 73084 73395 gene locus_tag LOCUS_08810 73084 73395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08810 73967 73392 gene locus_tag LOCUS_08820 73967 73392 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920228.1 protein_id gnl|my_center|LOCUS_08820 75154 74285 gene locus_tag LOCUS_08830 75154 74285 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J9 protein_id gnl|my_center|LOCUS_08830 75941 75159 gene locus_tag LOCUS_08840 75941 75159 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_08840 77067 75985 gene locus_tag LOCUS_08850 77067 75985 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919229.1 protein_id gnl|my_center|LOCUS_08850 78856 77078 gene locus_tag LOCUS_08860 78856 77078 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_08860 80124 78979 gene locus_tag LOCUS_08870 80124 78979 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640215.1 protein_id gnl|my_center|LOCUS_08870 81708 80290 gene locus_tag LOCUS_08880 81708 80290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 protein_id gnl|my_center|LOCUS_08880 81912 82841 gene locus_tag LOCUS_08890 81912 82841 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537711.1 protein_id gnl|my_center|LOCUS_08890 84133 82859 gene locus_tag LOCUS_08900 84133 82859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 85129 84200 gene locus_tag LOCUS_08910 85129 84200 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533047.1 protein_id gnl|my_center|LOCUS_08910 86385 85144 gene locus_tag LOCUS_08920 86385 85144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 87202 86408 gene locus_tag LOCUS_08930 gene menB 87202 86408 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPQ4 protein_id gnl|my_center|LOCUS_08930 87627 87199 gene locus_tag LOCUS_08940 87627 87199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 88388 87630 gene locus_tag LOCUS_08950 88388 87630 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_08950 88966 88385 gene locus_tag LOCUS_08960 88966 88385 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532372.1 protein_id gnl|my_center|LOCUS_08960 90129 88966 gene locus_tag LOCUS_08970 90129 88966 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003134747.1 protein_id gnl|my_center|LOCUS_08970 91024 90137 gene locus_tag LOCUS_08980 91024 90137 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085733.1 protein_id gnl|my_center|LOCUS_08980 91174 92601 gene locus_tag LOCUS_08990 91174 92601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_08990 92601 93800 gene locus_tag LOCUS_09000 92601 93800 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063909.1 protein_id gnl|my_center|LOCUS_09000 93842 94297 gene locus_tag LOCUS_09010 93842 94297 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089535.1 protein_id gnl|my_center|LOCUS_09010 94294 95163 gene locus_tag LOCUS_09020 94294 95163 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089536.1 protein_id gnl|my_center|LOCUS_09020 95236 96402 gene locus_tag LOCUS_09030 95236 96402 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920187.1 protein_id gnl|my_center|LOCUS_09030 96414 97328 gene locus_tag LOCUS_09040 96414 97328 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085741.1 protein_id gnl|my_center|LOCUS_09040 97330 98178 gene locus_tag LOCUS_09050 97330 98178 CDS product 3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927194.1 protein_id gnl|my_center|LOCUS_09050 98179 99111 gene locus_tag LOCUS_09060 98179 99111 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974328.1 protein_id gnl|my_center|LOCUS_09060 99148 99495 gene locus_tag LOCUS_09070 99148 99495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 99503 100510 gene locus_tag LOCUS_09080 99503 100510 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531452.1 protein_id gnl|my_center|LOCUS_09080 100619 102481 gene locus_tag LOCUS_09090 100619 102481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 103210 102557 gene locus_tag LOCUS_09100 103210 102557 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976284.1 protein_id gnl|my_center|LOCUS_09100 104759 103200 gene locus_tag LOCUS_09110 104759 103200 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_09110 105554 104766 gene locus_tag LOCUS_09120 105554 104766 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114532.1 protein_id gnl|my_center|LOCUS_09120 106803 105703 gene locus_tag LOCUS_09130 106803 105703 CDS product aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920254.1 protein_id gnl|my_center|LOCUS_09130 107312 106842 gene locus_tag LOCUS_09140 107312 106842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 108466 107309 gene locus_tag LOCUS_09150 108466 107309 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_09150 109438 108470 gene locus_tag LOCUS_09160 109438 108470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 109708 109442 gene locus_tag LOCUS_09170 109708 109442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 110325 109705 gene locus_tag LOCUS_09180 110325 109705 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205446.1 protein_id gnl|my_center|LOCUS_09180 111053 110325 gene locus_tag LOCUS_09190 111053 110325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 113777 111144 gene locus_tag LOCUS_09200 113777 111144 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_09200 113972 115018 gene locus_tag LOCUS_09210 113972 115018 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886860.1 protein_id gnl|my_center|LOCUS_09210 115044 116483 gene locus_tag LOCUS_09220 115044 116483 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228616.1 protein_id gnl|my_center|LOCUS_09220 116490 117299 gene locus_tag LOCUS_09230 116490 117299 CDS product putative phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705314.1 protein_id gnl|my_center|LOCUS_09230 118515 117394 gene locus_tag LOCUS_09240 118515 117394 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_09240 119374 118652 gene locus_tag LOCUS_09250 119374 118652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 120081 119452 gene locus_tag LOCUS_09260 120081 119452 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391165.1 protein_id gnl|my_center|LOCUS_09260 121713 120103 gene locus_tag LOCUS_09270 121713 120103 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918081.1 protein_id gnl|my_center|LOCUS_09270 122564 121728 gene locus_tag LOCUS_09280 122564 121728 CDS product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229072.1 protein_id gnl|my_center|LOCUS_09280 123370 122615 gene locus_tag LOCUS_09290 123370 122615 CDS product 2-hydroxycyclohexane-1-carbonyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_09290 124274 123363 gene locus_tag LOCUS_09300 124274 123363 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226917.1 protein_id gnl|my_center|LOCUS_09300 124813 124295 gene locus_tag LOCUS_09310 124813 124295 CDS product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105327.1 protein_id gnl|my_center|LOCUS_09310 126072 124810 gene locus_tag LOCUS_09320 126072 124810 CDS product aromatic-ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114852.1 protein_id gnl|my_center|LOCUS_09320 126202 126999 gene locus_tag LOCUS_09330 gene mhpD 126202 126999 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8Q7 protein_id gnl|my_center|LOCUS_09330 126996 127949 gene locus_tag LOCUS_09340 gene mhpF 126996 127949 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4P2 protein_id gnl|my_center|LOCUS_09340 127946 128980 gene locus_tag LOCUS_09350 gene mhpE 127946 128980 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NK03 protein_id gnl|my_center|LOCUS_09350 128973 129650 gene locus_tag LOCUS_09360 128973 129650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 129758 130987 gene locus_tag LOCUS_09370 129758 130987 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089977.1 protein_id gnl|my_center|LOCUS_09370 130980 131159 gene locus_tag LOCUS_09380 130980 131159 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AK4 protein_id gnl|my_center|LOCUS_09380 132361 131219 gene locus_tag LOCUS_09390 132361 131219 CDS product long-chain-acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225699.1 protein_id gnl|my_center|LOCUS_09390 133084 132506 gene locus_tag LOCUS_09400 gene rnhB 133084 132506 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_09400 133134 134351 gene locus_tag LOCUS_09410 gene yliI 133134 134351 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 protein_id gnl|my_center|LOCUS_09410 134391 134900 gene locus_tag LOCUS_09420 134391 134900 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538120.1 protein_id gnl|my_center|LOCUS_09420 134926 135474 gene locus_tag LOCUS_09430 134926 135474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918294.1 protein_id gnl|my_center|LOCUS_09430 135471 136061 gene locus_tag LOCUS_09440 135471 136061 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918295.1 protein_id gnl|my_center|LOCUS_09440 136054 137241 gene locus_tag LOCUS_09450 136054 137241 CDS product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708849.1 protein_id gnl|my_center|LOCUS_09450 137595 138122 gene locus_tag LOCUS_09460 137595 138122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 140500 138194 gene locus_tag LOCUS_09470 gene parC 140500 138194 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT97 protein_id gnl|my_center|LOCUS_09470 140946 140608 gene locus_tag LOCUS_09480 140946 140608 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_09480 142047 140953 gene locus_tag LOCUS_09490 142047 140953 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388823.1 protein_id gnl|my_center|LOCUS_09490 143111 142044 gene locus_tag LOCUS_09500 gene nifS 143111 142044 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_09500 143340 143876 gene locus_tag LOCUS_09510 143340 143876 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143006.1 protein_id gnl|my_center|LOCUS_09510 144185 143973 gene locus_tag LOCUS_09520 144185 143973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 144728 144201 gene locus_tag LOCUS_09530 144728 144201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 145276 144920 gene locus_tag LOCUS_09540 145276 144920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 147099 145489 gene locus_tag LOCUS_09550 gene pckA 147099 145489 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43086 protein_id gnl|my_center|LOCUS_09550 147357 148130 gene locus_tag LOCUS_09560 gene chvI 147357 148130 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970615.1 protein_id gnl|my_center|LOCUS_09560 148123 149745 gene locus_tag LOCUS_09570 148123 149745 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_09570 149742 150176 gene locus_tag LOCUS_09580 149742 150176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709868.1 protein_id gnl|my_center|LOCUS_09580 150258 151202 gene locus_tag LOCUS_09590 150258 151202 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ3 protein_id gnl|my_center|LOCUS_09590 151273 151677 gene locus_tag LOCUS_09600 151273 151677 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391194.1 protein_id gnl|my_center|LOCUS_09600 151709 151987 gene locus_tag LOCUS_09610 151709 151987 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709866.1 protein_id gnl|my_center|LOCUS_09610 152010 152810 gene locus_tag LOCUS_09620 152010 152810 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919071.1 protein_id gnl|my_center|LOCUS_09620 154264 152840 gene locus_tag LOCUS_09630 154264 152840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_09630 154916 154347 gene locus_tag LOCUS_09640 gene def 154916 154347 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BN9 protein_id gnl|my_center|LOCUS_09640 156160 154994 gene locus_tag LOCUS_09650 gene alkB 156160 154994 CDS product alkane 1-monooxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417047.1 protein_id gnl|my_center|LOCUS_09650 156860 156264 gene locus_tag LOCUS_09660 gene recR 156860 156264 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMS4 protein_id gnl|my_center|LOCUS_09660 156914 157819 gene locus_tag LOCUS_09670 gene fmt 156914 157819 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8K0 protein_id gnl|my_center|LOCUS_09670 157827 158570 gene locus_tag LOCUS_09680 gene truA 157827 158570 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP1 protein_id gnl|my_center|LOCUS_09680 158800 158591 gene locus_tag LOCUS_09690 158800 158591 CDS product flavin and CoA sequestration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940870.1 protein_id gnl|my_center|LOCUS_09690 159944 158952 gene locus_tag LOCUS_09700 159944 158952 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_09700 160194 160328 gene locus_tag LOCUS_09710 160194 160328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 160953 160366 gene locus_tag LOCUS_09720 160953 160366 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337129.1 protein_id gnl|my_center|LOCUS_09720 161008 161283 gene locus_tag LOCUS_09730 161008 161283 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920847.1 protein_id gnl|my_center|LOCUS_09730 161283 162179 gene locus_tag LOCUS_09740 161283 162179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707077.1 protein_id gnl|my_center|LOCUS_09740 162249 162917 gene locus_tag LOCUS_09750 gene hisG 162249 162917 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM6 protein_id gnl|my_center|LOCUS_09750 162917 164206 gene locus_tag LOCUS_09760 gene hisD 162917 164206 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_09760 164203 164664 gene locus_tag LOCUS_09770 gene nusB 164203 164664 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H535 protein_id gnl|my_center|LOCUS_09770 164661 165539 gene locus_tag LOCUS_09780 gene thiL 164661 165539 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K82 protein_id gnl|my_center|LOCUS_09780 165677 167800 gene locus_tag LOCUS_09790 gene hppA 165677 167800 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K83 protein_id gnl|my_center|LOCUS_09790 167982 169187 gene locus_tag LOCUS_09800 167982 169187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973112.1 protein_id gnl|my_center|LOCUS_09800 169184 170062 gene locus_tag LOCUS_09810 169184 170062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 170080 170970 gene locus_tag LOCUS_09820 170080 170970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 171004 171891 gene locus_tag LOCUS_09830 gene tesB 171004 171891 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_09830 173838 171898 gene locus_tag LOCUS_09840 gene uvrC 173838 171898 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKK4 protein_id gnl|my_center|LOCUS_09840 176365 173915 gene locus_tag LOCUS_09850 176365 173915 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640388.1 protein_id gnl|my_center|LOCUS_09850 176585 176830 gene locus_tag LOCUS_09860 gene infA 176585 176830 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V4 protein_id gnl|my_center|LOCUS_09860 176846 177424 gene locus_tag LOCUS_09870 176846 177424 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQN0 protein_id gnl|my_center|LOCUS_09870 177414 178391 gene locus_tag LOCUS_09880 177414 178391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 178388 178570 gene locus_tag LOCUS_09890 178388 178570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 178676 178751 gene locus_tag LOCUS_t00160 178676 178751 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 180477 178774 gene locus_tag LOCUS_09900 180477 178774 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086439.1 protein_id gnl|my_center|LOCUS_09900 180829 181542 gene locus_tag LOCUS_09910 180829 181542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 181573 182196 gene locus_tag LOCUS_09920 181573 182196 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205446.1 protein_id gnl|my_center|LOCUS_09920 182203 182493 gene locus_tag LOCUS_09930 182203 182493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 182991 182494 gene locus_tag LOCUS_09940 182991 182494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 183369 184841 gene locus_tag LOCUS_09950 183369 184841 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3V1 protein_id gnl|my_center|LOCUS_09950 184908 185231 gene locus_tag LOCUS_09960 gene arsR 184908 185231 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809062.1 protein_id gnl|my_center|LOCUS_09960 185241 185741 gene locus_tag LOCUS_09970 185241 185741 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888243.1 protein_id gnl|my_center|LOCUS_09970 185738 186808 gene locus_tag LOCUS_09980 185738 186808 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339061.1 protein_id gnl|my_center|LOCUS_09980 187234 186815 gene locus_tag LOCUS_09990 187234 186815 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811562.1 protein_id gnl|my_center|LOCUS_09990 187398 188318 gene locus_tag LOCUS_10000 187398 188318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 188315 189337 gene locus_tag LOCUS_10010 188315 189337 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_10010 190317 189340 gene locus_tag LOCUS_10020 190317 189340 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_10020 191479 190319 gene locus_tag LOCUS_10030 191479 190319 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090530.1 protein_id gnl|my_center|LOCUS_10030 192600 191533 gene locus_tag LOCUS_10040 192600 191533 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_10040 193798 192593 gene locus_tag LOCUS_10050 193798 192593 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701081.1 protein_id gnl|my_center|LOCUS_10050 194576 193812 gene locus_tag LOCUS_10060 194576 193812 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_10060 194728 195345 gene locus_tag LOCUS_10070 194728 195345 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815507.1 protein_id gnl|my_center|LOCUS_10070 195461 196420 gene locus_tag LOCUS_10080 195461 196420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 196606 198051 gene locus_tag LOCUS_10090 196606 198051 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 protein_id gnl|my_center|LOCUS_10090 199396 198092 gene locus_tag LOCUS_10100 199396 198092 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 protein_id gnl|my_center|LOCUS_10100 199980 199558 gene locus_tag LOCUS_10110 199980 199558 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_10110 201113 200007 gene locus_tag LOCUS_10120 201113 200007 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404432.1 protein_id gnl|my_center|LOCUS_10120 201983 201192 gene locus_tag LOCUS_10130 201983 201192 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229600.1 protein_id gnl|my_center|LOCUS_10130 202787 202029 gene locus_tag LOCUS_10140 202787 202029 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729757.1 protein_id gnl|my_center|LOCUS_10140 202918 203217 gene locus_tag LOCUS_10150 202918 203217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 203992 203243 gene locus_tag LOCUS_10160 203992 203243 CDS product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 protein_id gnl|my_center|LOCUS_10160 204525 204016 gene locus_tag LOCUS_10170 204525 204016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 205667 204522 gene locus_tag LOCUS_10180 205667 204522 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_10180 206022 206693 gene locus_tag LOCUS_10190 206022 206693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_10190 206749 207273 gene locus_tag LOCUS_10200 206749 207273 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228700.1 protein_id gnl|my_center|LOCUS_10200 207278 207787 gene locus_tag LOCUS_10210 207278 207787 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066672.1 protein_id gnl|my_center|LOCUS_10210 208603 207818 gene locus_tag LOCUS_10220 gene rhlG 208603 207818 CDS product rhamnolipids biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RPT1 protein_id gnl|my_center|LOCUS_10220 211282 208715 gene locus_tag LOCUS_10230 211282 208715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 211673 213232 gene locus_tag LOCUS_10240 211673 213232 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729521.1 protein_id gnl|my_center|LOCUS_10240 214277 213267 gene locus_tag LOCUS_10250 gene adhP 214277 213267 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_10250 216446 214353 gene locus_tag LOCUS_10260 216446 214353 CDS product pyrrolo-quinoline quinone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537605.1 protein_id gnl|my_center|LOCUS_10260 216679 217467 gene locus_tag LOCUS_10270 216679 217467 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085699.1 protein_id gnl|my_center|LOCUS_10270 218475 217489 gene locus_tag LOCUS_10280 218475 217489 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_10280 219738 218479 gene locus_tag LOCUS_10290 219738 218479 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035424.1 protein_id gnl|my_center|LOCUS_10290 221292 219919 gene locus_tag LOCUS_10300 221292 219919 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NQ6 protein_id gnl|my_center|LOCUS_10300 224329 221423 gene locus_tag LOCUS_10310 224329 221423 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_10310 224437 225015 gene locus_tag LOCUS_10320 224437 225015 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083622.1 protein_id gnl|my_center|LOCUS_10320 225061 225660 gene locus_tag LOCUS_10330 225061 225660 CDS product putative NADH dehydrogenase/NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4V1 protein_id gnl|my_center|LOCUS_10330 225693 226313 gene locus_tag LOCUS_10340 225693 226313 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 protein_id gnl|my_center|LOCUS_10340 226316 226804 gene locus_tag LOCUS_10350 226316 226804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 226983 227429 gene locus_tag LOCUS_10360 226983 227429 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_10360 227518 227943 gene locus_tag LOCUS_10370 227518 227943 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_10370 227985 228761 gene locus_tag LOCUS_10380 227985 228761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 228773 230104 gene locus_tag LOCUS_10390 gene miaB 228773 230104 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLW0 protein_id gnl|my_center|LOCUS_10390 230712 230101 gene locus_tag LOCUS_10400 230712 230101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 230827 231855 gene locus_tag LOCUS_10410 230827 231855 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527906.1 protein_id gnl|my_center|LOCUS_10410 231890 232399 gene locus_tag LOCUS_10420 231890 232399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 232406 233332 gene locus_tag LOCUS_10430 232406 233332 CDS product hemolysin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_10430 233495 234358 gene locus_tag LOCUS_10440 233495 234358 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388543.1 protein_id gnl|my_center|LOCUS_10440 234412 235374 gene locus_tag LOCUS_10450 234412 235374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 235910 235461 gene locus_tag LOCUS_10460 235910 235461 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7Y1 protein_id gnl|my_center|LOCUS_10460 236012 237433 gene locus_tag LOCUS_10470 236012 237433 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSV0 protein_id gnl|my_center|LOCUS_10470 237449 237868 gene locus_tag LOCUS_10480 237449 237868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707803.1 protein_id gnl|my_center|LOCUS_10480 239011 237872 gene locus_tag LOCUS_10490 239011 237872 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090103.1 protein_id gnl|my_center|LOCUS_10490 239923 239048 gene locus_tag LOCUS_10500 239923 239048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 241245 239920 gene locus_tag LOCUS_10510 241245 239920 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_10510 242291 241242 gene locus_tag LOCUS_10520 242291 241242 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532756.1 protein_id gnl|my_center|LOCUS_10520 242321 242887 gene locus_tag LOCUS_10530 242321 242887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336761.1 protein_id gnl|my_center|LOCUS_10530 242884 243618 gene locus_tag LOCUS_10540 242884 243618 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390997.1 protein_id gnl|my_center|LOCUS_10540 243770 244537 gene locus_tag LOCUS_10550 243770 244537 CDS product disulfide bond formation protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532754.1 protein_id gnl|my_center|LOCUS_10550 244572 247997 gene locus_tag LOCUS_10560 gene smc 244572 247997 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C7H0 protein_id gnl|my_center|LOCUS_10560 248097 249770 gene locus_tag LOCUS_10570 248097 249770 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_10570 250497 249778 gene locus_tag LOCUS_10580 250497 249778 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_10580 251894 250551 gene locus_tag LOCUS_10590 251894 250551 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920454.1 protein_id gnl|my_center|LOCUS_10590 252113 252682 gene locus_tag LOCUS_10600 252113 252682 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_10600 252679 253329 gene locus_tag LOCUS_10610 gene chrR 252679 253329 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918533.1 protein_id gnl|my_center|LOCUS_10610 253335 254153 gene locus_tag LOCUS_10620 253335 254153 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971976.1 protein_id gnl|my_center|LOCUS_10620 254150 254560 gene locus_tag LOCUS_10630 254150 254560 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640534.1 protein_id gnl|my_center|LOCUS_10630 254557 255405 gene locus_tag LOCUS_10640 254557 255405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 258862 255638 gene locus_tag LOCUS_10650 258862 255638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 260147 259056 gene locus_tag LOCUS_10660 260147 259056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 260630 260151 gene locus_tag LOCUS_10670 260630 260151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 260802 260635 gene locus_tag LOCUS_10680 260802 260635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 261643 260915 gene locus_tag LOCUS_10690 261643 260915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 262962 261724 gene locus_tag LOCUS_10700 262962 261724 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_10700 263238 263163 gene locus_tag LOCUS_t00170 263238 263163 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 264173 263256 gene locus_tag LOCUS_10710 264173 263256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 265462 264134 gene locus_tag LOCUS_10720 265462 264134 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969201.1 protein_id gnl|my_center|LOCUS_10720 266628 265468 gene locus_tag LOCUS_10730 266628 265468 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918642.1 protein_id gnl|my_center|LOCUS_10730 267175 266795 gene locus_tag LOCUS_10740 267175 266795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 269116 267272 gene locus_tag LOCUS_10750 269116 267272 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_10750 269499 272093 gene locus_tag LOCUS_10760 269499 272093 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_10760 272227 272679 gene locus_tag LOCUS_10770 272227 272679 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036362.1 protein_id gnl|my_center|LOCUS_10770 273764 272676 gene locus_tag LOCUS_10780 gene recF 273764 272676 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT0 protein_id gnl|my_center|LOCUS_10780 274525 273776 gene locus_tag LOCUS_10790 274525 273776 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_10790 274584 274660 gene locus_tag LOCUS_t00180 274584 274660 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 274923 275786 gene locus_tag LOCUS_10800 274923 275786 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_10800 275783 276271 gene locus_tag LOCUS_10810 275783 276271 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_10810 276268 278538 gene locus_tag LOCUS_10820 276268 278538 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530646.1 protein_id gnl|my_center|LOCUS_10820 278572 278820 gene locus_tag LOCUS_10830 278572 278820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 279417 278836 gene locus_tag LOCUS_10840 279417 278836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 280107 279703 gene locus_tag LOCUS_10850 280107 279703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence04 720 118 gene locus_tag LOCUS_10860 720 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 2117 702 gene locus_tag LOCUS_10870 2117 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3070 2114 gene locus_tag LOCUS_10880 3070 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727530.1 protein_id gnl|my_center|LOCUS_10880 4298 3141 gene locus_tag LOCUS_10890 gene nifS 4298 3141 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958022.1 protein_id gnl|my_center|LOCUS_10890 4589 5419 gene locus_tag LOCUS_10900 4589 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 5996 8140 gene locus_tag LOCUS_10910 5996 8140 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140315.1 protein_id gnl|my_center|LOCUS_10910 8158 8535 gene locus_tag LOCUS_10920 8158 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 8493 9035 gene locus_tag LOCUS_10930 8493 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 9580 10434 gene locus_tag LOCUS_10940 9580 10434 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945820.1 protein_id gnl|my_center|LOCUS_10940 10597 11211 gene locus_tag LOCUS_10950 10597 11211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 12410 11487 gene locus_tag LOCUS_10960 12410 11487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10960 13022 12429 gene locus_tag LOCUS_10970 13022 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10970 13751 13437 gene locus_tag LOCUS_10980 13751 13437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10980 14045 13752 gene locus_tag LOCUS_10990 14045 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10990 14417 14806 gene locus_tag LOCUS_11000 14417 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 14972 17137 gene locus_tag LOCUS_11010 14972 17137 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265515.1 protein_id gnl|my_center|LOCUS_11010 17380 17901 gene locus_tag LOCUS_11020 17380 17901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 18199 18414 gene locus_tag LOCUS_11030 18199 18414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 18592 19083 gene locus_tag LOCUS_11040 18592 19083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11040 19132 19488 gene locus_tag LOCUS_11050 19132 19488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 19519 19803 gene locus_tag LOCUS_11060 19519 19803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 19824 20690 gene locus_tag LOCUS_11070 19824 20690 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970408.1 protein_id gnl|my_center|LOCUS_11070 20935 21210 gene locus_tag LOCUS_11080 20935 21210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 21845 21636 gene locus_tag LOCUS_11090 21845 21636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 21729 22277 gene locus_tag LOCUS_11100 21729 22277 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63L28 protein_id gnl|my_center|LOCUS_11100 22274 23140 gene locus_tag LOCUS_11110 22274 23140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 23137 23742 gene locus_tag LOCUS_11120 23137 23742 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081527.1 protein_id gnl|my_center|LOCUS_11120 24971 23757 gene locus_tag LOCUS_11130 24971 23757 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707734.1 protein_id gnl|my_center|LOCUS_11130 25797 25099 gene locus_tag LOCUS_11140 gene trmB 25797 25099 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS4 protein_id gnl|my_center|LOCUS_11140 26581 25817 gene locus_tag LOCUS_11150 26581 25817 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE5 protein_id gnl|my_center|LOCUS_11150 27426 26731 gene locus_tag LOCUS_11160 gene ctrA 27426 26731 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314973.1 protein_id gnl|my_center|LOCUS_11160 29189 27603 gene locus_tag LOCUS_11170 gene rpoN2 29189 27603 CDS product RNA polymerase sigma-54 factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30333 protein_id gnl|my_center|LOCUS_11170 30036 29215 gene locus_tag LOCUS_11180 30036 29215 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387772.1 protein_id gnl|my_center|LOCUS_11180 30250 31596 gene locus_tag LOCUS_11190 30250 31596 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090251.1 protein_id gnl|my_center|LOCUS_11190 31593 32990 gene locus_tag LOCUS_11200 31593 32990 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119920.1 protein_id gnl|my_center|LOCUS_11200 33527 32994 gene locus_tag LOCUS_11210 gene ppa 33527 32994 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKZ2 protein_id gnl|my_center|LOCUS_11210 33634 34869 gene locus_tag LOCUS_11220 gene hisS 33634 34869 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 protein_id gnl|my_center|LOCUS_11220 35005 36072 gene locus_tag LOCUS_11230 gene prfA 35005 36072 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5V3 protein_id gnl|my_center|LOCUS_11230 36072 36908 gene locus_tag LOCUS_11240 gene prmC 36072 36908 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6X6 protein_id gnl|my_center|LOCUS_11240 37163 37900 gene locus_tag LOCUS_11250 37163 37900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 37951 39555 gene locus_tag LOCUS_11260 gene lnt 37951 39555 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WA1 protein_id gnl|my_center|LOCUS_11260 39912 42263 gene locus_tag LOCUS_11270 39912 42263 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021816.1 protein_id gnl|my_center|LOCUS_11270 43382 42279 gene locus_tag LOCUS_11280 43382 42279 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193577.1 protein_id gnl|my_center|LOCUS_11280 44664 43453 gene locus_tag LOCUS_11290 44664 43453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 47714 44874 gene locus_tag LOCUS_11300 47714 44874 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921293.1 protein_id gnl|my_center|LOCUS_11300 48168 48410 gene locus_tag LOCUS_11310 48168 48410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 49493 48426 gene locus_tag LOCUS_11320 49493 48426 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P426 protein_id gnl|my_center|LOCUS_11320 51367 49691 gene locus_tag LOCUS_11330 gene groL1 51367 49691 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY28 protein_id gnl|my_center|LOCUS_11330 51710 51423 gene locus_tag LOCUS_11340 gene groES 51710 51423 CDS product co-chaperonin GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001326101.1 protein_id gnl|my_center|LOCUS_11340 51969 52532 gene locus_tag LOCUS_11350 51969 52532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 53024 52641 gene locus_tag LOCUS_11360 gene rplL 53024 52641 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAX1 protein_id gnl|my_center|LOCUS_11360 53639 53124 gene locus_tag LOCUS_11370 gene rplJ 53639 53124 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV1 protein_id gnl|my_center|LOCUS_11370 54248 58423 gene locus_tag LOCUS_11380 gene rpoB 54248 58423 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE08 protein_id gnl|my_center|LOCUS_11380 58502 62794 gene locus_tag LOCUS_11390 gene rpoC 58502 62794 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5S9 protein_id gnl|my_center|LOCUS_11390 62911 64566 gene locus_tag LOCUS_11400 62911 64566 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531895.1 protein_id gnl|my_center|LOCUS_11400 64697 65152 gene locus_tag LOCUS_11410 64697 65152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 68793 65149 gene locus_tag LOCUS_11420 68793 65149 CDS product N-methylhydantoinase HyuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265799.1 protein_id gnl|my_center|LOCUS_11420 69118 69804 gene locus_tag LOCUS_11430 69118 69804 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919166.1 protein_id gnl|my_center|LOCUS_11430 70544 69834 gene locus_tag LOCUS_11440 gene fnrL 70544 69834 CDS product transcriptional activator protein FnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51007 protein_id gnl|my_center|LOCUS_11440 70617 71108 gene locus_tag LOCUS_11450 70617 71108 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339211.1 protein_id gnl|my_center|LOCUS_11450 71128 71682 gene locus_tag LOCUS_11460 71128 71682 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975277.1 protein_id gnl|my_center|LOCUS_11460 71723 72067 gene locus_tag LOCUS_11470 gene arsC 71723 72067 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896825.1 protein_id gnl|my_center|LOCUS_11470 72228 72863 gene locus_tag LOCUS_11480 72228 72863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404639.1 protein_id gnl|my_center|LOCUS_11480 73709 72891 gene locus_tag LOCUS_11490 73709 72891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 73839 74561 gene locus_tag LOCUS_11500 gene lipB 73839 74561 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSU9 protein_id gnl|my_center|LOCUS_11500 74579 74944 gene locus_tag LOCUS_11510 74579 74944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 76233 74950 gene locus_tag LOCUS_11520 gene murA 76233 74950 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J077 protein_id gnl|my_center|LOCUS_11520 76316 77203 gene locus_tag LOCUS_11530 76316 77203 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TEU3 protein_id gnl|my_center|LOCUS_11530 77985 77269 gene locus_tag LOCUS_11540 77985 77269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 78917 78099 gene locus_tag LOCUS_11550 78917 78099 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975631.1 protein_id gnl|my_center|LOCUS_11550 79387 78914 gene locus_tag LOCUS_11560 79387 78914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 82124 79380 gene locus_tag LOCUS_11570 gene glnE 82124 79380 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ7 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11570 82281 83954 gene locus_tag LOCUS_11580 82281 83954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_11580 83965 84951 gene locus_tag LOCUS_11590 83965 84951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639908.1 protein_id gnl|my_center|LOCUS_11590 85826 85155 gene locus_tag LOCUS_11600 85826 85155 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_11600 87832 85823 gene locus_tag LOCUS_11610 gene thrS 87832 85823 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_11610 87889 88677 gene locus_tag LOCUS_11620 87889 88677 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_11620 88674 89435 gene locus_tag LOCUS_11630 88674 89435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 89432 90415 gene locus_tag LOCUS_11640 89432 90415 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 protein_id gnl|my_center|LOCUS_11640 90600 95255 gene locus_tag LOCUS_11650 90600 95255 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028707.1 protein_id gnl|my_center|LOCUS_11650 95324 96550 gene locus_tag LOCUS_11660 95324 96550 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887566.1 protein_id gnl|my_center|LOCUS_11660 97620 96547 gene locus_tag LOCUS_11670 gene queG 97620 96547 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYQ7 protein_id gnl|my_center|LOCUS_11670 97665 98693 gene locus_tag LOCUS_11680 97665 98693 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_11680 98690 99928 gene locus_tag LOCUS_11690 98690 99928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 99947 100489 gene locus_tag LOCUS_11700 99947 100489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 101141 100497 gene locus_tag LOCUS_11710 101141 100497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 101377 101928 gene locus_tag LOCUS_11720 101377 101928 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU1 protein_id gnl|my_center|LOCUS_11720 102029 101945 gene locus_tag LOCUS_t00190 102029 101945 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 102542 102117 gene locus_tag LOCUS_11730 102542 102117 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 protein_id gnl|my_center|LOCUS_11730 103012 102539 gene locus_tag LOCUS_11740 103012 102539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 103442 103161 gene locus_tag LOCUS_11750 gene ihfB 103442 103161 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCQ1 protein_id gnl|my_center|LOCUS_11750 103754 105400 gene locus_tag LOCUS_11760 gene yhiP 103754 105400 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 protein_id gnl|my_center|LOCUS_11760 105674 105988 gene locus_tag LOCUS_11770 105674 105988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 106807 106001 gene locus_tag LOCUS_11780 106807 106001 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707968.1 protein_id gnl|my_center|LOCUS_11780 108738 106804 gene locus_tag LOCUS_11790 gene dxs 108738 106804 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T825 protein_id gnl|my_center|LOCUS_11790 109282 108758 gene locus_tag LOCUS_11800 109282 108758 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529546.1 protein_id gnl|my_center|LOCUS_11800 109959 109279 gene locus_tag LOCUS_11810 gene msrA 109959 109279 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGQ7 protein_id gnl|my_center|LOCUS_11810 111781 110183 gene locus_tag LOCUS_11820 gene purH 111781 110183 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU8 protein_id gnl|my_center|LOCUS_11820 113703 111778 gene locus_tag LOCUS_11830 113703 111778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338717.1 protein_id gnl|my_center|LOCUS_11830 114379 113696 gene locus_tag LOCUS_11840 114379 113696 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW9 protein_id gnl|my_center|LOCUS_11840 114569 115081 gene locus_tag LOCUS_11850 114569 115081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 115894 115103 gene locus_tag LOCUS_11860 115894 115103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640161.1 protein_id gnl|my_center|LOCUS_11860 116820 115891 gene locus_tag LOCUS_11870 116820 115891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640162.1 protein_id gnl|my_center|LOCUS_11870 117860 116817 gene locus_tag LOCUS_11880 117860 116817 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919044.1 protein_id gnl|my_center|LOCUS_11880 119234 118011 gene locus_tag LOCUS_11890 119234 118011 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812238.1 protein_id gnl|my_center|LOCUS_11890 122482 119291 gene locus_tag LOCUS_11900 122482 119291 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 protein_id gnl|my_center|LOCUS_11900 123670 122492 gene locus_tag LOCUS_11910 123670 122492 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921032.1 protein_id gnl|my_center|LOCUS_11910 124142 123876 gene locus_tag LOCUS_11920 124142 123876 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015510.1 protein_id gnl|my_center|LOCUS_11920 124622 124323 gene locus_tag LOCUS_11930 124622 124323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 protein_id gnl|my_center|LOCUS_11930 124947 124615 gene locus_tag LOCUS_11940 124947 124615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 125073 126266 gene locus_tag LOCUS_11950 gene mnmA 125073 126266 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J358 protein_id gnl|my_center|LOCUS_11950 126569 126282 gene locus_tag LOCUS_11960 126569 126282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 126738 127811 gene locus_tag LOCUS_11970 126738 127811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 128632 127832 gene locus_tag LOCUS_11980 128632 127832 CDS product phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388858.1 protein_id gnl|my_center|LOCUS_11980 129552 128629 gene locus_tag LOCUS_11990 129552 128629 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093118.1 protein_id gnl|my_center|LOCUS_11990 130163 129549 gene locus_tag LOCUS_12000 gene pdxH 130163 129549 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR21 protein_id gnl|my_center|LOCUS_12000 130277 131233 gene locus_tag LOCUS_12010 130277 131233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 131241 132293 gene locus_tag LOCUS_12020 131241 132293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973169.1 protein_id gnl|my_center|LOCUS_12020 132293 133096 gene locus_tag LOCUS_12030 gene fabI1 132293 133096 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3Y4 protein_id gnl|my_center|LOCUS_12030 133160 133558 gene locus_tag LOCUS_12040 133160 133558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205213.1 protein_id gnl|my_center|LOCUS_12040 134881 133574 gene locus_tag LOCUS_12050 gene wecC 134881 133574 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482531.1 protein_id gnl|my_center|LOCUS_12050 135552 134983 gene locus_tag LOCUS_12060 135552 134983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 136194 135652 gene locus_tag LOCUS_12070 gene coq7 136194 135652 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNK3 protein_id gnl|my_center|LOCUS_12070 136663 136181 gene locus_tag LOCUS_12080 136663 136181 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 protein_id gnl|my_center|LOCUS_12080 138004 136670 gene locus_tag LOCUS_12090 138004 136670 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_12090 139401 138100 gene locus_tag LOCUS_12100 139401 138100 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529075.1 protein_id gnl|my_center|LOCUS_12100 139823 139401 gene locus_tag LOCUS_12110 gene rlmH 139823 139401 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X82 protein_id gnl|my_center|LOCUS_12110 140380 139934 gene locus_tag LOCUS_12120 140380 139934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 141085 140390 gene locus_tag LOCUS_12130 gene nadD 141085 140390 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X84 protein_id gnl|my_center|LOCUS_12130 142320 141103 gene locus_tag LOCUS_12140 gene proA 142320 141103 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV06 protein_id gnl|my_center|LOCUS_12140 142683 143840 gene locus_tag LOCUS_12150 142683 143840 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919738.1 protein_id gnl|my_center|LOCUS_12150 143785 144240 gene locus_tag LOCUS_12160 143785 144240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389620.1 protein_id gnl|my_center|LOCUS_12160 145963 144266 gene locus_tag LOCUS_12170 145963 144266 CDS product dicarboxylate--CoA ligase PimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 protein_id gnl|my_center|LOCUS_12170 146761 146063 gene locus_tag LOCUS_12180 146761 146063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_12180 148038 146920 gene locus_tag LOCUS_12190 148038 146920 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_12190 149002 148046 gene locus_tag LOCUS_12200 149002 148046 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388336.1 protein_id gnl|my_center|LOCUS_12200 150126 149125 gene locus_tag LOCUS_12210 150126 149125 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 protein_id gnl|my_center|LOCUS_12210 150221 150427 gene locus_tag LOCUS_12220 150221 150427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 150581 152956 gene locus_tag LOCUS_12230 150581 152956 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_12230 153056 153727 gene locus_tag LOCUS_12240 153056 153727 CDS product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267604.1 protein_id gnl|my_center|LOCUS_12240 154021 153740 gene locus_tag LOCUS_12250 154021 153740 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZQ5 protein_id gnl|my_center|LOCUS_12250 154597 154025 gene locus_tag LOCUS_12260 154597 154025 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035602.1 protein_id gnl|my_center|LOCUS_12260 155623 154616 gene locus_tag LOCUS_12270 155623 154616 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWR2 protein_id gnl|my_center|LOCUS_12270 157231 155690 gene locus_tag LOCUS_12280 157231 155690 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920870.1 protein_id gnl|my_center|LOCUS_12280 157497 160061 gene locus_tag LOCUS_12290 157497 160061 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383620.1 protein_id gnl|my_center|LOCUS_12290 160121 160423 gene locus_tag LOCUS_12300 160121 160423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 160439 160777 gene locus_tag LOCUS_12310 160439 160777 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529180.1 protein_id gnl|my_center|LOCUS_12310 161082 161615 gene locus_tag LOCUS_12320 161082 161615 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265581.1 protein_id gnl|my_center|LOCUS_12320 162628 161687 gene locus_tag LOCUS_12330 162628 161687 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 protein_id gnl|my_center|LOCUS_12330 162696 163523 gene locus_tag LOCUS_12340 162696 163523 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707935.1 protein_id gnl|my_center|LOCUS_12340 165011 163557 gene locus_tag LOCUS_12350 165011 163557 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766669.1 protein_id gnl|my_center|LOCUS_12350 165269 166129 gene locus_tag LOCUS_12360 165269 166129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 168962 166155 gene locus_tag LOCUS_12370 168962 166155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 169853 168996 gene locus_tag LOCUS_12380 169853 168996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 170576 170073 gene locus_tag LOCUS_12390 170576 170073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 171740 170739 gene locus_tag LOCUS_12400 171740 170739 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_12400 172513 171737 gene locus_tag LOCUS_12410 172513 171737 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_12410 173151 172510 gene locus_tag LOCUS_12420 gene rsmG 173151 172510 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYH5 protein_id gnl|my_center|LOCUS_12420 175010 173148 gene locus_tag LOCUS_12430 gene mnmG 175010 173148 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYH4 protein_id gnl|my_center|LOCUS_12430 176394 175120 gene locus_tag LOCUS_12440 gene mnmE 176394 175120 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEE9 protein_id gnl|my_center|LOCUS_12440 176702 176445 gene locus_tag LOCUS_12450 176702 176445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921584.1 protein_id gnl|my_center|LOCUS_12450 176826 177524 gene locus_tag LOCUS_12460 176826 177524 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_12460 177952 177560 gene locus_tag LOCUS_12470 177952 177560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 179297 178041 gene locus_tag LOCUS_12480 gene rho 179297 178041 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CG88 protein_id gnl|my_center|LOCUS_12480 179913 179470 gene locus_tag LOCUS_12490 179913 179470 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_12490 180934 179963 gene locus_tag LOCUS_12500 gene hemE 180934 179963 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGU9 protein_id gnl|my_center|LOCUS_12500 181323 182189 gene locus_tag LOCUS_12510 181323 182189 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C520 protein_id gnl|my_center|LOCUS_12510 182225 182770 gene locus_tag LOCUS_12520 182225 182770 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGU7 protein_id gnl|my_center|LOCUS_12520 182767 183648 gene locus_tag LOCUS_12530 gene aroE 182767 183648 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SZ3 protein_id gnl|my_center|LOCUS_12530 183645 184259 gene locus_tag LOCUS_12540 gene coaE 183645 184259 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGU5 protein_id gnl|my_center|LOCUS_12540 184325 185008 gene locus_tag LOCUS_12550 184325 185008 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_12550 185049 185609 gene locus_tag LOCUS_12560 gene PSrp1 185049 185609 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 protein_id gnl|my_center|LOCUS_12560 185763 186224 gene locus_tag LOCUS_12570 185763 186224 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921423.1 protein_id gnl|my_center|LOCUS_12570 186214 186687 gene locus_tag LOCUS_12580 186214 186687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 186694 187014 gene locus_tag LOCUS_12590 186694 187014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 protein_id gnl|my_center|LOCUS_12590 187236 187937 gene locus_tag LOCUS_12600 187236 187937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 188744 187971 gene locus_tag LOCUS_12610 188744 187971 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974311.1 protein_id gnl|my_center|LOCUS_12610 189139 188807 gene locus_tag LOCUS_12620 189139 188807 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919875.1 protein_id gnl|my_center|LOCUS_12620 189669 189238 gene locus_tag LOCUS_12630 189669 189238 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_12630 189858 190118 gene locus_tag LOCUS_12640 189858 190118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 190548 190135 gene locus_tag LOCUS_12650 190548 190135 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771057.1 protein_id gnl|my_center|LOCUS_12650 191049 190567 gene locus_tag LOCUS_12660 gene popZ 191049 190567 CDS product pole-organizing protein PopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919196.1 protein_id gnl|my_center|LOCUS_12660 192579 191116 gene locus_tag LOCUS_12670 gene rsaFb 192579 191116 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 protein_id gnl|my_center|LOCUS_12670 193187 192582 gene locus_tag LOCUS_12680 gene pcm 193187 192582 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971822.1 protein_id gnl|my_center|LOCUS_12680 193350 194876 gene locus_tag LOCUS_12690 193350 194876 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8F0 protein_id gnl|my_center|LOCUS_12690 194953 195219 gene locus_tag LOCUS_12700 194953 195219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 195288 196100 gene locus_tag LOCUS_12710 195288 196100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 196093 196950 gene locus_tag LOCUS_12720 196093 196950 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921385.1 protein_id gnl|my_center|LOCUS_12720 197543 197019 gene locus_tag LOCUS_12730 gene rpsI 197543 197019 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1Z5 protein_id gnl|my_center|LOCUS_12730 198022 197543 gene locus_tag LOCUS_12740 gene rplM 198022 197543 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGF3 protein_id gnl|my_center|LOCUS_12740 198951 198181 gene locus_tag LOCUS_12750 198951 198181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 200050 198992 gene locus_tag LOCUS_12760 gene ctaA 200050 198992 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KD9 protein_id gnl|my_center|LOCUS_12760 200156 200524 gene locus_tag LOCUS_12770 200156 200524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 200544 201539 gene locus_tag LOCUS_12780 gene thiG 200544 201539 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL3 protein_id gnl|my_center|LOCUS_12780 201616 202143 gene locus_tag LOCUS_12790 201616 202143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 203636 202185 gene locus_tag LOCUS_12800 203636 202185 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7A4 protein_id gnl|my_center|LOCUS_12800 203712 204023 gene locus_tag LOCUS_12810 203712 204023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919372.1 protein_id gnl|my_center|LOCUS_12810 204108 204350 gene locus_tag LOCUS_12820 204108 204350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 204383 204742 gene locus_tag LOCUS_12830 204383 204742 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLD9 protein_id gnl|my_center|LOCUS_12830 204842 205597 gene locus_tag LOCUS_12840 204842 205597 CDS product putative transcriptional regulatory protein R02753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M88 protein_id gnl|my_center|LOCUS_12840 205615 206085 gene locus_tag LOCUS_12850 gene ruvC 205615 206085 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3G6 protein_id gnl|my_center|LOCUS_12850 206101 206457 gene locus_tag LOCUS_12860 206101 206457 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968490.1 protein_id gnl|my_center|LOCUS_12860 206556 208940 gene locus_tag LOCUS_12870 206556 208940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 208937 209377 gene locus_tag LOCUS_12880 208937 209377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 209504 209812 gene locus_tag LOCUS_12890 209504 209812 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918483.1 protein_id gnl|my_center|LOCUS_12890 209908 210927 gene locus_tag LOCUS_12900 gene cheBII 209908 210927 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C477 protein_id gnl|my_center|LOCUS_12900 210924 211790 gene locus_tag LOCUS_12910 gene cheR1 210924 211790 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XC4 protein_id gnl|my_center|LOCUS_12910 211912 213441 gene locus_tag LOCUS_12920 211912 213441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 213466 215151 gene locus_tag LOCUS_12930 213466 215151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 215888 215154 gene locus_tag LOCUS_12940 gene ubiG 215888 215154 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MK1 protein_id gnl|my_center|LOCUS_12940 215982 217226 gene locus_tag LOCUS_12950 215982 217226 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE8 protein_id gnl|my_center|LOCUS_12950 218472 217309 gene locus_tag LOCUS_12960 218472 217309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 220903 218747 gene locus_tag LOCUS_12970 gene katG 220903 218747 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 protein_id gnl|my_center|LOCUS_12970 221234 222244 gene locus_tag LOCUS_12980 221234 222244 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_12980 222332 223258 gene locus_tag LOCUS_12990 222332 223258 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123106.1 protein_id gnl|my_center|LOCUS_12990 223363 224367 gene locus_tag LOCUS_13000 223363 224367 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531115.1 protein_id gnl|my_center|LOCUS_13000 224364 224813 gene locus_tag LOCUS_13010 224364 224813 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709362.1 protein_id gnl|my_center|LOCUS_13010 225791 224826 gene locus_tag LOCUS_13020 225791 224826 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_13020 225987 226073 gene locus_tag LOCUS_t00200 225987 226073 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 226251 227459 gene locus_tag LOCUS_13030 226251 227459 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_13030 231530 227478 gene locus_tag LOCUS_13040 231530 227478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038249.1 protein_id gnl|my_center|LOCUS_13040 231820 232893 gene locus_tag LOCUS_13050 231820 232893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 233342 233118 gene locus_tag LOCUS_13060 233342 233118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 233639 234406 gene locus_tag LOCUS_13070 233639 234406 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 protein_id gnl|my_center|LOCUS_13070 234820 234437 gene locus_tag LOCUS_13080 234820 234437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 235005 234817 gene locus_tag LOCUS_13090 235005 234817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 235858 238680 gene locus_tag LOCUS_13100 235858 238680 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387995.1 protein_id gnl|my_center|LOCUS_13100 238677 239027 gene locus_tag LOCUS_13110 238677 239027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 239891 239085 gene locus_tag LOCUS_13120 gene istB 239891 239085 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 protein_id gnl|my_center|LOCUS_13120 241428 239881 gene locus_tag LOCUS_13130 gene istA 241428 239881 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324342.1 protein_id gnl|my_center|LOCUS_13130 241470 243374 gene locus_tag LOCUS_13140 241470 243374 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBQ0 protein_id gnl|my_center|LOCUS_13140 244306 243431 gene locus_tag LOCUS_13150 244306 243431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55426 protein_id gnl|my_center|LOCUS_13150 247275 244528 gene locus_tag LOCUS_13160 gene trwC 247275 244528 CDS product conjugative relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_13160 249095 247275 gene locus_tag LOCUS_13170 gene trwB 249095 247275 CDS product conjugation protein, ATP-binding domain trwB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639976.1 protein_id gnl|my_center|LOCUS_13170 249463 249092 gene locus_tag LOCUS_13180 249463 249092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639977.1 protein_id gnl|my_center|LOCUS_13180 250183 249668 gene locus_tag LOCUS_13190 250183 249668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 250417 250226 gene locus_tag LOCUS_13200 250417 250226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 250765 251358 gene locus_tag LOCUS_13210 250765 251358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 251906 251355 gene locus_tag LOCUS_13220 251906 251355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 252303 252040 gene locus_tag LOCUS_13230 252303 252040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970755.1 protein_id gnl|my_center|LOCUS_13230 253239 252505 gene locus_tag LOCUS_13240 253239 252505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 253969 254958 gene locus_tag LOCUS_13250 253969 254958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence05 1430 372 gene locus_tag LOCUS_13260 gene vanA 1430 372 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085177.1 protein_id gnl|my_center|LOCUS_13260 3883 1442 gene locus_tag LOCUS_13270 3883 1442 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920256.1 protein_id gnl|my_center|LOCUS_13270 4673 3999 gene locus_tag LOCUS_13280 4673 3999 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140311.1 protein_id gnl|my_center|LOCUS_13280 5059 4880 gene locus_tag LOCUS_13290 5059 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 4986 5423 gene locus_tag LOCUS_13300 4986 5423 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228154.1 protein_id gnl|my_center|LOCUS_13300 5433 6596 gene locus_tag LOCUS_13310 5433 6596 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_13310 6593 7480 gene locus_tag LOCUS_13320 gene atuB 6593 7480 CDS product citronellol catabolism dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_13320 7517 8329 gene locus_tag LOCUS_13330 7517 8329 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_13330 8372 9142 gene locus_tag LOCUS_13340 8372 9142 CDS product 2-hydroxycyclohexane-1-carbonyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_13340 9167 10819 gene locus_tag LOCUS_13350 9167 10819 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_13350 10913 11509 gene locus_tag LOCUS_13360 gene norE 10913 11509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_13360 11514 11795 gene locus_tag LOCUS_13370 11514 11795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 11828 12541 gene locus_tag LOCUS_13380 11828 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228943.1 protein_id gnl|my_center|LOCUS_13380 13720 12554 gene locus_tag LOCUS_13390 13720 12554 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701280.1 protein_id gnl|my_center|LOCUS_13390 14202 13762 gene locus_tag LOCUS_13400 14202 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 14728 15906 gene locus_tag LOCUS_13410 14728 15906 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879449.1 protein_id gnl|my_center|LOCUS_13410 15930 17270 gene locus_tag LOCUS_13420 15930 17270 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_13420 18019 17303 gene locus_tag LOCUS_13430 18019 17303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 18926 18144 gene locus_tag LOCUS_13440 18926 18144 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072376.1 protein_id gnl|my_center|LOCUS_13440 19327 20865 gene locus_tag LOCUS_13450 19327 20865 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730684.1 protein_id gnl|my_center|LOCUS_13450 21303 23654 gene locus_tag LOCUS_13460 21303 23654 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 protein_id gnl|my_center|LOCUS_13460 24054 23914 gene locus_tag LOCUS_13470 24054 23914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 25181 24177 gene locus_tag LOCUS_13480 25181 24177 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088811.1 protein_id gnl|my_center|LOCUS_13480 26039 25194 gene locus_tag LOCUS_13490 26039 25194 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072532.1 protein_id gnl|my_center|LOCUS_13490 27812 26076 gene locus_tag LOCUS_13500 gene mmgC 27812 26076 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085442.1 protein_id gnl|my_center|LOCUS_13500 27989 29626 gene locus_tag LOCUS_13510 27989 29626 CDS product steroid monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228901.1 protein_id gnl|my_center|LOCUS_13510 30593 29763 gene locus_tag LOCUS_13520 30593 29763 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815215.1 protein_id gnl|my_center|LOCUS_13520 30826 32187 gene locus_tag LOCUS_13530 30826 32187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 32238 33260 gene locus_tag LOCUS_13540 32238 33260 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920584.1 protein_id gnl|my_center|LOCUS_13540 33689 34561 gene locus_tag LOCUS_13550 33689 34561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 35484 34693 gene locus_tag LOCUS_13560 35484 34693 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224990.1 protein_id gnl|my_center|LOCUS_13560 37075 35537 gene locus_tag LOCUS_13570 37075 35537 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_13570 38274 37132 gene locus_tag LOCUS_13580 38274 37132 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036619.1 protein_id gnl|my_center|LOCUS_13580 39104 38430 gene locus_tag LOCUS_13590 39104 38430 CDS product putative transcriptional regulator TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701351.1 protein_id gnl|my_center|LOCUS_13590 40224 39160 gene locus_tag LOCUS_13600 40224 39160 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730665.1 protein_id gnl|my_center|LOCUS_13600 40404 41666 gene locus_tag LOCUS_13610 40404 41666 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224092.1 protein_id gnl|my_center|LOCUS_13610 41719 42828 gene locus_tag LOCUS_13620 41719 42828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705206.1 protein_id gnl|my_center|LOCUS_13620 42825 43853 gene locus_tag LOCUS_13630 42825 43853 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_13630 43850 44338 gene locus_tag LOCUS_13640 43850 44338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 44335 45771 gene locus_tag LOCUS_13650 44335 45771 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_13650 45810 46691 gene locus_tag LOCUS_13660 45810 46691 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 protein_id gnl|my_center|LOCUS_13660 46693 48321 gene locus_tag LOCUS_13670 46693 48321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228942.1 protein_id gnl|my_center|LOCUS_13670 48357 49895 gene locus_tag LOCUS_13680 48357 49895 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266601.1 protein_id gnl|my_center|LOCUS_13680 50012 50671 gene locus_tag LOCUS_13690 50012 50671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 51468 50692 gene locus_tag LOCUS_13700 51468 50692 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088800.1 protein_id gnl|my_center|LOCUS_13700 52406 51471 gene locus_tag LOCUS_13710 52406 51471 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 protein_id gnl|my_center|LOCUS_13710 52690 52403 gene locus_tag LOCUS_13720 52690 52403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 52638 54191 gene locus_tag LOCUS_13730 52638 54191 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807889.1 protein_id gnl|my_center|LOCUS_13730 55184 54261 gene locus_tag LOCUS_13740 55184 54261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 55361 56128 gene locus_tag LOCUS_13750 gene ostB 55361 56128 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P690 protein_id gnl|my_center|LOCUS_13750 56125 57930 gene locus_tag LOCUS_13760 56125 57930 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_13760 57957 59315 gene locus_tag LOCUS_13770 57957 59315 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390238.1 protein_id gnl|my_center|LOCUS_13770 59393 60172 gene locus_tag LOCUS_13780 59393 60172 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920792.1 protein_id gnl|my_center|LOCUS_13780 61081 60206 gene locus_tag LOCUS_13790 61081 60206 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_13790 61179 62183 gene locus_tag LOCUS_13800 61179 62183 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQA0 protein_id gnl|my_center|LOCUS_13800 62628 62194 gene locus_tag LOCUS_13810 62628 62194 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640617.1 protein_id gnl|my_center|LOCUS_13810 62818 64029 gene locus_tag LOCUS_13820 gene lys1 62818 64029 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_13820 64029 65210 gene locus_tag LOCUS_13830 gene nspC 64029 65210 CDS product carboxynorspermidine/carboxyspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A53 protein_id gnl|my_center|LOCUS_13830 65367 66575 gene locus_tag LOCUS_13840 65367 66575 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_13840 68813 66609 gene locus_tag LOCUS_13850 68813 66609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 70158 68938 gene locus_tag LOCUS_13860 70158 68938 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKP5 protein_id gnl|my_center|LOCUS_13860 71114 70311 gene locus_tag LOCUS_13870 gene murI 71114 70311 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y5G3 protein_id gnl|my_center|LOCUS_13870 71252 71833 gene locus_tag LOCUS_13880 gene plsY 71252 71833 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF8 protein_id gnl|my_center|LOCUS_13880 71830 72927 gene locus_tag LOCUS_13890 71830 72927 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_13890 72999 73703 gene locus_tag LOCUS_13900 72999 73703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 73791 76340 gene locus_tag LOCUS_13910 gene topA 73791 76340 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J6 protein_id gnl|my_center|LOCUS_13910 76440 77840 gene locus_tag LOCUS_13920 76440 77840 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204937.1 protein_id gnl|my_center|LOCUS_13920 78632 77850 gene locus_tag LOCUS_13930 78632 77850 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337887.1 protein_id gnl|my_center|LOCUS_13930 79663 78746 gene locus_tag LOCUS_13940 gene era 79663 78746 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT94 protein_id gnl|my_center|LOCUS_13940 80358 79660 gene locus_tag LOCUS_13950 gene rnc 80358 79660 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A805 protein_id gnl|my_center|LOCUS_13950 81215 80355 gene locus_tag LOCUS_13960 gene lepB 81215 80355 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R48 protein_id gnl|my_center|LOCUS_13960 81265 82875 gene locus_tag LOCUS_13970 gene pgi 81265 82875 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V31 protein_id gnl|my_center|LOCUS_13970 82872 84218 gene locus_tag LOCUS_13980 82872 84218 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388440.1 protein_id gnl|my_center|LOCUS_13980 85647 84238 gene locus_tag LOCUS_13990 gene pccR 85647 84238 CDS product propionyl-CoA carboxylase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4E6 protein_id gnl|my_center|LOCUS_13990 85763 87295 gene locus_tag LOCUS_14000 gene pccB 85763 87295 CDS product propionyl-CoA carboxylase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4E3 protein_id gnl|my_center|LOCUS_14000 87314 88495 gene locus_tag LOCUS_14010 87314 88495 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064006.1 protein_id gnl|my_center|LOCUS_14010 88492 88941 gene locus_tag LOCUS_14020 88492 88941 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 protein_id gnl|my_center|LOCUS_14020 88945 91095 gene locus_tag LOCUS_14030 gene bhbA 88945 91095 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888158.1 protein_id gnl|my_center|LOCUS_14030 91095 92144 gene locus_tag LOCUS_14040 gene bioB 91095 92144 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSZ4 protein_id gnl|my_center|LOCUS_14040 92144 92539 gene locus_tag LOCUS_14050 92144 92539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42879 protein_id gnl|my_center|LOCUS_14050 92548 94557 gene locus_tag LOCUS_14060 gene pccA 92548 94557 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973161.1 protein_id gnl|my_center|LOCUS_14060 95678 94572 gene locus_tag LOCUS_14070 gene aroB 95678 94572 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H332 protein_id gnl|my_center|LOCUS_14070 96238 95669 gene locus_tag LOCUS_14080 gene aroK 96238 95669 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A435 protein_id gnl|my_center|LOCUS_14080 96311 96496 gene locus_tag LOCUS_14090 96311 96496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 96527 98389 gene locus_tag LOCUS_14100 96527 98389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 98412 99311 gene locus_tag LOCUS_14110 gene xerD 98412 99311 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9G0 protein_id gnl|my_center|LOCUS_14110 99321 100268 gene locus_tag LOCUS_14120 gene accA 99321 100268 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92ME2 protein_id gnl|my_center|LOCUS_14120 100394 101884 gene locus_tag LOCUS_14130 100394 101884 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970525.1 protein_id gnl|my_center|LOCUS_14130 102148 101975 gene locus_tag LOCUS_14140 gene pilA1 102148 101975 CDS product PilA pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709934.1 protein_id gnl|my_center|LOCUS_14140 102433 102245 gene locus_tag LOCUS_14150 102433 102245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 102583 102957 gene locus_tag LOCUS_14160 gene mutT 102583 102957 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385432.1 protein_id gnl|my_center|LOCUS_14160 103018 103094 gene locus_tag LOCUS_t00210 103018 103094 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 103257 103568 gene locus_tag LOCUS_14170 103257 103568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 103757 104854 gene locus_tag LOCUS_14180 gene pdhA 103757 104854 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8U6 protein_id gnl|my_center|LOCUS_14180 104854 106224 gene locus_tag LOCUS_14190 gene pdhAb 104854 106224 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337522.1 protein_id gnl|my_center|LOCUS_14190 107141 106239 gene locus_tag LOCUS_14200 107141 106239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 107776 107159 gene locus_tag LOCUS_14210 107776 107159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 109641 107776 gene locus_tag LOCUS_14220 109641 107776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 110267 109824 gene locus_tag LOCUS_14230 110267 109824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 110716 110264 gene locus_tag LOCUS_14240 110716 110264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 112305 110713 gene locus_tag LOCUS_14250 112305 110713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 112414 113145 gene locus_tag LOCUS_14260 112414 113145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 113171 113635 gene locus_tag LOCUS_14270 113171 113635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 115002 113650 gene locus_tag LOCUS_14280 gene trmFO 115002 113650 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L21 protein_id gnl|my_center|LOCUS_14280 115048 115704 gene locus_tag LOCUS_14290 115048 115704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 118504 115715 gene locus_tag LOCUS_14300 gene gyrA 118504 115715 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK1 protein_id gnl|my_center|LOCUS_14300 118820 120133 gene locus_tag LOCUS_14310 118820 120133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 120980 120246 gene locus_tag LOCUS_14320 120980 120246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 121641 120991 gene locus_tag LOCUS_14330 121641 120991 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEC9 protein_id gnl|my_center|LOCUS_14330 121706 122650 gene locus_tag LOCUS_14340 gene lipA2 121706 122650 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBK9 protein_id gnl|my_center|LOCUS_14340 122650 123111 gene locus_tag LOCUS_14350 122650 123111 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_14350 123569 123072 gene locus_tag LOCUS_14360 gene cinA 123569 123072 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971625.1 protein_id gnl|my_center|LOCUS_14360 124753 123659 gene locus_tag LOCUS_14370 gene ispDF 124753 123659 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW85 protein_id gnl|my_center|LOCUS_14370 124912 125928 gene locus_tag LOCUS_14380 gene dus 124912 125928 CDS product putative tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED2 protein_id gnl|my_center|LOCUS_14380 125910 126977 gene locus_tag LOCUS_14390 gene ntrB 125910 126977 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315358.1 protein_id gnl|my_center|LOCUS_14390 127006 128424 gene locus_tag LOCUS_14400 127006 128424 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531494.1 protein_id gnl|my_center|LOCUS_14400 128569 130797 gene locus_tag LOCUS_14410 128569 130797 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_14410 130831 132225 gene locus_tag LOCUS_14420 gene ntrX 130831 132225 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087262.1 protein_id gnl|my_center|LOCUS_14420 132400 132981 gene locus_tag LOCUS_14430 132400 132981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 133032 134306 gene locus_tag LOCUS_14440 gene hflx 133032 134306 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LQ1 protein_id gnl|my_center|LOCUS_14440 135064 134303 gene locus_tag LOCUS_14450 gene mazG 135064 134303 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384177.1 protein_id gnl|my_center|LOCUS_14450 135300 135127 gene locus_tag LOCUS_14460 135300 135127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 136086 135316 gene locus_tag LOCUS_14470 136086 135316 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 protein_id gnl|my_center|LOCUS_14470 136859 136083 gene locus_tag LOCUS_14480 136859 136083 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_14480 138406 136859 gene locus_tag LOCUS_14490 gene metG 138406 136859 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LM7 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14490 139405 138452 gene locus_tag LOCUS_14500 139405 138452 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919689.1 protein_id gnl|my_center|LOCUS_14500 140049 139405 gene locus_tag LOCUS_14510 gene tmk 140049 139405 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD54 protein_id gnl|my_center|LOCUS_14510 141272 140046 gene locus_tag LOCUS_14520 gene dac 141272 140046 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087290.1 protein_id gnl|my_center|LOCUS_14520 142299 141310 gene locus_tag LOCUS_14530 142299 141310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 143464 142376 gene locus_tag LOCUS_14540 143464 142376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 144602 143532 gene locus_tag LOCUS_14550 144602 143532 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904740.1 protein_id gnl|my_center|LOCUS_14550 145941 144718 gene locus_tag LOCUS_14560 145941 144718 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228930.1 protein_id gnl|my_center|LOCUS_14560 146143 146346 gene locus_tag LOCUS_14570 146143 146346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 146699 146412 gene locus_tag LOCUS_14580 146699 146412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 147715 147197 gene locus_tag LOCUS_14590 147715 147197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 148314 148075 gene locus_tag LOCUS_14600 148314 148075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 148621 148307 gene locus_tag LOCUS_14610 148621 148307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 149133 148618 gene locus_tag LOCUS_14620 149133 148618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 149324 149130 gene locus_tag LOCUS_14630 149324 149130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 149976 149443 gene locus_tag LOCUS_14640 149976 149443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 151169 149994 gene locus_tag LOCUS_14650 gene int 151169 149994 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 protein_id gnl|my_center|LOCUS_14650 151401 151312 gene locus_tag LOCUS_t00220 151401 151312 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 152899 151484 gene locus_tag LOCUS_14660 152899 151484 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J255 protein_id gnl|my_center|LOCUS_14660 153300 152902 gene locus_tag LOCUS_14670 153300 152902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 153632 153309 gene locus_tag LOCUS_14680 153632 153309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence06 1469 2788 gene locus_tag LOCUS_14690 1469 2788 CDS product teichoic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919050.1 protein_id gnl|my_center|LOCUS_14690 3614 2706 gene locus_tag LOCUS_14700 3614 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4217 3678 gene locus_tag LOCUS_14710 4217 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 4439 4278 gene locus_tag LOCUS_14720 4439 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4401 4847 gene locus_tag LOCUS_14730 4401 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4844 5491 gene locus_tag LOCUS_14740 4844 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 5534 5812 gene locus_tag LOCUS_14750 5534 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 6262 8181 gene locus_tag LOCUS_14760 6262 8181 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_14760 8419 8343 gene locus_tag LOCUS_t00230 8419 8343 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8724 9128 gene locus_tag LOCUS_14770 8724 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 9168 9722 gene locus_tag LOCUS_14780 9168 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709890.1 protein_id gnl|my_center|LOCUS_14780 9822 11744 gene locus_tag LOCUS_14790 9822 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 11881 12159 gene locus_tag LOCUS_14800 11881 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 12181 12711 gene locus_tag LOCUS_14810 gene SigD 12181 12711 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087693.1 protein_id gnl|my_center|LOCUS_14810 12713 13363 gene locus_tag LOCUS_14820 12713 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 13753 13373 gene locus_tag LOCUS_14830 13753 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 14699 13935 gene locus_tag LOCUS_14840 14699 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 15705 14848 gene locus_tag LOCUS_14850 gene panC 15705 14848 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFK5 protein_id gnl|my_center|LOCUS_14850 15808 16641 gene locus_tag LOCUS_14860 15808 16641 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 protein_id gnl|my_center|LOCUS_14860 16654 16959 gene locus_tag LOCUS_14870 16654 16959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 16962 18365 gene locus_tag LOCUS_14880 16962 18365 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_14880 18365 19240 gene locus_tag LOCUS_14890 18365 19240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 19548 21956 gene locus_tag LOCUS_14900 19548 21956 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706760.1 protein_id gnl|my_center|LOCUS_14900 22503 22057 gene locus_tag LOCUS_14910 22503 22057 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_14910 23086 22553 gene locus_tag LOCUS_14920 23086 22553 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554654.1 protein_id gnl|my_center|LOCUS_14920 23949 23179 gene locus_tag LOCUS_14930 gene exbB1 23949 23179 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206608.1 protein_id gnl|my_center|LOCUS_14930 24686 24039 gene locus_tag LOCUS_14940 24686 24039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 25015 25896 gene locus_tag LOCUS_14950 25015 25896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 25978 27288 gene locus_tag LOCUS_14960 25978 27288 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 protein_id gnl|my_center|LOCUS_14960 27389 28372 gene locus_tag LOCUS_14970 27389 28372 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H0 protein_id gnl|my_center|LOCUS_14970 28509 29444 gene locus_tag LOCUS_14980 gene prs 28509 29444 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAV6 protein_id gnl|my_center|LOCUS_14980 29465 30247 gene locus_tag LOCUS_14990 29465 30247 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_14990 30552 30265 gene locus_tag LOCUS_15000 30552 30265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 30625 31056 gene locus_tag LOCUS_15010 30625 31056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 31116 31385 gene locus_tag LOCUS_15020 31116 31385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 31403 31762 gene locus_tag LOCUS_15030 gene rplT 31403 31762 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9E3 protein_id gnl|my_center|LOCUS_15030 32023 32931 gene locus_tag LOCUS_15040 32023 32931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 32976 34109 gene locus_tag LOCUS_15050 gene pheS 32976 34109 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9E4 protein_id gnl|my_center|LOCUS_15050 34106 36496 gene locus_tag LOCUS_15060 gene pheT 34106 36496 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SS9 protein_id gnl|my_center|LOCUS_15060 36518 38038 gene locus_tag LOCUS_15070 gene prfC 36518 38038 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C769 protein_id gnl|my_center|LOCUS_15070 39318 38041 gene locus_tag LOCUS_15080 39318 38041 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_15080 39395 40090 gene locus_tag LOCUS_15090 39395 40090 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338250.1 protein_id gnl|my_center|LOCUS_15090 40278 40616 gene locus_tag LOCUS_15100 40278 40616 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388885.1 protein_id gnl|my_center|LOCUS_15100 40661 42046 gene locus_tag LOCUS_15110 40661 42046 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8L5 protein_id gnl|my_center|LOCUS_15110 42601 48192 gene locus_tag LOCUS_15120 42601 48192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 48413 50551 gene locus_tag LOCUS_15130 48413 50551 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_15130 50648 51346 gene locus_tag LOCUS_15140 50648 51346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 51904 52128 gene locus_tag LOCUS_15150 51904 52128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 52959 52528 gene locus_tag LOCUS_15160 52959 52528 CDS product TIGR01244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 protein_id gnl|my_center|LOCUS_15160 53783 52956 gene locus_tag LOCUS_15170 53783 52956 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639941.1 protein_id gnl|my_center|LOCUS_15170 54053 54772 gene locus_tag LOCUS_15180 54053 54772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 55140 54961 gene locus_tag LOCUS_15190 55140 54961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 55135 56136 gene locus_tag LOCUS_15200 gene argD 55135 56136 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UI71 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15200 56136 57062 gene locus_tag LOCUS_15210 gene argF 56136 57062 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A653 protein_id gnl|my_center|LOCUS_15210 57137 58033 gene locus_tag LOCUS_15220 57137 58033 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKS8 protein_id gnl|my_center|LOCUS_15220 58152 58571 gene locus_tag LOCUS_15230 58152 58571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 58624 59337 gene locus_tag LOCUS_15240 gene queC 58624 59337 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW9 protein_id gnl|my_center|LOCUS_15240 59898 59368 gene locus_tag LOCUS_15250 59898 59368 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022393.1 protein_id gnl|my_center|LOCUS_15250 60399 59995 gene locus_tag LOCUS_15260 60399 59995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 60850 60317 gene locus_tag LOCUS_15270 60850 60317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 61443 60847 gene locus_tag LOCUS_15280 61443 60847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 61577 62215 gene locus_tag LOCUS_15290 61577 62215 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_15290 62514 62218 gene locus_tag LOCUS_15300 62514 62218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 63946 62720 gene locus_tag LOCUS_15310 63946 62720 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_15310 64181 63939 gene locus_tag LOCUS_15320 64181 63939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 64680 64237 gene locus_tag LOCUS_15330 64680 64237 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603272.1 protein_id gnl|my_center|LOCUS_15330 64759 64977 gene locus_tag LOCUS_15340 64759 64977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 64977 65615 gene locus_tag LOCUS_15350 64977 65615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920322.1 protein_id gnl|my_center|LOCUS_15350 65612 66073 gene locus_tag LOCUS_15360 65612 66073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537431.1 protein_id gnl|my_center|LOCUS_15360 66084 66818 gene locus_tag LOCUS_15370 66084 66818 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338572.1 protein_id gnl|my_center|LOCUS_15370 66815 67969 gene locus_tag LOCUS_15380 66815 67969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 protein_id gnl|my_center|LOCUS_15380 68452 67982 gene locus_tag LOCUS_15390 gene dksA 68452 67982 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9J6 protein_id gnl|my_center|LOCUS_15390 68747 69094 gene locus_tag LOCUS_15400 68747 69094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 70676 69150 gene locus_tag LOCUS_15410 70676 69150 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707296.1 protein_id gnl|my_center|LOCUS_15410 70783 72621 gene locus_tag LOCUS_15420 70783 72621 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404430.1 protein_id gnl|my_center|LOCUS_15420 72618 73814 gene locus_tag LOCUS_15430 gene aatB 72618 73814 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MML2 protein_id gnl|my_center|LOCUS_15430 73823 74488 gene locus_tag LOCUS_15440 73823 74488 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083305.1 protein_id gnl|my_center|LOCUS_15440 74488 74904 gene locus_tag LOCUS_15450 74488 74904 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_15450 75054 75221 gene locus_tag LOCUS_15460 gene rpmG 75054 75221 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC65 protein_id gnl|my_center|LOCUS_15460 75286 75963 gene locus_tag LOCUS_15470 75286 75963 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6E7 protein_id gnl|my_center|LOCUS_15470 76441 76040 gene locus_tag LOCUS_15480 76441 76040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 76352 77056 gene locus_tag LOCUS_15490 gene xthA3 76352 77056 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529670.1 protein_id gnl|my_center|LOCUS_15490 77053 78123 gene locus_tag LOCUS_15500 77053 78123 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN64 protein_id gnl|my_center|LOCUS_15500 79101 78136 gene locus_tag LOCUS_15510 79101 78136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 79417 79169 gene locus_tag LOCUS_15520 79417 79169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 82081 79469 gene locus_tag LOCUS_15530 82081 79469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15530 83127 82081 gene locus_tag LOCUS_15540 83127 82081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15540 84050 83124 gene locus_tag LOCUS_15550 84050 83124 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9A8 protein_id gnl|my_center|LOCUS_15550 85051 84047 gene locus_tag LOCUS_15560 85051 84047 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708657.1 protein_id gnl|my_center|LOCUS_15560 85210 85536 gene locus_tag LOCUS_15570 85210 85536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 85628 85825 gene locus_tag LOCUS_15580 85628 85825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 86110 85841 gene locus_tag LOCUS_15590 86110 85841 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039113.1 protein_id gnl|my_center|LOCUS_15590 87004 86201 gene locus_tag LOCUS_15600 gene uppP 87004 86201 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WH1 protein_id gnl|my_center|LOCUS_15600 89309 87111 gene locus_tag LOCUS_15610 89309 87111 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921333.1 protein_id gnl|my_center|LOCUS_15610 91217 89358 gene locus_tag LOCUS_15620 91217 89358 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921107.1 protein_id gnl|my_center|LOCUS_15620 91431 92675 gene locus_tag LOCUS_15630 91431 92675 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709850.1 protein_id gnl|my_center|LOCUS_15630 93593 92961 gene locus_tag LOCUS_15640 93593 92961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_15640 95077 93677 gene locus_tag LOCUS_15650 95077 93677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 95318 96547 gene locus_tag LOCUS_15660 95318 96547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 96607 98676 gene locus_tag LOCUS_15670 96607 98676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 98966 103606 gene locus_tag LOCUS_15680 98966 103606 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 protein_id gnl|my_center|LOCUS_15680 103634 105067 gene locus_tag LOCUS_15690 103634 105067 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064802.1 protein_id gnl|my_center|LOCUS_15690 105115 105720 gene locus_tag LOCUS_15700 105115 105720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 106531 105737 gene locus_tag LOCUS_15710 106531 105737 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036100.1 protein_id gnl|my_center|LOCUS_15710 106964 109501 gene locus_tag LOCUS_15720 gene gyrB 106964 109501 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKT5 protein_id gnl|my_center|LOCUS_15720 109693 110235 gene locus_tag LOCUS_15730 109693 110235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 111395 110328 gene locus_tag LOCUS_15740 111395 110328 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388400.1 protein_id gnl|my_center|LOCUS_15740 112273 111392 gene locus_tag LOCUS_15750 gene lgt 112273 111392 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ0 protein_id gnl|my_center|LOCUS_15750 112468 115257 gene locus_tag LOCUS_15760 gene glnD 112468 115257 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG2 protein_id gnl|my_center|LOCUS_15760 115946 115278 gene locus_tag LOCUS_15770 115946 115278 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972537.1 protein_id gnl|my_center|LOCUS_15770 116276 116542 gene locus_tag LOCUS_15780 116276 116542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 116615 118954 gene locus_tag LOCUS_15790 116615 118954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 119020 120147 gene locus_tag LOCUS_15800 119020 120147 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN15 protein_id gnl|my_center|LOCUS_15800 122151 120151 gene locus_tag LOCUS_15810 122151 120151 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974801.1 protein_id gnl|my_center|LOCUS_15810 122283 124124 gene locus_tag LOCUS_15820 122283 124124 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_15820 124318 124881 gene locus_tag LOCUS_15830 124318 124881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 125595 125005 gene locus_tag LOCUS_15840 gene dcd 125595 125005 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK9 protein_id gnl|my_center|LOCUS_15840 126823 125672 gene locus_tag LOCUS_15850 126823 125672 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_15850 127000 129114 gene locus_tag LOCUS_15860 gene ppk 127000 129114 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJJ7 protein_id gnl|my_center|LOCUS_15860 129125 130639 gene locus_tag LOCUS_15870 129125 130639 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_15870 130727 132670 gene locus_tag LOCUS_15880 gene ftsH 130727 132670 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN14 protein_id gnl|my_center|LOCUS_15880 133459 132719 gene locus_tag LOCUS_15890 133459 132719 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_15890 133966 133622 gene locus_tag LOCUS_15900 133966 133622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 134121 135278 gene locus_tag LOCUS_15910 134121 135278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 136795 135293 gene locus_tag LOCUS_15920 136795 135293 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9A7 protein_id gnl|my_center|LOCUS_15920 136920 137402 gene locus_tag LOCUS_15930 136920 137402 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J080 protein_id gnl|my_center|LOCUS_15930 137423 138121 gene locus_tag LOCUS_15940 137423 138121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 138141 138557 gene locus_tag LOCUS_15950 138141 138557 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240361.1 protein_id gnl|my_center|LOCUS_15950 138759 139331 gene locus_tag LOCUS_15960 138759 139331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 140540 139383 gene locus_tag LOCUS_15970 140540 139383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106235.1 protein_id gnl|my_center|LOCUS_15970 141148 140537 gene locus_tag LOCUS_15980 141148 140537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 141255 142262 gene locus_tag LOCUS_15990 gene galE 141255 142262 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088672.1 protein_id gnl|my_center|LOCUS_15990 142534 143160 gene locus_tag LOCUS_16000 142534 143160 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_16000 143239 143709 gene locus_tag LOCUS_16010 143239 143709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 144377 143718 gene locus_tag LOCUS_16020 144377 143718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 144674 145219 gene locus_tag LOCUS_16030 144674 145219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 146027 145287 gene locus_tag LOCUS_16040 146027 145287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 146150 146401 gene locus_tag LOCUS_16050 146150 146401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 146613 148361 gene locus_tag LOCUS_16060 146613 148361 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102976.1 protein_id gnl|my_center|LOCUS_16060 148358 149290 gene locus_tag LOCUS_16070 148358 149290 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102975.1 protein_id gnl|my_center|LOCUS_16070 149708 149409 gene locus_tag LOCUS_16080 149708 149409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 149838 150284 gene locus_tag LOCUS_16090 149838 150284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 150665 150432 gene locus_tag LOCUS_16100 150665 150432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 152598 150754 gene locus_tag LOCUS_16110 152598 150754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 153425 152595 gene locus_tag LOCUS_16120 153425 152595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 153330 153590 gene locus_tag LOCUS_16130 153330 153590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence07 860 570 gene locus_tag LOCUS_16140 860 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 2245 1196 gene locus_tag LOCUS_16150 2245 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 5034 2245 gene locus_tag LOCUS_16160 5034 2245 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_16160 6194 5169 gene locus_tag LOCUS_16170 6194 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202957.1 protein_id gnl|my_center|LOCUS_16170 7005 6196 gene locus_tag LOCUS_16180 7005 6196 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229007.1 protein_id gnl|my_center|LOCUS_16180 8814 7018 gene locus_tag LOCUS_16190 8814 7018 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_16190 9980 8850 gene locus_tag LOCUS_16200 9980 8850 CDS product 12-oxophytodienoate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103456.1 protein_id gnl|my_center|LOCUS_16200 10925 10002 gene locus_tag LOCUS_16210 10925 10002 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028960.1 protein_id gnl|my_center|LOCUS_16210 11980 10922 gene locus_tag LOCUS_16220 11980 10922 CDS product NAD-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_16220 12234 13283 gene locus_tag LOCUS_16230 12234 13283 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_16230 13313 13690 gene locus_tag LOCUS_16240 13313 13690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 14707 13697 gene locus_tag LOCUS_16250 14707 13697 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920827.1 protein_id gnl|my_center|LOCUS_16250 15477 14692 gene locus_tag LOCUS_16260 15477 14692 CDS product 2,3-dehydroadipyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292350.1 protein_id gnl|my_center|LOCUS_16260 16898 15477 gene locus_tag LOCUS_16270 16898 15477 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096755.1 protein_id gnl|my_center|LOCUS_16270 17329 16898 gene locus_tag LOCUS_16280 17329 16898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 18696 17326 gene locus_tag LOCUS_16290 gene accC 18696 17326 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124229.1 protein_id gnl|my_center|LOCUS_16290 19196 18696 gene locus_tag LOCUS_16300 gene accB 19196 18696 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124182.1 protein_id gnl|my_center|LOCUS_16300 19613 20323 gene locus_tag LOCUS_16310 19613 20323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 20382 21131 gene locus_tag LOCUS_16320 20382 21131 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_16320 21128 22396 gene locus_tag LOCUS_16330 21128 22396 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729591.1 protein_id gnl|my_center|LOCUS_16330 23834 22380 gene locus_tag LOCUS_16340 23834 22380 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 protein_id gnl|my_center|LOCUS_16340 24372 23875 gene locus_tag LOCUS_16350 24372 23875 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_16350 25502 24396 gene locus_tag LOCUS_16360 25502 24396 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228921.1 protein_id gnl|my_center|LOCUS_16360 26709 25519 gene locus_tag LOCUS_16370 26709 25519 CDS product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701349.1 protein_id gnl|my_center|LOCUS_16370 27537 26725 gene locus_tag LOCUS_16380 27537 26725 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_16380 28384 27554 gene locus_tag LOCUS_16390 28384 27554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 29307 28381 gene locus_tag LOCUS_16400 29307 28381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 30472 29321 gene locus_tag LOCUS_16410 30472 29321 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897320.1 protein_id gnl|my_center|LOCUS_16410 31593 30475 gene locus_tag LOCUS_16420 31593 30475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064172.1 protein_id gnl|my_center|LOCUS_16420 31855 32937 gene locus_tag LOCUS_16430 31855 32937 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926487.1 protein_id gnl|my_center|LOCUS_16430 32930 34450 gene locus_tag LOCUS_16440 gene lcfB 32930 34450 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07610 protein_id gnl|my_center|LOCUS_16440 34447 35340 gene locus_tag LOCUS_16450 34447 35340 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_16450 35333 36538 gene locus_tag LOCUS_16460 35333 36538 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_16460 37244 36555 gene locus_tag LOCUS_16470 37244 36555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 38336 37329 gene locus_tag LOCUS_16480 38336 37329 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 protein_id gnl|my_center|LOCUS_16480 41081 38475 gene locus_tag LOCUS_16490 41081 38475 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920256.1 protein_id gnl|my_center|LOCUS_16490 41299 41583 gene locus_tag LOCUS_16500 41299 41583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 43409 41682 gene locus_tag LOCUS_16510 43409 41682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 44020 43418 gene locus_tag LOCUS_16520 44020 43418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 protein_id gnl|my_center|LOCUS_16520 44769 44017 gene locus_tag LOCUS_16530 44769 44017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 45491 44913 gene locus_tag LOCUS_16540 45491 44913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 46720 45491 gene locus_tag LOCUS_16550 46720 45491 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 protein_id gnl|my_center|LOCUS_16550 48210 46753 gene locus_tag LOCUS_16560 48210 46753 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 protein_id gnl|my_center|LOCUS_16560 48816 48301 gene locus_tag LOCUS_16570 gene accB 48816 48301 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020267.1 protein_id gnl|my_center|LOCUS_16570 50361 48817 gene locus_tag LOCUS_16580 50361 48817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 51489 50512 gene locus_tag LOCUS_16590 51489 50512 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225004.1 protein_id gnl|my_center|LOCUS_16590 52719 51499 gene locus_tag LOCUS_16600 52719 51499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896388.1 protein_id gnl|my_center|LOCUS_16600 53591 52884 gene locus_tag LOCUS_16610 53591 52884 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930315.1 protein_id gnl|my_center|LOCUS_16610 53880 55799 gene locus_tag LOCUS_16620 53880 55799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 55821 56135 gene locus_tag LOCUS_16630 55821 56135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 56880 56125 gene locus_tag LOCUS_16640 56880 56125 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727829.1 protein_id gnl|my_center|LOCUS_16640 57022 58245 gene locus_tag LOCUS_16650 57022 58245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 58245 58745 gene locus_tag LOCUS_16660 58245 58745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 58820 59746 gene locus_tag LOCUS_16670 58820 59746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 62023 59771 gene locus_tag LOCUS_16680 62023 59771 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 protein_id gnl|my_center|LOCUS_16680 62976 62182 gene locus_tag LOCUS_16690 62976 62182 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919002.1 protein_id gnl|my_center|LOCUS_16690 65573 62973 gene locus_tag LOCUS_16700 gene nasC 65573 62973 CDS product assimilatory nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918503.1 protein_id gnl|my_center|LOCUS_16700 65968 65582 gene locus_tag LOCUS_16710 65968 65582 CDS product tRNA-(guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 protein_id gnl|my_center|LOCUS_16710 68463 65968 gene locus_tag LOCUS_16720 gene nirB 68463 65968 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918501.1 protein_id gnl|my_center|LOCUS_16720 70115 68877 gene locus_tag LOCUS_16730 70115 68877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_16730 71865 70180 gene locus_tag LOCUS_16740 71865 70180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 72941 71880 gene locus_tag LOCUS_16750 72941 71880 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_16750 74392 72971 gene locus_tag LOCUS_16760 74392 72971 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_16760 75821 74613 gene locus_tag LOCUS_16770 75821 74613 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 protein_id gnl|my_center|LOCUS_16770 76429 75818 gene locus_tag LOCUS_16780 76429 75818 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 protein_id gnl|my_center|LOCUS_16780 77427 76492 gene locus_tag LOCUS_16790 77427 76492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 79538 77424 gene locus_tag LOCUS_16800 gene exaA 79538 77424 CDS product quinoprotein ethanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_16800 81069 79561 gene locus_tag LOCUS_16810 81069 79561 CDS product flavin-binding family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083785.1 protein_id gnl|my_center|LOCUS_16810 81281 81703 gene locus_tag LOCUS_16820 81281 81703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 82855 81704 gene locus_tag LOCUS_16830 82855 81704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 84495 82852 gene locus_tag LOCUS_16840 84495 82852 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086637.1 protein_id gnl|my_center|LOCUS_16840 85327 84488 gene locus_tag LOCUS_16850 85327 84488 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_16850 85509 86534 gene locus_tag LOCUS_16860 85509 86534 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_16860 86531 86953 gene locus_tag LOCUS_16870 86531 86953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 86978 88090 gene locus_tag LOCUS_16880 86978 88090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_16880 88642 88091 gene locus_tag LOCUS_16890 88642 88091 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730035.1 protein_id gnl|my_center|LOCUS_16890 88829 89635 gene locus_tag LOCUS_16900 88829 89635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 89713 90966 gene locus_tag LOCUS_16910 gene wecC 89713 90966 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482531.1 protein_id gnl|my_center|LOCUS_16910 90963 92096 gene locus_tag LOCUS_16920 90963 92096 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706035.1 protein_id gnl|my_center|LOCUS_16920 92632 92081 gene locus_tag LOCUS_16930 92632 92081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 92808 93524 gene locus_tag LOCUS_16940 gene gumB 92808 93524 CDS product GumB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037595.1 protein_id gnl|my_center|LOCUS_16940 93540 95756 gene locus_tag LOCUS_16950 93540 95756 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_16950 95768 97006 gene locus_tag LOCUS_16960 95768 97006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 97541 97113 gene locus_tag LOCUS_16970 97541 97113 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919041.1 protein_id gnl|my_center|LOCUS_16970 98731 97547 gene locus_tag LOCUS_16980 98731 97547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919043.1 protein_id gnl|my_center|LOCUS_16980 99728 98799 gene locus_tag LOCUS_16990 gene etfA 99728 98799 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53573 protein_id gnl|my_center|LOCUS_16990 100513 99767 gene locus_tag LOCUS_17000 100513 99767 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708569.1 protein_id gnl|my_center|LOCUS_17000 101825 100626 gene locus_tag LOCUS_17010 gene sucC 101825 100626 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYZ1 protein_id gnl|my_center|LOCUS_17010 101944 102717 gene locus_tag LOCUS_17020 101944 102717 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338590.1 protein_id gnl|my_center|LOCUS_17020 103487 102795 gene locus_tag LOCUS_17030 103487 102795 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531371.1 protein_id gnl|my_center|LOCUS_17030 103677 105029 gene locus_tag LOCUS_17040 103677 105029 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530058.1 protein_id gnl|my_center|LOCUS_17040 105467 105057 gene locus_tag LOCUS_17050 105467 105057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 106022 105471 gene locus_tag LOCUS_17060 gene lspA 106022 105471 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGD1 protein_id gnl|my_center|LOCUS_17060 108934 106019 gene locus_tag LOCUS_17070 gene ileS 108934 106019 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ34 protein_id gnl|my_center|LOCUS_17070 110052 109000 gene locus_tag LOCUS_17080 110052 109000 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086958.1 protein_id gnl|my_center|LOCUS_17080 111006 110080 gene locus_tag LOCUS_17090 111006 110080 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_17090 111494 111003 gene locus_tag LOCUS_17100 111494 111003 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TG76 protein_id gnl|my_center|LOCUS_17100 112495 111491 gene locus_tag LOCUS_17110 gene purK 112495 111491 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J672 protein_id gnl|my_center|LOCUS_17110 113117 112605 gene locus_tag LOCUS_17120 gene purE 113117 112605 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CFL8 protein_id gnl|my_center|LOCUS_17120 113830 113144 gene locus_tag LOCUS_17130 gene gpmA 113830 113144 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYN6 protein_id gnl|my_center|LOCUS_17130 114107 113877 gene locus_tag LOCUS_17140 114107 113877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 114169 114243 gene locus_tag LOCUS_t00240 114169 114243 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 114574 114284 gene locus_tag LOCUS_17150 114574 114284 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840431.1 protein_id gnl|my_center|LOCUS_17150 115377 114571 gene locus_tag LOCUS_17160 115377 114571 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918939.1 protein_id gnl|my_center|LOCUS_17160 115482 118109 gene locus_tag LOCUS_17170 gene pepN 115482 118109 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104725.1 protein_id gnl|my_center|LOCUS_17170 118102 118884 gene locus_tag LOCUS_17180 118102 118884 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFJ6 protein_id gnl|my_center|LOCUS_17180 119094 119672 gene locus_tag LOCUS_17190 119094 119672 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAX0 protein_id gnl|my_center|LOCUS_17190 119690 120973 gene locus_tag LOCUS_17200 gene fbcB 119690 120973 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PE7 protein_id gnl|my_center|LOCUS_17200 121003 121851 gene locus_tag LOCUS_17210 121003 121851 CDS product ribosomal protein P2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975689.1 protein_id gnl|my_center|LOCUS_17210 121928 122464 gene locus_tag LOCUS_17220 gene apt 121928 122464 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UD91 protein_id gnl|my_center|LOCUS_17220 122629 124482 gene locus_tag LOCUS_17230 122629 124482 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230338.1 protein_id gnl|my_center|LOCUS_17230 124523 124596 gene locus_tag LOCUS_t00250 124523 124596 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 125044 127245 gene locus_tag LOCUS_17240 125044 127245 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 protein_id gnl|my_center|LOCUS_17240 127491 127862 gene locus_tag LOCUS_17250 127491 127862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 127973 129478 gene locus_tag LOCUS_17260 127973 129478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 129523 129945 gene locus_tag LOCUS_17270 129523 129945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 130579 129971 gene locus_tag LOCUS_17280 130579 129971 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920061.1 protein_id gnl|my_center|LOCUS_17280 130706 131548 gene locus_tag LOCUS_17290 130706 131548 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_17290 131553 131780 gene locus_tag LOCUS_17300 131553 131780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 131801 132370 gene locus_tag LOCUS_17310 131801 132370 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 protein_id gnl|my_center|LOCUS_17310 132412 133281 gene locus_tag LOCUS_17320 gene hbdA 132412 133281 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45223 protein_id gnl|my_center|LOCUS_17320 133698 133306 gene locus_tag LOCUS_17330 133698 133306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 134080 133673 gene locus_tag LOCUS_17340 134080 133673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 136716 134107 gene locus_tag LOCUS_17350 gene mutS 136716 134107 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG0 protein_id gnl|my_center|LOCUS_17350 136894 139155 gene locus_tag LOCUS_17360 136894 139155 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391289.1 protein_id gnl|my_center|LOCUS_17360 139941 139156 gene locus_tag LOCUS_17370 139941 139156 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ69 protein_id gnl|my_center|LOCUS_17370 141503 140253 gene locus_tag LOCUS_17380 141503 140253 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176729.1 protein_id gnl|my_center|LOCUS_17380 141471 141737 gene locus_tag LOCUS_17390 141471 141737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 143163 143606 gene locus_tag LOCUS_17400 143163 143606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 143682 146165 gene locus_tag LOCUS_17410 143682 146165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence08 3966 1936 gene locus_tag LOCUS_17420 3966 1936 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_17420 4000 5541 gene locus_tag LOCUS_17430 4000 5541 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524967.1 protein_id gnl|my_center|LOCUS_17430 5601 6329 gene locus_tag LOCUS_17440 5601 6329 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969361.1 protein_id gnl|my_center|LOCUS_17440 7100 6399 gene locus_tag LOCUS_17450 gene rplA 7100 6399 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV0 protein_id gnl|my_center|LOCUS_17450 7536 7105 gene locus_tag LOCUS_17460 gene rplK 7536 7105 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLH9 protein_id gnl|my_center|LOCUS_17460 8887 7751 gene locus_tag LOCUS_17470 8887 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 9676 9074 gene locus_tag LOCUS_17480 9676 9074 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265507.1 protein_id gnl|my_center|LOCUS_17480 9906 10724 gene locus_tag LOCUS_17490 9906 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 10899 10744 gene locus_tag LOCUS_17500 10899 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 11105 12415 gene locus_tag LOCUS_17510 11105 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 12483 14618 gene locus_tag LOCUS_17520 12483 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_17520 14615 15757 gene locus_tag LOCUS_17530 14615 15757 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_17530 15771 17228 gene locus_tag LOCUS_17540 15771 17228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887433.1 protein_id gnl|my_center|LOCUS_17540 18118 17411 gene locus_tag LOCUS_17550 18118 17411 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142671.1 protein_id gnl|my_center|LOCUS_17550 19238 18219 gene locus_tag LOCUS_17560 19238 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533238.1 protein_id gnl|my_center|LOCUS_17560 19587 19231 gene locus_tag LOCUS_17570 19587 19231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 19969 19610 gene locus_tag LOCUS_17580 19969 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 20344 20625 gene locus_tag LOCUS_17590 20344 20625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 20742 21032 gene locus_tag LOCUS_17600 20742 21032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 21029 22606 gene locus_tag LOCUS_17610 21029 22606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 23080 22991 gene locus_tag LOCUS_t00260 23080 22991 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23291 23674 gene locus_tag LOCUS_17620 23291 23674 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919487.1 protein_id gnl|my_center|LOCUS_17620 24566 23691 gene locus_tag LOCUS_17630 24566 23691 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8S9 protein_id gnl|my_center|LOCUS_17630 24714 25418 gene locus_tag LOCUS_17640 gene gcrA 24714 25418 CDS product cell cycle regulatory protein GcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265783.1 protein_id gnl|my_center|LOCUS_17640 25459 25989 gene locus_tag LOCUS_17650 25459 25989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192577.1 protein_id gnl|my_center|LOCUS_17650 26085 26918 gene locus_tag LOCUS_17660 26085 26918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 27238 28476 gene locus_tag LOCUS_17670 27238 28476 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 protein_id gnl|my_center|LOCUS_17670 28479 29141 gene locus_tag LOCUS_17680 28479 29141 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_17680 31505 29208 gene locus_tag LOCUS_17690 gene pnp 31505 29208 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWZ0 protein_id gnl|my_center|LOCUS_17690 32089 31820 gene locus_tag LOCUS_17700 gene rpsO 32089 31820 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC70 protein_id gnl|my_center|LOCUS_17700 33099 32095 gene locus_tag LOCUS_17710 gene truB 33099 32095 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58063 protein_id gnl|my_center|LOCUS_17710 33785 33099 gene locus_tag LOCUS_17720 33785 33099 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389529.1 protein_id gnl|my_center|LOCUS_17720 34258 33839 gene locus_tag LOCUS_17730 gene rbfA 34258 33839 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB0 protein_id gnl|my_center|LOCUS_17730 36852 34303 gene locus_tag LOCUS_17740 gene infB 36852 34303 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN5 protein_id gnl|my_center|LOCUS_17740 37630 36878 gene locus_tag LOCUS_17750 37630 36878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385439.1 protein_id gnl|my_center|LOCUS_17750 39266 37611 gene locus_tag LOCUS_17760 gene nusA 39266 37611 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF27 protein_id gnl|my_center|LOCUS_17760 39862 39275 gene locus_tag LOCUS_17770 gene rimP 39862 39275 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN8 protein_id gnl|my_center|LOCUS_17770 40012 40419 gene locus_tag LOCUS_17780 40012 40419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 40452 41888 gene locus_tag LOCUS_17790 gene leuC 40452 41888 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV55 protein_id gnl|my_center|LOCUS_17790 41901 42071 gene locus_tag LOCUS_17800 41901 42071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 42071 42676 gene locus_tag LOCUS_17810 gene leuD 42071 42676 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZJ0 protein_id gnl|my_center|LOCUS_17810 42793 43116 gene locus_tag LOCUS_17820 42793 43116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920348.1 protein_id gnl|my_center|LOCUS_17820 43121 43354 gene locus_tag LOCUS_17830 43121 43354 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088461.1 protein_id gnl|my_center|LOCUS_17830 43389 43718 gene locus_tag LOCUS_17840 43389 43718 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PH5 protein_id gnl|my_center|LOCUS_17840 44088 44897 gene locus_tag LOCUS_17850 44088 44897 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920181.1 protein_id gnl|my_center|LOCUS_17850 46443 44911 gene locus_tag LOCUS_17860 46443 44911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17860 47242 46448 gene locus_tag LOCUS_17870 47242 46448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17870 47669 49372 gene locus_tag LOCUS_17880 47669 49372 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920146.1 protein_id gnl|my_center|LOCUS_17880 49475 51154 gene locus_tag LOCUS_17890 49475 51154 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110294.1 protein_id gnl|my_center|LOCUS_17890 51168 52100 gene locus_tag LOCUS_17900 gene oppB 51168 52100 CDS product oligopeptide transport system permease protein OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24138 protein_id gnl|my_center|LOCUS_17900 52103 53521 gene locus_tag LOCUS_17910 52103 53521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 53518 54555 gene locus_tag LOCUS_17920 gene oppD 53518 54555 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854348.1 protein_id gnl|my_center|LOCUS_17920 54552 55526 gene locus_tag LOCUS_17930 gene ykfD 54552 55526 CDS product putative oligopeptide transport ATP-binding protein YkfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0SP98 protein_id gnl|my_center|LOCUS_17930 56913 55555 gene locus_tag LOCUS_17940 56913 55555 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971181.1 protein_id gnl|my_center|LOCUS_17940 57117 58037 gene locus_tag LOCUS_17950 57117 58037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 58738 58160 gene locus_tag LOCUS_17960 58738 58160 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391429.1 protein_id gnl|my_center|LOCUS_17960 58855 59538 gene locus_tag LOCUS_17970 58855 59538 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195778.1 protein_id gnl|my_center|LOCUS_17970 61162 59561 gene locus_tag LOCUS_17980 gene lysS 61162 59561 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C6 protein_id gnl|my_center|LOCUS_17980 61570 62718 gene locus_tag LOCUS_17990 61570 62718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 62782 63657 gene locus_tag LOCUS_18000 62782 63657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 63735 66554 gene locus_tag LOCUS_18010 63735 66554 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_18010 66520 67119 gene locus_tag LOCUS_18020 66520 67119 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_18020 67557 67126 gene locus_tag LOCUS_18030 67557 67126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 67853 67554 gene locus_tag LOCUS_18040 gene ihfA 67853 67554 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J366 protein_id gnl|my_center|LOCUS_18040 68929 67964 gene locus_tag LOCUS_18050 gene fabH 68929 67964 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QT4 protein_id gnl|my_center|LOCUS_18050 70014 68926 gene locus_tag LOCUS_18060 gene plsX 70014 68926 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K88 protein_id gnl|my_center|LOCUS_18060 70220 70041 gene locus_tag LOCUS_18070 gene rpmF 70220 70041 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTT0 protein_id gnl|my_center|LOCUS_18070 70362 70814 gene locus_tag LOCUS_18080 70362 70814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 71468 70827 gene locus_tag LOCUS_18090 71468 70827 CDS product Zn-dependent hydrolase glyoxalase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265678.1 protein_id gnl|my_center|LOCUS_18090 72245 71550 gene locus_tag LOCUS_18100 72245 71550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 72344 72559 gene locus_tag LOCUS_18110 72344 72559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 72549 72914 gene locus_tag LOCUS_18120 72549 72914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 74444 72918 gene locus_tag LOCUS_18130 gene cysS 74444 72918 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E391 protein_id gnl|my_center|LOCUS_18130 75372 74476 gene locus_tag LOCUS_18140 75372 74476 CDS product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083045.1 protein_id gnl|my_center|LOCUS_18140 76074 75412 gene locus_tag LOCUS_18150 76074 75412 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_18150 77897 76077 gene locus_tag LOCUS_18160 77897 76077 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 protein_id gnl|my_center|LOCUS_18160 78575 77919 gene locus_tag LOCUS_18170 gene tal 78575 77919 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM7 protein_id gnl|my_center|LOCUS_18170 79359 78670 gene locus_tag LOCUS_18180 79359 78670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 79439 81616 gene locus_tag LOCUS_18190 gene priA 79439 81616 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S6 protein_id gnl|my_center|LOCUS_18190 81698 82327 gene locus_tag LOCUS_18200 81698 82327 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088446.1 protein_id gnl|my_center|LOCUS_18200 83308 82334 gene locus_tag LOCUS_18210 gene ada 83308 82334 CDS product bifunctional transcriptional activator/DNA repair enzyme protein Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147548.1 protein_id gnl|my_center|LOCUS_18210 83453 85093 gene locus_tag LOCUS_18220 83453 85093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 85249 85803 gene locus_tag LOCUS_18230 gene atpH 85249 85803 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWL8 protein_id gnl|my_center|LOCUS_18230 85835 87364 gene locus_tag LOCUS_18240 gene atpA 85835 87364 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X72 protein_id gnl|my_center|LOCUS_18240 87393 88271 gene locus_tag LOCUS_18250 gene atpG 87393 88271 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAC0 protein_id gnl|my_center|LOCUS_18250 88295 89752 gene locus_tag LOCUS_18260 gene atpD 88295 89752 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV18 protein_id gnl|my_center|LOCUS_18260 89757 90014 gene locus_tag LOCUS_18270 gene atpC 89757 90014 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCI9 protein_id gnl|my_center|LOCUS_18270 90201 90440 gene locus_tag LOCUS_18280 90201 90440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 91497 90541 gene locus_tag LOCUS_18290 gene wcaG 91497 90541 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV57 protein_id gnl|my_center|LOCUS_18290 92630 91509 gene locus_tag LOCUS_18300 gene gmd 92630 91509 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV56 protein_id gnl|my_center|LOCUS_18300 93058 92765 gene locus_tag LOCUS_18310 93058 92765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 93908 93033 gene locus_tag LOCUS_18320 93908 93033 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528075.1 protein_id gnl|my_center|LOCUS_18320 93853 94122 gene locus_tag LOCUS_18330 93853 94122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 94126 95178 gene locus_tag LOCUS_18340 94126 95178 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_18340 95179 96903 gene locus_tag LOCUS_18350 95179 96903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 96893 97978 gene locus_tag LOCUS_18360 96893 97978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 98773 97970 gene locus_tag LOCUS_18370 98773 97970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 99539 98766 gene locus_tag LOCUS_18380 99539 98766 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125497.1 protein_id gnl|my_center|LOCUS_18380 100590 101135 gene locus_tag LOCUS_18390 100590 101135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 101132 102328 gene locus_tag LOCUS_18400 101132 102328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 102338 103363 gene locus_tag LOCUS_18410 102338 103363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 105185 103344 gene locus_tag LOCUS_18420 105185 103344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_18420 105422 106957 gene locus_tag LOCUS_18430 gene cpaF 105422 106957 CDS product pilus assembly protein CpaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920779.1 protein_id gnl|my_center|LOCUS_18430 108027 107113 gene locus_tag LOCUS_18440 108027 107113 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 protein_id gnl|my_center|LOCUS_18440 108158 108391 gene locus_tag LOCUS_18450 108158 108391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 108523 108651 gene locus_tag LOCUS_18460 108523 108651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 109280 108675 gene locus_tag LOCUS_18470 109280 108675 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204341.1 protein_id gnl|my_center|LOCUS_18470 110050 109277 gene locus_tag LOCUS_18480 110050 109277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 110969 110055 gene locus_tag LOCUS_18490 110969 110055 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8M8 protein_id gnl|my_center|LOCUS_18490 110922 111266 gene locus_tag LOCUS_18500 110922 111266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 111997 111302 gene locus_tag LOCUS_18510 111997 111302 CDS product racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836295.1 protein_id gnl|my_center|LOCUS_18510 113639 112182 gene locus_tag LOCUS_18520 gene pntB 113639 112182 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EG1 protein_id gnl|my_center|LOCUS_18520 113923 113639 gene locus_tag LOCUS_18530 113923 113639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 115061 113925 gene locus_tag LOCUS_18540 115061 113925 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923248.1 protein_id gnl|my_center|LOCUS_18540 115191 115069 gene locus_tag LOCUS_18550 115191 115069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 115458 116882 gene locus_tag LOCUS_18560 gene tacA 115458 116882 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921147.1 protein_id gnl|my_center|LOCUS_18560 117994 116885 gene locus_tag LOCUS_18570 117994 116885 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C3 protein_id gnl|my_center|LOCUS_18570 119118 117994 gene locus_tag LOCUS_18580 119118 117994 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H4 protein_id gnl|my_center|LOCUS_18580 120088 119315 gene locus_tag LOCUS_18590 120088 119315 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920743.1 protein_id gnl|my_center|LOCUS_18590 120918 120085 gene locus_tag LOCUS_18600 120918 120085 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC29 protein_id gnl|my_center|LOCUS_18600 121292 121005 gene locus_tag LOCUS_18610 121292 121005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265875.1 protein_id gnl|my_center|LOCUS_18610 121496 121987 gene locus_tag LOCUS_18620 121496 121987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921090.1 protein_id gnl|my_center|LOCUS_18620 124287 121945 gene locus_tag LOCUS_18630 gene fbiC 124287 121945 CDS product FO synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZZ7 protein_id gnl|my_center|LOCUS_18630 124904 124284 gene locus_tag LOCUS_18640 124904 124284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 125875 124901 gene locus_tag LOCUS_18650 125875 124901 CDS product LPPG--FO 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_18650 126642 125872 gene locus_tag LOCUS_18660 126642 125872 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_18660 127358 126639 gene locus_tag LOCUS_18670 127358 126639 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_18670 128825 127506 gene locus_tag LOCUS_18680 128825 127506 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TP24 protein_id gnl|my_center|LOCUS_18680 129068 128829 gene locus_tag LOCUS_18690 129068 128829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 129208 129065 gene locus_tag LOCUS_18700 129208 129065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 131322 129205 gene locus_tag LOCUS_18710 gene fixI1 131322 129205 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708322.1 protein_id gnl|my_center|LOCUS_18710 131765 131319 gene locus_tag LOCUS_18720 131765 131319 CDS product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524997.1 protein_id gnl|my_center|LOCUS_18720 133255 131765 gene locus_tag LOCUS_18730 gene fixG 133255 131765 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971694.1 protein_id gnl|my_center|LOCUS_18730 134177 133242 gene locus_tag LOCUS_18740 gene fixP 134177 133242 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIY8 protein_id gnl|my_center|LOCUS_18740 134340 134170 gene locus_tag LOCUS_18750 134340 134170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 135083 134337 gene locus_tag LOCUS_18760 gene fixO2 135083 134337 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967401.1 protein_id gnl|my_center|LOCUS_18760 136757 135087 gene locus_tag LOCUS_18770 136757 135087 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970735.1 protein_id gnl|my_center|LOCUS_18770 137538 136840 gene locus_tag LOCUS_18780 137538 136840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 138339 137656 gene locus_tag LOCUS_18790 138339 137656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 protein_id gnl|my_center|LOCUS_18790 138873 138403 gene locus_tag LOCUS_18800 138873 138403 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187998.1 protein_id gnl|my_center|LOCUS_18800 138996 141341 gene locus_tag LOCUS_18810 138996 141341 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7Q0 protein_id gnl|my_center|LOCUS_18810 >Feature sequence09 226 136 gene locus_tag LOCUS_t00270 226 136 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 344 688 gene locus_tag LOCUS_18820 344 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225986.1 protein_id gnl|my_center|LOCUS_18820 2794 701 gene locus_tag LOCUS_18830 2794 701 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 protein_id gnl|my_center|LOCUS_18830 3723 2866 gene locus_tag LOCUS_18840 gene hemF 3723 2866 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SC2 protein_id gnl|my_center|LOCUS_18840 3819 4547 gene locus_tag LOCUS_18850 3819 4547 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974363.1 protein_id gnl|my_center|LOCUS_18850 4768 5190 gene locus_tag LOCUS_18860 gene infC 4768 5190 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_18860 5321 6739 gene locus_tag LOCUS_18870 5321 6739 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_18870 7269 6736 gene locus_tag LOCUS_18880 7269 6736 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 protein_id gnl|my_center|LOCUS_18880 7899 7399 gene locus_tag LOCUS_18890 7899 7399 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089884.1 protein_id gnl|my_center|LOCUS_18890 9347 7977 gene locus_tag LOCUS_18900 gene tolB 9347 7977 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 protein_id gnl|my_center|LOCUS_18900 10150 9344 gene locus_tag LOCUS_18910 10150 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 10613 10161 gene locus_tag LOCUS_18920 gene tolR 10613 10161 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089889.1 protein_id gnl|my_center|LOCUS_18920 11323 10613 gene locus_tag LOCUS_18930 gene tolQ 11323 10613 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537914.1 protein_id gnl|my_center|LOCUS_18930 11811 11320 gene locus_tag LOCUS_18940 11811 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 12266 11889 gene locus_tag LOCUS_18950 12266 11889 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_18950 12580 12266 gene locus_tag LOCUS_18960 gene hisE 12580 12266 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50935 protein_id gnl|my_center|LOCUS_18960 12599 13030 gene locus_tag LOCUS_18970 12599 13030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 13716 12958 gene locus_tag LOCUS_18980 gene hisF 13716 12958 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEK3 protein_id gnl|my_center|LOCUS_18980 13928 13713 gene locus_tag LOCUS_18990 13928 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 14660 13932 gene locus_tag LOCUS_19000 gene hisA 14660 13932 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM5 protein_id gnl|my_center|LOCUS_19000 15292 14663 gene locus_tag LOCUS_19010 gene hisH 15292 14663 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEI7 protein_id gnl|my_center|LOCUS_19010 15878 15285 gene locus_tag LOCUS_19020 gene hisB 15878 15285 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA4 protein_id gnl|my_center|LOCUS_19020 15992 16495 gene locus_tag LOCUS_19030 15992 16495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531016.1 protein_id gnl|my_center|LOCUS_19030 16541 16912 gene locus_tag LOCUS_19040 16541 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 16944 17579 gene locus_tag LOCUS_19050 gene gmk 16944 17579 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 protein_id gnl|my_center|LOCUS_19050 20085 17590 gene locus_tag LOCUS_19060 20085 17590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 20290 21129 gene locus_tag LOCUS_19070 gene dapD 20290 21129 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 protein_id gnl|my_center|LOCUS_19070 21222 21374 gene locus_tag LOCUS_19080 21222 21374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 22665 21382 gene locus_tag LOCUS_19090 22665 21382 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_19090 23240 22662 gene locus_tag LOCUS_19100 23240 22662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 23673 23344 gene locus_tag LOCUS_19110 23673 23344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 23939 24274 gene locus_tag LOCUS_19120 23939 24274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 24627 24289 gene locus_tag LOCUS_19130 24627 24289 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967057.1 protein_id gnl|my_center|LOCUS_19130 25112 24699 gene locus_tag LOCUS_19140 25112 24699 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207891.1 protein_id gnl|my_center|LOCUS_19140 25208 25813 gene locus_tag LOCUS_19150 25208 25813 CDS product lipocalin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921307.1 protein_id gnl|my_center|LOCUS_19150 26385 26002 gene locus_tag LOCUS_19160 26385 26002 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_19160 26747 26520 gene locus_tag LOCUS_19170 26747 26520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 26892 27500 gene locus_tag LOCUS_19180 26892 27500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531339.1 protein_id gnl|my_center|LOCUS_19180 28500 27490 gene locus_tag LOCUS_19190 28500 27490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 28949 28497 gene locus_tag LOCUS_19200 28949 28497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 30893 29004 gene locus_tag LOCUS_19210 gene thiC 30893 29004 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TI9 protein_id gnl|my_center|LOCUS_19210 31285 32301 gene locus_tag LOCUS_19220 31285 32301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 32722 32558 gene locus_tag LOCUS_19230 32722 32558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 34495 32846 gene locus_tag LOCUS_19240 34495 32846 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728663.1 protein_id gnl|my_center|LOCUS_19240 34755 36794 gene locus_tag LOCUS_19250 34755 36794 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141702.1 protein_id gnl|my_center|LOCUS_19250 37403 36807 gene locus_tag LOCUS_19260 37403 36807 CDS product UPF0314 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN1 protein_id gnl|my_center|LOCUS_19260 37526 39019 gene locus_tag LOCUS_19270 gene crtI 37526 39019 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_19270 39016 39624 gene locus_tag LOCUS_19280 39016 39624 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CXS5 protein_id gnl|my_center|LOCUS_19280 40546 39653 gene locus_tag LOCUS_19290 40546 39653 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089189.1 protein_id gnl|my_center|LOCUS_19290 40714 42225 gene locus_tag LOCUS_19300 40714 42225 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_19300 43706 42222 gene locus_tag LOCUS_19310 43706 42222 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCZ9 protein_id gnl|my_center|LOCUS_19310 45049 43703 gene locus_tag LOCUS_19320 45049 43703 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532138.1 protein_id gnl|my_center|LOCUS_19320 45077 46276 gene locus_tag LOCUS_19330 gene dinB 45077 46276 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKE5 protein_id gnl|my_center|LOCUS_19330 46740 46258 gene locus_tag LOCUS_19340 46740 46258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 47360 46734 gene locus_tag LOCUS_19350 47360 46734 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688731.1 protein_id gnl|my_center|LOCUS_19350 47885 47424 gene locus_tag LOCUS_19360 47885 47424 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083122.1 protein_id gnl|my_center|LOCUS_19360 48585 48025 gene locus_tag LOCUS_19370 48585 48025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 49078 48707 gene locus_tag LOCUS_19380 49078 48707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 50237 49092 gene locus_tag LOCUS_19390 50237 49092 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_19390 50599 50243 gene locus_tag LOCUS_19400 50599 50243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 50796 50596 gene locus_tag LOCUS_19410 gene fer 50796 50596 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228937.1 protein_id gnl|my_center|LOCUS_19410 52072 50822 gene locus_tag LOCUS_19420 52072 50822 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228930.1 protein_id gnl|my_center|LOCUS_19420 52892 52092 gene locus_tag LOCUS_19430 52892 52092 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_19430 54540 52879 gene locus_tag LOCUS_19440 54540 52879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 55045 54551 gene locus_tag LOCUS_19450 55045 54551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 56531 55056 gene locus_tag LOCUS_19460 56531 55056 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726834.1 protein_id gnl|my_center|LOCUS_19460 58962 56635 gene locus_tag LOCUS_19470 58962 56635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 60638 59004 gene locus_tag LOCUS_19480 60638 59004 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_19480 61537 60656 gene locus_tag LOCUS_19490 gene atuB 61537 60656 CDS product citronellol catabolism dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_19490 62605 61544 gene locus_tag LOCUS_19500 62605 61544 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_19500 63854 62598 gene locus_tag LOCUS_19510 63854 62598 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_19510 64716 63907 gene locus_tag LOCUS_19520 64716 63907 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088192.1 protein_id gnl|my_center|LOCUS_19520 65507 64713 gene locus_tag LOCUS_19530 gene kduD 65507 64713 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087125.1 protein_id gnl|my_center|LOCUS_19530 65912 67069 gene locus_tag LOCUS_19540 65912 67069 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879449.1 protein_id gnl|my_center|LOCUS_19540 67092 68450 gene locus_tag LOCUS_19550 67092 68450 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_19550 69180 68476 gene locus_tag LOCUS_19560 69180 68476 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402868.1 protein_id gnl|my_center|LOCUS_19560 70014 69295 gene locus_tag LOCUS_19570 70014 69295 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_19570 72040 70031 gene locus_tag LOCUS_19580 72040 70031 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 protein_id gnl|my_center|LOCUS_19580 72273 72689 gene locus_tag LOCUS_19590 72273 72689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 74350 72680 gene locus_tag LOCUS_19600 74350 72680 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030732.1 protein_id gnl|my_center|LOCUS_19600 75419 74367 gene locus_tag LOCUS_19610 75419 74367 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 protein_id gnl|my_center|LOCUS_19610 75674 75459 gene locus_tag LOCUS_19620 75674 75459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 76644 75685 gene locus_tag LOCUS_19630 76644 75685 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_19630 78016 76670 gene locus_tag LOCUS_19640 78016 76670 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_19640 79215 78013 gene locus_tag LOCUS_19650 gene fldC 79215 78013 CDS product R-phenyllactate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255773.1 protein_id gnl|my_center|LOCUS_19650 79452 80606 gene locus_tag LOCUS_19660 79452 80606 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927195.1 protein_id gnl|my_center|LOCUS_19660 81528 80623 gene locus_tag LOCUS_19670 81528 80623 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266773.1 protein_id gnl|my_center|LOCUS_19670 83165 81537 gene locus_tag LOCUS_19680 gene cadA 83165 81537 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808140.1 protein_id gnl|my_center|LOCUS_19680 85721 83316 gene locus_tag LOCUS_19690 85721 83316 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919836.1 protein_id gnl|my_center|LOCUS_19690 86758 86042 gene locus_tag LOCUS_19700 86758 86042 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929954.1 protein_id gnl|my_center|LOCUS_19700 86973 87788 gene locus_tag LOCUS_19710 86973 87788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 87854 89122 gene locus_tag LOCUS_19720 87854 89122 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_19720 89128 90213 gene locus_tag LOCUS_19730 89128 90213 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186177.1 protein_id gnl|my_center|LOCUS_19730 90210 91205 gene locus_tag LOCUS_19740 90210 91205 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528521.1 protein_id gnl|my_center|LOCUS_19740 91210 92025 gene locus_tag LOCUS_19750 91210 92025 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088380.1 protein_id gnl|my_center|LOCUS_19750 92048 92809 gene locus_tag LOCUS_19760 gene fabG 92048 92809 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086690.1 protein_id gnl|my_center|LOCUS_19760 93174 92893 gene locus_tag LOCUS_19770 93174 92893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 >Feature sequence10 224 532 gene locus_tag LOCUS_19780 224 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19780 914 1222 gene locus_tag LOCUS_19790 914 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1305 2321 gene locus_tag LOCUS_19800 1305 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2318 2542 gene locus_tag LOCUS_19810 2318 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 protein_id gnl|my_center|LOCUS_19810 3570 2878 gene locus_tag LOCUS_19820 3570 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 6967 3839 gene locus_tag LOCUS_19830 6967 3839 CDS product efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975224.1 protein_id gnl|my_center|LOCUS_19830 8070 6964 gene locus_tag LOCUS_19840 8070 6964 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268201.1 protein_id gnl|my_center|LOCUS_19840 9524 8067 gene locus_tag LOCUS_19850 9524 8067 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946399.1 protein_id gnl|my_center|LOCUS_19850 9819 10427 gene locus_tag LOCUS_19860 9819 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 10489 11610 gene locus_tag LOCUS_19870 10489 11610 CDS product patatin family phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923293.1 protein_id gnl|my_center|LOCUS_19870 12398 12745 gene locus_tag LOCUS_19880 12398 12745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 12801 14243 gene locus_tag LOCUS_19890 12801 14243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 14266 14808 gene locus_tag LOCUS_19900 14266 14808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 14756 15949 gene locus_tag LOCUS_19910 14756 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 16211 16996 gene locus_tag LOCUS_19920 16211 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966077.1 protein_id gnl|my_center|LOCUS_19920 17204 16947 gene locus_tag LOCUS_19930 17204 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 18290 17322 gene locus_tag LOCUS_19940 18290 17322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 19142 18291 gene locus_tag LOCUS_19950 19142 18291 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726627.1 protein_id gnl|my_center|LOCUS_19950 19836 19204 gene locus_tag LOCUS_19960 19836 19204 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_19960 20472 19912 gene locus_tag LOCUS_19970 20472 19912 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_234853.2 protein_id gnl|my_center|LOCUS_19970 21213 20515 gene locus_tag LOCUS_19980 21213 20515 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4C8 protein_id gnl|my_center|LOCUS_19980 21314 22204 gene locus_tag LOCUS_19990 21314 22204 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967190.1 protein_id gnl|my_center|LOCUS_19990 22839 22213 gene locus_tag LOCUS_20000 22839 22213 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724650.1 protein_id gnl|my_center|LOCUS_20000 23317 24690 gene locus_tag LOCUS_20010 23317 24690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087068.1 protein_id gnl|my_center|LOCUS_20010 24683 25420 gene locus_tag LOCUS_20020 24683 25420 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087067.1 protein_id gnl|my_center|LOCUS_20020 25417 26514 gene locus_tag LOCUS_20030 25417 26514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 26526 27710 gene locus_tag LOCUS_20040 26526 27710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 27707 28501 gene locus_tag LOCUS_20050 27707 28501 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_20050 28767 29630 gene locus_tag LOCUS_20060 28767 29630 CDS product nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389186.1 protein_id gnl|my_center|LOCUS_20060 29627 30355 gene locus_tag LOCUS_20070 29627 30355 CDS product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917920.1 protein_id gnl|my_center|LOCUS_20070 30821 30360 gene locus_tag LOCUS_20080 gene tadA 30821 30360 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DE3 protein_id gnl|my_center|LOCUS_20080 30942 31229 gene locus_tag LOCUS_20090 gene rpmB 30942 31229 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9V8 protein_id gnl|my_center|LOCUS_20090 32317 31283 gene locus_tag LOCUS_20100 32317 31283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 33260 32331 gene locus_tag LOCUS_20110 33260 32331 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 protein_id gnl|my_center|LOCUS_20110 33475 33272 gene locus_tag LOCUS_20120 33475 33272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968840.1 protein_id gnl|my_center|LOCUS_20120 34984 33500 gene locus_tag LOCUS_20130 gene xseA 34984 33500 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYM1 protein_id gnl|my_center|LOCUS_20130 34983 36293 gene locus_tag LOCUS_20140 gene purD 34983 36293 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T902 protein_id gnl|my_center|LOCUS_20140 36775 36332 gene locus_tag LOCUS_20150 36775 36332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 37851 36859 gene locus_tag LOCUS_20160 37851 36859 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921560.1 protein_id gnl|my_center|LOCUS_20160 38000 38428 gene locus_tag LOCUS_20170 38000 38428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 38802 38452 gene locus_tag LOCUS_20180 38802 38452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390318.1 protein_id gnl|my_center|LOCUS_20180 39296 38799 gene locus_tag LOCUS_20190 39296 38799 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809464.1 protein_id gnl|my_center|LOCUS_20190 39784 39293 gene locus_tag LOCUS_20200 39784 39293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 41009 39795 gene locus_tag LOCUS_20210 41009 39795 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR78 protein_id gnl|my_center|LOCUS_20210 41764 41006 gene locus_tag LOCUS_20220 41764 41006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 42504 41761 gene locus_tag LOCUS_20230 gene sufC 42504 41761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919728.1 protein_id gnl|my_center|LOCUS_20230 43022 42504 gene locus_tag LOCUS_20240 43022 42504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 44494 43019 gene locus_tag LOCUS_20250 gene sufB 44494 43019 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919730.1 protein_id gnl|my_center|LOCUS_20250 44907 44491 gene locus_tag LOCUS_20260 44907 44491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 45324 46373 gene locus_tag LOCUS_20270 gene pyrD 45324 46373 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKQ4 protein_id gnl|my_center|LOCUS_20270 46384 48123 gene locus_tag LOCUS_20280 gene ggt 46384 48123 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339171.1 protein_id gnl|my_center|LOCUS_20280 48191 49990 gene locus_tag LOCUS_20290 48191 49990 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_20290 51380 50004 gene locus_tag LOCUS_20300 gene gltX2 51380 50004 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZQ8 protein_id gnl|my_center|LOCUS_20300 51540 52391 gene locus_tag LOCUS_20310 51540 52391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918996.1 protein_id gnl|my_center|LOCUS_20310 52388 53431 gene locus_tag LOCUS_20320 52388 53431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 53915 57307 gene locus_tag LOCUS_20330 53915 57307 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085761.1 protein_id gnl|my_center|LOCUS_20330 57310 59823 gene locus_tag LOCUS_20340 57310 59823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085762.1 protein_id gnl|my_center|LOCUS_20340 59820 60722 gene locus_tag LOCUS_20350 59820 60722 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085763.1 protein_id gnl|my_center|LOCUS_20350 62328 60754 gene locus_tag LOCUS_20360 gene guaA 62328 60754 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SQ3 protein_id gnl|my_center|LOCUS_20360 62513 63424 gene locus_tag LOCUS_20370 gene argB 62513 63424 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP10 protein_id gnl|my_center|LOCUS_20370 63440 64042 gene locus_tag LOCUS_20380 63440 64042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 64145 64438 gene locus_tag LOCUS_20390 64145 64438 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528977.1 protein_id gnl|my_center|LOCUS_20390 64452 65348 gene locus_tag LOCUS_20400 gene folD 64452 65348 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAJ9 protein_id gnl|my_center|LOCUS_20400 66003 65383 gene locus_tag LOCUS_20410 gene lonD 66003 65383 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973262.1 protein_id gnl|my_center|LOCUS_20410 66935 66021 gene locus_tag LOCUS_20420 gene trxA 66935 66021 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083423.1 protein_id gnl|my_center|LOCUS_20420 67138 67212 gene locus_tag LOCUS_t00280 67138 67212 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 67446 68261 gene locus_tag LOCUS_20430 67446 68261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 69081 69488 gene locus_tag LOCUS_20440 69081 69488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 71654 69546 gene locus_tag LOCUS_20450 71654 69546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 72199 71732 gene locus_tag LOCUS_20460 72199 71732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 72614 72276 gene locus_tag LOCUS_20470 72614 72276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 73267 72611 gene locus_tag LOCUS_20480 73267 72611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 73328 74272 gene locus_tag LOCUS_20490 73328 74272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_20490 74272 74718 gene locus_tag LOCUS_20500 74272 74718 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389406.1 protein_id gnl|my_center|LOCUS_20500 74715 75134 gene locus_tag LOCUS_20510 74715 75134 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 protein_id gnl|my_center|LOCUS_20510 75134 75547 gene locus_tag LOCUS_20520 75134 75547 CDS product TIGR01244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 protein_id gnl|my_center|LOCUS_20520 75719 76798 gene locus_tag LOCUS_20530 75719 76798 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102993.1 protein_id gnl|my_center|LOCUS_20530 76835 78592 gene locus_tag LOCUS_20540 76835 78592 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_20540 78845 79312 gene locus_tag LOCUS_20550 78845 79312 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_20550 79652 80185 gene locus_tag LOCUS_20560 79652 80185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 80220 80849 gene locus_tag LOCUS_20570 80220 80849 CDS product antioxidant protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114495.1 protein_id gnl|my_center|LOCUS_20570 80940 82286 gene locus_tag LOCUS_20580 80940 82286 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974382.1 protein_id gnl|my_center|LOCUS_20580 82286 83281 gene locus_tag LOCUS_20590 82286 83281 CDS product ubiquinol oxidase subunit II, cyanide insensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974381.1 protein_id gnl|my_center|LOCUS_20590 83447 84058 gene locus_tag LOCUS_20600 83447 84058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331288.1 protein_id gnl|my_center|LOCUS_20600 84167 84547 gene locus_tag LOCUS_20610 84167 84547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 84591 85043 gene locus_tag LOCUS_20620 84591 85043 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 protein_id gnl|my_center|LOCUS_20620 85096 86448 gene locus_tag LOCUS_20630 85096 86448 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_20630 88021 86762 gene locus_tag LOCUS_20640 88021 86762 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_20640 88301 88023 gene locus_tag LOCUS_20650 88301 88023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence11 184 501 gene locus_tag LOCUS_20660 184 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 987 553 gene locus_tag LOCUS_20670 987 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 1571 984 gene locus_tag LOCUS_20680 1571 984 CDS product putative biphenyl-2,3-diol 1,2-dioxygenase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705084.1 protein_id gnl|my_center|LOCUS_20680 2082 1708 gene locus_tag LOCUS_20690 2082 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2885 2142 gene locus_tag LOCUS_20700 2885 2142 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811309.1 protein_id gnl|my_center|LOCUS_20700 3756 2944 gene locus_tag LOCUS_20710 3756 2944 CDS product putative short-chain type dehydrogenase/reductase y4lA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55541 protein_id gnl|my_center|LOCUS_20710 4201 3839 gene locus_tag LOCUS_20720 4201 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896239.1 protein_id gnl|my_center|LOCUS_20720 5463 4198 gene locus_tag LOCUS_20730 5463 4198 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726818.1 protein_id gnl|my_center|LOCUS_20730 5541 6275 gene locus_tag LOCUS_20740 5541 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 6674 6288 gene locus_tag LOCUS_20750 6674 6288 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728127.1 protein_id gnl|my_center|LOCUS_20750 7449 6757 gene locus_tag LOCUS_20760 7449 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 7671 8522 gene locus_tag LOCUS_20770 7671 8522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_20770 8629 9384 gene locus_tag LOCUS_20780 8629 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 11055 9439 gene locus_tag LOCUS_20790 11055 9439 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083241.1 protein_id gnl|my_center|LOCUS_20790 12156 11188 gene locus_tag LOCUS_20800 12156 11188 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089169.1 protein_id gnl|my_center|LOCUS_20800 12331 13494 gene locus_tag LOCUS_20810 12331 13494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701068.1 protein_id gnl|my_center|LOCUS_20810 13730 14764 gene locus_tag LOCUS_20820 13730 14764 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728253.1 protein_id gnl|my_center|LOCUS_20820 14806 16020 gene locus_tag LOCUS_20830 14806 16020 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_20830 16020 16532 gene locus_tag LOCUS_20840 16020 16532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 17315 16560 gene locus_tag LOCUS_20850 17315 16560 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_20850 17528 17872 gene locus_tag LOCUS_20860 17528 17872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 17896 19161 gene locus_tag LOCUS_20870 17896 19161 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726824.1 protein_id gnl|my_center|LOCUS_20870 19466 19885 gene locus_tag LOCUS_20880 19466 19885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 21902 19935 gene locus_tag LOCUS_20890 gene acsA 21902 19935 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WV5 protein_id gnl|my_center|LOCUS_20890 22922 21978 gene locus_tag LOCUS_20900 22922 21978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 23917 22970 gene locus_tag LOCUS_20910 23917 22970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 24138 25352 gene locus_tag LOCUS_20920 24138 25352 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728130.1 protein_id gnl|my_center|LOCUS_20920 25352 25849 gene locus_tag LOCUS_20930 25352 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 25976 26860 gene locus_tag LOCUS_20940 25976 26860 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975760.1 protein_id gnl|my_center|LOCUS_20940 27084 28280 gene locus_tag LOCUS_20950 27084 28280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 28390 29589 gene locus_tag LOCUS_20960 28390 29589 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083717.1 protein_id gnl|my_center|LOCUS_20960 29628 31106 gene locus_tag LOCUS_20970 29628 31106 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090334.1 protein_id gnl|my_center|LOCUS_20970 31117 32769 gene locus_tag LOCUS_20980 31117 32769 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_20980 32805 33857 gene locus_tag LOCUS_20990 32805 33857 CDS product NAD-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_20990 34286 33909 gene locus_tag LOCUS_21000 34286 33909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 34643 35221 gene locus_tag LOCUS_21010 34643 35221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 35229 36014 gene locus_tag LOCUS_21020 35229 36014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 36028 36870 gene locus_tag LOCUS_21030 36028 36870 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067339.1 protein_id gnl|my_center|LOCUS_21030 36921 37964 gene locus_tag LOCUS_21040 36921 37964 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103810.1 protein_id gnl|my_center|LOCUS_21040 38117 38800 gene locus_tag LOCUS_21050 38117 38800 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705261.1 protein_id gnl|my_center|LOCUS_21050 38815 39456 gene locus_tag LOCUS_21060 gene catJ 38815 39456 CDS product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807676.1 protein_id gnl|my_center|LOCUS_21060 39464 40243 gene locus_tag LOCUS_21070 gene caiD 39464 40243 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787370.1 protein_id gnl|my_center|LOCUS_21070 40240 41025 gene locus_tag LOCUS_21080 gene paaG 40240 41025 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223512.1 protein_id gnl|my_center|LOCUS_21080 41589 41053 gene locus_tag LOCUS_21090 gene nusG 41589 41053 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J68 protein_id gnl|my_center|LOCUS_21090 41824 41630 gene locus_tag LOCUS_21100 41824 41630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 42110 43627 gene locus_tag LOCUS_21110 42110 43627 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_21110 44017 43942 gene locus_tag LOCUS_t00290 44017 43942 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 44194 45000 gene locus_tag LOCUS_21120 44194 45000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 45063 45503 gene locus_tag LOCUS_21130 45063 45503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 45874 45476 gene locus_tag LOCUS_21140 45874 45476 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087052.1 protein_id gnl|my_center|LOCUS_21140 46515 45964 gene locus_tag LOCUS_21150 46515 45964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 46982 46491 gene locus_tag LOCUS_21160 46982 46491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 47206 48939 gene locus_tag LOCUS_21170 47206 48939 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640164.1 protein_id gnl|my_center|LOCUS_21170 49236 48967 gene locus_tag LOCUS_21180 49236 48967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 49838 49233 gene locus_tag LOCUS_21190 49838 49233 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731337.1 protein_id gnl|my_center|LOCUS_21190 50553 49825 gene locus_tag LOCUS_21200 50553 49825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 51098 50700 gene locus_tag LOCUS_21210 51098 50700 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037778.1 protein_id gnl|my_center|LOCUS_21210 52626 51127 gene locus_tag LOCUS_21220 52626 51127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 52796 53092 gene locus_tag LOCUS_21230 52796 53092 CDS product polyhydroxyalkanoic acid system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640665.1 protein_id gnl|my_center|LOCUS_21230 53540 53100 gene locus_tag LOCUS_21240 53540 53100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_21240 54376 53600 gene locus_tag LOCUS_21250 54376 53600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 54873 54412 gene locus_tag LOCUS_21260 54873 54412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 55682 54870 gene locus_tag LOCUS_21270 55682 54870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 56665 55688 gene locus_tag LOCUS_21280 56665 55688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523363.1 protein_id gnl|my_center|LOCUS_21280 57669 56668 gene locus_tag LOCUS_21290 57669 56668 CDS product pilus assembly protein TadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563827.1 protein_id gnl|my_center|LOCUS_21290 59077 57671 gene locus_tag LOCUS_21300 59077 57671 CDS product Flp pilus assembly protein, ATPase CpaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337065.1 protein_id gnl|my_center|LOCUS_21300 60279 59074 gene locus_tag LOCUS_21310 60279 59074 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531961.1 protein_id gnl|my_center|LOCUS_21310 60917 60294 gene locus_tag LOCUS_21320 60917 60294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 61408 60914 gene locus_tag LOCUS_21330 61408 60914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 62958 61405 gene locus_tag LOCUS_21340 62958 61405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887182.1 protein_id gnl|my_center|LOCUS_21340 63290 62976 gene locus_tag LOCUS_21350 63290 62976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 64764 63280 gene locus_tag LOCUS_21360 64764 63280 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337067.1 protein_id gnl|my_center|LOCUS_21360 65665 64769 gene locus_tag LOCUS_21370 65665 64769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 65942 65757 gene locus_tag LOCUS_21380 65942 65757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 66373 67200 gene locus_tag LOCUS_21390 66373 67200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 67283 68269 gene locus_tag LOCUS_21400 67283 68269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 69085 68279 gene locus_tag LOCUS_21410 69085 68279 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388679.1 protein_id gnl|my_center|LOCUS_21410 70140 69082 gene locus_tag LOCUS_21420 70140 69082 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921445.1 protein_id gnl|my_center|LOCUS_21420 70546 70935 gene locus_tag LOCUS_21430 70546 70935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 70925 72352 gene locus_tag LOCUS_21440 gene dur3 70925 72352 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124139.1 protein_id gnl|my_center|LOCUS_21440 72349 72471 gene locus_tag LOCUS_21450 72349 72471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 72465 73559 gene locus_tag LOCUS_21460 gene pyrB 72465 73559 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329097.1 protein_id gnl|my_center|LOCUS_21460 73609 75549 gene locus_tag LOCUS_21470 gene asnB 73609 75549 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 protein_id gnl|my_center|LOCUS_21470 75988 75599 gene locus_tag LOCUS_21480 75988 75599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 77276 76032 gene locus_tag LOCUS_21490 gene amaB 77276 76032 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124142.1 protein_id gnl|my_center|LOCUS_21490 77728 77803 gene locus_tag LOCUS_t00300 77728 77803 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 77778 78095 gene locus_tag LOCUS_21500 77778 78095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 78117 78566 gene locus_tag LOCUS_21510 78117 78566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence12 355 687 gene locus_tag LOCUS_21520 355 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 946 870 gene locus_tag LOCUS_t00310 946 870 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1629 1075 gene locus_tag LOCUS_21530 1629 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 2597 1626 gene locus_tag LOCUS_21540 2597 1626 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919550.1 protein_id gnl|my_center|LOCUS_21540 3873 2611 gene locus_tag LOCUS_21550 3873 2611 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC2 protein_id gnl|my_center|LOCUS_21550 4315 4046 gene locus_tag LOCUS_21560 gene acpP 4315 4046 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKN9 protein_id gnl|my_center|LOCUS_21560 6204 4420 gene locus_tag LOCUS_21570 gene aspS 6204 4420 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7M8 protein_id gnl|my_center|LOCUS_21570 6203 7567 gene locus_tag LOCUS_21580 gene rnd 6203 7567 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7L8 protein_id gnl|my_center|LOCUS_21580 7564 8460 gene locus_tag LOCUS_21590 7564 8460 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_21590 8564 8758 gene locus_tag LOCUS_21600 8564 8758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 9388 8780 gene locus_tag LOCUS_21610 9388 8780 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_21610 9500 10813 gene locus_tag LOCUS_21620 9500 10813 CDS product 2-acyl-glycerophospho-ethanolamine acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946946.1 protein_id gnl|my_center|LOCUS_21620 11054 10830 gene locus_tag LOCUS_21630 11054 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 11538 11125 gene locus_tag LOCUS_21640 11538 11125 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528904.1 protein_id gnl|my_center|LOCUS_21640 11602 12543 gene locus_tag LOCUS_21650 11602 12543 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_21650 12686 14368 gene locus_tag LOCUS_21660 12686 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 14455 15264 gene locus_tag LOCUS_21670 gene dapF 14455 15264 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y853 protein_id gnl|my_center|LOCUS_21670 15261 16433 gene locus_tag LOCUS_21680 15261 16433 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970514.1 protein_id gnl|my_center|LOCUS_21680 16430 17353 gene locus_tag LOCUS_21690 gene ftsY 16430 17353 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X49 protein_id gnl|my_center|LOCUS_21690 17353 18000 gene locus_tag LOCUS_21700 17353 18000 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L49 protein_id gnl|my_center|LOCUS_21700 19985 18030 gene locus_tag LOCUS_21710 gene kup 19985 18030 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y19 protein_id gnl|my_center|LOCUS_21710 20717 20082 gene locus_tag LOCUS_21720 20717 20082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 21154 20714 gene locus_tag LOCUS_21730 gene ccmH 21154 20714 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45405 protein_id gnl|my_center|LOCUS_21730 21690 21151 gene locus_tag LOCUS_21740 gene ccmG 21690 21151 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336994.1 protein_id gnl|my_center|LOCUS_21740 23642 21687 gene locus_tag LOCUS_21750 gene cycK 23642 21687 CDS product cytochrome c-type biogenesis protein CycK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45403 protein_id gnl|my_center|LOCUS_21750 24132 23671 gene locus_tag LOCUS_21760 gene ccmE 24132 23671 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8M7 protein_id gnl|my_center|LOCUS_21760 24269 24129 gene locus_tag LOCUS_21770 24269 24129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 24997 24272 gene locus_tag LOCUS_21780 24997 24272 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_21780 26245 25091 gene locus_tag LOCUS_21790 26245 25091 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919943.1 protein_id gnl|my_center|LOCUS_21790 26279 26203 gene locus_tag LOCUS_t00320 26279 26203 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 26479 27051 gene locus_tag LOCUS_21800 26479 27051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 27363 27136 gene locus_tag LOCUS_21810 gene rpmE 27363 27136 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9I5 protein_id gnl|my_center|LOCUS_21810 27935 27468 gene locus_tag LOCUS_21820 gene fabZ 27935 27468 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A714 protein_id gnl|my_center|LOCUS_21820 28643 27966 gene locus_tag LOCUS_21830 28643 27966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 31396 28643 gene locus_tag LOCUS_21840 gene bamA 31396 28643 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A711 protein_id gnl|my_center|LOCUS_21840 32755 31640 gene locus_tag LOCUS_21850 32755 31640 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL7 protein_id gnl|my_center|LOCUS_21850 33927 32752 gene locus_tag LOCUS_21860 gene dxr 33927 32752 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_21860 34621 33929 gene locus_tag LOCUS_21870 34621 33929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 35345 34671 gene locus_tag LOCUS_21880 35345 34671 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Z8 protein_id gnl|my_center|LOCUS_21880 35941 35384 gene locus_tag LOCUS_21890 gene frr 35941 35384 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KP6 protein_id gnl|my_center|LOCUS_21890 36667 35945 gene locus_tag LOCUS_21900 gene pyrH 36667 35945 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A705 protein_id gnl|my_center|LOCUS_21900 37761 36835 gene locus_tag LOCUS_21910 gene tsf 37761 36835 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU08 protein_id gnl|my_center|LOCUS_21910 37924 37739 gene locus_tag LOCUS_21920 37924 37739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 38660 37863 gene locus_tag LOCUS_21930 gene rpsB 38660 37863 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A703 protein_id gnl|my_center|LOCUS_21930 38826 38623 gene locus_tag LOCUS_21940 38826 38623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 39036 39311 gene locus_tag LOCUS_21950 39036 39311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 40148 39342 gene locus_tag LOCUS_21960 40148 39342 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_21960 40810 40148 gene locus_tag LOCUS_21970 gene psd 40810 40148 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY9 protein_id gnl|my_center|LOCUS_21970 41044 42147 gene locus_tag LOCUS_21980 41044 42147 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482300.1 protein_id gnl|my_center|LOCUS_21980 42583 43521 gene locus_tag LOCUS_21990 42583 43521 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975458.1 protein_id gnl|my_center|LOCUS_21990 43780 44232 gene locus_tag LOCUS_22000 43780 44232 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_22000 44412 44636 gene locus_tag LOCUS_22010 44412 44636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 45482 44676 gene locus_tag LOCUS_22020 gene istB 45482 44676 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163403.1 protein_id gnl|my_center|LOCUS_22020 47007 45472 gene locus_tag LOCUS_22030 gene istA 47007 45472 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324342.1 protein_id gnl|my_center|LOCUS_22030 47782 47105 gene locus_tag LOCUS_22040 47782 47105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 48075 47990 gene locus_tag LOCUS_t00330 48075 47990 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 48229 49023 gene locus_tag LOCUS_22050 48229 49023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 49373 49101 gene locus_tag LOCUS_22060 49373 49101 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_22060 52014 49612 gene locus_tag LOCUS_22070 gene lon 52014 49612 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU43 protein_id gnl|my_center|LOCUS_22070 52552 52211 gene locus_tag LOCUS_22080 52552 52211 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BN3 protein_id gnl|my_center|LOCUS_22080 54446 52557 gene locus_tag LOCUS_22090 gene dnaX 54446 52557 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338432.1 protein_id gnl|my_center|LOCUS_22090 54903 54661 gene locus_tag LOCUS_22100 54903 54661 CDS product NADH-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919265.1 protein_id gnl|my_center|LOCUS_22100 57385 54956 gene locus_tag LOCUS_22110 57385 54956 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640169.1 protein_id gnl|my_center|LOCUS_22110 58411 57401 gene locus_tag LOCUS_22120 58411 57401 CDS product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_22120 58421 58771 gene locus_tag LOCUS_22130 58421 58771 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709705.1 protein_id gnl|my_center|LOCUS_22130 60239 58809 gene locus_tag LOCUS_22140 60239 58809 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_22140 60921 60244 gene locus_tag LOCUS_22150 60921 60244 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 protein_id gnl|my_center|LOCUS_22150 61353 61030 gene locus_tag LOCUS_22160 61353 61030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 62145 61423 gene locus_tag LOCUS_22170 gene bp26 62145 61423 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037741.1 protein_id gnl|my_center|LOCUS_22170 62262 64085 gene locus_tag LOCUS_22180 62262 64085 CDS product elongation factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337683.1 protein_id gnl|my_center|LOCUS_22180 64555 64082 gene locus_tag LOCUS_22190 64555 64082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 64665 65237 gene locus_tag LOCUS_22200 64665 65237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 65258 66421 gene locus_tag LOCUS_22210 65258 66421 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_22210 67408 66422 gene locus_tag LOCUS_22220 67408 66422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22220 69023 67419 gene locus_tag LOCUS_22230 69023 67419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22230 69361 69032 gene locus_tag LOCUS_22240 gene yajC 69361 69032 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 protein_id gnl|my_center|LOCUS_22240 69543 69376 gene locus_tag LOCUS_22250 69543 69376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 69626 69702 gene locus_tag LOCUS_t00340 69626 69702 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 69913 70821 gene locus_tag LOCUS_22260 69913 70821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 70894 71091 gene locus_tag LOCUS_22270 70894 71091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 71139 71651 gene locus_tag LOCUS_22280 71139 71651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 71856 72227 gene locus_tag LOCUS_22290 71856 72227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 72224 74050 gene locus_tag LOCUS_22300 72224 74050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 74050 76818 gene locus_tag LOCUS_22310 gene trwC 74050 76818 CDS product conjugative relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_22310 77046 77564 gene locus_tag LOCUS_22320 77046 77564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence13 728 444 gene locus_tag LOCUS_22330 728 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22330 1412 1035 gene locus_tag LOCUS_22340 1412 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1782 1588 gene locus_tag LOCUS_22350 1782 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2019 3362 gene locus_tag LOCUS_22360 2019 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 3362 4480 gene locus_tag LOCUS_22370 3362 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 4477 7566 gene locus_tag LOCUS_22380 4477 7566 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_22380 8201 9196 gene locus_tag LOCUS_22390 8201 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 9196 12297 gene locus_tag LOCUS_22400 9196 12297 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144156.1 protein_id gnl|my_center|LOCUS_22400 12294 13667 gene locus_tag LOCUS_22410 12294 13667 CDS product outer membrane efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040021.1 protein_id gnl|my_center|LOCUS_22410 13678 14253 gene locus_tag LOCUS_22420 13678 14253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 14908 14180 gene locus_tag LOCUS_22430 14908 14180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 15613 15095 gene locus_tag LOCUS_22440 15613 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 16954 15638 gene locus_tag LOCUS_22450 16954 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 18759 16951 gene locus_tag LOCUS_22460 gene copA 18759 16951 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931403.1 protein_id gnl|my_center|LOCUS_22460 19300 18815 gene locus_tag LOCUS_22470 19300 18815 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_22470 19816 19382 gene locus_tag LOCUS_22480 19816 19382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 20116 19820 gene locus_tag LOCUS_22490 20116 19820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 20250 20954 gene locus_tag LOCUS_22500 20250 20954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 20951 21415 gene locus_tag LOCUS_22510 20951 21415 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389385.1 protein_id gnl|my_center|LOCUS_22510 21619 21900 gene locus_tag LOCUS_22520 21619 21900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 22254 22024 gene locus_tag LOCUS_22530 22254 22024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 22195 22800 gene locus_tag LOCUS_22540 22195 22800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 23082 24431 gene locus_tag LOCUS_22550 23082 24431 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_22550 24428 24841 gene locus_tag LOCUS_22560 24428 24841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 24838 25365 gene locus_tag LOCUS_22570 24838 25365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_22570 25362 25850 gene locus_tag LOCUS_22580 25362 25850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 25944 26663 gene locus_tag LOCUS_22590 25944 26663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 26707 28059 gene locus_tag LOCUS_22600 26707 28059 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_22600 30363 29701 gene locus_tag LOCUS_22610 30363 29701 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061872.1 protein_id gnl|my_center|LOCUS_22610 33063 30499 gene locus_tag LOCUS_22620 33063 30499 CDS product vitamin K epoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969748.1 protein_id gnl|my_center|LOCUS_22620 33523 33158 gene locus_tag LOCUS_22630 33523 33158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 34043 34675 gene locus_tag LOCUS_22640 34043 34675 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_22640 34850 36421 gene locus_tag LOCUS_22650 34850 36421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 36437 36883 gene locus_tag LOCUS_22660 36437 36883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886973.1 protein_id gnl|my_center|LOCUS_22660 37356 36898 gene locus_tag LOCUS_22670 37356 36898 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811033.1 protein_id gnl|my_center|LOCUS_22670 37495 37761 gene locus_tag LOCUS_22680 37495 37761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 37847 38143 gene locus_tag LOCUS_22690 37847 38143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 38437 38682 gene locus_tag LOCUS_22700 38437 38682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 38806 40035 gene locus_tag LOCUS_22710 38806 40035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 40092 41543 gene locus_tag LOCUS_22720 40092 41543 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817192.1 protein_id gnl|my_center|LOCUS_22720 41540 44707 gene locus_tag LOCUS_22730 gene cusA 41540 44707 CDS product cation efflux system protein CusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38054 protein_id gnl|my_center|LOCUS_22730 44686 45084 gene locus_tag LOCUS_22740 44686 45084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 45404 47761 gene locus_tag LOCUS_22750 45404 47761 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 protein_id gnl|my_center|LOCUS_22750 47875 48297 gene locus_tag LOCUS_22760 47875 48297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 50249 48318 gene locus_tag LOCUS_22770 50249 48318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115264.1 protein_id gnl|my_center|LOCUS_22770 50958 50341 gene locus_tag LOCUS_22780 50958 50341 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_22780 51034 51432 gene locus_tag LOCUS_22790 51034 51432 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336988.1 protein_id gnl|my_center|LOCUS_22790 52966 51572 gene locus_tag LOCUS_22800 52966 51572 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_22800 54603 52963 gene locus_tag LOCUS_22810 54603 52963 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_22810 55174 54695 gene locus_tag LOCUS_22820 55174 54695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 55828 55199 gene locus_tag LOCUS_22830 55828 55199 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530543.1 protein_id gnl|my_center|LOCUS_22830 56196 55825 gene locus_tag LOCUS_22840 56196 55825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 59530 56219 gene locus_tag LOCUS_22850 59530 56219 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920570.1 protein_id gnl|my_center|LOCUS_22850 60668 59520 gene locus_tag LOCUS_22860 60668 59520 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920568.1 protein_id gnl|my_center|LOCUS_22860 61933 60680 gene locus_tag LOCUS_22870 61933 60680 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_22870 62371 61997 gene locus_tag LOCUS_22880 62371 61997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 63448 62495 gene locus_tag LOCUS_22890 63448 62495 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806898.1 protein_id gnl|my_center|LOCUS_22890 64517 63579 gene locus_tag LOCUS_22900 64517 63579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967479.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence14 878 99 gene locus_tag LOCUS_22910 878 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2835 862 gene locus_tag LOCUS_22920 gene vexE 2835 862 CDS product Vi polysaccharide export protein VexE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43112 protein_id gnl|my_center|LOCUS_22920 4211 2826 gene locus_tag LOCUS_22930 4211 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 4967 4230 gene locus_tag LOCUS_22940 gene rkpS 4967 4230 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887056.1 protein_id gnl|my_center|LOCUS_22940 5778 4969 gene locus_tag LOCUS_22950 gene vexB 5778 4969 CDS product Vi polysaccharide export inner-membrane protein VexB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43109 protein_id gnl|my_center|LOCUS_22950 6776 5775 gene locus_tag LOCUS_22960 6776 5775 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338467.1 protein_id gnl|my_center|LOCUS_22960 8622 6874 gene locus_tag LOCUS_22970 gene vipC 8622 6874 CDS product Vi polysaccharide biosynthesis protein VipC/TviE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04975 protein_id gnl|my_center|LOCUS_22970 11139 8800 gene locus_tag LOCUS_22980 gene tviD 11139 8800 CDS product Vi polysaccharide biosynthesis protein TviD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04974 protein_id gnl|my_center|LOCUS_22980 12416 11766 gene locus_tag LOCUS_22990 12416 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 12415 13185 gene locus_tag LOCUS_23000 gene modA 12415 13185 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972401.1 protein_id gnl|my_center|LOCUS_23000 13191 13892 gene locus_tag LOCUS_23010 gene modB 13191 13892 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038307.1 protein_id gnl|my_center|LOCUS_23010 13882 14505 gene locus_tag LOCUS_23020 13882 14505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 14550 16058 gene locus_tag LOCUS_23030 14550 16058 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_23030 16891 16073 gene locus_tag LOCUS_23040 16891 16073 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_23040 17786 16929 gene locus_tag LOCUS_23050 gene purU 17786 16929 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89HN5 protein_id gnl|my_center|LOCUS_23050 18201 17887 gene locus_tag LOCUS_23060 18201 17887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 18354 19388 gene locus_tag LOCUS_23070 18354 19388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 19586 19855 gene locus_tag LOCUS_23080 19586 19855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 20145 19879 gene locus_tag LOCUS_23090 20145 19879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 20513 20178 gene locus_tag LOCUS_23100 20513 20178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 21250 20645 gene locus_tag LOCUS_23110 21250 20645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 21730 21278 gene locus_tag LOCUS_23120 21730 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 22477 21821 gene locus_tag LOCUS_23130 22477 21821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039537.1 protein_id gnl|my_center|LOCUS_23130 23672 22656 gene locus_tag LOCUS_23140 gene trpS 23672 22656 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG6 protein_id gnl|my_center|LOCUS_23140 25282 23678 gene locus_tag LOCUS_23150 25282 23678 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 protein_id gnl|my_center|LOCUS_23150 25837 25307 gene locus_tag LOCUS_23160 gene secB 25837 25307 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN7 protein_id gnl|my_center|LOCUS_23160 26113 26772 gene locus_tag LOCUS_23170 26113 26772 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_23170 26762 28048 gene locus_tag LOCUS_23180 26762 28048 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391354.1 protein_id gnl|my_center|LOCUS_23180 28045 28620 gene locus_tag LOCUS_23190 28045 28620 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385484.1 protein_id gnl|my_center|LOCUS_23190 30222 28633 gene locus_tag LOCUS_23200 30222 28633 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920757.1 protein_id gnl|my_center|LOCUS_23200 30879 30313 gene locus_tag LOCUS_23210 30879 30313 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920756.1 protein_id gnl|my_center|LOCUS_23210 32123 31056 gene locus_tag LOCUS_23220 gene aroC 32123 31056 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3W7 protein_id gnl|my_center|LOCUS_23220 32204 32812 gene locus_tag LOCUS_23230 gene ruvA 32204 32812 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIH6 protein_id gnl|my_center|LOCUS_23230 33186 32869 gene locus_tag LOCUS_23240 33186 32869 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022494.1 protein_id gnl|my_center|LOCUS_23240 33249 34301 gene locus_tag LOCUS_23250 gene ruvB 33249 34301 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TN03 protein_id gnl|my_center|LOCUS_23250 35301 34765 gene locus_tag LOCUS_23260 35301 34765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 35970 35362 gene locus_tag LOCUS_23270 35970 35362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 38886 36211 gene locus_tag LOCUS_23280 38886 36211 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNJ0 protein_id gnl|my_center|LOCUS_23280 39955 39065 gene locus_tag LOCUS_23290 39955 39065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530053.1 protein_id gnl|my_center|LOCUS_23290 40150 41568 gene locus_tag LOCUS_23300 40150 41568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 41983 41576 gene locus_tag LOCUS_23310 41983 41576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 41897 42106 gene locus_tag LOCUS_23320 41897 42106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 42300 42812 gene locus_tag LOCUS_23330 42300 42812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 43368 42841 gene locus_tag LOCUS_23340 43368 42841 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090849.1 protein_id gnl|my_center|LOCUS_23340 44496 43420 gene locus_tag LOCUS_23350 gene ispG 44496 43420 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE4 protein_id gnl|my_center|LOCUS_23350 45676 44606 gene locus_tag LOCUS_23360 45676 44606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_23360 46237 45722 gene locus_tag LOCUS_23370 46237 45722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 46236 47252 gene locus_tag LOCUS_23380 gene cmaX 46236 47252 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098062.1 protein_id gnl|my_center|LOCUS_23380 47698 47294 gene locus_tag LOCUS_23390 47698 47294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 49207 47771 gene locus_tag LOCUS_23400 49207 47771 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_23400 49480 49265 gene locus_tag LOCUS_23410 49480 49265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 50033 49503 gene locus_tag LOCUS_23420 50033 49503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 50172 51218 gene locus_tag LOCUS_23430 50172 51218 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265509.1 protein_id gnl|my_center|LOCUS_23430 51211 52806 gene locus_tag LOCUS_23440 gene nadB 51211 52806 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51363 protein_id gnl|my_center|LOCUS_23440 52917 53759 gene locus_tag LOCUS_23450 52917 53759 CDS product 2,5-dichloro-2,5-cyclohexadiene-1,4-diol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917983.1 protein_id gnl|my_center|LOCUS_23450 54027 54353 gene locus_tag LOCUS_23460 54027 54353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 54672 54433 gene locus_tag LOCUS_23470 54672 54433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096795.1 protein_id gnl|my_center|LOCUS_23470 54947 54720 gene locus_tag LOCUS_23480 54947 54720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 55440 57509 gene locus_tag LOCUS_23490 55440 57509 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2R4 protein_id gnl|my_center|LOCUS_23490 57517 58515 gene locus_tag LOCUS_23500 57517 58515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 58710 58507 gene locus_tag LOCUS_23510 58710 58507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 >Feature sequence15 1760 132 gene locus_tag LOCUS_23520 1760 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2061 2324 gene locus_tag LOCUS_23530 2061 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 2770 3138 gene locus_tag LOCUS_23540 2770 3138 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4C7 protein_id gnl|my_center|LOCUS_23540 3678 3965 gene locus_tag LOCUS_23550 3678 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 5463 4012 gene locus_tag LOCUS_23560 5463 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 6538 5657 gene locus_tag LOCUS_23570 6538 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 6799 8285 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcagctggaccgcgatttctgaactgctatcct 8708 8361 gene locus_tag LOCUS_23580 8708 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 9643 8705 gene locus_tag LOCUS_23590 gene cas1 9643 8705 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_23590 12908 9723 gene locus_tag LOCUS_23600 gene cas9 12908 9723 CDS product CRISPR-associated endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX87 protein_id gnl|my_center|LOCUS_23600 18772 13070 gene locus_tag LOCUS_23610 18772 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090812.1 protein_id gnl|my_center|LOCUS_23610 20826 18769 gene locus_tag LOCUS_23620 20826 18769 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBQ0 protein_id gnl|my_center|LOCUS_23620 21053 20823 gene locus_tag LOCUS_23630 21053 20823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 23966 21054 gene locus_tag LOCUS_23640 23966 21054 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387994.1 protein_id gnl|my_center|LOCUS_23640 24814 23966 gene locus_tag LOCUS_23650 24814 23966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921185.1 protein_id gnl|my_center|LOCUS_23650 27884 24861 gene locus_tag LOCUS_23660 27884 24861 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036267.1 protein_id gnl|my_center|LOCUS_23660 28501 27881 gene locus_tag LOCUS_23670 28501 27881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968479.1 protein_id gnl|my_center|LOCUS_23670 29079 28498 gene locus_tag LOCUS_23680 29079 28498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_23680 30101 29076 gene locus_tag LOCUS_23690 30101 29076 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640144.1 protein_id gnl|my_center|LOCUS_23690 31502 30183 gene locus_tag LOCUS_23700 31502 30183 CDS product IQ calmodulin-binding- domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368619.1 protein_id gnl|my_center|LOCUS_23700 34711 31499 gene locus_tag LOCUS_23710 34711 31499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 38151 34708 gene locus_tag LOCUS_23720 38151 34708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063831.1 protein_id gnl|my_center|LOCUS_23720 38874 38242 gene locus_tag LOCUS_23730 38874 38242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 39635 38997 gene locus_tag LOCUS_23740 39635 38997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 39813 41015 gene locus_tag LOCUS_23750 gene repA 39813 41015 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974267.1 protein_id gnl|my_center|LOCUS_23750 41093 42166 gene locus_tag LOCUS_23760 41093 42166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 42249 43502 gene locus_tag LOCUS_23770 42249 43502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 44559 45290 gene locus_tag LOCUS_23780 44559 45290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 45339 46022 gene locus_tag LOCUS_23790 45339 46022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970314.1 protein_id gnl|my_center|LOCUS_23790 46028 46885 gene locus_tag LOCUS_23800 46028 46885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338943.1 protein_id gnl|my_center|LOCUS_23800 47684 47385 gene locus_tag LOCUS_23810 47684 47385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 47725 47934 gene locus_tag LOCUS_23820 47725 47934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 48242 47985 gene locus_tag LOCUS_23830 48242 47985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 48325 48780 gene locus_tag LOCUS_23840 48325 48780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 48841 49152 gene locus_tag LOCUS_23850 48841 49152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 49149 50411 gene locus_tag LOCUS_23860 49149 50411 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_23860 50599 50880 gene locus_tag LOCUS_23870 50599 50880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 50880 51269 gene locus_tag LOCUS_23880 50880 51269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 52100 51336 gene locus_tag LOCUS_23890 52100 51336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 53116 52079 gene locus_tag LOCUS_23900 53116 52079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 53760 53113 gene locus_tag LOCUS_23910 53760 53113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 53903 54613 gene locus_tag LOCUS_23920 53903 54613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 54663 54941 gene locus_tag LOCUS_23930 54663 54941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 55450 56427 gene locus_tag LOCUS_23940 55450 56427 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_23940 56424 57626 gene locus_tag LOCUS_23950 56424 57626 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence16 288 1763 gene locus_tag LOCUS_23960 gene argH 288 1763 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE3 protein_id gnl|my_center|LOCUS_23960 1760 2002 gene locus_tag LOCUS_23970 1760 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2023 3285 gene locus_tag LOCUS_23980 gene lysA 2023 3285 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8H9 protein_id gnl|my_center|LOCUS_23980 3296 4078 gene locus_tag LOCUS_23990 3296 4078 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639858.1 protein_id gnl|my_center|LOCUS_23990 4223 4381 gene locus_tag LOCUS_24000 4223 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 4397 5404 gene locus_tag LOCUS_24010 4397 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 5389 6321 gene locus_tag LOCUS_24020 5389 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211259.1 protein_id gnl|my_center|LOCUS_24020 6805 6323 gene locus_tag LOCUS_24030 6805 6323 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Z5 protein_id gnl|my_center|LOCUS_24030 7995 6787 gene locus_tag LOCUS_24040 7995 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 9105 7999 gene locus_tag LOCUS_24050 9105 7999 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087722.1 protein_id gnl|my_center|LOCUS_24050 10015 9098 gene locus_tag LOCUS_24060 gene sipf 10015 9098 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJK6 protein_id gnl|my_center|LOCUS_24060 10413 10012 gene locus_tag LOCUS_24070 gene acpS 10413 10012 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W3 protein_id gnl|my_center|LOCUS_24070 11174 10410 gene locus_tag LOCUS_24080 gene pdxJ 11174 10410 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_24080 11773 11189 gene locus_tag LOCUS_24090 11773 11189 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_24090 11772 11999 gene locus_tag LOCUS_24100 11772 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 12004 13044 gene locus_tag LOCUS_24110 12004 13044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 13084 14772 gene locus_tag LOCUS_24120 13084 14772 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A300 protein_id gnl|my_center|LOCUS_24120 14904 15824 gene locus_tag LOCUS_24130 gene ctaB 14904 15824 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T814 protein_id gnl|my_center|LOCUS_24130 15821 15958 gene locus_tag LOCUS_24140 15821 15958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 15955 16515 gene locus_tag LOCUS_24150 gene ctaG 15955 16515 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ5 protein_id gnl|my_center|LOCUS_24150 16605 17426 gene locus_tag LOCUS_24160 16605 17426 CDS product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 protein_id gnl|my_center|LOCUS_24160 17431 17820 gene locus_tag LOCUS_24170 17431 17820 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532773.1 protein_id gnl|my_center|LOCUS_24170 17832 18395 gene locus_tag LOCUS_24180 gene surf-1 17832 18395 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5F5 protein_id gnl|my_center|LOCUS_24180 18467 19867 gene locus_tag LOCUS_24190 gene thrC 18467 19867 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_24190 19860 20750 gene locus_tag LOCUS_24200 19860 20750 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640170.1 protein_id gnl|my_center|LOCUS_24200 20759 21133 gene locus_tag LOCUS_24210 20759 21133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 21138 21461 gene locus_tag LOCUS_24220 21138 21461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 21463 22491 gene locus_tag LOCUS_24230 gene moaA 21463 22491 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDF6 protein_id gnl|my_center|LOCUS_24230 22498 22743 gene locus_tag LOCUS_24240 22498 22743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 22748 23191 gene locus_tag LOCUS_24250 22748 23191 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 protein_id gnl|my_center|LOCUS_24250 23736 23200 gene locus_tag LOCUS_24260 23736 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 24015 24395 gene locus_tag LOCUS_24270 gene rplU 24015 24395 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB8 protein_id gnl|my_center|LOCUS_24270 24415 24681 gene locus_tag LOCUS_24280 gene rpmA 24415 24681 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV03 protein_id gnl|my_center|LOCUS_24280 24882 25418 gene locus_tag LOCUS_24290 24882 25418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 25567 26205 gene locus_tag LOCUS_24300 25567 26205 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640214.1 protein_id gnl|my_center|LOCUS_24300 26973 26185 gene locus_tag LOCUS_24310 26973 26185 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918273.1 protein_id gnl|my_center|LOCUS_24310 26966 28285 gene locus_tag LOCUS_24320 gene pyrC 26966 28285 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89S50 protein_id gnl|my_center|LOCUS_24320 28585 28370 gene locus_tag LOCUS_24330 28585 28370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 28469 29107 gene locus_tag LOCUS_24340 28469 29107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 30606 29149 gene locus_tag LOCUS_24350 gene astD 30606 29149 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50174 protein_id gnl|my_center|LOCUS_24350 30760 31629 gene locus_tag LOCUS_24360 30760 31629 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 protein_id gnl|my_center|LOCUS_24360 31626 32774 gene locus_tag LOCUS_24370 31626 32774 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390873.1 protein_id gnl|my_center|LOCUS_24370 32901 33677 gene locus_tag LOCUS_24380 32901 33677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 33708 35054 gene locus_tag LOCUS_24390 33708 35054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 35138 36481 gene locus_tag LOCUS_24400 35138 36481 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533232.1 protein_id gnl|my_center|LOCUS_24400 37873 36500 gene locus_tag LOCUS_24410 gene gsh1 37873 36500 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_24410 38660 37917 gene locus_tag LOCUS_24420 38660 37917 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8G6 protein_id gnl|my_center|LOCUS_24420 38700 39611 gene locus_tag LOCUS_24430 gene ubiA 38700 39611 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHE7 protein_id gnl|my_center|LOCUS_24430 40012 39617 gene locus_tag LOCUS_24440 40012 39617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385268.1 protein_id gnl|my_center|LOCUS_24440 40106 40957 gene locus_tag LOCUS_24450 gene htpX 40106 40957 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UBM5 protein_id gnl|my_center|LOCUS_24450 41040 40964 gene locus_tag LOCUS_t00350 41040 40964 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 41144 41069 gene locus_tag LOCUS_t00360 41144 41069 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 42224 41217 gene locus_tag LOCUS_24460 42224 41217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 44001 42196 gene locus_tag LOCUS_24470 44001 42196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 44225 44689 gene locus_tag LOCUS_24480 gene putR 44225 44689 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722321.1 protein_id gnl|my_center|LOCUS_24480 46051 44702 gene locus_tag LOCUS_24490 46051 44702 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_24490 46552 46067 gene locus_tag LOCUS_24500 46552 46067 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919749.1 protein_id gnl|my_center|LOCUS_24500 47106 46669 gene locus_tag LOCUS_24510 gene aroQ 47106 46669 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A744 protein_id gnl|my_center|LOCUS_24510 47603 47190 gene locus_tag LOCUS_24520 47603 47190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 47934 49178 gene locus_tag LOCUS_24530 47934 49178 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946961.1 protein_id gnl|my_center|LOCUS_24530 49333 49578 gene locus_tag LOCUS_24540 49333 49578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 49692 50531 gene locus_tag LOCUS_24550 49692 50531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886998.1 protein_id gnl|my_center|LOCUS_24550 50521 51435 gene locus_tag LOCUS_24560 50521 51435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_24560 51432 51683 gene locus_tag LOCUS_24570 51432 51683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence17 20 2722 gene locus_tag LOCUS_24580 20 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 3293 3006 gene locus_tag LOCUS_24590 3293 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 3545 3411 gene locus_tag LOCUS_24600 3545 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 4274 4053 gene locus_tag LOCUS_24610 4274 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 4366 5067 gene locus_tag LOCUS_24620 4366 5067 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084489.1 protein_id gnl|my_center|LOCUS_24620 5416 5132 gene locus_tag LOCUS_24630 5416 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 6090 5440 gene locus_tag LOCUS_24640 6090 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 6674 6450 gene locus_tag LOCUS_24650 6674 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 7496 6747 gene locus_tag LOCUS_24660 7496 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 7774 7547 gene locus_tag LOCUS_24670 7774 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 7879 8838 gene locus_tag LOCUS_24680 7879 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 9053 9250 gene locus_tag LOCUS_24690 9053 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 9216 9386 gene locus_tag LOCUS_24700 9216 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 9850 9383 gene locus_tag LOCUS_24710 9850 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 10611 9874 gene locus_tag LOCUS_24720 10611 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 10803 11612 gene locus_tag LOCUS_24730 10803 11612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 11722 11856 gene locus_tag LOCUS_24740 gene rpmH 11722 11856 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BQ2 protein_id gnl|my_center|LOCUS_24740 11968 12399 gene locus_tag LOCUS_24750 11968 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 12396 12662 gene locus_tag LOCUS_24760 12396 12662 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYY9 protein_id gnl|my_center|LOCUS_24760 12659 14464 gene locus_tag LOCUS_24770 gene yidC 12659 14464 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BQ0 protein_id gnl|my_center|LOCUS_24770 14486 15127 gene locus_tag LOCUS_24780 gene engB 14486 15127 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BP9 protein_id gnl|my_center|LOCUS_24780 15266 15925 gene locus_tag LOCUS_24790 15266 15925 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112753.1 protein_id gnl|my_center|LOCUS_24790 15925 17079 gene locus_tag LOCUS_24800 gene dapE 15925 17079 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF3 protein_id gnl|my_center|LOCUS_24800 17076 18401 gene locus_tag LOCUS_24810 gene gltP 17076 18401 CDS product proton glutamate symport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038324.1 protein_id gnl|my_center|LOCUS_24810 19042 18398 gene locus_tag LOCUS_24820 gene nth 19042 18398 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ19 protein_id gnl|my_center|LOCUS_24820 19783 19055 gene locus_tag LOCUS_24830 gene dapB 19783 19055 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WK2 protein_id gnl|my_center|LOCUS_24830 19810 20535 gene locus_tag LOCUS_24840 gene cobB 19810 20535 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRF3 protein_id gnl|my_center|LOCUS_24840 21303 20521 gene locus_tag LOCUS_24850 21303 20521 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921553.1 protein_id gnl|my_center|LOCUS_24850 21718 21314 gene locus_tag LOCUS_24860 21718 21314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087873.1 protein_id gnl|my_center|LOCUS_24860 21927 22601 gene locus_tag LOCUS_24870 21927 22601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 24129 22630 gene locus_tag LOCUS_24880 gene dnaA 24129 22630 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI9 protein_id gnl|my_center|LOCUS_24880 24903 24643 gene locus_tag LOCUS_24890 gene rpsT 24903 24643 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY62 protein_id gnl|my_center|LOCUS_24890 25892 25080 gene locus_tag LOCUS_24900 gene mutM 25892 25080 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4E4 protein_id gnl|my_center|LOCUS_24900 26002 26733 gene locus_tag LOCUS_24910 gene ubiE 26002 26733 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WD0 protein_id gnl|my_center|LOCUS_24910 26721 28289 gene locus_tag LOCUS_24920 26721 28289 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFF6 protein_id gnl|my_center|LOCUS_24920 29352 28297 gene locus_tag LOCUS_24930 29352 28297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 29787 29389 gene locus_tag LOCUS_24940 29787 29389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 29899 31662 gene locus_tag LOCUS_24950 29899 31662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 31664 32137 gene locus_tag LOCUS_24960 gene dut 31664 32137 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 protein_id gnl|my_center|LOCUS_24960 32197 32352 gene locus_tag LOCUS_24970 32197 32352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 33054 32374 gene locus_tag LOCUS_24980 gene ung 33054 32374 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCM8 protein_id gnl|my_center|LOCUS_24980 33134 33751 gene locus_tag LOCUS_24990 gene rnd1 33134 33751 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338751.1 protein_id gnl|my_center|LOCUS_24990 33779 34426 gene locus_tag LOCUS_25000 33779 34426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 34423 34956 gene locus_tag LOCUS_25010 34423 34956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 35551 34937 gene locus_tag LOCUS_25020 35551 34937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 36906 35551 gene locus_tag LOCUS_25030 36906 35551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 37324 37025 gene locus_tag LOCUS_25040 37324 37025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 37531 38418 gene locus_tag LOCUS_25050 37531 38418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 38522 38671 gene locus_tag LOCUS_25060 38522 38671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 38718 38984 gene locus_tag LOCUS_25070 38718 38984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 38998 39462 gene locus_tag LOCUS_25080 38998 39462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 39469 41409 gene locus_tag LOCUS_25090 39469 41409 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388610.1 protein_id gnl|my_center|LOCUS_25090 41492 43111 gene locus_tag LOCUS_25100 41492 43111 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 protein_id gnl|my_center|LOCUS_25100 43114 44400 gene locus_tag LOCUS_25110 43114 44400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 44400 45293 gene locus_tag LOCUS_25120 gene rmlA 44400 45293 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MEU4 protein_id gnl|my_center|LOCUS_25120 45290 45835 gene locus_tag LOCUS_25130 gene rfbC 45290 45835 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807148.1 protein_id gnl|my_center|LOCUS_25130 45832 46689 gene locus_tag LOCUS_25140 gene rfbD 45832 46689 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_25140 46682 47743 gene locus_tag LOCUS_25150 gene rfbB 46682 47743 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD6 protein_id gnl|my_center|LOCUS_25150 47759 48433 gene locus_tag LOCUS_25160 47759 48433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 48430 49521 gene locus_tag LOCUS_25170 48430 49521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence18 147 689 gene locus_tag LOCUS_25180 147 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 976 1623 gene locus_tag LOCUS_25190 976 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2388 1651 gene locus_tag LOCUS_25200 2388 1651 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_25200 3338 2388 gene locus_tag LOCUS_25210 3338 2388 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_25210 4204 3335 gene locus_tag LOCUS_25220 4204 3335 CDS product cobalamin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383527.1 protein_id gnl|my_center|LOCUS_25220 6074 4218 gene locus_tag LOCUS_25230 6074 4218 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_25230 6723 7703 gene locus_tag LOCUS_25240 6723 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 7839 8156 gene locus_tag LOCUS_25250 7839 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 8340 10217 gene locus_tag LOCUS_25260 8340 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 10500 11462 gene locus_tag LOCUS_25270 gene mdh 10500 11462 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ83 protein_id gnl|my_center|LOCUS_25270 11498 12388 gene locus_tag LOCUS_25280 gene sucD 11498 12388 CDS product succinyl-CoA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918227.1 protein_id gnl|my_center|LOCUS_25280 12500 15376 gene locus_tag LOCUS_25290 gene sucA 12500 15376 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382958.1 protein_id gnl|my_center|LOCUS_25290 15397 16647 gene locus_tag LOCUS_25300 gene sucB 15397 16647 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X64 protein_id gnl|my_center|LOCUS_25300 16662 18065 gene locus_tag LOCUS_25310 16662 18065 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV29 protein_id gnl|my_center|LOCUS_25310 18669 18139 gene locus_tag LOCUS_25320 18669 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 18725 18946 gene locus_tag LOCUS_25330 18725 18946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 19596 19009 gene locus_tag LOCUS_25340 19596 19009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 21929 19758 gene locus_tag LOCUS_25350 21929 19758 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_25350 22434 22018 gene locus_tag LOCUS_25360 gene rplQ 22434 22018 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA8 protein_id gnl|my_center|LOCUS_25360 23702 22647 gene locus_tag LOCUS_25370 gene rpoA 23702 22647 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY4 protein_id gnl|my_center|LOCUS_25370 24207 23818 gene locus_tag LOCUS_25380 gene rpsK 24207 23818 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F7 protein_id gnl|my_center|LOCUS_25380 24640 24272 gene locus_tag LOCUS_25390 gene rpsM 24640 24272 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE39 protein_id gnl|my_center|LOCUS_25390 25661 24993 gene locus_tag LOCUS_25400 gene adk 25661 24993 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0D2 protein_id gnl|my_center|LOCUS_25400 27054 25690 gene locus_tag LOCUS_25410 gene secY 27054 25690 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ9 protein_id gnl|my_center|LOCUS_25410 27658 27176 gene locus_tag LOCUS_25420 gene rplO 27658 27176 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q3 protein_id gnl|my_center|LOCUS_25420 27931 27746 gene locus_tag LOCUS_25430 gene rpmD 27931 27746 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TME2 protein_id gnl|my_center|LOCUS_25430 28735 27938 gene locus_tag LOCUS_25440 28735 27938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 29079 28735 gene locus_tag LOCUS_25450 gene rplR 29079 28735 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ6 protein_id gnl|my_center|LOCUS_25450 29614 29081 gene locus_tag LOCUS_25460 gene rplF 29614 29081 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5C2 protein_id gnl|my_center|LOCUS_25460 30009 29614 gene locus_tag LOCUS_25470 gene rpsH 30009 29614 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX4 protein_id gnl|my_center|LOCUS_25470 30325 30020 gene locus_tag LOCUS_25480 gene rpsN 30325 30020 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTB8 protein_id gnl|my_center|LOCUS_25480 30931 30350 gene locus_tag LOCUS_25490 gene rplE 30931 30350 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD6 protein_id gnl|my_center|LOCUS_25490 31244 30924 gene locus_tag LOCUS_25500 gene rplX 31244 30924 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4E5 protein_id gnl|my_center|LOCUS_25500 31614 31246 gene locus_tag LOCUS_25510 gene rplN 31614 31246 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX0 protein_id gnl|my_center|LOCUS_25510 31972 31682 gene locus_tag LOCUS_25520 gene rpsQ 31972 31682 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q20 protein_id gnl|my_center|LOCUS_25520 32190 31984 gene locus_tag LOCUS_25530 gene rpmC 32190 31984 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMD2 protein_id gnl|my_center|LOCUS_25530 32625 32194 gene locus_tag LOCUS_25540 gene rplP 32625 32194 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW7 protein_id gnl|my_center|LOCUS_25540 33343 32648 gene locus_tag LOCUS_25550 gene rpsC 33343 32648 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE24 protein_id gnl|my_center|LOCUS_25550 33724 33347 gene locus_tag LOCUS_25560 gene rplV 33724 33347 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMC9 protein_id gnl|my_center|LOCUS_25560 33999 33724 gene locus_tag LOCUS_25570 gene rpsS 33999 33724 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW4 protein_id gnl|my_center|LOCUS_25570 34839 34003 gene locus_tag LOCUS_25580 gene rplB 34839 34003 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMC7 protein_id gnl|my_center|LOCUS_25580 35160 34852 gene locus_tag LOCUS_25590 gene rplW 35160 34852 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8V1 protein_id gnl|my_center|LOCUS_25590 35798 35160 gene locus_tag LOCUS_25600 gene rplD 35798 35160 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J85 protein_id gnl|my_center|LOCUS_25600 36660 35803 gene locus_tag LOCUS_25610 gene rplC 36660 35803 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D7 protein_id gnl|my_center|LOCUS_25610 37221 36910 gene locus_tag LOCUS_25620 gene rpsJ 37221 36910 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_25620 38721 37531 gene locus_tag LOCUS_25630 gene tuf2 38721 37531 CDS product elongation factor Tu 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU6 protein_id gnl|my_center|LOCUS_25630 40944 38812 gene locus_tag LOCUS_25640 gene fusA 40944 38812 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV7 protein_id gnl|my_center|LOCUS_25640 41519 41049 gene locus_tag LOCUS_25650 gene rpsG 41519 41049 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMC0 protein_id gnl|my_center|LOCUS_25650 42037 41666 gene locus_tag LOCUS_25660 gene rpsL 42037 41666 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMB9 protein_id gnl|my_center|LOCUS_25660 42466 43269 gene locus_tag LOCUS_25670 42466 43269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence19 1556 2548 gene locus_tag LOCUS_25680 1556 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2563 4071 gene locus_tag LOCUS_25690 2563 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 4113 5933 gene locus_tag LOCUS_25700 4113 5933 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337665.1 protein_id gnl|my_center|LOCUS_25700 6042 7535 gene locus_tag LOCUS_25710 6042 7535 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969696.1 protein_id gnl|my_center|LOCUS_25710 7757 7554 gene locus_tag LOCUS_25720 7757 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229783.1 protein_id gnl|my_center|LOCUS_25720 9065 7767 gene locus_tag LOCUS_25730 gene hslU 9065 7767 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEL0 protein_id gnl|my_center|LOCUS_25730 9697 9071 gene locus_tag LOCUS_25740 gene hslV 9697 9071 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM9 protein_id gnl|my_center|LOCUS_25740 10177 9713 gene locus_tag LOCUS_25750 10177 9713 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919242.1 protein_id gnl|my_center|LOCUS_25750 10358 10873 gene locus_tag LOCUS_25760 10358 10873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 10882 11394 gene locus_tag LOCUS_25770 10882 11394 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971447.1 protein_id gnl|my_center|LOCUS_25770 11960 11439 gene locus_tag LOCUS_25780 11960 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 13930 12083 gene locus_tag LOCUS_25790 gene feoB 13930 12083 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 protein_id gnl|my_center|LOCUS_25790 14169 13930 gene locus_tag LOCUS_25800 14169 13930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 14900 14241 gene locus_tag LOCUS_25810 14900 14241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_25810 15539 14943 gene locus_tag LOCUS_25820 15539 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 15665 16282 gene locus_tag LOCUS_25830 15665 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 16270 16722 gene locus_tag LOCUS_25840 16270 16722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391102.1 protein_id gnl|my_center|LOCUS_25840 16719 17441 gene locus_tag LOCUS_25850 16719 17441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709853.1 protein_id gnl|my_center|LOCUS_25850 17495 18058 gene locus_tag LOCUS_25860 17495 18058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 18119 18559 gene locus_tag LOCUS_25870 18119 18559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 18546 19544 gene locus_tag LOCUS_25880 gene ribD 18546 19544 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K78 protein_id gnl|my_center|LOCUS_25880 19578 20195 gene locus_tag LOCUS_25890 19578 20195 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 protein_id gnl|my_center|LOCUS_25890 21374 20196 gene locus_tag LOCUS_25900 21374 20196 CDS product aromatic amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710112.1 protein_id gnl|my_center|LOCUS_25900 22284 21472 gene locus_tag LOCUS_25910 22284 21472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 22472 22561 gene locus_tag LOCUS_t00370 22472 22561 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22722 23486 gene locus_tag LOCUS_25920 22722 23486 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082858.1 protein_id gnl|my_center|LOCUS_25920 23762 23505 gene locus_tag LOCUS_25930 23762 23505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 24358 23759 gene locus_tag LOCUS_25940 24358 23759 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939101.1 protein_id gnl|my_center|LOCUS_25940 25180 24446 gene locus_tag LOCUS_25950 25180 24446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 26023 25367 gene locus_tag LOCUS_25960 26023 25367 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389714.1 protein_id gnl|my_center|LOCUS_25960 27261 26140 gene locus_tag LOCUS_25970 27261 26140 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904740.1 protein_id gnl|my_center|LOCUS_25970 27418 28074 gene locus_tag LOCUS_25980 27418 28074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 28501 28097 gene locus_tag LOCUS_25990 28501 28097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 29610 28501 gene locus_tag LOCUS_26000 29610 28501 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_26000 30415 29624 gene locus_tag LOCUS_26010 30415 29624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 31190 30420 gene locus_tag LOCUS_26020 gene fadB 31190 30420 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085730.1 protein_id gnl|my_center|LOCUS_26020 32022 31183 gene locus_tag LOCUS_26030 32022 31183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 32494 32033 gene locus_tag LOCUS_26040 32494 32033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 33076 32564 gene locus_tag LOCUS_26050 33076 32564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 33168 33827 gene locus_tag LOCUS_26060 33168 33827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 35150 33867 gene locus_tag LOCUS_26070 35150 33867 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228930.1 protein_id gnl|my_center|LOCUS_26070 36261 35176 gene locus_tag LOCUS_26080 36261 35176 CDS product 5-exo-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731184.1 protein_id gnl|my_center|LOCUS_26080 37471 36326 gene locus_tag LOCUS_26090 gene luxA2 37471 36326 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090024.1 protein_id gnl|my_center|LOCUS_26090 37709 39349 gene locus_tag LOCUS_26100 37709 39349 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729480.1 protein_id gnl|my_center|LOCUS_26100 40013 39363 gene locus_tag LOCUS_26110 40013 39363 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229253.1 protein_id gnl|my_center|LOCUS_26110 41738 40119 gene locus_tag LOCUS_26120 41738 40119 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728663.1 protein_id gnl|my_center|LOCUS_26120 42221 42871 gene locus_tag LOCUS_26130 42221 42871 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228985.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence20 792 634 gene locus_tag LOCUS_26140 792 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1049 738 gene locus_tag LOCUS_26150 1049 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 2251 1523 gene locus_tag LOCUS_26160 2251 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 2939 2232 gene locus_tag LOCUS_26170 2939 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 3290 2943 gene locus_tag LOCUS_26180 3290 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 4714 3302 gene locus_tag LOCUS_26190 4714 3302 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_26190 4964 5689 gene locus_tag LOCUS_26200 4964 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 5773 6096 gene locus_tag LOCUS_26210 5773 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 7014 6760 gene locus_tag LOCUS_26220 7014 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 7031 7267 gene locus_tag LOCUS_26230 7031 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 7271 8056 gene locus_tag LOCUS_26240 7271 8056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 8367 8062 gene locus_tag LOCUS_26250 8367 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 8568 8377 gene locus_tag LOCUS_26260 8568 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 9138 8575 gene locus_tag LOCUS_26270 9138 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 9400 9759 gene locus_tag LOCUS_26280 9400 9759 CDS product single-stranded DNA endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533281.1 protein_id gnl|my_center|LOCUS_26280 10332 9910 gene locus_tag LOCUS_26290 10332 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 10730 11008 gene locus_tag LOCUS_26300 10730 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090958.1 protein_id gnl|my_center|LOCUS_26300 11124 11360 gene locus_tag LOCUS_26310 11124 11360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 11665 11741 gene locus_tag LOCUS_t00380 11665 11741 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12622 11855 gene locus_tag LOCUS_26320 12622 11855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 12844 12653 gene locus_tag LOCUS_26330 12844 12653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 13011 15812 gene locus_tag LOCUS_26340 13011 15812 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124782.1 protein_id gnl|my_center|LOCUS_26340 15809 16906 gene locus_tag LOCUS_26350 15809 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 16994 17305 gene locus_tag LOCUS_26360 16994 17305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 17302 17628 gene locus_tag LOCUS_26370 17302 17628 CDS product translation repressor RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971265.1 protein_id gnl|my_center|LOCUS_26370 17625 19688 gene locus_tag LOCUS_26380 17625 19688 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037258.1 protein_id gnl|my_center|LOCUS_26380 19681 20874 gene locus_tag LOCUS_26390 19681 20874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037257.1 protein_id gnl|my_center|LOCUS_26390 21853 21011 gene locus_tag LOCUS_26400 21853 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 21976 22965 gene locus_tag LOCUS_26410 21976 22965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968157.1 protein_id gnl|my_center|LOCUS_26410 23677 22922 gene locus_tag LOCUS_26420 23677 22922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976054.1 protein_id gnl|my_center|LOCUS_26420 24228 23980 gene locus_tag LOCUS_26430 24228 23980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 25795 24866 gene locus_tag LOCUS_26440 25795 24866 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975458.1 protein_id gnl|my_center|LOCUS_26440 26158 25799 gene locus_tag LOCUS_26450 26158 25799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 27492 26170 gene locus_tag LOCUS_26460 27492 26170 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_26460 28133 27798 gene locus_tag LOCUS_26470 28133 27798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 28443 28246 gene locus_tag LOCUS_26480 28443 28246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 28502 28648 gene locus_tag LOCUS_26490 28502 28648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 30224 29043 gene locus_tag LOCUS_26500 30224 29043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037257.1 protein_id gnl|my_center|LOCUS_26500 32208 30217 gene locus_tag LOCUS_26510 32208 30217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039745.1 protein_id gnl|my_center|LOCUS_26510 33473 32286 gene locus_tag LOCUS_26520 33473 32286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 35174 33684 gene locus_tag LOCUS_26530 gene mloB 35174 33684 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_26530 35997 35299 gene locus_tag LOCUS_26540 35997 35299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 36176 35994 gene locus_tag LOCUS_26550 36176 35994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 36964 36176 gene locus_tag LOCUS_26560 36964 36176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 39714 36961 gene locus_tag LOCUS_26570 39714 36961 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124782.1 protein_id gnl|my_center|LOCUS_26570 39889 40248 gene locus_tag LOCUS_26580 39889 40248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 40772 41137 gene locus_tag LOCUS_26590 40772 41137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 41497 41916 gene locus_tag LOCUS_26600 41497 41916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence21 655 119 gene locus_tag LOCUS_26610 655 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 2984 1176 gene locus_tag LOCUS_26620 2984 1176 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087156.1 protein_id gnl|my_center|LOCUS_26620 3452 3051 gene locus_tag LOCUS_26630 3452 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331421.1 protein_id gnl|my_center|LOCUS_26630 5248 3980 gene locus_tag LOCUS_26640 5248 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 5559 5257 gene locus_tag LOCUS_26650 5559 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 6219 6070 gene locus_tag LOCUS_26660 6219 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 7101 6664 gene locus_tag LOCUS_26670 7101 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 8099 7155 gene locus_tag LOCUS_26680 gene ardC 8099 7155 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974367.1 protein_id gnl|my_center|LOCUS_26680 8848 8612 gene locus_tag LOCUS_26690 8848 8612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 9677 8886 gene locus_tag LOCUS_26700 9677 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 9907 9674 gene locus_tag LOCUS_26710 9907 9674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 10775 10560 gene locus_tag LOCUS_26720 10775 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 11110 11496 gene locus_tag LOCUS_26730 11110 11496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 13195 11648 gene locus_tag LOCUS_26740 13195 11648 CDS product N6 adenine-specific DNA methyltransferase N12 class inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331420.1 protein_id gnl|my_center|LOCUS_26740 13377 13192 gene locus_tag LOCUS_26750 13377 13192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 13687 13394 gene locus_tag LOCUS_26760 13687 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 13935 13684 gene locus_tag LOCUS_26770 13935 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 14229 13939 gene locus_tag LOCUS_26780 14229 13939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 14824 14594 gene locus_tag LOCUS_26790 14824 14594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 15363 14845 gene locus_tag LOCUS_26800 15363 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 15623 15363 gene locus_tag LOCUS_26810 15623 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 16126 15800 gene locus_tag LOCUS_26820 16126 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 16899 16147 gene locus_tag LOCUS_26830 16899 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 17753 16899 gene locus_tag LOCUS_26840 17753 16899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 19004 17973 gene locus_tag LOCUS_26850 19004 17973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 19569 19162 gene locus_tag LOCUS_26860 19569 19162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 19789 20004 gene locus_tag LOCUS_26870 19789 20004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 20090 20332 gene locus_tag LOCUS_26880 20090 20332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 20877 20329 gene locus_tag LOCUS_26890 20877 20329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 21075 22073 gene locus_tag LOCUS_26900 21075 22073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 22073 22327 gene locus_tag LOCUS_26910 22073 22327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 22327 22635 gene locus_tag LOCUS_26920 22327 22635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 22664 22909 gene locus_tag LOCUS_26930 22664 22909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 22917 23258 gene locus_tag LOCUS_26940 22917 23258 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533342.1 protein_id gnl|my_center|LOCUS_26940 23248 25617 gene locus_tag LOCUS_26950 gene virB4 23248 25617 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887127.1 protein_id gnl|my_center|LOCUS_26950 25630 26400 gene locus_tag LOCUS_26960 25630 26400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 26400 26672 gene locus_tag LOCUS_26970 26400 26672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 26684 27718 gene locus_tag LOCUS_26980 26684 27718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 27730 28098 gene locus_tag LOCUS_26990 27730 28098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 28099 28788 gene locus_tag LOCUS_27000 gene virB8 28099 28788 CDS product conjugal transfer protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967689.1 protein_id gnl|my_center|LOCUS_27000 28785 29651 gene locus_tag LOCUS_27010 gene avhB9 28785 29651 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974429.1 protein_id gnl|my_center|LOCUS_27010 29648 30955 gene locus_tag LOCUS_27020 29648 30955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 30955 31947 gene locus_tag LOCUS_27030 gene virB11 30955 31947 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887135.1 protein_id gnl|my_center|LOCUS_27030 31957 33951 gene locus_tag LOCUS_27040 31957 33951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 33948 34352 gene locus_tag LOCUS_27050 33948 34352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 34852 34349 gene locus_tag LOCUS_27060 34852 34349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 36327 34849 gene locus_tag LOCUS_27070 36327 34849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 36914 36324 gene locus_tag LOCUS_27080 36914 36324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 37241 37504 gene locus_tag LOCUS_27090 37241 37504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 37874 37554 gene locus_tag LOCUS_27100 37874 37554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 38354 37992 gene locus_tag LOCUS_27110 38354 37992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 38792 38433 gene locus_tag LOCUS_27120 38792 38433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 39469 38789 gene locus_tag LOCUS_27130 39469 38789 CDS product partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205518.1 protein_id gnl|my_center|LOCUS_27130 40179 39841 gene locus_tag LOCUS_27140 40179 39841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 41101 40511 gene locus_tag LOCUS_27150 41101 40511 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948274.1 protein_id gnl|my_center|LOCUS_27150 41616 41098 gene locus_tag LOCUS_27160 41616 41098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence22 164 682 gene locus_tag LOCUS_27170 164 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 1179 709 gene locus_tag LOCUS_27180 1179 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 1879 1211 gene locus_tag LOCUS_27190 1879 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 2475 1870 gene locus_tag LOCUS_27200 2475 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 4364 2481 gene locus_tag LOCUS_27210 4364 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 4662 5285 gene locus_tag LOCUS_27220 4662 5285 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969688.1 protein_id gnl|my_center|LOCUS_27220 5317 6999 gene locus_tag LOCUS_27230 5317 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 7438 7055 gene locus_tag LOCUS_27240 7438 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 7806 7731 gene locus_tag LOCUS_t00390 7806 7731 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8354 7848 gene locus_tag LOCUS_27250 8354 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 9205 8339 gene locus_tag LOCUS_27260 9205 8339 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918101.1 protein_id gnl|my_center|LOCUS_27260 10496 9264 gene locus_tag LOCUS_27270 10496 9264 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709807.1 protein_id gnl|my_center|LOCUS_27270 10386 10721 gene locus_tag LOCUS_27280 10386 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 11743 10739 gene locus_tag LOCUS_27290 gene hemH 11743 10739 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIN3 protein_id gnl|my_center|LOCUS_27290 14025 11743 gene locus_tag LOCUS_27300 14025 11743 CDS product exported oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063689.1 protein_id gnl|my_center|LOCUS_27300 14983 14030 gene locus_tag LOCUS_27310 14983 14030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 15114 16262 gene locus_tag LOCUS_27320 15114 16262 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_27320 16265 17110 gene locus_tag LOCUS_27330 16265 17110 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G39 protein_id gnl|my_center|LOCUS_27330 17203 18717 gene locus_tag LOCUS_27340 17203 18717 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390050.1 protein_id gnl|my_center|LOCUS_27340 21021 18805 gene locus_tag LOCUS_27350 21021 18805 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529554.1 protein_id gnl|my_center|LOCUS_27350 21776 21156 gene locus_tag LOCUS_27360 21776 21156 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_27360 22354 21920 gene locus_tag LOCUS_27370 22354 21920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 22377 22940 gene locus_tag LOCUS_27380 gene mobA 22377 22940 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYZ6 protein_id gnl|my_center|LOCUS_27380 23548 22946 gene locus_tag LOCUS_27390 23548 22946 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_27390 24669 23545 gene locus_tag LOCUS_27400 gene metX 24669 23545 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J1 protein_id gnl|my_center|LOCUS_27400 24757 25887 gene locus_tag LOCUS_27410 gene hisC 24757 25887 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP86 protein_id gnl|my_center|LOCUS_27410 25884 26798 gene locus_tag LOCUS_27420 gene tyrC 25884 26798 CDS product cyclohexadienyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084213.1 protein_id gnl|my_center|LOCUS_27420 27490 26804 gene locus_tag LOCUS_27430 gene plsC 27490 26804 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084210.1 protein_id gnl|my_center|LOCUS_27430 28042 27512 gene locus_tag LOCUS_27440 28042 27512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 28986 28039 gene locus_tag LOCUS_27450 28986 28039 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391003.1 protein_id gnl|my_center|LOCUS_27450 29708 28983 gene locus_tag LOCUS_27460 29708 28983 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391002.1 protein_id gnl|my_center|LOCUS_27460 29947 30885 gene locus_tag LOCUS_27470 29947 30885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 31041 31199 gene locus_tag LOCUS_27480 31041 31199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 31394 31481 gene locus_tag LOCUS_t00400 31394 31481 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34078 31919 gene locus_tag LOCUS_27490 34078 31919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 35091 34228 gene locus_tag LOCUS_27500 35091 34228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 35582 35088 gene locus_tag LOCUS_27510 35582 35088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 36148 35579 gene locus_tag LOCUS_27520 36148 35579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 37556 36936 gene locus_tag LOCUS_27530 37556 36936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence23 1289 45 gene locus_tag LOCUS_27540 1289 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 1542 1300 gene locus_tag LOCUS_27550 1542 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 2307 1552 gene locus_tag LOCUS_27560 2307 1552 CDS product conjugal transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938883.1 protein_id gnl|my_center|LOCUS_27560 3700 2333 gene locus_tag LOCUS_27570 gene trbI 3700 2333 CDS product conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974832.1 protein_id gnl|my_center|LOCUS_27570 4486 3713 gene locus_tag LOCUS_27580 4486 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 5472 4489 gene locus_tag LOCUS_27590 gene trbG 5472 4489 CDS product putative conjugal transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55404 protein_id gnl|my_center|LOCUS_27590 6209 5490 gene locus_tag LOCUS_27600 gene trbF 6209 5490 CDS product putative conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55403 protein_id gnl|my_center|LOCUS_27600 8775 6196 gene locus_tag LOCUS_27610 gene trbE 8775 6196 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974837.1 protein_id gnl|my_center|LOCUS_27610 9104 8772 gene locus_tag LOCUS_27620 9104 8772 CDS product conjugal transfer protein TrbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970256.1 protein_id gnl|my_center|LOCUS_27620 9503 9123 gene locus_tag LOCUS_27630 9503 9123 CDS product conjugal transfer protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970255.1 protein_id gnl|my_center|LOCUS_27630 10482 9517 gene locus_tag LOCUS_27640 10482 9517 CDS product conjugal transfer protein TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970254.1 protein_id gnl|my_center|LOCUS_27640 10966 10589 gene locus_tag LOCUS_27650 10966 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 11504 11743 gene locus_tag LOCUS_27660 11504 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 11922 12689 gene locus_tag LOCUS_27670 11922 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 13083 13442 gene locus_tag LOCUS_27680 13083 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 13547 13810 gene locus_tag LOCUS_27690 13547 13810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 13916 14245 gene locus_tag LOCUS_27700 13916 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 14238 14537 gene locus_tag LOCUS_27710 14238 14537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 14534 15280 gene locus_tag LOCUS_27720 14534 15280 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221868.1 protein_id gnl|my_center|LOCUS_27720 15283 16305 gene locus_tag LOCUS_27730 15283 16305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 16423 17055 gene locus_tag LOCUS_27740 16423 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 17526 17086 gene locus_tag LOCUS_27750 17526 17086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 18251 17526 gene locus_tag LOCUS_27760 18251 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 18487 18248 gene locus_tag LOCUS_27770 18487 18248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 18949 19335 gene locus_tag LOCUS_27780 18949 19335 CDS product conjugal transfer relaxosome component TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205281.1 protein_id gnl|my_center|LOCUS_27780 19352 21670 gene locus_tag LOCUS_27790 19352 21670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 21692 23584 gene locus_tag LOCUS_27800 21692 23584 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 protein_id gnl|my_center|LOCUS_27800 23581 24114 gene locus_tag LOCUS_27810 gene traF 23581 24114 CDS product putative conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55417 protein_id gnl|my_center|LOCUS_27810 24119 26299 gene locus_tag LOCUS_27820 24119 26299 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7LJB3 protein_id gnl|my_center|LOCUS_27820 26296 26547 gene locus_tag LOCUS_27830 26296 26547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 26566 29925 gene locus_tag LOCUS_27840 26566 29925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 30325 29927 gene locus_tag LOCUS_27850 30325 29927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 30445 30600 gene locus_tag LOCUS_27860 30445 30600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 30748 30897 gene locus_tag LOCUS_27870 30748 30897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 31072 30908 gene locus_tag LOCUS_27880 31072 30908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 31994 31290 gene locus_tag LOCUS_27890 31994 31290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 33219 32143 gene locus_tag LOCUS_27900 33219 32143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 34622 33531 gene locus_tag LOCUS_27910 34622 33531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence24 995 174 gene locus_tag LOCUS_27920 995 174 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_27920 1124 1414 gene locus_tag LOCUS_27930 1124 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 1753 1376 gene locus_tag LOCUS_27940 1753 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2279 2206 gene locus_tag LOCUS_t00410 2279 2206 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3181 2369 gene locus_tag LOCUS_27950 3181 2369 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_27950 3756 3190 gene locus_tag LOCUS_27960 3756 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 5227 4028 gene locus_tag LOCUS_27970 5227 4028 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN4 protein_id gnl|my_center|LOCUS_27970 5490 7376 gene locus_tag LOCUS_27980 5490 7376 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087132.1 protein_id gnl|my_center|LOCUS_27980 7542 8447 gene locus_tag LOCUS_27990 7542 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 8579 9094 gene locus_tag LOCUS_28000 8579 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 9091 9558 gene locus_tag LOCUS_28010 9091 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 9692 10921 gene locus_tag LOCUS_28020 9692 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 10908 12008 gene locus_tag LOCUS_28030 10908 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 13139 12030 gene locus_tag LOCUS_28040 13139 12030 CDS product DesA-family fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639906.1 protein_id gnl|my_center|LOCUS_28040 13353 14510 gene locus_tag LOCUS_28050 13353 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 protein_id gnl|my_center|LOCUS_28050 14822 15604 gene locus_tag LOCUS_28060 gene phyR 14822 15604 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 protein_id gnl|my_center|LOCUS_28060 17308 15644 gene locus_tag LOCUS_28070 17308 15644 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529277.1 protein_id gnl|my_center|LOCUS_28070 17561 17770 gene locus_tag LOCUS_28080 17561 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 17767 18372 gene locus_tag LOCUS_28090 gene sigT 17767 18372 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921304.1 protein_id gnl|my_center|LOCUS_28090 19147 18470 gene locus_tag LOCUS_28100 19147 18470 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKP1 protein_id gnl|my_center|LOCUS_28100 19274 20611 gene locus_tag LOCUS_28110 gene glmM 19274 20611 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN1 protein_id gnl|my_center|LOCUS_28110 20608 21366 gene locus_tag LOCUS_28120 20608 21366 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_28120 22251 21367 gene locus_tag LOCUS_28130 22251 21367 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYR8 protein_id gnl|my_center|LOCUS_28130 22434 22361 gene locus_tag LOCUS_t00420 22434 22361 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22631 23830 gene locus_tag LOCUS_28140 22631 23830 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532289.1 protein_id gnl|my_center|LOCUS_28140 23827 24492 gene locus_tag LOCUS_28150 gene rlmE 23827 24492 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXU5 protein_id gnl|my_center|LOCUS_28150 25187 24540 gene locus_tag LOCUS_28160 25187 24540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 25313 26221 gene locus_tag LOCUS_28170 gene pheA 25313 26221 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_28170 26294 26977 gene locus_tag LOCUS_28180 26294 26977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265569.1 protein_id gnl|my_center|LOCUS_28180 26977 28326 gene locus_tag LOCUS_28190 26977 28326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918452.1 protein_id gnl|my_center|LOCUS_28190 28323 29285 gene locus_tag LOCUS_28200 28323 29285 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918453.1 protein_id gnl|my_center|LOCUS_28200 29323 30645 gene locus_tag LOCUS_28210 29323 30645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918454.1 protein_id gnl|my_center|LOCUS_28210 30642 31712 gene locus_tag LOCUS_28220 30642 31712 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918455.1 protein_id gnl|my_center|LOCUS_28220 31715 32638 gene locus_tag LOCUS_28230 31715 32638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640008.1 protein_id gnl|my_center|LOCUS_28230 32768 32968 gene locus_tag LOCUS_28240 32768 32968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 33606 33289 gene locus_tag LOCUS_28250 33606 33289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 33967 33656 gene locus_tag LOCUS_28260 33967 33656 CDS product cyanate transport inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281194.1 protein_id gnl|my_center|LOCUS_28260 34227 34033 gene locus_tag LOCUS_28270 34227 34033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 34490 34287 gene locus_tag LOCUS_28280 34490 34287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence25 163 477 gene locus_tag LOCUS_28290 163 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 989 540 gene locus_tag LOCUS_28300 989 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 1803 2180 gene locus_tag LOCUS_28310 1803 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2288 4543 gene locus_tag LOCUS_28320 2288 4543 CDS product molybdopterin-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230850.1 protein_id gnl|my_center|LOCUS_28320 4589 5359 gene locus_tag LOCUS_28330 4589 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 5609 7885 gene locus_tag LOCUS_28340 5609 7885 CDS product molybdopterin-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230850.1 protein_id gnl|my_center|LOCUS_28340 8253 7876 gene locus_tag LOCUS_28350 8253 7876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 8435 8776 gene locus_tag LOCUS_28360 8435 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28360 9899 9213 gene locus_tag LOCUS_28370 9899 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 10096 11385 gene locus_tag LOCUS_28380 10096 11385 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_28380 11455 12741 gene locus_tag LOCUS_28390 11455 12741 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 protein_id gnl|my_center|LOCUS_28390 12766 13086 gene locus_tag LOCUS_28400 12766 13086 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887567.1 protein_id gnl|my_center|LOCUS_28400 14089 13289 gene locus_tag LOCUS_28410 14089 13289 CDS product insertion element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936644.1 protein_id gnl|my_center|LOCUS_28410 14481 14203 gene locus_tag LOCUS_28420 14481 14203 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948267.1 protein_id gnl|my_center|LOCUS_28420 15816 14617 gene locus_tag LOCUS_28430 15816 14617 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533500.1 protein_id gnl|my_center|LOCUS_28430 17113 15881 gene locus_tag LOCUS_28440 17113 15881 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730165.1 protein_id gnl|my_center|LOCUS_28440 17922 17110 gene locus_tag LOCUS_28450 17922 17110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 18037 18525 gene locus_tag LOCUS_28460 18037 18525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 19500 20279 gene locus_tag LOCUS_28470 19500 20279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence26 2642 159 gene locus_tag LOCUS_28480 2642 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 3632 2718 gene locus_tag LOCUS_28490 3632 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3778 4362 gene locus_tag LOCUS_28500 3778 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 4338 4562 gene locus_tag LOCUS_28510 4338 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 5823 4570 gene locus_tag LOCUS_28520 5823 4570 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219063.1 protein_id gnl|my_center|LOCUS_28520 6147 7415 gene locus_tag LOCUS_28530 gene int 6147 7415 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 protein_id gnl|my_center|LOCUS_28530 7584 7390 gene locus_tag LOCUS_28540 7584 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 7787 7581 gene locus_tag LOCUS_28550 7787 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 8425 9612 gene locus_tag LOCUS_28560 8425 9612 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940951.1 protein_id gnl|my_center|LOCUS_28560 9617 11734 gene locus_tag LOCUS_28570 9617 11734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940950.1 protein_id gnl|my_center|LOCUS_28570 11731 12885 gene locus_tag LOCUS_28580 11731 12885 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940949.1 protein_id gnl|my_center|LOCUS_28580 13427 12915 gene locus_tag LOCUS_28590 13427 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 <20461 13439 gene locus_tag LOCUS_28600 <20461 13439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262086.1:RTX toxin >Feature sequence27 539 1042 gene locus_tag LOCUS_28610 539 1042 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_28610 1414 1181 gene locus_tag LOCUS_28620 1414 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 1560 1787 gene locus_tag LOCUS_28630 1560 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 4510 2183 gene locus_tag LOCUS_28640 gene fyuA 4510 2183 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_28640 6797 4590 gene locus_tag LOCUS_28650 6797 4590 CDS product N-methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729441.1 protein_id gnl|my_center|LOCUS_28650 8919 6814 gene locus_tag LOCUS_28660 8919 6814 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_28660 10031 8949 gene locus_tag LOCUS_28670 10031 8949 CDS product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 protein_id gnl|my_center|LOCUS_28670 11231 10212 gene locus_tag LOCUS_28680 11231 10212 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086225.1 protein_id gnl|my_center|LOCUS_28680 13300 11231 gene locus_tag LOCUS_28690 13300 11231 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870477.1 protein_id gnl|my_center|LOCUS_28690 15333 13294 gene locus_tag LOCUS_28700 15333 13294 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_28700 15645 15388 gene locus_tag LOCUS_28710 15645 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 16802 17044 gene locus_tag LOCUS_28720 16802 17044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence28 563 1426 gene locus_tag LOCUS_28730 563 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 1765 3180 gene locus_tag LOCUS_28740 1765 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 3261 3818 gene locus_tag LOCUS_28750 3261 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 5025 4267 gene locus_tag LOCUS_28760 5025 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331492.1 protein_id gnl|my_center|LOCUS_28760 5459 5022 gene locus_tag LOCUS_28770 5459 5022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 6022 5447 gene locus_tag LOCUS_28780 6022 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 6212 6433 gene locus_tag LOCUS_28790 6212 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107539.1 protein_id gnl|my_center|LOCUS_28790 6687 6593 gene locus_tag LOCUS_t00430 6687 6593 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6947 7243 gene locus_tag LOCUS_28800 6947 7243 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258305.1 protein_id gnl|my_center|LOCUS_28800 7406 7999 gene locus_tag LOCUS_28810 7406 7999 CDS product invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_28810 8139 8330 gene locus_tag LOCUS_28820 8139 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 8327 10084 gene locus_tag LOCUS_28830 8327 10084 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417095.1 protein_id gnl|my_center|LOCUS_28830 10081 13152 gene locus_tag LOCUS_28840 10081 13152 CDS product adenine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963680.1 protein_id gnl|my_center|LOCUS_28840 15581 13290 gene locus_tag LOCUS_28850 15581 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385733.1 protein_id gnl|my_center|LOCUS_28850 15823 16476 gene locus_tag LOCUS_28860 15823 16476 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083586.1 protein_id gnl|my_center|LOCUS_28860 16799 16954 gene locus_tag LOCUS_28870 16799 16954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 >Feature sequence29 1552 536 gene locus_tag LOCUS_28880 1552 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 1670 2800 gene locus_tag LOCUS_28890 1670 2800 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039584.1 protein_id gnl|my_center|LOCUS_28890 2975 4087 gene locus_tag LOCUS_28900 2975 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 5277 4114 gene locus_tag LOCUS_28910 5277 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_28910 6105 5701 gene locus_tag LOCUS_28920 6105 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 6651 7292 gene locus_tag LOCUS_28930 6651 7292 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897687.1 protein_id gnl|my_center|LOCUS_28930 8896 7376 gene locus_tag LOCUS_28940 8896 7376 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969871.1 protein_id gnl|my_center|LOCUS_28940 9336 8929 gene locus_tag LOCUS_28950 9336 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090486.1 protein_id gnl|my_center|LOCUS_28950 10603 9350 gene locus_tag LOCUS_28960 gene ordL 10603 9350 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973446.1 protein_id gnl|my_center|LOCUS_28960 10827 12242 gene locus_tag LOCUS_28970 10827 12242 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_28970 12259 13155 gene locus_tag LOCUS_28980 12259 13155 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970789.1 protein_id gnl|my_center|LOCUS_28980 13152 13841 gene locus_tag LOCUS_28990 13152 13841 CDS product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532905.1 protein_id gnl|my_center|LOCUS_28990 13841 15175 gene locus_tag LOCUS_29000 gene gltB 13841 15175 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973662.1 protein_id gnl|my_center|LOCUS_29000 15276 16280 gene locus_tag LOCUS_29010 15276 16280 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523151.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence30 319 137 gene locus_tag LOCUS_29020 319 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 772 1383 gene locus_tag LOCUS_29030 772 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 1509 1700 gene locus_tag LOCUS_29040 1509 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 2541 1633 gene locus_tag LOCUS_29050 2541 1633 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_29050 3280 2726 gene locus_tag LOCUS_29060 3280 2726 CDS product hypothetical biphenyl dioxygenase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705092.1 protein_id gnl|my_center|LOCUS_29060 4656 3289 gene locus_tag LOCUS_29070 gene hcaE 4656 3289 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MJF0 protein_id gnl|my_center|LOCUS_29070 5208 4681 gene locus_tag LOCUS_29080 5208 4681 CDS product hypothetical biphenyl dioxygenase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705092.1 protein_id gnl|my_center|LOCUS_29080 6553 5201 gene locus_tag LOCUS_29090 6553 5201 CDS product putative large terminal subunit of phenylpropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705095.1 protein_id gnl|my_center|LOCUS_29090 6766 8406 gene locus_tag LOCUS_29100 6766 8406 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104293.1 protein_id gnl|my_center|LOCUS_29100 8520 9746 gene locus_tag LOCUS_29110 8520 9746 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226226.1 protein_id gnl|my_center|LOCUS_29110 10554 9766 gene locus_tag LOCUS_29120 gene xylL 10554 9766 CDS product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113313.1 protein_id gnl|my_center|LOCUS_29120 10706 11692 gene locus_tag LOCUS_29130 10706 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 11735 12910 gene locus_tag LOCUS_29140 11735 12910 CDS product biphenyl 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925750.1 protein_id gnl|my_center|LOCUS_29140 12907 13404 gene locus_tag LOCUS_29150 12907 13404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 14228 13572 gene locus_tag LOCUS_29160 14228 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 14471 14256 gene locus_tag LOCUS_29170 14471 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 15818 14787 gene locus_tag LOCUS_29180 15818 14787 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088795.1 protein_id gnl|my_center|LOCUS_29180 15910 16119 gene locus_tag LOCUS_29190 15910 16119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence31 <1 940 gene locus_tag LOCUS_29200 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368629.1:methylase 1044 3017 gene locus_tag LOCUS_29210 1044 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211744.1 protein_id gnl|my_center|LOCUS_29210 3850 4572 gene locus_tag LOCUS_29220 3850 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 5198 4692 gene locus_tag LOCUS_29230 5198 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 6952 5168 gene locus_tag LOCUS_29240 6952 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 8195 6945 gene locus_tag LOCUS_29250 8195 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 8558 9487 gene locus_tag LOCUS_29260 gene ardC 8558 9487 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974367.1 protein_id gnl|my_center|LOCUS_29260 9499 9939 gene locus_tag LOCUS_29270 9499 9939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 10159 11094 gene locus_tag LOCUS_29280 10159 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967479.1 protein_id gnl|my_center|LOCUS_29280 11166 11435 gene locus_tag LOCUS_29290 11166 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 11706 12104 gene locus_tag LOCUS_29300 11706 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 12437 12171 gene locus_tag LOCUS_29310 12437 12171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 12781 13002 gene locus_tag LOCUS_29320 12781 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 13783 13619 gene locus_tag LOCUS_29330 13783 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 13826 14770 gene locus_tag LOCUS_29340 13826 14770 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 protein_id gnl|my_center|LOCUS_29340 14767 15645 gene locus_tag LOCUS_29350 14767 15645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 >Feature sequence32 154 588 gene locus_tag LOCUS_29360 154 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 560 1201 gene locus_tag LOCUS_29370 560 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 1222 1989 gene locus_tag LOCUS_29380 1222 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 4147 2081 gene locus_tag LOCUS_29390 4147 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 4416 4147 gene locus_tag LOCUS_29400 4416 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 4567 5871 gene locus_tag LOCUS_29410 4567 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 6638 5883 gene locus_tag LOCUS_29420 6638 5883 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 protein_id gnl|my_center|LOCUS_29420 6874 6638 gene locus_tag LOCUS_29430 6874 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 6764 8065 gene locus_tag LOCUS_29440 6764 8065 CDS product teichoic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919050.1 protein_id gnl|my_center|LOCUS_29440 8814 8068 gene locus_tag LOCUS_29450 gene gloB 8814 8068 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4Z8 protein_id gnl|my_center|LOCUS_29450 8926 9825 gene locus_tag LOCUS_29460 gene cysD 8926 9825 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4V5 protein_id gnl|my_center|LOCUS_29460 9825 11756 gene locus_tag LOCUS_29470 9825 11756 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385211.1 protein_id gnl|my_center|LOCUS_29470 11753 12502 gene locus_tag LOCUS_29480 11753 12502 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_29480 12565 13947 gene locus_tag LOCUS_29490 12565 13947 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_29490 >Feature sequence33 8766 8840 gene locus_tag LOCUS_t00440 8766 8840 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence34 151 570 gene locus_tag LOCUS_29500 151 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 2203 2742 gene locus_tag LOCUS_29510 2203 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 4106 3489 gene locus_tag LOCUS_29520 4106 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265992.1 protein_id gnl|my_center|LOCUS_29520 6297 5086 gene locus_tag LOCUS_29530 gene hmp 6297 5086 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIY1 protein_id gnl|my_center|LOCUS_29530 6787 6362 gene locus_tag LOCUS_29540 6787 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920892.1 protein_id gnl|my_center|LOCUS_29540 6876 7298 gene locus_tag LOCUS_29550 gene nsrR 6876 7298 CDS product HTH-type transcriptional regulator NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07573 protein_id gnl|my_center|LOCUS_29550 >Feature sequence35 <1 1043 gene locus_tag LOCUS_29560 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010774201.1:adenine methyltransferase 1040 1555 gene locus_tag LOCUS_29570 1040 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 1552 1995 gene locus_tag LOCUS_29580 1552 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 2865 1894 gene locus_tag LOCUS_29590 2865 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 3208 4239 gene locus_tag LOCUS_29600 3208 4239 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_29600 4961 4347 gene locus_tag LOCUS_29610 4961 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 6135 4936 gene locus_tag LOCUS_29620 6135 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 6479 6114 gene locus_tag LOCUS_29630 6479 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 >Feature sequence36 113 1825 gene locus_tag LOCUS_29640 gene vipC 113 1825 CDS product Vi polysaccharide biosynthesis protein VipC/TviE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04975 protein_id gnl|my_center|LOCUS_29640 2996 2205 gene locus_tag LOCUS_29650 2996 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3106 3354 gene locus_tag LOCUS_29660 3106 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 4399 4698 gene locus_tag LOCUS_29670 4399 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 4711 5094 gene locus_tag LOCUS_29680 4711 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 5149 5547 gene locus_tag LOCUS_29690 5149 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 5723 5544 gene locus_tag LOCUS_29700 5723 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 5867 6019 gene locus_tag LOCUS_29710 5867 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence37 1906 305 gene locus_tag LOCUS_29720 gene int 1906 305 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_29720 2337 1903 gene locus_tag LOCUS_29730 2337 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_29730 2856 2380 gene locus_tag LOCUS_29740 2856 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 3326 2859 gene locus_tag LOCUS_29750 3326 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 4689 3319 gene locus_tag LOCUS_29760 4689 3319 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q832V4 protein_id gnl|my_center|LOCUS_29760 5559 5023 gene locus_tag LOCUS_29770 5559 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 5658 5885 gene locus_tag LOCUS_29780 5658 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 >Feature sequence38 1011 565 gene locus_tag LOCUS_29790 1011 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 1173 4085 gene locus_tag LOCUS_29800 gene uvrA 1173 4085 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTJ3 protein_id gnl|my_center|LOCUS_29800 4297 4593 gene locus_tag LOCUS_29810 4297 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence39 168 407 gene locus_tag LOCUS_29820 168 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 517 867 gene locus_tag LOCUS_29830 517 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 1114 917 gene locus_tag LOCUS_29840 1114 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092060.1 protein_id gnl|my_center|LOCUS_29840 1266 3806 gene locus_tag LOCUS_29850 1266 3806 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971462.1 protein_id gnl|my_center|LOCUS_29850 3803 4297 gene locus_tag LOCUS_29860 gene hmrR2 3803 4297 CDS product heavy metal-dependent transcription regulator 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58379 protein_id gnl|my_center|LOCUS_29860 4668 4471 gene locus_tag LOCUS_29870 4668 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 >Feature sequence40 678 424 gene locus_tag LOCUS_29880 678 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 1100 1474 gene locus_tag LOCUS_29890 1100 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 1471 1797 gene locus_tag LOCUS_29900 1471 1797 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_29900 1797 2039 gene locus_tag LOCUS_29910 1797 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 2032 2331 gene locus_tag LOCUS_29920 2032 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 3464 2352 gene locus_tag LOCUS_29930 3464 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 4054 3467 gene locus_tag LOCUS_29940 4054 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence41 894 181 gene locus_tag LOCUS_29950 894 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 1241 891 gene locus_tag LOCUS_29960 1241 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 2482 1238 gene locus_tag LOCUS_29970 2482 1238 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726818.1 protein_id gnl|my_center|LOCUS_29970 2895 3056 gene locus_tag LOCUS_29980 2895 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 3056 3328 gene locus_tag LOCUS_29990 3056 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 3917 3438 gene locus_tag LOCUS_30000 3917 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 >Feature sequence42 557 381 gene locus_tag LOCUS_30010 557 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 1239 1673 gene locus_tag LOCUS_30020 1239 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 1670 2584 gene locus_tag LOCUS_30030 1670 2584 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967848.1 protein_id gnl|my_center|LOCUS_30030 2581 3585 gene locus_tag LOCUS_30040 2581 3585 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967849.1 protein_id gnl|my_center|LOCUS_30040 >Feature sequence43 341 1528 gene locus_tag LOCUS_30050 341 1528 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_30050 1871 1461 gene locus_tag LOCUS_30060 1871 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 2877 1873 gene locus_tag LOCUS_30070 2877 1873 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289860.1 protein_id gnl|my_center|LOCUS_30070 >Feature sequence44 620 414 gene locus_tag LOCUS_30080 620 414 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533400.1 protein_id gnl|my_center|LOCUS_30080 691 903 gene locus_tag LOCUS_30090 691 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 903 1289 gene locus_tag LOCUS_30100 903 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 1856 1413 gene locus_tag LOCUS_30110 1856 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 2368 1853 gene locus_tag LOCUS_30120 2368 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 <3407 2365 gene locus_tag LOCUS_30130 <3407 2365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010774201.1:adenine methyltransferase >Feature sequence45 1882 794 gene locus_tag LOCUS_30140 1882 794 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4U9 protein_id gnl|my_center|LOCUS_30140 2165 2320 gene locus_tag LOCUS_30150 2165 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 3113 2274 gene locus_tag LOCUS_30160 3113 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence46 1057 827 gene locus_tag LOCUS_30170 1057 827 CDS product conjugal transfer trad family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525231.1 protein_id gnl|my_center|LOCUS_30170 1385 1080 gene locus_tag LOCUS_30180 1385 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 1559 2758 gene locus_tag LOCUS_30190 1559 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence47 162 905 gene locus_tag LOCUS_30200 162 905 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142671.1 protein_id gnl|my_center|LOCUS_30200 988 1263 gene locus_tag LOCUS_30210 988 1263 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213260.1 protein_id gnl|my_center|LOCUS_30210 1308 1814 gene locus_tag LOCUS_30220 1308 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 >Feature sequence48 1394 18 gene locus_tag LOCUS_30230 1394 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 1500 1784 gene locus_tag LOCUS_30240 1500 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence49 576 1538 gene locus_tag LOCUS_30250 576 1538 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707869.1 protein_id gnl|my_center|LOCUS_30250 >Feature sequence50 1178 1272 gene locus_tag LOCUS_t00450 1178 1272 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence51 >Feature sequence52 60 1337 gene locus_tag LOCUS_30260 gene pdhB 60 1337 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y470 protein_id gnl|my_center|LOCUS_30260 >Feature sequence53 206 1102 gene locus_tag LOCUS_30270 206 1102 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880615.1 protein_id gnl|my_center|LOCUS_30270 >Feature sequence54 1199 87 gene locus_tag LOCUS_30280 1199 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280