>Feature sequence01 350 1471 gene locus_tag LOCUS_00010 gene gp34 350 1471 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971283.1 protein_id gnl|my_center|LOCUS_00010 1521 1853 gene locus_tag LOCUS_00020 1521 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2021 2458 gene locus_tag LOCUS_00030 2021 2458 CDS product peptidase U35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383947.1 protein_id gnl|my_center|LOCUS_00030 2573 3703 gene locus_tag LOCUS_00040 gene gp36 2573 3703 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 protein_id gnl|my_center|LOCUS_00040 3851 4129 gene locus_tag LOCUS_00050 3851 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4129 4665 gene locus_tag LOCUS_00060 4129 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4662 4853 gene locus_tag LOCUS_00070 4662 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4850 5251 gene locus_tag LOCUS_00080 4850 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5837 5508 gene locus_tag LOCUS_00090 5837 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 5892 6299 gene locus_tag LOCUS_00100 5892 6299 CDS product tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383953.1 protein_id gnl|my_center|LOCUS_00100 6296 6619 gene locus_tag LOCUS_00110 6296 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6616 6813 gene locus_tag LOCUS_00120 6616 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 7067 7621 gene locus_tag LOCUS_00130 7067 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 7621 9969 gene locus_tag LOCUS_00140 7621 9969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 9960 10787 gene locus_tag LOCUS_00150 9960 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337518.1 protein_id gnl|my_center|LOCUS_00150 10784 11149 gene locus_tag LOCUS_00160 10784 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 11146 13386 gene locus_tag LOCUS_00170 11146 13386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 13419 13916 gene locus_tag LOCUS_00180 13419 13916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 14118 15197 gene locus_tag LOCUS_00190 14118 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 15581 16114 gene locus_tag LOCUS_00200 15581 16114 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022393.1 protein_id gnl|my_center|LOCUS_00200 16723 16181 gene locus_tag LOCUS_00210 16723 16181 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H57 protein_id gnl|my_center|LOCUS_00210 16849 17583 gene locus_tag LOCUS_00220 16849 17583 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722809.1 protein_id gnl|my_center|LOCUS_00220 18388 17765 gene locus_tag LOCUS_00230 gene gst 18388 17765 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314066.1 protein_id gnl|my_center|LOCUS_00230 19138 18482 gene locus_tag LOCUS_00240 19138 18482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085111.1 protein_id gnl|my_center|LOCUS_00240 19334 19125 gene locus_tag LOCUS_00250 19334 19125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 21880 19550 gene locus_tag LOCUS_00260 21880 19550 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_00260 22234 22037 gene locus_tag LOCUS_00270 22234 22037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 22340 23344 gene locus_tag LOCUS_00280 22340 23344 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_00280 23700 24575 gene locus_tag LOCUS_00290 23700 24575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 24688 25716 gene locus_tag LOCUS_00300 24688 25716 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972206.1 protein_id gnl|my_center|LOCUS_00300 25817 26515 gene locus_tag LOCUS_00310 25817 26515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_00310 26653 28359 gene locus_tag LOCUS_00320 26653 28359 CDS product dicarboxylate--CoA ligase PimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389067.1 protein_id gnl|my_center|LOCUS_00320 28446 28979 gene locus_tag LOCUS_00330 gene msrA 28446 28979 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTB6 protein_id gnl|my_center|LOCUS_00330 29024 29344 gene locus_tag LOCUS_00340 29024 29344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 30352 29396 gene locus_tag LOCUS_00350 30352 29396 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8G2 protein_id gnl|my_center|LOCUS_00350 30489 31304 gene locus_tag LOCUS_00360 30489 31304 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707935.1 protein_id gnl|my_center|LOCUS_00360 32815 31481 gene locus_tag LOCUS_00370 32815 31481 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766669.1 protein_id gnl|my_center|LOCUS_00370 33040 32867 gene locus_tag LOCUS_00380 33040 32867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 33276 33485 gene locus_tag LOCUS_00390 33276 33485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 34457 33513 gene locus_tag LOCUS_00400 gene argC 34457 33513 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H5 protein_id gnl|my_center|LOCUS_00400 35362 34454 gene locus_tag LOCUS_00410 35362 34454 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920773.1 protein_id gnl|my_center|LOCUS_00410 35729 35322 gene locus_tag LOCUS_00420 35729 35322 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_00420 37186 35792 gene locus_tag LOCUS_00430 37186 35792 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_00430 37417 37196 gene locus_tag LOCUS_00440 37417 37196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 37331 37531 gene locus_tag LOCUS_00450 37331 37531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 37531 38367 gene locus_tag LOCUS_00460 37531 38367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 39921 38590 gene locus_tag LOCUS_00470 gene rimO 39921 38590 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8U2 protein_id gnl|my_center|LOCUS_00470 41008 40019 gene locus_tag LOCUS_00480 41008 40019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524032.1 protein_id gnl|my_center|LOCUS_00480 42081 41071 gene locus_tag LOCUS_00490 42081 41071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 42867 42154 gene locus_tag LOCUS_00500 gene surE 42867 42154 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH6 protein_id gnl|my_center|LOCUS_00500 42748 42966 gene locus_tag LOCUS_00510 42748 42966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 44309 43029 gene locus_tag LOCUS_00520 gene serS 44309 43029 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEQ2 protein_id gnl|my_center|LOCUS_00520 44403 44843 gene locus_tag LOCUS_00530 44403 44843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087415.1 protein_id gnl|my_center|LOCUS_00530 44942 45304 gene locus_tag LOCUS_00540 44942 45304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 45323 45892 gene locus_tag LOCUS_00550 45323 45892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 46452 46916 gene locus_tag LOCUS_00560 gene dksA 46452 46916 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9J6 protein_id gnl|my_center|LOCUS_00560 46985 47359 gene locus_tag LOCUS_00570 46985 47359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 47853 48032 gene locus_tag LOCUS_00580 47853 48032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336845.1 protein_id gnl|my_center|LOCUS_00580 48154 48633 gene locus_tag LOCUS_00590 48154 48633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 48783 50753 gene locus_tag LOCUS_00600 48783 50753 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389852.1 protein_id gnl|my_center|LOCUS_00600 50753 54931 gene locus_tag LOCUS_00610 50753 54931 CDS product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389851.1 protein_id gnl|my_center|LOCUS_00610 55141 55794 gene locus_tag LOCUS_00620 gene ropB2 55141 55794 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530975.1 protein_id gnl|my_center|LOCUS_00620 56551 55877 gene locus_tag LOCUS_00630 gene pyrF 56551 55877 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS7 protein_id gnl|my_center|LOCUS_00630 56886 56548 gene locus_tag LOCUS_00640 56886 56548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 57813 56956 gene locus_tag LOCUS_00650 57813 56956 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923249.1 protein_id gnl|my_center|LOCUS_00650 58316 57810 gene locus_tag LOCUS_00660 58316 57810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00660 59222 58347 gene locus_tag LOCUS_00670 59222 58347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00670 59430 59624 gene locus_tag LOCUS_00680 59430 59624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 60449 59907 gene locus_tag LOCUS_00690 60449 59907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 60629 61945 gene locus_tag LOCUS_00700 60629 61945 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFB8 protein_id gnl|my_center|LOCUS_00700 63057 62038 gene locus_tag LOCUS_00710 gene xylR 63057 62038 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920901.1 protein_id gnl|my_center|LOCUS_00710 63643 64929 gene locus_tag LOCUS_00720 63643 64929 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919382.1 protein_id gnl|my_center|LOCUS_00720 64933 66348 gene locus_tag LOCUS_00730 gene uxaC 64933 66348 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F4 protein_id gnl|my_center|LOCUS_00730 66345 67814 gene locus_tag LOCUS_00740 gene uxuB 66345 67814 CDS product mannitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089575.1 protein_id gnl|my_center|LOCUS_00740 68300 67821 gene locus_tag LOCUS_00750 gene putR 68300 67821 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313921.1 protein_id gnl|my_center|LOCUS_00750 68399 71998 gene locus_tag LOCUS_00760 gene putA1 68399 71998 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF64 protein_id gnl|my_center|LOCUS_00760 73700 72030 gene locus_tag LOCUS_00770 73700 72030 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265651.1 protein_id gnl|my_center|LOCUS_00770 74902 73880 gene locus_tag LOCUS_00780 74902 73880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 75407 74994 gene locus_tag LOCUS_00790 75407 74994 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532088.1 protein_id gnl|my_center|LOCUS_00790 76257 75409 gene locus_tag LOCUS_00800 76257 75409 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_00800 77022 76342 gene locus_tag LOCUS_00810 77022 76342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 79452 77395 gene locus_tag LOCUS_00820 gene rpoD 79452 77395 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBM5 protein_id gnl|my_center|LOCUS_00820 81431 79530 gene locus_tag LOCUS_00830 gene dnaG 81431 79530 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB5 protein_id gnl|my_center|LOCUS_00830 81821 81432 gene locus_tag LOCUS_00840 81821 81432 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035690.1 protein_id gnl|my_center|LOCUS_00840 82328 81876 gene locus_tag LOCUS_00850 82328 81876 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090104.1 protein_id gnl|my_center|LOCUS_00850 82486 83664 gene locus_tag LOCUS_00860 gene carA 82486 83664 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB3 protein_id gnl|my_center|LOCUS_00860 83661 84029 gene locus_tag LOCUS_00870 83661 84029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 84418 87753 gene locus_tag LOCUS_00880 84418 87753 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB2 protein_id gnl|my_center|LOCUS_00880 87834 88310 gene locus_tag LOCUS_00890 gene greA 87834 88310 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4I3 protein_id gnl|my_center|LOCUS_00890 88334 88972 gene locus_tag LOCUS_00900 88334 88972 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970095.1 protein_id gnl|my_center|LOCUS_00900 89198 88977 gene locus_tag LOCUS_00910 89198 88977 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707005.1 protein_id gnl|my_center|LOCUS_00910 89857 89303 gene locus_tag LOCUS_00920 89857 89303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 90173 89850 gene locus_tag LOCUS_00930 90173 89850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 90559 90170 gene locus_tag LOCUS_00940 90559 90170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 91265 90600 gene locus_tag LOCUS_00950 91265 90600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 91497 92771 gene locus_tag LOCUS_00960 gene eno 91497 92771 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3H9 protein_id gnl|my_center|LOCUS_00960 92849 93160 gene locus_tag LOCUS_00970 92849 93160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 93511 94461 gene locus_tag LOCUS_00980 gene pdhA 93511 94461 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT64 protein_id gnl|my_center|LOCUS_00980 94461 95843 gene locus_tag LOCUS_00990 gene pdhB3 94461 95843 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707841.1 protein_id gnl|my_center|LOCUS_00990 96582 95905 gene locus_tag LOCUS_01000 96582 95905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 97213 96593 gene locus_tag LOCUS_01010 97213 96593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 99192 97210 gene locus_tag LOCUS_01020 99192 97210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 99327 100001 gene locus_tag LOCUS_01030 99327 100001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 100037 100501 gene locus_tag LOCUS_01040 100037 100501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 101922 100579 gene locus_tag LOCUS_01050 gene trmFO 101922 100579 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L21 protein_id gnl|my_center|LOCUS_01050 103353 102049 gene locus_tag LOCUS_01060 103353 102049 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971161.1 protein_id gnl|my_center|LOCUS_01060 103683 105050 gene locus_tag LOCUS_01070 103683 105050 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921072.1 protein_id gnl|my_center|LOCUS_01070 106827 105157 gene locus_tag LOCUS_01080 gene leuA 106827 105157 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUD3 protein_id gnl|my_center|LOCUS_01080 107798 107172 gene locus_tag LOCUS_01090 107798 107172 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_01090 109060 108041 gene locus_tag LOCUS_01100 gene ilvC 109060 108041 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6H4 protein_id gnl|my_center|LOCUS_01100 109795 109280 gene locus_tag LOCUS_01110 gene ilvH 109795 109280 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_01110 110154 109795 gene locus_tag LOCUS_01120 110154 109795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 111916 110165 gene locus_tag LOCUS_01130 111916 110165 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CA17 protein_id gnl|my_center|LOCUS_01130 112961 112017 gene locus_tag LOCUS_01140 gene miaA 112961 112017 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX74 protein_id gnl|my_center|LOCUS_01140 112960 113838 gene locus_tag LOCUS_01150 gene serB 112960 113838 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338897.1 protein_id gnl|my_center|LOCUS_01150 113912 114262 gene locus_tag LOCUS_01160 113912 114262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 114271 115821 gene locus_tag LOCUS_01170 114271 115821 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708237.1 protein_id gnl|my_center|LOCUS_01170 116457 115987 gene locus_tag LOCUS_01180 116457 115987 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Z8 protein_id gnl|my_center|LOCUS_01180 117572 116454 gene locus_tag LOCUS_01190 117572 116454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919309.1 protein_id gnl|my_center|LOCUS_01190 117677 118000 gene locus_tag LOCUS_01200 gene gatC 117677 118000 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAW8 protein_id gnl|my_center|LOCUS_01200 117997 119481 gene locus_tag LOCUS_01210 gene gatA 117997 119481 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZJ5 protein_id gnl|my_center|LOCUS_01210 119483 119716 gene locus_tag LOCUS_01220 119483 119716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 119709 121214 gene locus_tag LOCUS_01230 gene gatB 119709 121214 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U821 protein_id gnl|my_center|LOCUS_01230 124592 121389 gene locus_tag LOCUS_01240 124592 121389 CDS product autotransporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265524.1 protein_id gnl|my_center|LOCUS_01240 127103 124680 gene locus_tag LOCUS_01250 127103 124680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 128028 127087 gene locus_tag LOCUS_01260 gene bupR 128028 127087 CDS product inner membrane sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815596.1 protein_id gnl|my_center|LOCUS_01260 128596 128084 gene locus_tag LOCUS_01270 128596 128084 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_01270 128888 130096 gene locus_tag LOCUS_01280 128888 130096 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_01280 130182 132650 gene locus_tag LOCUS_01290 gene glgP 130182 132650 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M15 protein_id gnl|my_center|LOCUS_01290 132671 134830 gene locus_tag LOCUS_01300 gene glgB 132671 134830 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNQ2 protein_id gnl|my_center|LOCUS_01300 134887 136149 gene locus_tag LOCUS_01310 gene glgC 134887 136149 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8L5 protein_id gnl|my_center|LOCUS_01310 136158 137606 gene locus_tag LOCUS_01320 gene glgA 136158 137606 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNQ0 protein_id gnl|my_center|LOCUS_01320 137603 139489 gene locus_tag LOCUS_01330 137603 139489 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNP8 protein_id gnl|my_center|LOCUS_01330 139605 140165 gene locus_tag LOCUS_01340 139605 140165 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727174.1 protein_id gnl|my_center|LOCUS_01340 140243 140168 gene locus_tag LOCUS_t00010 140243 140168 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 140796 140266 gene locus_tag LOCUS_01350 140796 140266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 141091 140840 gene locus_tag LOCUS_01360 141091 140840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 141764 141150 gene locus_tag LOCUS_01370 gene rpsD 141764 141150 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J446 protein_id gnl|my_center|LOCUS_01370 141979 142275 gene locus_tag LOCUS_01380 141979 142275 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265672.1 protein_id gnl|my_center|LOCUS_01380 143367 142312 gene locus_tag LOCUS_01390 143367 142312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 143908 143450 gene locus_tag LOCUS_01400 gene nrdR 143908 143450 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB9 protein_id gnl|my_center|LOCUS_01400 145338 144037 gene locus_tag LOCUS_01410 gene glyA1 145338 144037 CDS product serine hydroxymethyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QU6 protein_id gnl|my_center|LOCUS_01410 145800 145363 gene locus_tag LOCUS_01420 145800 145363 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 protein_id gnl|my_center|LOCUS_01420 145930 146094 gene locus_tag LOCUS_01430 145930 146094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 146928 146272 gene locus_tag LOCUS_01440 146928 146272 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143006.1 protein_id gnl|my_center|LOCUS_01440 147081 148181 gene locus_tag LOCUS_01450 gene nifS 147081 148181 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_01450 148178 149266 gene locus_tag LOCUS_01460 gene iscS 148178 149266 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SN1 protein_id gnl|my_center|LOCUS_01460 149284 149619 gene locus_tag LOCUS_01470 149284 149619 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_01470 149616 150596 gene locus_tag LOCUS_01480 149616 150596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 150871 152481 gene locus_tag LOCUS_01490 gene dnaX 150871 152481 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338432.1 protein_id gnl|my_center|LOCUS_01490 152485 152808 gene locus_tag LOCUS_01500 152485 152808 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPZ1 protein_id gnl|my_center|LOCUS_01500 152964 155360 gene locus_tag LOCUS_01510 gene lon 152964 155360 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2H6 protein_id gnl|my_center|LOCUS_01510 155542 155814 gene locus_tag LOCUS_01520 155542 155814 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_01520 156012 156575 gene locus_tag LOCUS_01530 156012 156575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 156684 156760 gene locus_tag LOCUS_t00020 156684 156760 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 156851 157222 gene locus_tag LOCUS_01540 156851 157222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 157209 157739 gene locus_tag LOCUS_01550 157209 157739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 158386 157733 gene locus_tag LOCUS_01560 158386 157733 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640127.1 protein_id gnl|my_center|LOCUS_01560 159584 158445 gene locus_tag LOCUS_01570 159584 158445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 160821 159625 gene locus_tag LOCUS_01580 160821 159625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087637.1 protein_id gnl|my_center|LOCUS_01580 161672 160989 gene locus_tag LOCUS_01590 161672 160989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 163994 161727 gene locus_tag LOCUS_01600 163994 161727 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920475.1 protein_id gnl|my_center|LOCUS_01600 164924 164004 gene locus_tag LOCUS_01610 164924 164004 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968807.1 protein_id gnl|my_center|LOCUS_01610 165022 167136 gene locus_tag LOCUS_01620 gene glcB 165022 167136 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 protein_id gnl|my_center|LOCUS_01620 167187 168287 gene locus_tag LOCUS_01630 167187 168287 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 protein_id gnl|my_center|LOCUS_01630 168284 168862 gene locus_tag LOCUS_01640 168284 168862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 168966 169529 gene locus_tag LOCUS_01650 gene efp 168966 169529 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMY9 protein_id gnl|my_center|LOCUS_01650 169628 170440 gene locus_tag LOCUS_01660 169628 170440 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_01660 170569 170943 gene locus_tag LOCUS_01670 gene nuoA 170569 170943 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ5 protein_id gnl|my_center|LOCUS_01670 170934 171488 gene locus_tag LOCUS_01680 gene nuoB 170934 171488 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7W4 protein_id gnl|my_center|LOCUS_01680 171490 172293 gene locus_tag LOCUS_01690 171490 172293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 172420 173655 gene locus_tag LOCUS_01700 gene nuoD 172420 173655 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJA9 protein_id gnl|my_center|LOCUS_01700 173655 174323 gene locus_tag LOCUS_01710 173655 174323 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_01710 174320 175651 gene locus_tag LOCUS_01720 174320 175651 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531094.1 protein_id gnl|my_center|LOCUS_01720 175654 177660 gene locus_tag LOCUS_01730 175654 177660 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU34 protein_id gnl|my_center|LOCUS_01730 177767 178816 gene locus_tag LOCUS_01740 gene nuoH 177767 178816 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU33 protein_id gnl|my_center|LOCUS_01740 178813 179298 gene locus_tag LOCUS_01750 gene nuoI1 178813 179298 CDS product NADH-quinone oxidoreductase subunit I 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3F0 protein_id gnl|my_center|LOCUS_01750 179435 180046 gene locus_tag LOCUS_01760 179435 180046 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389439.1 protein_id gnl|my_center|LOCUS_01760 180043 180348 gene locus_tag LOCUS_01770 gene nuoK 180043 180348 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KJ8 protein_id gnl|my_center|LOCUS_01770 180359 182452 gene locus_tag LOCUS_01780 gene nuoL 180359 182452 CDS product NADH:ubiquinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919805.1 protein_id gnl|my_center|LOCUS_01780 182452 184017 gene locus_tag LOCUS_01790 182452 184017 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_01790 184017 185453 gene locus_tag LOCUS_01800 gene nuoN2 184017 185453 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA70 protein_id gnl|my_center|LOCUS_01800 185495 186154 gene locus_tag LOCUS_01810 gene birA 185495 186154 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707633.1 protein_id gnl|my_center|LOCUS_01810 186169 186948 gene locus_tag LOCUS_01820 gene coaX 186169 186948 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU25 protein_id gnl|my_center|LOCUS_01820 186948 188585 gene locus_tag LOCUS_01830 186948 188585 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_01830 188595 188864 gene locus_tag LOCUS_01840 188595 188864 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707636.1 protein_id gnl|my_center|LOCUS_01840 191612 188931 gene locus_tag LOCUS_01850 191612 188931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 191685 191987 gene locus_tag LOCUS_01860 191685 191987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 192078 193259 gene locus_tag LOCUS_01870 192078 193259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 193316 194404 gene locus_tag LOCUS_01880 193316 194404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 194407 195780 gene locus_tag LOCUS_01890 194407 195780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 197134 195848 gene locus_tag LOCUS_01900 gene cisY 197134 195848 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJ53 protein_id gnl|my_center|LOCUS_01900 198576 197155 gene locus_tag LOCUS_01910 gene gltX2 198576 197155 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 protein_id gnl|my_center|LOCUS_01910 198719 200785 gene locus_tag LOCUS_01920 198719 200785 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087598.1 protein_id gnl|my_center|LOCUS_01920 201453 200782 gene locus_tag LOCUS_01930 gene lexA 201453 200782 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFK2 protein_id gnl|my_center|LOCUS_01930 202763 201579 gene locus_tag LOCUS_01940 gene moeA 202763 201579 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971802.1 protein_id gnl|my_center|LOCUS_01940 203230 202760 gene locus_tag LOCUS_01950 gene moaC 203230 202760 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC52 protein_id gnl|my_center|LOCUS_01950 204018 203227 gene locus_tag LOCUS_01960 gene trpC 204018 203227 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T2 protein_id gnl|my_center|LOCUS_01960 205007 204015 gene locus_tag LOCUS_01970 gene trpD 205007 204015 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 protein_id gnl|my_center|LOCUS_01970 205247 206752 gene locus_tag LOCUS_01980 205247 206752 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971436.1 protein_id gnl|my_center|LOCUS_01980 207367 206777 gene locus_tag LOCUS_01990 207367 206777 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919763.1 protein_id gnl|my_center|LOCUS_01990 207591 207827 gene locus_tag LOCUS_02000 207591 207827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 208607 208993 gene locus_tag LOCUS_02010 208607 208993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 209238 210827 gene locus_tag LOCUS_02020 209238 210827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918059.1 protein_id gnl|my_center|LOCUS_02020 210920 213625 gene locus_tag LOCUS_02030 210920 213625 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918060.1 protein_id gnl|my_center|LOCUS_02030 214348 213707 gene locus_tag LOCUS_02040 214348 213707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 214518 215342 gene locus_tag LOCUS_02050 214518 215342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 215339 217522 gene locus_tag LOCUS_02060 gene pulD 215339 217522 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918062.1 protein_id gnl|my_center|LOCUS_02060 217519 219132 gene locus_tag LOCUS_02070 gene xcsE 217519 219132 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038522.1 protein_id gnl|my_center|LOCUS_02070 219125 220342 gene locus_tag LOCUS_02080 gene pulF 219125 220342 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918064.1 protein_id gnl|my_center|LOCUS_02080 220352 220894 gene locus_tag LOCUS_02090 gene xcsG 220352 220894 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038520.1 protein_id gnl|my_center|LOCUS_02090 220941 221390 gene locus_tag LOCUS_02100 220941 221390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 221452 221787 gene locus_tag LOCUS_02110 221452 221787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 221787 222452 gene locus_tag LOCUS_02120 gene xcsJ 221787 222452 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038517.1 protein_id gnl|my_center|LOCUS_02120 222445 223434 gene locus_tag LOCUS_02130 222445 223434 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABP6 protein_id gnl|my_center|LOCUS_02130 223431 224549 gene locus_tag LOCUS_02140 223431 224549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 224546 225031 gene locus_tag LOCUS_02150 224546 225031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 225031 225750 gene locus_tag LOCUS_02160 225031 225750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918072.1 protein_id gnl|my_center|LOCUS_02160 225747 226487 gene locus_tag LOCUS_02170 gene pulO 225747 226487 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4N1 protein_id gnl|my_center|LOCUS_02170 226527 227381 gene locus_tag LOCUS_02180 226527 227381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 227266 228897 gene locus_tag LOCUS_02190 227266 228897 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085809.1 protein_id gnl|my_center|LOCUS_02190 228894 232439 gene locus_tag LOCUS_02200 gene dnaE2 228894 232439 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H427 protein_id gnl|my_center|LOCUS_02200 232529 232453 gene locus_tag LOCUS_t00030 232529 232453 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 232999 232796 gene locus_tag LOCUS_02210 232999 232796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 234529 233156 gene locus_tag LOCUS_02220 234529 233156 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_02220 234629 236314 gene locus_tag LOCUS_02230 234629 236314 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_02230 237483 236659 gene locus_tag LOCUS_02240 237483 236659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_02240 238133 237495 gene locus_tag LOCUS_02250 238133 237495 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAR1 protein_id gnl|my_center|LOCUS_02250 238178 239143 gene locus_tag LOCUS_02260 gene lipA 238178 239143 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFG1 protein_id gnl|my_center|LOCUS_02260 239148 239624 gene locus_tag LOCUS_02270 239148 239624 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384473.1 protein_id gnl|my_center|LOCUS_02270 240088 239570 gene locus_tag LOCUS_02280 gene cinA 240088 239570 CDS product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971625.1 protein_id gnl|my_center|LOCUS_02280 241280 240093 gene locus_tag LOCUS_02290 gene ispDF 241280 240093 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7I5 protein_id gnl|my_center|LOCUS_02290 241424 242401 gene locus_tag LOCUS_02300 gene dus 241424 242401 CDS product putative tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED2 protein_id gnl|my_center|LOCUS_02300 242398 243507 gene locus_tag LOCUS_02310 gene ntrB 242398 243507 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_02310 243507 244958 gene locus_tag LOCUS_02320 243507 244958 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975265.1 protein_id gnl|my_center|LOCUS_02320 245119 247323 gene locus_tag LOCUS_02330 245119 247323 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_02330 247313 248683 gene locus_tag LOCUS_02340 gene ntrX 247313 248683 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087262.1 protein_id gnl|my_center|LOCUS_02340 248841 249323 gene locus_tag LOCUS_02350 248841 249323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 249453 250397 gene locus_tag LOCUS_02360 gene glsA 249453 250397 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLD2 protein_id gnl|my_center|LOCUS_02360 250539 250465 gene locus_tag LOCUS_t00040 250539 250465 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 251440 250664 gene locus_tag LOCUS_02370 gene nadK 251440 250664 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX24 protein_id gnl|my_center|LOCUS_02370 252450 251437 gene locus_tag LOCUS_02380 gene moaA 252450 251437 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDF6 protein_id gnl|my_center|LOCUS_02380 252573 254588 gene locus_tag LOCUS_02390 252573 254588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 254980 254585 gene locus_tag LOCUS_02400 254980 254585 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037778.1 protein_id gnl|my_center|LOCUS_02400 255729 255037 gene locus_tag LOCUS_02410 255729 255037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 256171 255758 gene locus_tag LOCUS_02420 256171 255758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 259759 256283 gene locus_tag LOCUS_02430 gene mfd 259759 256283 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9F5 protein_id gnl|my_center|LOCUS_02430 260177 259911 gene locus_tag LOCUS_02440 260177 259911 CDS product Sdh5 family flavination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640346.1 protein_id gnl|my_center|LOCUS_02440 260265 262328 gene locus_tag LOCUS_02450 260265 262328 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_02450 262380 263462 gene locus_tag LOCUS_02460 262380 263462 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 protein_id gnl|my_center|LOCUS_02460 263778 263425 gene locus_tag LOCUS_02470 263778 263425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 265072 263855 gene locus_tag LOCUS_02480 gene tyrS 265072 263855 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR3 protein_id gnl|my_center|LOCUS_02480 265127 266212 gene locus_tag LOCUS_02490 gene anmK 265127 266212 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR4 protein_id gnl|my_center|LOCUS_02490 267301 266318 gene locus_tag LOCUS_02500 267301 266318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 268476 267301 gene locus_tag LOCUS_02510 268476 267301 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_02510 268659 269984 gene locus_tag LOCUS_02520 268659 269984 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389429.1 protein_id gnl|my_center|LOCUS_02520 270082 270897 gene locus_tag LOCUS_02530 270082 270897 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 protein_id gnl|my_center|LOCUS_02530 270918 272054 gene locus_tag LOCUS_02540 270918 272054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 272059 272667 gene locus_tag LOCUS_02550 272059 272667 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525376.1 protein_id gnl|my_center|LOCUS_02550 272726 273481 gene locus_tag LOCUS_02560 gene fnrL 272726 273481 CDS product transcriptional activator protein FnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51007 protein_id gnl|my_center|LOCUS_02560 273560 275263 gene locus_tag LOCUS_02570 gene fixN 273560 275263 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316285.1 protein_id gnl|my_center|LOCUS_02570 275277 276023 gene locus_tag LOCUS_02580 gene fixO 275277 276023 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971696.1 protein_id gnl|my_center|LOCUS_02580 276020 276193 gene locus_tag LOCUS_02590 276020 276193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 276186 277142 gene locus_tag LOCUS_02600 gene ccoP 276186 277142 CDS product Cbb3-type cytochrome c oxidase subunit CcoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J015 protein_id gnl|my_center|LOCUS_02600 277191 278621 gene locus_tag LOCUS_02610 277191 278621 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524998.1 protein_id gnl|my_center|LOCUS_02610 278621 279073 gene locus_tag LOCUS_02620 gene fixH 278621 279073 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971693.1 protein_id gnl|my_center|LOCUS_02620 279073 281208 gene locus_tag LOCUS_02630 gene fixI1 279073 281208 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708322.1 protein_id gnl|my_center|LOCUS_02630 282645 281371 gene locus_tag LOCUS_02640 282645 281371 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889500.1 protein_id gnl|my_center|LOCUS_02640 284618 282642 gene locus_tag LOCUS_02650 gene parE 284618 282642 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBJ0 protein_id gnl|my_center|LOCUS_02650 284779 285621 gene locus_tag LOCUS_02660 284779 285621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635849.2 protein_id gnl|my_center|LOCUS_02660 286392 285691 gene locus_tag LOCUS_02670 286392 285691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 286508 287368 gene locus_tag LOCUS_02680 286508 287368 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8S9 protein_id gnl|my_center|LOCUS_02680 287705 288814 gene locus_tag LOCUS_02690 gene wecB 287705 288814 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM43 protein_id gnl|my_center|LOCUS_02690 289081 290376 gene locus_tag LOCUS_02700 gene wecC 289081 290376 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482531.1 protein_id gnl|my_center|LOCUS_02700 290479 291174 gene locus_tag LOCUS_02710 gene gumB 290479 291174 CDS product GumB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037595.1 protein_id gnl|my_center|LOCUS_02710 291174 293279 gene locus_tag LOCUS_02720 291174 293279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 294005 293331 gene locus_tag LOCUS_02730 gene purQ 294005 293331 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4K2 protein_id gnl|my_center|LOCUS_02730 294242 294009 gene locus_tag LOCUS_02740 gene purS 294242 294009 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI1 protein_id gnl|my_center|LOCUS_02740 294399 294554 gene locus_tag LOCUS_02750 294399 294554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 294603 295355 gene locus_tag LOCUS_02760 294603 295355 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFE0 protein_id gnl|my_center|LOCUS_02760 296235 295453 gene locus_tag LOCUS_02770 gene purC 296235 295453 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9L2 protein_id gnl|my_center|LOCUS_02770 297910 296504 gene locus_tag LOCUS_02780 gene ostA 297910 296504 CDS product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P688 protein_id gnl|my_center|LOCUS_02780 299631 297907 gene locus_tag LOCUS_02790 299631 297907 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_02790 300487 299780 gene locus_tag LOCUS_02800 300487 299780 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6ULS4 protein_id gnl|my_center|LOCUS_02800 300746 300588 gene locus_tag LOCUS_02810 300746 300588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 300873 301790 gene locus_tag LOCUS_02820 300873 301790 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528412.1 protein_id gnl|my_center|LOCUS_02820 301830 302072 gene locus_tag LOCUS_02830 301830 302072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529165.1 protein_id gnl|my_center|LOCUS_02830 302072 302368 gene locus_tag LOCUS_02840 302072 302368 CDS product plasmid maintenance protein CcdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529164.1 protein_id gnl|my_center|LOCUS_02840 302435 304762 gene locus_tag LOCUS_02850 gene parC 302435 304762 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT97 protein_id gnl|my_center|LOCUS_02850 304948 306585 gene locus_tag LOCUS_02860 304948 306585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 307760 306549 gene locus_tag LOCUS_02870 307760 306549 CDS product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708849.1 protein_id gnl|my_center|LOCUS_02870 308356 307757 gene locus_tag LOCUS_02880 308356 307757 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085254.1 protein_id gnl|my_center|LOCUS_02880 308919 308353 gene locus_tag LOCUS_02890 308919 308353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104740.1 protein_id gnl|my_center|LOCUS_02890 309476 308964 gene locus_tag LOCUS_02900 309476 308964 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918293.1 protein_id gnl|my_center|LOCUS_02900 309399 309566 gene locus_tag LOCUS_02910 309399 309566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 309611 309994 gene locus_tag LOCUS_02920 309611 309994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 311020 310073 gene locus_tag LOCUS_02930 311020 310073 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918089.1 protein_id gnl|my_center|LOCUS_02930 311137 311544 gene locus_tag LOCUS_02940 311137 311544 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336801.1 protein_id gnl|my_center|LOCUS_02940 311690 311977 gene locus_tag LOCUS_02950 311690 311977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 312349 312047 gene locus_tag LOCUS_02960 312349 312047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 313120 313046 gene locus_tag LOCUS_t00050 313120 313046 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 314006 313149 gene locus_tag LOCUS_02970 314006 313149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 315325 314003 gene locus_tag LOCUS_02980 315325 314003 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_02980 316532 315354 gene locus_tag LOCUS_02990 316532 315354 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918642.1 protein_id gnl|my_center|LOCUS_02990 316659 316877 gene locus_tag LOCUS_03000 316659 316877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 316936 317589 gene locus_tag LOCUS_03010 316936 317589 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337078.1 protein_id gnl|my_center|LOCUS_03010 318010 317615 gene locus_tag LOCUS_03020 318010 317615 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706199.1 protein_id gnl|my_center|LOCUS_03020 318045 320411 gene locus_tag LOCUS_03030 gene rnr 318045 320411 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC60 protein_id gnl|my_center|LOCUS_03030 320956 320495 gene locus_tag LOCUS_03040 320956 320495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 321137 322438 gene locus_tag LOCUS_03050 321137 322438 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBK4 protein_id gnl|my_center|LOCUS_03050 322438 322839 gene locus_tag LOCUS_03060 322438 322839 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265510.1 protein_id gnl|my_center|LOCUS_03060 322863 324278 gene locus_tag LOCUS_03070 322863 324278 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J255 protein_id gnl|my_center|LOCUS_03070 324310 324888 gene locus_tag LOCUS_03080 324310 324888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 326346 324868 gene locus_tag LOCUS_03090 326346 324868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 327921 326509 gene locus_tag LOCUS_03100 gene glnA3 327921 326509 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCG7 protein_id gnl|my_center|LOCUS_03100 328358 328020 gene locus_tag LOCUS_03110 gene glnB 328358 328020 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 protein_id gnl|my_center|LOCUS_03110 329433 328606 gene locus_tag LOCUS_03120 gene map 329433 328606 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4Z4 protein_id gnl|my_center|LOCUS_03120 329637 330398 gene locus_tag LOCUS_03130 329637 330398 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532015.1 protein_id gnl|my_center|LOCUS_03130 331073 330402 gene locus_tag LOCUS_03140 331073 330402 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_03140 331208 331657 gene locus_tag LOCUS_03150 331208 331657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 333426 331642 gene locus_tag LOCUS_03160 333426 331642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920670.1 protein_id gnl|my_center|LOCUS_03160 335630 333423 gene locus_tag LOCUS_03170 335630 333423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640602.1 protein_id gnl|my_center|LOCUS_03170 336775 335627 gene locus_tag LOCUS_03180 336775 335627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920668.1 protein_id gnl|my_center|LOCUS_03180 337665 336772 gene locus_tag LOCUS_03190 337665 336772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035348.1 protein_id gnl|my_center|LOCUS_03190 338662 337673 gene locus_tag LOCUS_03200 gene moxR 338662 337673 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035349.1 protein_id gnl|my_center|LOCUS_03200 339445 338801 gene locus_tag LOCUS_03210 339445 338801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_635487.2 protein_id gnl|my_center|LOCUS_03210 340847 339513 gene locus_tag LOCUS_03220 gene tldD 340847 339513 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_03220 342469 340868 gene locus_tag LOCUS_03230 gene tldD 342469 340868 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035352.1 protein_id gnl|my_center|LOCUS_03230 342864 342788 gene locus_tag LOCUS_t00060 342864 342788 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 343299 342967 gene locus_tag LOCUS_03240 343299 342967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 343421 344356 gene locus_tag LOCUS_03250 gene thyA 343421 344356 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0W9 protein_id gnl|my_center|LOCUS_03250 344477 345772 gene locus_tag LOCUS_03260 gene bkdA1 344477 345772 CDS product 2-oxoisovalerate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1M2 protein_id gnl|my_center|LOCUS_03260 345968 346990 gene locus_tag LOCUS_03270 gene bkdA2 345968 346990 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1M1 protein_id gnl|my_center|LOCUS_03270 346996 348324 gene locus_tag LOCUS_03280 346996 348324 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW2 protein_id gnl|my_center|LOCUS_03280 348801 348328 gene locus_tag LOCUS_03290 348801 348328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 348972 350126 gene locus_tag LOCUS_03300 348972 350126 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391267.1 protein_id gnl|my_center|LOCUS_03300 350169 350245 gene locus_tag LOCUS_t00070 350169 350245 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 350525 350289 gene locus_tag LOCUS_03310 350525 350289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 351118 350522 gene locus_tag LOCUS_03320 351118 350522 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBD3 protein_id gnl|my_center|LOCUS_03320 351744 351409 gene locus_tag LOCUS_03330 351744 351409 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG1 protein_id gnl|my_center|LOCUS_03330 351976 351737 gene locus_tag LOCUS_03340 351976 351737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 352123 354090 gene locus_tag LOCUS_03350 352123 354090 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MII9 protein_id gnl|my_center|LOCUS_03350 354168 355127 gene locus_tag LOCUS_03360 354168 355127 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCV1 protein_id gnl|my_center|LOCUS_03360 355186 356388 gene locus_tag LOCUS_03370 gene pgk 355186 356388 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIJ2 protein_id gnl|my_center|LOCUS_03370 356452 357363 gene locus_tag LOCUS_03380 356452 357363 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 protein_id gnl|my_center|LOCUS_03380 357437 358153 gene locus_tag LOCUS_03390 gene thiE 357437 358153 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 protein_id gnl|my_center|LOCUS_03390 358150 358770 gene locus_tag LOCUS_03400 358150 358770 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391422.1 protein_id gnl|my_center|LOCUS_03400 358895 361552 gene locus_tag LOCUS_03410 gene alaS 358895 361552 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9N4 protein_id gnl|my_center|LOCUS_03410 361557 362891 gene locus_tag LOCUS_03420 gene hflX 361557 362891 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTR0 protein_id gnl|my_center|LOCUS_03420 363454 362900 gene locus_tag LOCUS_03430 363454 362900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 364030 363551 gene locus_tag LOCUS_03440 364030 363551 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886775.1 protein_id gnl|my_center|LOCUS_03440 364806 364027 gene locus_tag LOCUS_03450 364806 364027 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531500.1 protein_id gnl|my_center|LOCUS_03450 366255 364954 gene locus_tag LOCUS_03460 gene kgtP 366255 364954 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973502.1 protein_id gnl|my_center|LOCUS_03460 366875 366252 gene locus_tag LOCUS_03470 366875 366252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 367666 366875 gene locus_tag LOCUS_03480 367666 366875 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 protein_id gnl|my_center|LOCUS_03480 368436 367663 gene locus_tag LOCUS_03490 368436 367663 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_03490 370009 368441 gene locus_tag LOCUS_03500 gene metG 370009 368441 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LM7 protein_id gnl|my_center|LOCUS_03500 371024 370053 gene locus_tag LOCUS_03510 371024 370053 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919689.1 protein_id gnl|my_center|LOCUS_03510 371647 371021 gene locus_tag LOCUS_03520 gene tmk 371647 371021 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP2 protein_id gnl|my_center|LOCUS_03520 372807 371644 gene locus_tag LOCUS_03530 372807 371644 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_03530 373751 372855 gene locus_tag LOCUS_03540 373751 372855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 374919 373873 gene locus_tag LOCUS_03550 374919 373873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 376762 375038 gene locus_tag LOCUS_03560 376762 375038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 375055 375142 gene locus_tag LOCUS_t00080 375055 375142 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 377148 376759 gene locus_tag LOCUS_03570 377148 376759 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968128.1 protein_id gnl|my_center|LOCUS_03570 377482 377168 gene locus_tag LOCUS_03580 377482 377168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 377833 377618 gene locus_tag LOCUS_03590 377833 377618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 protein_id gnl|my_center|LOCUS_03590 378987 377836 gene locus_tag LOCUS_03600 378987 377836 CDS product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 protein_id gnl|my_center|LOCUS_03600 380000 378984 gene locus_tag LOCUS_03610 380000 378984 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368416.1 protein_id gnl|my_center|LOCUS_03610 380686 379997 gene locus_tag LOCUS_03620 380686 379997 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368415.1 protein_id gnl|my_center|LOCUS_03620 382041 380683 gene locus_tag LOCUS_03630 gene trbL1 382041 380683 CDS product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 protein_id gnl|my_center|LOCUS_03630 382332 382045 gene locus_tag LOCUS_03640 382332 382045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368413.1 protein_id gnl|my_center|LOCUS_03640 383123 382353 gene locus_tag LOCUS_03650 383123 382353 CDS product conjugal transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 protein_id gnl|my_center|LOCUS_03650 385576 383120 gene locus_tag LOCUS_03660 385576 383120 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 protein_id gnl|my_center|LOCUS_03660 385869 385588 gene locus_tag LOCUS_03670 385869 385588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 386201 385869 gene locus_tag LOCUS_03680 386201 385869 CDS product conjugal transfer protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388565.1 protein_id gnl|my_center|LOCUS_03680 387142 386198 gene locus_tag LOCUS_03690 gene trbB1 387142 386198 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 protein_id gnl|my_center|LOCUS_03690 387796 387335 gene locus_tag LOCUS_03700 387796 387335 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538234.1 protein_id gnl|my_center|LOCUS_03700 389732 387807 gene locus_tag LOCUS_03710 389732 387807 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368406.1 protein_id gnl|my_center|LOCUS_03710 390330 389947 gene locus_tag LOCUS_03720 390330 389947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence02 862 77 gene locus_tag LOCUS_03730 862 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919037.1 protein_id gnl|my_center|LOCUS_03730 2432 903 gene locus_tag LOCUS_03740 2432 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 2656 5301 gene locus_tag LOCUS_03750 gene mgpS 2656 5301 CDS product ATP-dependent helicase MgpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003581.1 protein_id gnl|my_center|LOCUS_03750 5294 5590 gene locus_tag LOCUS_03760 5294 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03760 5686 6024 gene locus_tag LOCUS_03770 5686 6024 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 protein_id gnl|my_center|LOCUS_03770 6270 6797 gene locus_tag LOCUS_03780 6270 6797 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918539.1 protein_id gnl|my_center|LOCUS_03780 7113 6871 gene locus_tag LOCUS_03790 7113 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 7717 7193 gene locus_tag LOCUS_03800 gene aspG 7717 7193 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_03800 8466 7714 gene locus_tag LOCUS_03810 gene proC 8466 7714 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DI5 protein_id gnl|my_center|LOCUS_03810 9040 8534 gene locus_tag LOCUS_03820 9040 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_03820 9382 9083 gene locus_tag LOCUS_03830 9382 9083 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722325.1 protein_id gnl|my_center|LOCUS_03830 9973 9425 gene locus_tag LOCUS_03840 gene tspO 9973 9425 CDS product sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296956.1 protein_id gnl|my_center|LOCUS_03840 13102 9998 gene locus_tag LOCUS_03850 gene acrF 13102 9998 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038276.1 protein_id gnl|my_center|LOCUS_03850 14155 13112 gene locus_tag LOCUS_03860 14155 13112 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_03860 14982 14245 gene locus_tag LOCUS_03870 14982 14245 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390370.1 protein_id gnl|my_center|LOCUS_03870 17006 14982 gene locus_tag LOCUS_03880 17006 14982 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 protein_id gnl|my_center|LOCUS_03880 17083 18711 gene locus_tag LOCUS_03890 17083 18711 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265813.1 protein_id gnl|my_center|LOCUS_03890 20094 18772 gene locus_tag LOCUS_03900 20094 18772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 20801 20091 gene locus_tag LOCUS_03910 20801 20091 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086487.1 protein_id gnl|my_center|LOCUS_03910 21835 20990 gene locus_tag LOCUS_03920 21835 20990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 23597 22101 gene locus_tag LOCUS_03930 gene ychM 23597 22101 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036716.1 protein_id gnl|my_center|LOCUS_03930 24299 23601 gene locus_tag LOCUS_03940 24299 23601 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I730 protein_id gnl|my_center|LOCUS_03940 25160 24444 gene locus_tag LOCUS_03950 25160 24444 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707648.1 protein_id gnl|my_center|LOCUS_03950 25854 25324 gene locus_tag LOCUS_03960 25854 25324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 26033 27001 gene locus_tag LOCUS_03970 26033 27001 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921017.1 protein_id gnl|my_center|LOCUS_03970 26992 27213 gene locus_tag LOCUS_03980 26992 27213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 27424 30000 gene locus_tag LOCUS_03990 27424 30000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 30463 30990 gene locus_tag LOCUS_04000 30463 30990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 30983 31219 gene locus_tag LOCUS_04010 30983 31219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 31351 32022 gene locus_tag LOCUS_04020 31351 32022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 32019 33239 gene locus_tag LOCUS_04030 32019 33239 CDS product phage capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257523.1 protein_id gnl|my_center|LOCUS_04030 33735 33379 gene locus_tag LOCUS_04040 33735 33379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 34454 34933 gene locus_tag LOCUS_04050 34454 34933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 34930 35346 gene locus_tag LOCUS_04060 34930 35346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 35484 35990 gene locus_tag LOCUS_04070 35484 35990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 36004 36186 gene locus_tag LOCUS_04080 36004 36186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 36183 37286 gene locus_tag LOCUS_04090 36183 37286 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384001.1 protein_id gnl|my_center|LOCUS_04090 37373 37297 gene locus_tag LOCUS_t00090 37373 37297 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37895 37410 gene locus_tag LOCUS_04100 37895 37410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918712.1 protein_id gnl|my_center|LOCUS_04100 38722 37892 gene locus_tag LOCUS_04110 38722 37892 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385446.1 protein_id gnl|my_center|LOCUS_04110 38985 38728 gene locus_tag LOCUS_04120 gene grxC 38985 38728 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164717.1 protein_id gnl|my_center|LOCUS_04120 39786 39037 gene locus_tag LOCUS_04130 39786 39037 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970080.1 protein_id gnl|my_center|LOCUS_04130 39828 40679 gene locus_tag LOCUS_04140 39828 40679 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529447.1 protein_id gnl|my_center|LOCUS_04140 41458 40700 gene locus_tag LOCUS_04150 41458 40700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 42419 41556 gene locus_tag LOCUS_04160 42419 41556 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720501.1 protein_id gnl|my_center|LOCUS_04160 42494 43396 gene locus_tag LOCUS_04170 42494 43396 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_04170 44554 43397 gene locus_tag LOCUS_04180 44554 43397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 protein_id gnl|my_center|LOCUS_04180 44699 45766 gene locus_tag LOCUS_04190 44699 45766 CDS product DesA-family fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639906.1 protein_id gnl|my_center|LOCUS_04190 46868 45768 gene locus_tag LOCUS_04200 gene lptG 46868 45768 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_04200 48083 46872 gene locus_tag LOCUS_04210 48083 46872 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035891.1 protein_id gnl|my_center|LOCUS_04210 48218 48706 gene locus_tag LOCUS_04220 48218 48706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 48716 49684 gene locus_tag LOCUS_04230 48716 49684 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919044.1 protein_id gnl|my_center|LOCUS_04230 49790 50125 gene locus_tag LOCUS_04240 49790 50125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 51088 50315 gene locus_tag LOCUS_04250 51088 50315 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101332.1 protein_id gnl|my_center|LOCUS_04250 51550 51224 gene locus_tag LOCUS_04260 51550 51224 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919875.1 protein_id gnl|my_center|LOCUS_04260 52359 51631 gene locus_tag LOCUS_04270 52359 51631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 53266 52466 gene locus_tag LOCUS_04280 53266 52466 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975631.1 protein_id gnl|my_center|LOCUS_04280 53724 53263 gene locus_tag LOCUS_04290 53724 53263 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975630.1 protein_id gnl|my_center|LOCUS_04290 56414 53724 gene locus_tag LOCUS_04300 gene glnE 56414 53724 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8N3 protein_id gnl|my_center|LOCUS_04300 56517 56708 gene locus_tag LOCUS_04310 56517 56708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 56784 57131 gene locus_tag LOCUS_04320 56784 57131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 58006 57134 gene locus_tag LOCUS_04330 58006 57134 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930427.1 protein_id gnl|my_center|LOCUS_04330 58153 59328 gene locus_tag LOCUS_04340 58153 59328 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529310.1 protein_id gnl|my_center|LOCUS_04340 59325 60116 gene locus_tag LOCUS_04350 gene bdhA 59325 60116 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084304.1 protein_id gnl|my_center|LOCUS_04350 60420 60136 gene locus_tag LOCUS_04360 60420 60136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 60552 60424 gene locus_tag LOCUS_04370 60552 60424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 60833 60585 gene locus_tag LOCUS_04380 60833 60585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 61096 62457 gene locus_tag LOCUS_04390 61096 62457 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_04390 63452 62463 gene locus_tag LOCUS_04400 63452 62463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390849.1 protein_id gnl|my_center|LOCUS_04400 64312 63449 gene locus_tag LOCUS_04410 64312 63449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 64596 64309 gene locus_tag LOCUS_04420 64596 64309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 65254 64814 gene locus_tag LOCUS_04430 65254 64814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 65326 66597 gene locus_tag LOCUS_04440 65326 66597 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391290.1 protein_id gnl|my_center|LOCUS_04440 66733 67803 gene locus_tag LOCUS_04450 66733 67803 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_04450 67812 69206 gene locus_tag LOCUS_04460 67812 69206 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU2 protein_id gnl|my_center|LOCUS_04460 69331 70572 gene locus_tag LOCUS_04470 69331 70572 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_04470 70581 71369 gene locus_tag LOCUS_04480 gene pstB 70581 71369 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9M8 protein_id gnl|my_center|LOCUS_04480 71387 72079 gene locus_tag LOCUS_04490 71387 72079 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT9 protein_id gnl|my_center|LOCUS_04490 72085 72786 gene locus_tag LOCUS_04500 gene phoB 72085 72786 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_04500 73426 72890 gene locus_tag LOCUS_04510 gene def 73426 72890 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF24 protein_id gnl|my_center|LOCUS_04510 74085 73489 gene locus_tag LOCUS_04520 gene recR 74085 73489 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BN4 protein_id gnl|my_center|LOCUS_04520 74139 75047 gene locus_tag LOCUS_04530 gene fmt 74139 75047 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8K0 protein_id gnl|my_center|LOCUS_04530 75100 75843 gene locus_tag LOCUS_04540 gene truA 75100 75843 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ8 protein_id gnl|my_center|LOCUS_04540 76559 75840 gene locus_tag LOCUS_04550 76559 75840 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_04550 76628 76704 gene locus_tag LOCUS_t00100 76628 76704 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 77418 76765 gene locus_tag LOCUS_04560 gene tal 77418 76765 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S7 protein_id gnl|my_center|LOCUS_04560 77551 78213 gene locus_tag LOCUS_04570 77551 78213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 78258 80426 gene locus_tag LOCUS_04580 gene priA 78258 80426 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9S6 protein_id gnl|my_center|LOCUS_04580 82079 80559 gene locus_tag LOCUS_04590 82079 80559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918952.1 protein_id gnl|my_center|LOCUS_04590 83214 82153 gene locus_tag LOCUS_04600 83214 82153 CDS product bifunctional transcriptional activator/DNA repair enzyme protein Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208972.1 protein_id gnl|my_center|LOCUS_04600 83328 84875 gene locus_tag LOCUS_04610 83328 84875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 85040 85612 gene locus_tag LOCUS_04620 gene atpH 85040 85612 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X71 protein_id gnl|my_center|LOCUS_04620 85615 87144 gene locus_tag LOCUS_04630 gene atpA 85615 87144 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X72 protein_id gnl|my_center|LOCUS_04630 87218 88102 gene locus_tag LOCUS_04640 gene atpG 87218 88102 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J432 protein_id gnl|my_center|LOCUS_04640 88127 89572 gene locus_tag LOCUS_04650 gene atpD 88127 89572 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV18 protein_id gnl|my_center|LOCUS_04650 89623 89877 gene locus_tag LOCUS_04660 89623 89877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 90310 89957 gene locus_tag LOCUS_04670 90310 89957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720981.1 protein_id gnl|my_center|LOCUS_04670 90605 92131 gene locus_tag LOCUS_04680 90605 92131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 92827 92102 gene locus_tag LOCUS_04690 92827 92102 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_04690 93810 92800 gene locus_tag LOCUS_04700 93810 92800 CDS product bactoprenol glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920729.1 protein_id gnl|my_center|LOCUS_04700 93927 95492 gene locus_tag LOCUS_04710 93927 95492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 95489 97018 gene locus_tag LOCUS_04720 gene cpaF 95489 97018 CDS product pilus assembly protein CpaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920779.1 protein_id gnl|my_center|LOCUS_04720 97152 97973 gene locus_tag LOCUS_04730 97152 97973 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035527.1 protein_id gnl|my_center|LOCUS_04730 98116 98955 gene locus_tag LOCUS_04740 98116 98955 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811290.1 protein_id gnl|my_center|LOCUS_04740 99358 98927 gene locus_tag LOCUS_04750 gene osmC 99358 98927 CDS product osmotically inducible protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_04750 99445 99822 gene locus_tag LOCUS_04760 99445 99822 CDS product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975383.1 protein_id gnl|my_center|LOCUS_04760 99982 100683 gene locus_tag LOCUS_04770 99982 100683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920046.1 protein_id gnl|my_center|LOCUS_04770 100787 100975 gene locus_tag LOCUS_04780 100787 100975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 101132 103591 gene locus_tag LOCUS_04790 101132 103591 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918074.1 protein_id gnl|my_center|LOCUS_04790 103688 104560 gene locus_tag LOCUS_04800 gene panB 103688 104560 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP30 protein_id gnl|my_center|LOCUS_04800 104586 105335 gene locus_tag LOCUS_04810 104586 105335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 105350 106699 gene locus_tag LOCUS_04820 gene bamB 105350 106699 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z4P5 protein_id gnl|my_center|LOCUS_04820 106829 108193 gene locus_tag LOCUS_04830 gene engA 106829 108193 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y567 protein_id gnl|my_center|LOCUS_04830 108199 108414 gene locus_tag LOCUS_04840 108199 108414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 108505 108945 gene locus_tag LOCUS_04850 108505 108945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 108991 109995 gene locus_tag LOCUS_04860 108991 109995 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528459.1 protein_id gnl|my_center|LOCUS_04860 111080 109992 gene locus_tag LOCUS_04870 111080 109992 CDS product succinoglycan biosynthesis protein exoh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061863.1 protein_id gnl|my_center|LOCUS_04870 111276 112931 gene locus_tag LOCUS_04880 111276 112931 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086599.1 protein_id gnl|my_center|LOCUS_04880 114541 113090 gene locus_tag LOCUS_04890 114541 113090 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530984.1 protein_id gnl|my_center|LOCUS_04890 117415 114698 gene locus_tag LOCUS_04900 gene valS 117415 114698 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE9 protein_id gnl|my_center|LOCUS_04900 118183 117461 gene locus_tag LOCUS_04910 gene nnrU 118183 117461 CDS product NnrU protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707556.1 protein_id gnl|my_center|LOCUS_04910 118743 118228 gene locus_tag LOCUS_04920 gene popZ 118743 118228 CDS product pole-organizing protein PopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919196.1 protein_id gnl|my_center|LOCUS_04920 120223 118781 gene locus_tag LOCUS_04930 120223 118781 CDS product type I secretion protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389551.1 protein_id gnl|my_center|LOCUS_04930 120917 120285 gene locus_tag LOCUS_04940 120917 120285 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 protein_id gnl|my_center|LOCUS_04940 121117 121190 gene locus_tag LOCUS_t00110 121117 121190 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 121258 121932 gene locus_tag LOCUS_04950 121258 121932 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390941.1 protein_id gnl|my_center|LOCUS_04950 121937 122581 gene locus_tag LOCUS_04960 121937 122581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 123072 122650 gene locus_tag LOCUS_04970 gene ndk 123072 122650 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9D7 protein_id gnl|my_center|LOCUS_04970 123599 123162 gene locus_tag LOCUS_04980 123599 123162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 125192 123747 gene locus_tag LOCUS_04990 gene pepA 125192 123747 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX86 protein_id gnl|my_center|LOCUS_04990 125374 127641 gene locus_tag LOCUS_05000 gene lptD 125374 127641 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7N2 protein_id gnl|my_center|LOCUS_05000 127728 129113 gene locus_tag LOCUS_05010 127728 129113 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7N3 protein_id gnl|my_center|LOCUS_05010 129211 130131 gene locus_tag LOCUS_05020 gene pdxA1 129211 130131 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QZ0 protein_id gnl|my_center|LOCUS_05020 130139 130978 gene locus_tag LOCUS_05030 gene rsmA 130139 130978 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6X4 protein_id gnl|my_center|LOCUS_05030 131720 131199 gene locus_tag LOCUS_05040 131720 131199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 132987 131812 gene locus_tag LOCUS_05050 132987 131812 CDS product rRNA cytosine-C5-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_05050 134550 133093 gene locus_tag LOCUS_05060 gene guaB 134550 133093 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N70 protein_id gnl|my_center|LOCUS_05060 136681 134732 gene locus_tag LOCUS_05070 gene ftsH 136681 134732 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE6 protein_id gnl|my_center|LOCUS_05070 136950 136759 gene locus_tag LOCUS_05080 136950 136759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 138025 137045 gene locus_tag LOCUS_05090 138025 137045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 138957 138016 gene locus_tag LOCUS_05100 138957 138016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 139996 139052 gene locus_tag LOCUS_05110 139996 139052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 142357 140081 gene locus_tag LOCUS_05120 gene ptsP 142357 140081 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083049.1 protein_id gnl|my_center|LOCUS_05120 142498 143655 gene locus_tag LOCUS_05130 gene hisC 142498 143655 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038377.1 protein_id gnl|my_center|LOCUS_05130 143792 144958 gene locus_tag LOCUS_05140 143792 144958 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918955.1 protein_id gnl|my_center|LOCUS_05140 146186 145047 gene locus_tag LOCUS_05150 146186 145047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 148901 146301 gene locus_tag LOCUS_05160 gene metH2 148901 146301 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036697.1 protein_id gnl|my_center|LOCUS_05160 150014 148968 gene locus_tag LOCUS_05170 150014 148968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05170 151044 150133 gene locus_tag LOCUS_05180 151044 150133 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU65 protein_id gnl|my_center|LOCUS_05180 152012 151041 gene locus_tag LOCUS_05190 152012 151041 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976246.1 protein_id gnl|my_center|LOCUS_05190 152229 152444 gene locus_tag LOCUS_05200 152229 152444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 152523 152765 gene locus_tag LOCUS_05210 152523 152765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 153248 152838 gene locus_tag LOCUS_05220 153248 152838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 153445 154440 gene locus_tag LOCUS_05230 153445 154440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083009.1 protein_id gnl|my_center|LOCUS_05230 154920 154627 gene locus_tag LOCUS_05240 gene rpmB 154920 154627 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHW1 protein_id gnl|my_center|LOCUS_05240 155064 155285 gene locus_tag LOCUS_05250 155064 155285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 155326 155784 gene locus_tag LOCUS_05260 gene tadA 155326 155784 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J463 protein_id gnl|my_center|LOCUS_05260 157644 155746 gene locus_tag LOCUS_05270 157644 155746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 157687 158103 gene locus_tag LOCUS_05280 157687 158103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 158209 158502 gene locus_tag LOCUS_05290 158209 158502 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946237.1 protein_id gnl|my_center|LOCUS_05290 159385 158582 gene locus_tag LOCUS_05300 159385 158582 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_05300 160488 159382 gene locus_tag LOCUS_05310 160488 159382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 161077 160574 gene locus_tag LOCUS_05320 161077 160574 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205231.1 protein_id gnl|my_center|LOCUS_05320 161168 163273 gene locus_tag LOCUS_05330 161168 163273 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 protein_id gnl|my_center|LOCUS_05330 163657 164172 gene locus_tag LOCUS_05340 gene rplJ 163657 164172 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV1 protein_id gnl|my_center|LOCUS_05340 164245 164619 gene locus_tag LOCUS_05350 gene rplL 164245 164619 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J73 protein_id gnl|my_center|LOCUS_05350 164926 165111 gene locus_tag LOCUS_05360 164926 165111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 165837 166283 gene locus_tag LOCUS_05370 165837 166283 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_05370 166280 167218 gene locus_tag LOCUS_05380 166280 167218 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ3 protein_id gnl|my_center|LOCUS_05380 167241 167645 gene locus_tag LOCUS_05390 167241 167645 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505374.1 protein_id gnl|my_center|LOCUS_05390 167642 167914 gene locus_tag LOCUS_05400 gene ptsH 167642 167914 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311103.1 protein_id gnl|my_center|LOCUS_05400 169167 168031 gene locus_tag LOCUS_05410 169167 168031 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_05410 169238 170035 gene locus_tag LOCUS_05420 169238 170035 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919071.1 protein_id gnl|my_center|LOCUS_05420 170038 171339 gene locus_tag LOCUS_05430 170038 171339 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113829.1 protein_id gnl|my_center|LOCUS_05430 171421 171879 gene locus_tag LOCUS_05440 171421 171879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 172416 171892 gene locus_tag LOCUS_05450 172416 171892 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640141.1 protein_id gnl|my_center|LOCUS_05450 175161 172486 gene locus_tag LOCUS_05460 175161 172486 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918977.1 protein_id gnl|my_center|LOCUS_05460 175862 175494 gene locus_tag LOCUS_05470 gene rplS 175862 175494 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7G7 protein_id gnl|my_center|LOCUS_05470 176606 175869 gene locus_tag LOCUS_05480 gene trmD 176606 175869 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIW8 protein_id gnl|my_center|LOCUS_05480 176875 176603 gene locus_tag LOCUS_05490 176875 176603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 177306 176932 gene locus_tag LOCUS_05500 gene vapC 177306 176932 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AB8 protein_id gnl|my_center|LOCUS_05500 177572 177303 gene locus_tag LOCUS_05510 177572 177303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 178098 177604 gene locus_tag LOCUS_05520 gene rimM 178098 177604 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ03 protein_id gnl|my_center|LOCUS_05520 178553 178104 gene locus_tag LOCUS_05530 178553 178104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 180155 178683 gene locus_tag LOCUS_05540 180155 178683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 181099 180368 gene locus_tag LOCUS_05550 181099 180368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084123.1 protein_id gnl|my_center|LOCUS_05550 181247 182653 gene locus_tag LOCUS_05560 gene yhdG 181247 182653 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 protein_id gnl|my_center|LOCUS_05560 182659 183279 gene locus_tag LOCUS_05570 182659 183279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 183323 184123 gene locus_tag LOCUS_05580 gene dapF 183323 184123 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV61 protein_id gnl|my_center|LOCUS_05580 184123 185373 gene locus_tag LOCUS_05590 184123 185373 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970514.1 protein_id gnl|my_center|LOCUS_05590 185373 186311 gene locus_tag LOCUS_05600 185373 186311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 186416 187042 gene locus_tag LOCUS_05610 186416 187042 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQZ3 protein_id gnl|my_center|LOCUS_05610 187240 187854 gene locus_tag LOCUS_05620 187240 187854 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW3 protein_id gnl|my_center|LOCUS_05620 187989 188423 gene locus_tag LOCUS_05630 187989 188423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 188764 188429 gene locus_tag LOCUS_05640 188764 188429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 189285 188737 gene locus_tag LOCUS_05650 189285 188737 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920846.1 protein_id gnl|my_center|LOCUS_05650 190536 189838 gene locus_tag LOCUS_05660 190536 189838 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920423.1 protein_id gnl|my_center|LOCUS_05660 191513 190635 gene locus_tag LOCUS_05670 191513 190635 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_05670 192595 191513 gene locus_tag LOCUS_05680 gene cheBII 192595 191513 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C477 protein_id gnl|my_center|LOCUS_05680 193034 192669 gene locus_tag LOCUS_05690 193034 192669 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921300.1 protein_id gnl|my_center|LOCUS_05690 193589 193152 gene locus_tag LOCUS_05700 193589 193152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 196032 193594 gene locus_tag LOCUS_05710 196032 193594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 196397 196128 gene locus_tag LOCUS_05720 196397 196128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 196984 196541 gene locus_tag LOCUS_05730 gene mscL 196984 196541 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T62 protein_id gnl|my_center|LOCUS_05730 197085 197687 gene locus_tag LOCUS_05740 197085 197687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402887.1 protein_id gnl|my_center|LOCUS_05740 197692 198498 gene locus_tag LOCUS_05750 197692 198498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05750 198498 199175 gene locus_tag LOCUS_05760 198498 199175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 199172 199702 gene locus_tag LOCUS_05770 199172 199702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05770 200165 199707 gene locus_tag LOCUS_05780 200165 199707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 200264 200827 gene locus_tag LOCUS_05790 200264 200827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 200886 202061 gene locus_tag LOCUS_05800 200886 202061 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_05800 203797 202181 gene locus_tag LOCUS_05810 203797 202181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 203905 204672 gene locus_tag LOCUS_05820 203905 204672 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067036.1 protein_id gnl|my_center|LOCUS_05820 205987 204707 gene locus_tag LOCUS_05830 gene wcbO 205987 204707 CDS product capsular polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063856.1 protein_id gnl|my_center|LOCUS_05830 207506 205980 gene locus_tag LOCUS_05840 207506 205980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 208839 207544 gene locus_tag LOCUS_05850 gene wcbB 208839 207544 CDS product capsular polysaccharide glycosyltransferase biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938575.1 protein_id gnl|my_center|LOCUS_05850 209334 208894 gene locus_tag LOCUS_05860 209334 208894 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920328.1 protein_id gnl|my_center|LOCUS_05860 209977 209342 gene locus_tag LOCUS_05870 209977 209342 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918096.1 protein_id gnl|my_center|LOCUS_05870 210876 209995 gene locus_tag LOCUS_05880 gene lppC 210876 209995 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039204.1 protein_id gnl|my_center|LOCUS_05880 211586 210876 gene locus_tag LOCUS_05890 211586 210876 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 protein_id gnl|my_center|LOCUS_05890 212669 211668 gene locus_tag LOCUS_05900 gene thiG 212669 211668 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL3 protein_id gnl|my_center|LOCUS_05900 212794 213234 gene locus_tag LOCUS_05910 gene aroQ 212794 213234 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A744 protein_id gnl|my_center|LOCUS_05910 213342 213827 gene locus_tag LOCUS_05920 gene accB 213342 213827 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087064.1 protein_id gnl|my_center|LOCUS_05920 213841 215187 gene locus_tag LOCUS_05930 213841 215187 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_05930 215251 215595 gene locus_tag LOCUS_05940 gene arsC 215251 215595 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYL3 protein_id gnl|my_center|LOCUS_05940 215665 216414 gene locus_tag LOCUS_05950 215665 216414 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_05950 218771 216411 gene locus_tag LOCUS_05960 218771 216411 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265609.1 protein_id gnl|my_center|LOCUS_05960 220553 218835 gene locus_tag LOCUS_05970 220553 218835 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640164.1 protein_id gnl|my_center|LOCUS_05970 220745 221269 gene locus_tag LOCUS_05980 220745 221269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 221317 221868 gene locus_tag LOCUS_05990 221317 221868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 221985 222383 gene locus_tag LOCUS_06000 221985 222383 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707673.1 protein_id gnl|my_center|LOCUS_06000 223572 222823 gene locus_tag LOCUS_06010 223572 222823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 223675 224772 gene locus_tag LOCUS_06020 223675 224772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919490.1 protein_id gnl|my_center|LOCUS_06020 224819 226042 gene locus_tag LOCUS_06030 224819 226042 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_06030 226948 226190 gene locus_tag LOCUS_06040 226948 226190 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702850.1 protein_id gnl|my_center|LOCUS_06040 228858 226945 gene locus_tag LOCUS_06050 228858 226945 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385211.1 protein_id gnl|my_center|LOCUS_06050 229874 228981 gene locus_tag LOCUS_06060 gene cysD 229874 228981 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A881 protein_id gnl|my_center|LOCUS_06060 229980 231068 gene locus_tag LOCUS_06070 229980 231068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 232247 231195 gene locus_tag LOCUS_06080 232247 231195 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_06080 232687 232244 gene locus_tag LOCUS_06090 232687 232244 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086784.1 protein_id gnl|my_center|LOCUS_06090 232744 233898 gene locus_tag LOCUS_06100 gene dapE 232744 233898 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABF3 protein_id gnl|my_center|LOCUS_06100 235580 233895 gene locus_tag LOCUS_06110 235580 233895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 236213 235680 gene locus_tag LOCUS_06120 236213 235680 CDS product smr protein/Muts2-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391349.1 protein_id gnl|my_center|LOCUS_06120 237445 236225 gene locus_tag LOCUS_06130 237445 236225 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391354.1 protein_id gnl|my_center|LOCUS_06130 238136 237483 gene locus_tag LOCUS_06140 238136 237483 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_06140 238319 238825 gene locus_tag LOCUS_06150 gene secB 238319 238825 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN7 protein_id gnl|my_center|LOCUS_06150 238966 240552 gene locus_tag LOCUS_06160 238966 240552 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 protein_id gnl|my_center|LOCUS_06160 240560 241564 gene locus_tag LOCUS_06170 gene trpS 240560 241564 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG6 protein_id gnl|my_center|LOCUS_06170 241719 242375 gene locus_tag LOCUS_06180 241719 242375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 242776 244008 gene locus_tag LOCUS_06190 242776 244008 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_06190 244674 244093 gene locus_tag LOCUS_06200 244674 244093 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6F6 protein_id gnl|my_center|LOCUS_06200 246162 244762 gene locus_tag LOCUS_06210 gene dnaA 246162 244762 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY61 protein_id gnl|my_center|LOCUS_06210 246857 246594 gene locus_tag LOCUS_06220 gene rpsT 246857 246594 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY62 protein_id gnl|my_center|LOCUS_06220 247797 246976 gene locus_tag LOCUS_06230 gene mutM 247797 246976 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 protein_id gnl|my_center|LOCUS_06230 247871 248602 gene locus_tag LOCUS_06240 gene ubiE 247871 248602 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WD0 protein_id gnl|my_center|LOCUS_06240 248610 250151 gene locus_tag LOCUS_06250 248610 250151 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ4 protein_id gnl|my_center|LOCUS_06250 250148 250444 gene locus_tag LOCUS_06260 250148 250444 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173685.1 protein_id gnl|my_center|LOCUS_06260 250444 250791 gene locus_tag LOCUS_06270 250444 250791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 250788 252065 gene locus_tag LOCUS_06280 250788 252065 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710170.1 protein_id gnl|my_center|LOCUS_06280 252040 252495 gene locus_tag LOCUS_06290 gene dut 252040 252495 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCW4 protein_id gnl|my_center|LOCUS_06290 252502 252981 gene locus_tag LOCUS_06300 252502 252981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 252978 253745 gene locus_tag LOCUS_06310 252978 253745 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391540.1 protein_id gnl|my_center|LOCUS_06310 253733 254098 gene locus_tag LOCUS_06320 253733 254098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 254201 256189 gene locus_tag LOCUS_06330 gene thrS 254201 256189 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_06330 256319 256852 gene locus_tag LOCUS_06340 gene infC 256319 256852 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_06340 257382 258149 gene locus_tag LOCUS_06350 257382 258149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 258901 258290 gene locus_tag LOCUS_06360 gene msrA 258901 258290 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGQ7 protein_id gnl|my_center|LOCUS_06360 259100 258948 gene locus_tag LOCUS_06370 259100 258948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 260660 259458 gene locus_tag LOCUS_06380 260660 259458 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A830 protein_id gnl|my_center|LOCUS_06380 261411 260788 gene locus_tag LOCUS_06390 261411 260788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06390 262620 261445 gene locus_tag LOCUS_06400 262620 261445 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561701.1 protein_id gnl|my_center|LOCUS_06400 262676 263098 gene locus_tag LOCUS_06410 262676 263098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 263548 263111 gene locus_tag LOCUS_06420 263548 263111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 263785 266082 gene locus_tag LOCUS_06430 263785 266082 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640416.1 protein_id gnl|my_center|LOCUS_06430 266202 267443 gene locus_tag LOCUS_06440 266202 267443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 267559 267915 gene locus_tag LOCUS_06450 267559 267915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 268044 269414 gene locus_tag LOCUS_06460 268044 269414 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NQ6 protein_id gnl|my_center|LOCUS_06460 269795 270190 gene locus_tag LOCUS_06470 269795 270190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 270891 270349 gene locus_tag LOCUS_06480 gene rluE 270891 270349 CDS product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX48 protein_id gnl|my_center|LOCUS_06480 272031 270895 gene locus_tag LOCUS_06490 272031 270895 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246030.1 protein_id gnl|my_center|LOCUS_06490 272818 272120 gene locus_tag LOCUS_06500 272818 272120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 273353 272967 gene locus_tag LOCUS_06510 273353 272967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 273499 274053 gene locus_tag LOCUS_06520 273499 274053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 274252 274965 gene locus_tag LOCUS_06530 274252 274965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 275238 275636 gene locus_tag LOCUS_06540 275238 275636 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038652.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence03 444 79 gene locus_tag LOCUS_06550 444 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 1177 713 gene locus_tag LOCUS_06560 1177 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1337 1262 gene locus_tag LOCUS_t00120 1337 1262 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1528 1453 gene locus_tag LOCUS_t00130 1528 1453 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1953 1618 gene locus_tag LOCUS_06570 1953 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 2136 3446 gene locus_tag LOCUS_06580 gene aroA 2136 3446 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IW89 protein_id gnl|my_center|LOCUS_06580 3443 3694 gene locus_tag LOCUS_06590 3443 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3691 4326 gene locus_tag LOCUS_06600 gene cmk 3691 4326 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WF1 protein_id gnl|my_center|LOCUS_06600 4496 6208 gene locus_tag LOCUS_06610 4496 6208 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9B0 protein_id gnl|my_center|LOCUS_06610 6376 6666 gene locus_tag LOCUS_06620 gene ihfB 6376 6666 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E2 protein_id gnl|my_center|LOCUS_06620 6715 6800 gene locus_tag LOCUS_t00140 6715 6800 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6918 8702 gene locus_tag LOCUS_06630 6918 8702 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_06630 9214 8714 gene locus_tag LOCUS_06640 9214 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 10028 9237 gene locus_tag LOCUS_06650 10028 9237 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640150.1 protein_id gnl|my_center|LOCUS_06650 10423 10025 gene locus_tag LOCUS_06660 gene apaG 10423 10025 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S97 protein_id gnl|my_center|LOCUS_06660 11664 10456 gene locus_tag LOCUS_06670 gene metZ 11664 10456 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFC1 protein_id gnl|my_center|LOCUS_06670 12659 11661 gene locus_tag LOCUS_06680 12659 11661 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 protein_id gnl|my_center|LOCUS_06680 13198 12779 gene locus_tag LOCUS_06690 13198 12779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 14308 13265 gene locus_tag LOCUS_06700 gene leuB 14308 13265 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MHN0 protein_id gnl|my_center|LOCUS_06700 15094 14360 gene locus_tag LOCUS_06710 gene recO 15094 14360 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT96 protein_id gnl|my_center|LOCUS_06710 17177 15117 gene locus_tag LOCUS_06720 gene uvrC 17177 15117 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS75 protein_id gnl|my_center|LOCUS_06720 17982 17368 gene locus_tag LOCUS_06730 17982 17368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 18469 17975 gene locus_tag LOCUS_06740 18469 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 18782 18555 gene locus_tag LOCUS_06750 18782 18555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 19621 18836 gene locus_tag LOCUS_06760 gene atpB 19621 18836 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA4 protein_id gnl|my_center|LOCUS_06760 20002 19679 gene locus_tag LOCUS_06770 20002 19679 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T934 protein_id gnl|my_center|LOCUS_06770 20574 20173 gene locus_tag LOCUS_06780 20574 20173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921381.1 protein_id gnl|my_center|LOCUS_06780 20759 20571 gene locus_tag LOCUS_06790 20759 20571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 23986 20756 gene locus_tag LOCUS_06800 23986 20756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 24122 24541 gene locus_tag LOCUS_06810 24122 24541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 24583 26280 gene locus_tag LOCUS_06820 24583 26280 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003660.1 protein_id gnl|my_center|LOCUS_06820 26680 26285 gene locus_tag LOCUS_06830 26680 26285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 27044 26862 gene locus_tag LOCUS_06840 27044 26862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 27213 27386 gene locus_tag LOCUS_06850 27213 27386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 27500 27877 gene locus_tag LOCUS_06860 27500 27877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 27943 28302 gene locus_tag LOCUS_06870 27943 28302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 28844 28449 gene locus_tag LOCUS_06880 28844 28449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 29458 28931 gene locus_tag LOCUS_06890 29458 28931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 29827 30108 gene locus_tag LOCUS_06900 29827 30108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 30105 30341 gene locus_tag LOCUS_06910 30105 30341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 30338 30568 gene locus_tag LOCUS_06920 30338 30568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 30565 30819 gene locus_tag LOCUS_06930 30565 30819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 31060 31335 gene locus_tag LOCUS_06940 31060 31335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 31620 31369 gene locus_tag LOCUS_06950 31620 31369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 32154 31717 gene locus_tag LOCUS_06960 32154 31717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 32528 32154 gene locus_tag LOCUS_06970 32528 32154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 33503 32739 gene locus_tag LOCUS_06980 33503 32739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 33546 34109 gene locus_tag LOCUS_06990 33546 34109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 34189 34359 gene locus_tag LOCUS_07000 34189 34359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 35337 35630 gene locus_tag LOCUS_07010 35337 35630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 36076 37446 gene locus_tag LOCUS_07020 36076 37446 CDS product DNA-packaging protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976029.1 protein_id gnl|my_center|LOCUS_07020 37474 38859 gene locus_tag LOCUS_07030 37474 38859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 39363 38836 gene locus_tag LOCUS_07040 39363 38836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 39515 40126 gene locus_tag LOCUS_07050 39515 40126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 40300 41307 gene locus_tag LOCUS_07060 40300 41307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 41374 41784 gene locus_tag LOCUS_07070 41374 41784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 41784 42095 gene locus_tag LOCUS_07080 41784 42095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 42085 42426 gene locus_tag LOCUS_07090 42085 42426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 42423 42770 gene locus_tag LOCUS_07100 42423 42770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 42835 43284 gene locus_tag LOCUS_07110 42835 43284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 43340 43699 gene locus_tag LOCUS_07120 43340 43699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 43935 47174 gene locus_tag LOCUS_07130 43935 47174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 47177 47509 gene locus_tag LOCUS_07140 47177 47509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 47509 48018 gene locus_tag LOCUS_07150 47509 48018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 48501 48019 gene locus_tag LOCUS_07160 48501 48019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 48526 49272 gene locus_tag LOCUS_07170 48526 49272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 49272 52160 gene locus_tag LOCUS_07180 49272 52160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 52164 54224 gene locus_tag LOCUS_07190 52164 54224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 54224 54589 gene locus_tag LOCUS_07200 54224 54589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 54586 54747 gene locus_tag LOCUS_07210 54586 54747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 54804 58628 gene locus_tag LOCUS_07220 54804 58628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 58691 59047 gene locus_tag LOCUS_07230 58691 59047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 59469 60659 gene locus_tag LOCUS_07240 59469 60659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 60689 60874 gene locus_tag LOCUS_07250 60689 60874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 62638 61076 gene locus_tag LOCUS_07260 62638 61076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 63256 63083 gene locus_tag LOCUS_07270 63256 63083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 63621 63253 gene locus_tag LOCUS_07280 63621 63253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 63950 63618 gene locus_tag LOCUS_07290 63950 63618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 64650 64318 gene locus_tag LOCUS_07300 64650 64318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 65078 64647 gene locus_tag LOCUS_07310 65078 64647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 65198 65959 gene locus_tag LOCUS_07320 65198 65959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 66246 65956 gene locus_tag LOCUS_07330 66246 65956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 66684 66253 gene locus_tag LOCUS_07340 66684 66253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 67343 67648 gene locus_tag LOCUS_07350 67343 67648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 67849 68298 gene locus_tag LOCUS_07360 67849 68298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035594.1 protein_id gnl|my_center|LOCUS_07360 70190 68769 gene locus_tag LOCUS_07370 70190 68769 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531373.1 protein_id gnl|my_center|LOCUS_07370 70760 70326 gene locus_tag LOCUS_07380 70760 70326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 70838 72277 gene locus_tag LOCUS_07390 70838 72277 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971098.1 protein_id gnl|my_center|LOCUS_07390 72409 73185 gene locus_tag LOCUS_07400 72409 73185 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 protein_id gnl|my_center|LOCUS_07400 73494 73568 gene locus_tag LOCUS_t00150 73494 73568 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 74011 74787 gene locus_tag LOCUS_07410 74011 74787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 74827 76176 gene locus_tag LOCUS_07420 74827 76176 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087245.1 protein_id gnl|my_center|LOCUS_07420 78271 76220 gene locus_tag LOCUS_07430 78271 76220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 80417 78264 gene locus_tag LOCUS_07440 80417 78264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 82206 80425 gene locus_tag LOCUS_07450 82206 80425 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117762.1 protein_id gnl|my_center|LOCUS_07450 82698 82396 gene locus_tag LOCUS_07460 82698 82396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 115010 82695 gene locus_tag LOCUS_07470 115010 82695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 117090 117344 gene locus_tag LOCUS_07480 117090 117344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 117405 118157 gene locus_tag LOCUS_07490 117405 118157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 118185 118364 gene locus_tag LOCUS_07500 118185 118364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 118398 119843 gene locus_tag LOCUS_07510 118398 119843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 121722 120370 gene locus_tag LOCUS_07520 121722 120370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 122275 121742 gene locus_tag LOCUS_07530 122275 121742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 123006 122287 gene locus_tag LOCUS_07540 123006 122287 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088682.1 protein_id gnl|my_center|LOCUS_07540 123206 124234 gene locus_tag LOCUS_07550 123206 124234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 125137 124238 gene locus_tag LOCUS_07560 125137 124238 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 protein_id gnl|my_center|LOCUS_07560 125224 126246 gene locus_tag LOCUS_07570 125224 126246 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528763.1 protein_id gnl|my_center|LOCUS_07570 126246 127643 gene locus_tag LOCUS_07580 gene astD 126246 127643 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C761 protein_id gnl|my_center|LOCUS_07580 128094 127714 gene locus_tag LOCUS_07590 128094 127714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889155.1 protein_id gnl|my_center|LOCUS_07590 128666 128454 gene locus_tag LOCUS_07600 128666 128454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 130069 128666 gene locus_tag LOCUS_07610 130069 128666 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391534.1 protein_id gnl|my_center|LOCUS_07610 131296 130163 gene locus_tag LOCUS_07620 131296 130163 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390873.1 protein_id gnl|my_center|LOCUS_07620 132158 131289 gene locus_tag LOCUS_07630 132158 131289 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 protein_id gnl|my_center|LOCUS_07630 132196 133620 gene locus_tag LOCUS_07640 132196 133620 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN18 protein_id gnl|my_center|LOCUS_07640 133666 135099 gene locus_tag LOCUS_07650 gene astD 133666 135099 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQH8 protein_id gnl|my_center|LOCUS_07650 135181 135984 gene locus_tag LOCUS_07660 135181 135984 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919002.1 protein_id gnl|my_center|LOCUS_07660 135981 136277 gene locus_tag LOCUS_07670 135981 136277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 136281 137912 gene locus_tag LOCUS_07680 136281 137912 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707864.1 protein_id gnl|my_center|LOCUS_07680 138032 138472 gene locus_tag LOCUS_07690 138032 138472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 138465 139250 gene locus_tag LOCUS_07700 gene cysH 138465 139250 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J542 protein_id gnl|my_center|LOCUS_07700 139362 141158 gene locus_tag LOCUS_07710 139362 141158 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919880.1 protein_id gnl|my_center|LOCUS_07710 142777 141290 gene locus_tag LOCUS_07720 142777 141290 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9A7 protein_id gnl|my_center|LOCUS_07720 142947 143429 gene locus_tag LOCUS_07730 142947 143429 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM8 protein_id gnl|my_center|LOCUS_07730 143459 144127 gene locus_tag LOCUS_07740 143459 144127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 144124 144582 gene locus_tag LOCUS_07750 144124 144582 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 protein_id gnl|my_center|LOCUS_07750 144590 145144 gene locus_tag LOCUS_07760 gene dcd 144590 145144 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPK9 protein_id gnl|my_center|LOCUS_07760 145262 145936 gene locus_tag LOCUS_07770 145262 145936 CDS product ser/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 protein_id gnl|my_center|LOCUS_07770 146201 148957 gene locus_tag LOCUS_07780 gene bfeA 146201 148957 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_07780 148960 152103 gene locus_tag LOCUS_07790 148960 152103 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229807.1 protein_id gnl|my_center|LOCUS_07790 152855 152166 gene locus_tag LOCUS_07800 152855 152166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 153340 152852 gene locus_tag LOCUS_07810 gene rpoE6 153340 152852 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967076.1 protein_id gnl|my_center|LOCUS_07810 153429 154712 gene locus_tag LOCUS_07820 153429 154712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 154812 155438 gene locus_tag LOCUS_07830 154812 155438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 156492 155545 gene locus_tag LOCUS_07840 gene aes 156492 155545 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_07840 157385 156630 gene locus_tag LOCUS_07850 gene ctrA 157385 156630 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314973.1 protein_id gnl|my_center|LOCUS_07850 158409 157546 gene locus_tag LOCUS_07860 158409 157546 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919349.1 protein_id gnl|my_center|LOCUS_07860 158545 159264 gene locus_tag LOCUS_07870 158545 159264 CDS product pirin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919348.1 protein_id gnl|my_center|LOCUS_07870 159373 159972 gene locus_tag LOCUS_07880 159373 159972 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H1H5 protein_id gnl|my_center|LOCUS_07880 162051 160096 gene locus_tag LOCUS_07890 162051 160096 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640707.1 protein_id gnl|my_center|LOCUS_07890 162228 163916 gene locus_tag LOCUS_07900 162228 163916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_07900 164448 164014 gene locus_tag LOCUS_07910 164448 164014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 164565 165548 gene locus_tag LOCUS_07920 164565 165548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639908.1 protein_id gnl|my_center|LOCUS_07920 165666 166514 gene locus_tag LOCUS_07930 165666 166514 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141681.1 protein_id gnl|my_center|LOCUS_07930 167360 166518 gene locus_tag LOCUS_07940 167360 166518 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272436.1 protein_id gnl|my_center|LOCUS_07940 167334 167504 gene locus_tag LOCUS_07950 167334 167504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 167560 168237 gene locus_tag LOCUS_07960 167560 168237 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083305.1 protein_id gnl|my_center|LOCUS_07960 168268 168693 gene locus_tag LOCUS_07970 168268 168693 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_07970 169274 168690 gene locus_tag LOCUS_07980 169274 168690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 169756 170241 gene locus_tag LOCUS_07990 169756 170241 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806996.1 protein_id gnl|my_center|LOCUS_07990 170407 171498 gene locus_tag LOCUS_08000 170407 171498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 173856 171550 gene locus_tag LOCUS_08010 173856 171550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 175014 174196 gene locus_tag LOCUS_08020 gene ate 175014 174196 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y485 protein_id gnl|my_center|LOCUS_08020 176376 175129 gene locus_tag LOCUS_08030 176376 175129 CDS product L-threonine dehydratase catabolic TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CE74 protein_id gnl|my_center|LOCUS_08030 176398 177342 gene locus_tag LOCUS_08040 176398 177342 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969533.1 protein_id gnl|my_center|LOCUS_08040 177393 179078 gene locus_tag LOCUS_08050 177393 179078 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_08050 180827 179085 gene locus_tag LOCUS_08060 180827 179085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 181576 180830 gene locus_tag LOCUS_08070 181576 180830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_08070 182706 181573 gene locus_tag LOCUS_08080 182706 181573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 183995 182715 gene locus_tag LOCUS_08090 183995 182715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 184762 184010 gene locus_tag LOCUS_08100 184762 184010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 185952 184825 gene locus_tag LOCUS_08110 185952 184825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 187304 185955 gene locus_tag LOCUS_08120 187304 185955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 189305 187410 gene locus_tag LOCUS_08130 189305 187410 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_08130 190851 189316 gene locus_tag LOCUS_08140 190851 189316 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_08140 192071 190848 gene locus_tag LOCUS_08150 192071 190848 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_08150 193141 192068 gene locus_tag LOCUS_08160 193141 192068 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_08160 194278 193208 gene locus_tag LOCUS_08170 194278 193208 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_08170 195123 194275 gene locus_tag LOCUS_08180 195123 194275 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_08180 196655 195168 gene locus_tag LOCUS_08190 196655 195168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 198278 196677 gene locus_tag LOCUS_08200 198278 196677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 199189 198275 gene locus_tag LOCUS_08210 199189 198275 CDS product chromosome partitioning ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_08210 200724 199204 gene locus_tag LOCUS_08220 200724 199204 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_08220 201374 200727 gene locus_tag LOCUS_08230 201374 200727 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_08230 202731 201508 gene locus_tag LOCUS_08240 202731 201508 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_08240 204257 202737 gene locus_tag LOCUS_08250 204257 202737 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_08250 204320 205336 gene locus_tag LOCUS_08260 204320 205336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 205344 205655 gene locus_tag LOCUS_08270 205344 205655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 206725 205763 gene locus_tag LOCUS_08280 206725 205763 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQA0 protein_id gnl|my_center|LOCUS_08280 207646 206909 gene locus_tag LOCUS_08290 207646 206909 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719573.1 protein_id gnl|my_center|LOCUS_08290 208543 207671 gene locus_tag LOCUS_08300 208543 207671 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976011.1 protein_id gnl|my_center|LOCUS_08300 209518 208565 gene locus_tag LOCUS_08310 209518 208565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719571.1 protein_id gnl|my_center|LOCUS_08310 211052 209643 gene locus_tag LOCUS_08320 211052 209643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003579.1 protein_id gnl|my_center|LOCUS_08320 211192 212028 gene locus_tag LOCUS_08330 211192 212028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLC7 protein_id gnl|my_center|LOCUS_08330 212126 212202 gene locus_tag LOCUS_t00160 212126 212202 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence04 110 658 gene locus_tag LOCUS_08340 110 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 792 1802 gene locus_tag LOCUS_08350 792 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2745 1939 gene locus_tag LOCUS_08360 2745 1939 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388679.1 protein_id gnl|my_center|LOCUS_08360 4116 2950 gene locus_tag LOCUS_08370 4116 2950 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706681.1 protein_id gnl|my_center|LOCUS_08370 5032 4532 gene locus_tag LOCUS_08380 5032 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921571.1 protein_id gnl|my_center|LOCUS_08380 6102 5029 gene locus_tag LOCUS_08390 6102 5029 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN64 protein_id gnl|my_center|LOCUS_08390 6899 6102 gene locus_tag LOCUS_08400 6899 6102 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067261.1 protein_id gnl|my_center|LOCUS_08400 7810 7175 gene locus_tag LOCUS_08410 7810 7175 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6E7 protein_id gnl|my_center|LOCUS_08410 8261 7890 gene locus_tag LOCUS_08420 8261 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 8538 8290 gene locus_tag LOCUS_08430 8538 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 10957 8639 gene locus_tag LOCUS_08440 10957 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 11081 11218 gene locus_tag LOCUS_08450 11081 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 11702 11208 gene locus_tag LOCUS_08460 11702 11208 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035710.1 protein_id gnl|my_center|LOCUS_08460 12557 11703 gene locus_tag LOCUS_08470 12557 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530053.1 protein_id gnl|my_center|LOCUS_08470 13783 12623 gene locus_tag LOCUS_08480 gene ispG 13783 12623 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE4 protein_id gnl|my_center|LOCUS_08480 15199 13904 gene locus_tag LOCUS_08490 15199 13904 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919955.1 protein_id gnl|my_center|LOCUS_08490 16981 15599 gene locus_tag LOCUS_08500 16981 15599 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_08500 17403 16978 gene locus_tag LOCUS_08510 17403 16978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 18209 17403 gene locus_tag LOCUS_08520 18209 17403 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389967.1 protein_id gnl|my_center|LOCUS_08520 18319 19164 gene locus_tag LOCUS_08530 gene panC 18319 19164 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6C8 protein_id gnl|my_center|LOCUS_08530 19762 19322 gene locus_tag LOCUS_08540 19762 19322 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972600.1 protein_id gnl|my_center|LOCUS_08540 20817 19762 gene locus_tag LOCUS_08550 gene hemE 20817 19762 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SK1 protein_id gnl|my_center|LOCUS_08550 21107 21934 gene locus_tag LOCUS_08560 21107 21934 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C520 protein_id gnl|my_center|LOCUS_08560 21931 22524 gene locus_tag LOCUS_08570 21931 22524 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC58 protein_id gnl|my_center|LOCUS_08570 22521 23345 gene locus_tag LOCUS_08580 gene aroE 22521 23345 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DM7 protein_id gnl|my_center|LOCUS_08580 23357 23950 gene locus_tag LOCUS_08590 gene coaE 23357 23950 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C2I0 protein_id gnl|my_center|LOCUS_08590 23983 24684 gene locus_tag LOCUS_08600 23983 24684 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_08600 24760 25365 gene locus_tag LOCUS_08610 24760 25365 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385412.1 protein_id gnl|my_center|LOCUS_08610 25496 25963 gene locus_tag LOCUS_08620 25496 25963 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529589.1 protein_id gnl|my_center|LOCUS_08620 25950 26420 gene locus_tag LOCUS_08630 25950 26420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 26410 26763 gene locus_tag LOCUS_08640 26410 26763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971254.1 protein_id gnl|my_center|LOCUS_08640 26953 27612 gene locus_tag LOCUS_08650 26953 27612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 27757 28218 gene locus_tag LOCUS_08660 27757 28218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083725.1 protein_id gnl|my_center|LOCUS_08660 28861 28232 gene locus_tag LOCUS_08670 28861 28232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 28900 29553 gene locus_tag LOCUS_08680 28900 29553 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_08680 29557 29982 gene locus_tag LOCUS_08690 29557 29982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391102.1 protein_id gnl|my_center|LOCUS_08690 29963 30679 gene locus_tag LOCUS_08700 29963 30679 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338637.1 protein_id gnl|my_center|LOCUS_08700 30684 30983 gene locus_tag LOCUS_08710 30684 30983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 31900 31031 gene locus_tag LOCUS_08720 31900 31031 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3F9 protein_id gnl|my_center|LOCUS_08720 31944 32603 gene locus_tag LOCUS_08730 31944 32603 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083968.1 protein_id gnl|my_center|LOCUS_08730 32789 35587 gene locus_tag LOCUS_08740 32789 35587 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_08740 36311 35565 gene locus_tag LOCUS_08750 36311 35565 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529027.1 protein_id gnl|my_center|LOCUS_08750 36335 36892 gene locus_tag LOCUS_08760 36335 36892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 36963 37316 gene locus_tag LOCUS_08770 36963 37316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 38250 37555 gene locus_tag LOCUS_08780 38250 37555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 38518 38967 gene locus_tag LOCUS_08790 38518 38967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 39070 41598 gene locus_tag LOCUS_08800 gene leuS 39070 41598 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN70 protein_id gnl|my_center|LOCUS_08800 41685 42200 gene locus_tag LOCUS_08810 41685 42200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 42197 43222 gene locus_tag LOCUS_08820 gene holA 42197 43222 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_08820 43419 44351 gene locus_tag LOCUS_08830 43419 44351 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 protein_id gnl|my_center|LOCUS_08830 44348 45022 gene locus_tag LOCUS_08840 44348 45022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 45001 46083 gene locus_tag LOCUS_08850 45001 46083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 46115 46519 gene locus_tag LOCUS_08860 gene msrB 46115 46519 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I016 protein_id gnl|my_center|LOCUS_08860 46681 48765 gene locus_tag LOCUS_08870 46681 48765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 49850 48828 gene locus_tag LOCUS_08880 49850 48828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 50117 51373 gene locus_tag LOCUS_08890 gene rho 50117 51373 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN82 protein_id gnl|my_center|LOCUS_08890 51390 52112 gene locus_tag LOCUS_08900 51390 52112 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975937.1 protein_id gnl|my_center|LOCUS_08900 53345 52377 gene locus_tag LOCUS_08910 gene qor 53345 52377 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921586.1 protein_id gnl|my_center|LOCUS_08910 54130 53345 gene locus_tag LOCUS_08920 54130 53345 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_08920 54193 54441 gene locus_tag LOCUS_08930 54193 54441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 54457 55740 gene locus_tag LOCUS_08940 gene mnmE 54457 55740 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEE9 protein_id gnl|my_center|LOCUS_08940 55802 57652 gene locus_tag LOCUS_08950 gene mnmG 55802 57652 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y689 protein_id gnl|my_center|LOCUS_08950 57649 58293 gene locus_tag LOCUS_08960 gene rsmG 57649 58293 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYH5 protein_id gnl|my_center|LOCUS_08960 58290 59072 gene locus_tag LOCUS_08970 gene parA 58290 59072 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAV7 protein_id gnl|my_center|LOCUS_08970 59069 59992 gene locus_tag LOCUS_08980 59069 59992 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_08980 60110 62707 gene locus_tag LOCUS_08990 gene pepN 60110 62707 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_08990 63236 62721 gene locus_tag LOCUS_09000 63236 62721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 63132 63395 gene locus_tag LOCUS_09010 63132 63395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 63401 63928 gene locus_tag LOCUS_09020 63401 63928 CDS product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 protein_id gnl|my_center|LOCUS_09020 63925 64455 gene locus_tag LOCUS_09030 63925 64455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389354.1 protein_id gnl|my_center|LOCUS_09030 64514 65602 gene locus_tag LOCUS_09040 gene dinB 64514 65602 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKE5 protein_id gnl|my_center|LOCUS_09040 66409 65639 gene locus_tag LOCUS_09050 66409 65639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 66656 66747 gene locus_tag LOCUS_t00170 66656 66747 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 66768 67319 gene locus_tag LOCUS_09060 66768 67319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 68502 67288 gene locus_tag LOCUS_09070 68502 67288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 69479 68499 gene locus_tag LOCUS_09080 69479 68499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 70140 69643 gene locus_tag LOCUS_09090 gene mmyF 70140 69643 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039528.1 protein_id gnl|my_center|LOCUS_09090 72469 70208 gene locus_tag LOCUS_09100 gene tme 72469 70208 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30808 protein_id gnl|my_center|LOCUS_09100 72582 75233 gene locus_tag LOCUS_09110 gene mutS 72582 75233 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI5 protein_id gnl|my_center|LOCUS_09110 75243 78005 gene locus_tag LOCUS_09120 gene glnD 75243 78005 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG2 protein_id gnl|my_center|LOCUS_09120 78613 78002 gene locus_tag LOCUS_09130 78613 78002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 79593 78631 gene locus_tag LOCUS_09140 79593 78631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 80481 79597 gene locus_tag LOCUS_09150 80481 79597 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_09150 81590 80481 gene locus_tag LOCUS_09160 81590 80481 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937915.1 protein_id gnl|my_center|LOCUS_09160 81689 82363 gene locus_tag LOCUS_09170 81689 82363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 84253 82400 gene locus_tag LOCUS_09180 84253 82400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 85260 84319 gene locus_tag LOCUS_09190 85260 84319 CDS product gluconate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920008.1 protein_id gnl|my_center|LOCUS_09190 86581 85262 gene locus_tag LOCUS_09200 86581 85262 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976331.1 protein_id gnl|my_center|LOCUS_09200 86710 89175 gene locus_tag LOCUS_09210 86710 89175 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533673.1 protein_id gnl|my_center|LOCUS_09210 89708 89172 gene locus_tag LOCUS_09220 89708 89172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 92209 89711 gene locus_tag LOCUS_09230 gene gyrB 92209 89711 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKT5 protein_id gnl|my_center|LOCUS_09230 92287 92769 gene locus_tag LOCUS_09240 92287 92769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 93290 92784 gene locus_tag LOCUS_09250 93290 92784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 94489 93305 gene locus_tag LOCUS_09260 94489 93305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 protein_id gnl|my_center|LOCUS_09260 95160 94558 gene locus_tag LOCUS_09270 95160 94558 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367926.1 protein_id gnl|my_center|LOCUS_09270 95215 96714 gene locus_tag LOCUS_09280 95215 96714 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095878.1 protein_id gnl|my_center|LOCUS_09280 97846 96728 gene locus_tag LOCUS_09290 gene pyrD 97846 96728 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKQ4 protein_id gnl|my_center|LOCUS_09290 98122 99066 gene locus_tag LOCUS_09300 98122 99066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 99167 99577 gene locus_tag LOCUS_09310 99167 99577 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_09310 99574 101061 gene locus_tag LOCUS_09320 99574 101061 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_09320 101061 101567 gene locus_tag LOCUS_09330 101061 101567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 101564 102019 gene locus_tag LOCUS_09340 101564 102019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 102020 102781 gene locus_tag LOCUS_09350 gene SufC 102020 102781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720602.1 protein_id gnl|my_center|LOCUS_09350 102871 103662 gene locus_tag LOCUS_09360 102871 103662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 103781 104989 gene locus_tag LOCUS_09370 103781 104989 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKV3 protein_id gnl|my_center|LOCUS_09370 104986 105438 gene locus_tag LOCUS_09380 104986 105438 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946343.1 protein_id gnl|my_center|LOCUS_09380 105438 105797 gene locus_tag LOCUS_09390 105438 105797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390318.1 protein_id gnl|my_center|LOCUS_09390 105921 106727 gene locus_tag LOCUS_09400 105921 106727 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918939.1 protein_id gnl|my_center|LOCUS_09400 106815 106970 gene locus_tag LOCUS_09410 106815 106970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 107334 106975 gene locus_tag LOCUS_09420 107334 106975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 107998 107465 gene locus_tag LOCUS_09430 107998 107465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 108566 108012 gene locus_tag LOCUS_09440 gene coq7 108566 108012 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNK3 protein_id gnl|my_center|LOCUS_09440 109051 108563 gene locus_tag LOCUS_09450 109051 108563 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 protein_id gnl|my_center|LOCUS_09450 110491 109145 gene locus_tag LOCUS_09460 gene ctpA 110491 109145 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709662.1 protein_id gnl|my_center|LOCUS_09460 111848 110613 gene locus_tag LOCUS_09470 111848 110613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 112275 111853 gene locus_tag LOCUS_09480 gene rlmH 112275 111853 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8W4 protein_id gnl|my_center|LOCUS_09480 112782 112393 gene locus_tag LOCUS_09490 112782 112393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 113424 112795 gene locus_tag LOCUS_09500 gene nadD 113424 112795 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV07 protein_id gnl|my_center|LOCUS_09500 114441 113476 gene locus_tag LOCUS_09510 114441 113476 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706378.1 protein_id gnl|my_center|LOCUS_09510 114581 115006 gene locus_tag LOCUS_09520 114581 115006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 115047 115865 gene locus_tag LOCUS_09530 115047 115865 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706375.1 protein_id gnl|my_center|LOCUS_09530 115994 117724 gene locus_tag LOCUS_09540 115994 117724 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706388.1 protein_id gnl|my_center|LOCUS_09540 117738 118520 gene locus_tag LOCUS_09550 117738 118520 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531257.1 protein_id gnl|my_center|LOCUS_09550 120758 118539 gene locus_tag LOCUS_09560 gene gfdS 120758 118539 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337818.1 protein_id gnl|my_center|LOCUS_09560 121912 120755 gene locus_tag LOCUS_09570 121912 120755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083160.1 protein_id gnl|my_center|LOCUS_09570 122368 121964 gene locus_tag LOCUS_09580 122368 121964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701719.1 protein_id gnl|my_center|LOCUS_09580 123991 122471 gene locus_tag LOCUS_09590 gene aldA 123991 122471 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 protein_id gnl|my_center|LOCUS_09590 124522 124067 gene locus_tag LOCUS_09600 124522 124067 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707572.1 protein_id gnl|my_center|LOCUS_09600 125143 124601 gene locus_tag LOCUS_09610 125143 124601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088934.1 protein_id gnl|my_center|LOCUS_09610 125226 126023 gene locus_tag LOCUS_09620 125226 126023 CDS product quinoprotein dehydrogenase-associated SoxYZ-like carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088937.1 protein_id gnl|my_center|LOCUS_09620 126020 126970 gene locus_tag LOCUS_09630 126020 126970 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532067.1 protein_id gnl|my_center|LOCUS_09630 129263 126954 gene locus_tag LOCUS_09640 129263 126954 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088923.1 protein_id gnl|my_center|LOCUS_09640 131551 129344 gene locus_tag LOCUS_09650 gene yagR 131551 129344 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037857.1 protein_id gnl|my_center|LOCUS_09650 132504 131548 gene locus_tag LOCUS_09660 132504 131548 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968216.1 protein_id gnl|my_center|LOCUS_09660 133136 132501 gene locus_tag LOCUS_09670 gene yagT 133136 132501 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037859.1 protein_id gnl|my_center|LOCUS_09670 133501 133575 gene locus_tag LOCUS_t00180 133501 133575 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 134151 134849 gene locus_tag LOCUS_09680 134151 134849 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705043.1 protein_id gnl|my_center|LOCUS_09680 135089 136006 gene locus_tag LOCUS_09690 gene trbB1 135089 136006 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368408.1 protein_id gnl|my_center|LOCUS_09690 136006 136338 gene locus_tag LOCUS_09700 136006 136338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 136338 136607 gene locus_tag LOCUS_09710 136338 136607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 136607 139039 gene locus_tag LOCUS_09720 gene trbE 136607 139039 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090993.1 protein_id gnl|my_center|LOCUS_09720 139036 139737 gene locus_tag LOCUS_09730 139036 139737 CDS product conjugal transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538236.1 protein_id gnl|my_center|LOCUS_09730 139739 140023 gene locus_tag LOCUS_09740 139739 140023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 140016 141296 gene locus_tag LOCUS_09750 gene trbL 140016 141296 CDS product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090990.1 protein_id gnl|my_center|LOCUS_09750 141299 141982 gene locus_tag LOCUS_09760 gene trbF 141299 141982 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090989.1 protein_id gnl|my_center|LOCUS_09760 141979 142980 gene locus_tag LOCUS_09770 gene trbG 141979 142980 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 protein_id gnl|my_center|LOCUS_09770 142977 144191 gene locus_tag LOCUS_09780 142977 144191 CDS product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 protein_id gnl|my_center|LOCUS_09780 144191 144409 gene locus_tag LOCUS_09790 144191 144409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090986.1 protein_id gnl|my_center|LOCUS_09790 145310 144384 gene locus_tag LOCUS_09800 145310 144384 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382879.1 protein_id gnl|my_center|LOCUS_09800 145755 145889 gene locus_tag LOCUS_09810 145755 145889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 145945 146580 gene locus_tag LOCUS_09820 145945 146580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920558.1 protein_id gnl|my_center|LOCUS_09820 146877 148328 gene locus_tag LOCUS_09830 146877 148328 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920557.1 protein_id gnl|my_center|LOCUS_09830 150434 148335 gene locus_tag LOCUS_09840 150434 148335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 152734 150428 gene locus_tag LOCUS_09850 152734 150428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 153683 153111 gene locus_tag LOCUS_09860 153683 153111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 154515 154102 gene locus_tag LOCUS_09870 154515 154102 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114482.1 protein_id gnl|my_center|LOCUS_09870 154411 154701 gene locus_tag LOCUS_09880 154411 154701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 155866 154937 gene locus_tag LOCUS_09890 155866 154937 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975458.1 protein_id gnl|my_center|LOCUS_09890 157895 156138 gene locus_tag LOCUS_09900 157895 156138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530108.1 protein_id gnl|my_center|LOCUS_09900 158934 158707 gene locus_tag LOCUS_09910 158934 158707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 159100 159879 gene locus_tag LOCUS_09920 159100 159879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 160128 161021 gene locus_tag LOCUS_09930 160128 161021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 161014 161655 gene locus_tag LOCUS_09940 161014 161655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 161704 162759 gene locus_tag LOCUS_09950 161704 162759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 162762 164009 gene locus_tag LOCUS_09960 162762 164009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 165035 164031 gene locus_tag LOCUS_09970 165035 164031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 165341 166147 gene locus_tag LOCUS_09980 165341 166147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 167028 166414 gene locus_tag LOCUS_09990 167028 166414 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521445.1 protein_id gnl|my_center|LOCUS_09990 167954 167025 gene locus_tag LOCUS_10000 167954 167025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 168598 167951 gene locus_tag LOCUS_10010 168598 167951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 168784 169059 gene locus_tag LOCUS_10020 168784 169059 CDS product integration host factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920190.1 protein_id gnl|my_center|LOCUS_10020 169531 169100 gene locus_tag LOCUS_10030 169531 169100 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082874.1 protein_id gnl|my_center|LOCUS_10030 <170510 169528 gene locus_tag LOCUS_10040 <170510 169528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368406.1:conjugal transfer protein TraG >Feature sequence05 752 75 gene locus_tag LOCUS_10050 gene flgH 752 75 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YB2 protein_id gnl|my_center|LOCUS_10050 1549 761 gene locus_tag LOCUS_10060 gene flgG 1549 761 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B8 protein_id gnl|my_center|LOCUS_10060 2364 1621 gene locus_tag LOCUS_10070 gene flgF 2364 1621 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC99 protein_id gnl|my_center|LOCUS_10070 3283 2438 gene locus_tag LOCUS_10080 gene flgE 3283 2438 CDS product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I588 protein_id gnl|my_center|LOCUS_10080 4000 3344 gene locus_tag LOCUS_10090 gene flgD 4000 3344 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3M6 protein_id gnl|my_center|LOCUS_10090 4407 3997 gene locus_tag LOCUS_10100 gene flgC 4407 3997 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9B4 protein_id gnl|my_center|LOCUS_10100 4778 4410 gene locus_tag LOCUS_10110 gene flgB 4778 4410 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1S6 protein_id gnl|my_center|LOCUS_10110 5032 5700 gene locus_tag LOCUS_10120 gene motA 5032 5700 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338091.1 protein_id gnl|my_center|LOCUS_10120 5697 6191 gene locus_tag LOCUS_10130 5697 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 6260 6826 gene locus_tag LOCUS_10140 6260 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 6871 7149 gene locus_tag LOCUS_10150 6871 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 7162 7470 gene locus_tag LOCUS_10160 7162 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7809 8558 gene locus_tag LOCUS_10170 gene pleA 7809 8558 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640469.1 protein_id gnl|my_center|LOCUS_10170 8568 10706 gene locus_tag LOCUS_10180 gene flhA 8568 10706 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337939.1 protein_id gnl|my_center|LOCUS_10180 10721 11449 gene locus_tag LOCUS_10190 gene fliA 10721 11449 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720175.1 protein_id gnl|my_center|LOCUS_10190 13394 11559 gene locus_tag LOCUS_10200 gene opgH 13394 11559 CDS product glucans biosynthesis glucosyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P532 protein_id gnl|my_center|LOCUS_10200 14996 13509 gene locus_tag LOCUS_10210 gene mdoG 14996 13509 CDS product glucan biosynthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339113.1 protein_id gnl|my_center|LOCUS_10210 16166 15348 gene locus_tag LOCUS_10220 gene fliC 16166 15348 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CK20 protein_id gnl|my_center|LOCUS_10220 16501 17760 gene locus_tag LOCUS_10230 16501 17760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 17775 18137 gene locus_tag LOCUS_10240 17775 18137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 18141 19886 gene locus_tag LOCUS_10250 gene fliF1 18141 19886 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1V7 protein_id gnl|my_center|LOCUS_10250 19879 20895 gene locus_tag LOCUS_10260 gene fliG 19879 20895 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1V6 protein_id gnl|my_center|LOCUS_10260 20888 21619 gene locus_tag LOCUS_10270 20888 21619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 21616 22944 gene locus_tag LOCUS_10280 gene fliI 21616 22944 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037089.1 protein_id gnl|my_center|LOCUS_10280 22941 23366 gene locus_tag LOCUS_10290 22941 23366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 23368 25443 gene locus_tag LOCUS_10300 23368 25443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 25471 26094 gene locus_tag LOCUS_10310 25471 26094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 26146 27030 gene locus_tag LOCUS_10320 26146 27030 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ75 protein_id gnl|my_center|LOCUS_10320 27027 27362 gene locus_tag LOCUS_10330 27027 27362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 27445 27711 gene locus_tag LOCUS_10340 27445 27711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 27695 28594 gene locus_tag LOCUS_10350 gene fliP 27695 28594 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1U7 protein_id gnl|my_center|LOCUS_10350 28701 28973 gene locus_tag LOCUS_10360 28701 28973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 28970 29752 gene locus_tag LOCUS_10370 gene fliR 28970 29752 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884W2 protein_id gnl|my_center|LOCUS_10370 29756 30892 gene locus_tag LOCUS_10380 gene flhB 29756 30892 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_10380 30900 32045 gene locus_tag LOCUS_10390 30900 32045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 32102 32563 gene locus_tag LOCUS_10400 32102 32563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 32643 34046 gene locus_tag LOCUS_10410 gene fliD 32643 34046 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24216 protein_id gnl|my_center|LOCUS_10410 34064 34459 gene locus_tag LOCUS_10420 34064 34459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 34664 35860 gene locus_tag LOCUS_10430 gene argD1 34664 35860 CDS product acetylornithine aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAL3 protein_id gnl|my_center|LOCUS_10430 35967 36893 gene locus_tag LOCUS_10440 gene argF 35967 36893 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A653 protein_id gnl|my_center|LOCUS_10440 36915 37874 gene locus_tag LOCUS_10450 gene hslO 36915 37874 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58097 protein_id gnl|my_center|LOCUS_10450 38019 38432 gene locus_tag LOCUS_10460 38019 38432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 38488 39180 gene locus_tag LOCUS_10470 gene queC 38488 39180 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FW9 protein_id gnl|my_center|LOCUS_10470 39194 39841 gene locus_tag LOCUS_10480 gene queE 39194 39841 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SC0 protein_id gnl|my_center|LOCUS_10480 40543 39848 gene locus_tag LOCUS_10490 40543 39848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 40896 40618 gene locus_tag LOCUS_10500 40896 40618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 41640 40945 gene locus_tag LOCUS_10510 gene lipB 41640 40945 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSU9 protein_id gnl|my_center|LOCUS_10510 41730 42515 gene locus_tag LOCUS_10520 41730 42515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 43096 42497 gene locus_tag LOCUS_10530 43096 42497 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084228.1 protein_id gnl|my_center|LOCUS_10530 44005 43103 gene locus_tag LOCUS_10540 gene hemF 44005 43103 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAT8 protein_id gnl|my_center|LOCUS_10540 44460 44002 gene locus_tag LOCUS_10550 gene trmL 44460 44002 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDC2 protein_id gnl|my_center|LOCUS_10550 44669 45235 gene locus_tag LOCUS_10560 44669 45235 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH6 protein_id gnl|my_center|LOCUS_10560 45247 46539 gene locus_tag LOCUS_10570 gene fbcB 45247 46539 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PE7 protein_id gnl|my_center|LOCUS_10570 46555 47406 gene locus_tag LOCUS_10580 gene fbcC 46555 47406 CDS product ribosomal protein P2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969491.1 protein_id gnl|my_center|LOCUS_10580 47485 48018 gene locus_tag LOCUS_10590 gene apt 47485 48018 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI44 protein_id gnl|my_center|LOCUS_10590 48656 48036 gene locus_tag LOCUS_10600 48656 48036 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067713.1 protein_id gnl|my_center|LOCUS_10600 48795 48721 gene locus_tag LOCUS_t00190 48795 48721 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 48923 50254 gene locus_tag LOCUS_10610 gene dctA2 48923 50254 CDS product C4-dicarboxylate transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KML7 protein_id gnl|my_center|LOCUS_10610 50641 50264 gene locus_tag LOCUS_10620 gene cpdR 50641 50264 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918630.1 protein_id gnl|my_center|LOCUS_10620 50796 51689 gene locus_tag LOCUS_10630 50796 51689 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066934.1 protein_id gnl|my_center|LOCUS_10630 53540 51693 gene locus_tag LOCUS_10640 53540 51693 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533629.1 protein_id gnl|my_center|LOCUS_10640 54939 53935 gene locus_tag LOCUS_10650 gene fbp 54939 53935 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P237 protein_id gnl|my_center|LOCUS_10650 55158 55940 gene locus_tag LOCUS_10660 55158 55940 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639941.1 protein_id gnl|my_center|LOCUS_10660 56424 56035 gene locus_tag LOCUS_10670 56424 56035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 56755 56519 gene locus_tag LOCUS_10680 56755 56519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 58162 56996 gene locus_tag LOCUS_10690 gene rnd 58162 56996 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_10690 58288 60072 gene locus_tag LOCUS_10700 gene aspS 58288 60072 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7M8 protein_id gnl|my_center|LOCUS_10700 60185 60976 gene locus_tag LOCUS_10710 60185 60976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 61061 62374 gene locus_tag LOCUS_10720 61061 62374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 62449 62634 gene locus_tag LOCUS_10730 62449 62634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 63236 62751 gene locus_tag LOCUS_10740 gene greB 63236 62751 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ24 protein_id gnl|my_center|LOCUS_10740 65357 63318 gene locus_tag LOCUS_10750 65357 63318 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971339.1 protein_id gnl|my_center|LOCUS_10750 65505 66383 gene locus_tag LOCUS_10760 gene dapA 65505 66383 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGL3 protein_id gnl|my_center|LOCUS_10760 66491 66973 gene locus_tag LOCUS_10770 gene smpB 66491 66973 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RH74 protein_id gnl|my_center|LOCUS_10770 66977 67573 gene locus_tag LOCUS_10780 66977 67573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 67621 70050 gene locus_tag LOCUS_10790 67621 70050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 70147 70503 gene locus_tag LOCUS_10800 70147 70503 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967059.1 protein_id gnl|my_center|LOCUS_10800 70612 71676 gene locus_tag LOCUS_10810 gene recA 70612 71676 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH9 protein_id gnl|my_center|LOCUS_10810 71992 72780 gene locus_tag LOCUS_10820 71992 72780 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326778.1 protein_id gnl|my_center|LOCUS_10820 77117 72900 gene locus_tag LOCUS_10830 77117 72900 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972439.1 protein_id gnl|my_center|LOCUS_10830 79201 77117 gene locus_tag LOCUS_10840 79201 77117 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389852.1 protein_id gnl|my_center|LOCUS_10840 79383 81149 gene locus_tag LOCUS_10850 79383 81149 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_10850 81251 81325 gene locus_tag LOCUS_t00200 81251 81325 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 81444 81785 gene locus_tag LOCUS_10860 81444 81785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 82301 81780 gene locus_tag LOCUS_10870 82301 81780 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919934.1 protein_id gnl|my_center|LOCUS_10870 82858 82316 gene locus_tag LOCUS_10880 82858 82316 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709628.1 protein_id gnl|my_center|LOCUS_10880 85554 82855 gene locus_tag LOCUS_10890 85554 82855 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_10890 86018 85650 gene locus_tag LOCUS_10900 86018 85650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 86145 87725 gene locus_tag LOCUS_10910 gene lysS 86145 87725 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C6 protein_id gnl|my_center|LOCUS_10910 88404 87934 gene locus_tag LOCUS_10920 88404 87934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 89322 88636 gene locus_tag LOCUS_10930 89322 88636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 90270 89419 gene locus_tag LOCUS_10940 90270 89419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 90532 91071 gene locus_tag LOCUS_10950 90532 91071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 91064 93628 gene locus_tag LOCUS_10960 91064 93628 CDS product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972107.1 protein_id gnl|my_center|LOCUS_10960 94208 93639 gene locus_tag LOCUS_10970 94208 93639 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975277.1 protein_id gnl|my_center|LOCUS_10970 94687 94205 gene locus_tag LOCUS_10980 94687 94205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_10980 95912 94704 gene locus_tag LOCUS_10990 95912 94704 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN4 protein_id gnl|my_center|LOCUS_10990 96056 97795 gene locus_tag LOCUS_11000 96056 97795 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_11000 97926 98756 gene locus_tag LOCUS_11010 97926 98756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 98925 99275 gene locus_tag LOCUS_11020 gene clpS 98925 99275 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TA15 protein_id gnl|my_center|LOCUS_11020 99393 100892 gene locus_tag LOCUS_11030 gene katA 99393 100892 CDS product catalase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95631 protein_id gnl|my_center|LOCUS_11030 101037 102824 gene locus_tag LOCUS_11040 101037 102824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 102902 103279 gene locus_tag LOCUS_11050 102902 103279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 104326 103337 gene locus_tag LOCUS_11060 gene glpX 104326 103337 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C840 protein_id gnl|my_center|LOCUS_11060 104439 104867 gene locus_tag LOCUS_11070 104439 104867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 106178 104874 gene locus_tag LOCUS_11080 106178 104874 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 protein_id gnl|my_center|LOCUS_11080 107040 106264 gene locus_tag LOCUS_11090 107040 106264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 107390 108049 gene locus_tag LOCUS_11100 107390 108049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 108122 108877 gene locus_tag LOCUS_11110 gene exbB1 108122 108877 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206608.1 protein_id gnl|my_center|LOCUS_11110 108993 109481 gene locus_tag LOCUS_11120 gene exbD1 108993 109481 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_11120 109506 109928 gene locus_tag LOCUS_11130 109506 109928 CDS product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188495.1 protein_id gnl|my_center|LOCUS_11130 110169 110498 gene locus_tag LOCUS_11140 110169 110498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 112301 110514 gene locus_tag LOCUS_11150 gene draA 112301 110514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036668.1 protein_id gnl|my_center|LOCUS_11150 112408 113382 gene locus_tag LOCUS_11160 112408 113382 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969505.1 protein_id gnl|my_center|LOCUS_11160 114540 113392 gene locus_tag LOCUS_11170 114540 113392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143858.1 protein_id gnl|my_center|LOCUS_11170 115541 114558 gene locus_tag LOCUS_11180 gene pslN 115541 114558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113726.1 protein_id gnl|my_center|LOCUS_11180 115647 116201 gene locus_tag LOCUS_11190 115647 116201 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 protein_id gnl|my_center|LOCUS_11190 116871 116191 gene locus_tag LOCUS_11200 116871 116191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 118235 116868 gene locus_tag LOCUS_11210 118235 116868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 118441 119667 gene locus_tag LOCUS_11220 118441 119667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 119727 120590 gene locus_tag LOCUS_11230 119727 120590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 120966 120595 gene locus_tag LOCUS_11240 120966 120595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 121264 121932 gene locus_tag LOCUS_11250 121264 121932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 121974 122891 gene locus_tag LOCUS_11260 121974 122891 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_11260 123248 123063 gene locus_tag LOCUS_11270 123248 123063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399964.1 protein_id gnl|my_center|LOCUS_11270 125293 123245 gene locus_tag LOCUS_11280 gene cstA 125293 123245 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529393.1 protein_id gnl|my_center|LOCUS_11280 125731 125363 gene locus_tag LOCUS_11290 125731 125363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 126072 125764 gene locus_tag LOCUS_11300 gene phnA 126072 125764 CDS product alkylphosphonate uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 protein_id gnl|my_center|LOCUS_11300 126765 126127 gene locus_tag LOCUS_11310 gene engB 126765 126127 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SF6 protein_id gnl|my_center|LOCUS_11310 128614 126911 gene locus_tag LOCUS_11320 gene yidC 128614 126911 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BQ0 protein_id gnl|my_center|LOCUS_11320 128857 128645 gene locus_tag LOCUS_11330 128857 128645 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67303 protein_id gnl|my_center|LOCUS_11330 129249 128854 gene locus_tag LOCUS_11340 129249 128854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 129416 129282 gene locus_tag LOCUS_11350 129416 129282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 130399 129689 gene locus_tag LOCUS_11360 130399 129689 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312616.1 protein_id gnl|my_center|LOCUS_11360 131807 130458 gene locus_tag LOCUS_11370 131807 130458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087068.1 protein_id gnl|my_center|LOCUS_11370 134629 131936 gene locus_tag LOCUS_11380 134629 131936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 135194 136474 gene locus_tag LOCUS_11390 135194 136474 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_11390 136568 139102 gene locus_tag LOCUS_11400 136568 139102 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531366.1 protein_id gnl|my_center|LOCUS_11400 139615 139151 gene locus_tag LOCUS_11410 139615 139151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 140027 141154 gene locus_tag LOCUS_11420 gene prfB 140027 141154 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLD6 protein_id gnl|my_center|LOCUS_11420 141156 141884 gene locus_tag LOCUS_11430 141156 141884 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087755.1 protein_id gnl|my_center|LOCUS_11430 141965 142273 gene locus_tag LOCUS_11440 141965 142273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 143152 142442 gene locus_tag LOCUS_11450 143152 142442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 144404 143184 gene locus_tag LOCUS_11460 144404 143184 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887770.1 protein_id gnl|my_center|LOCUS_11460 144662 144447 gene locus_tag LOCUS_11470 144662 144447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 144621 146438 gene locus_tag LOCUS_11480 144621 146438 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_11480 146532 146699 gene locus_tag LOCUS_11490 146532 146699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 146976 146752 gene locus_tag LOCUS_11500 146976 146752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 146878 147369 gene locus_tag LOCUS_11510 146878 147369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 147435 147782 gene locus_tag LOCUS_11520 147435 147782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 147872 148264 gene locus_tag LOCUS_11530 147872 148264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 148242 148715 gene locus_tag LOCUS_11540 148242 148715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 148866 150191 gene locus_tag LOCUS_11550 148866 150191 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RB9 protein_id gnl|my_center|LOCUS_11550 150259 151305 gene locus_tag LOCUS_11560 150259 151305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270493.1 protein_id gnl|my_center|LOCUS_11560 152160 151312 gene locus_tag LOCUS_11570 152160 151312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 152857 152288 gene locus_tag LOCUS_11580 152857 152288 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 protein_id gnl|my_center|LOCUS_11580 153099 152866 gene locus_tag LOCUS_11590 153099 152866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 154024 153110 gene locus_tag LOCUS_11600 154024 153110 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_11600 154119 154685 gene locus_tag LOCUS_11610 154119 154685 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920061.1 protein_id gnl|my_center|LOCUS_11610 155449 154718 gene locus_tag LOCUS_11620 155449 154718 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339467.1 protein_id gnl|my_center|LOCUS_11620 155634 156917 gene locus_tag LOCUS_11630 gene murA 155634 156917 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J077 protein_id gnl|my_center|LOCUS_11630 156910 158436 gene locus_tag LOCUS_11640 156910 158436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 158818 158384 gene locus_tag LOCUS_11650 158818 158384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 159144 158917 gene locus_tag LOCUS_11660 159144 158917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 159765 159148 gene locus_tag LOCUS_11670 159765 159148 CDS product DNA-3-methyladenine glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970091.1 protein_id gnl|my_center|LOCUS_11670 159843 160160 gene locus_tag LOCUS_11680 159843 160160 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887716.1 protein_id gnl|my_center|LOCUS_11680 160983 160264 gene locus_tag LOCUS_11690 160983 160264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 161758 161018 gene locus_tag LOCUS_11700 161758 161018 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531400.1 protein_id gnl|my_center|LOCUS_11700 161862 161948 gene locus_tag LOCUS_t00210 161862 161948 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 162728 161994 gene locus_tag LOCUS_11710 gene ubiG 162728 161994 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y662 protein_id gnl|my_center|LOCUS_11710 162823 164088 gene locus_tag LOCUS_11720 162823 164088 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE8 protein_id gnl|my_center|LOCUS_11720 >Feature sequence06 964 68 gene locus_tag LOCUS_11730 964 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_11730 1816 971 gene locus_tag LOCUS_11740 1816 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920090.1 protein_id gnl|my_center|LOCUS_11740 1999 2871 gene locus_tag LOCUS_11750 gene glyQ 1999 2871 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 protein_id gnl|my_center|LOCUS_11750 3026 5275 gene locus_tag LOCUS_11760 gene glyS 3026 5275 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8L1 protein_id gnl|my_center|LOCUS_11760 5414 8116 gene locus_tag LOCUS_11770 5414 8116 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919346.1 protein_id gnl|my_center|LOCUS_11770 8660 8175 gene locus_tag LOCUS_11780 8660 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 8803 8879 gene locus_tag LOCUS_t00220 8803 8879 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8936 9012 gene locus_tag LOCUS_t00230 8936 9012 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10668 8968 gene locus_tag LOCUS_11790 gene ccrB 10668 8968 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 protein_id gnl|my_center|LOCUS_11790 11031 10687 gene locus_tag LOCUS_11800 11031 10687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 11497 11006 gene locus_tag LOCUS_11810 11497 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888283.1 protein_id gnl|my_center|LOCUS_11810 11823 11497 gene locus_tag LOCUS_11820 11823 11497 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888282.1 protein_id gnl|my_center|LOCUS_11820 12159 12830 gene locus_tag LOCUS_11830 12159 12830 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CT41 protein_id gnl|my_center|LOCUS_11830 13399 13157 gene locus_tag LOCUS_11840 13399 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 13328 13597 gene locus_tag LOCUS_11850 13328 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082886.1 protein_id gnl|my_center|LOCUS_11850 14004 14516 gene locus_tag LOCUS_11860 14004 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 14684 15055 gene locus_tag LOCUS_11870 14684 15055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 15068 16057 gene locus_tag LOCUS_11880 15068 16057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 protein_id gnl|my_center|LOCUS_11880 16060 16347 gene locus_tag LOCUS_11890 16060 16347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 16581 16847 gene locus_tag LOCUS_11900 16581 16847 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538230.1 protein_id gnl|my_center|LOCUS_11900 16844 17737 gene locus_tag LOCUS_11910 16844 17737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11910 18012 18599 gene locus_tag LOCUS_11920 18012 18599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082880.1 protein_id gnl|my_center|LOCUS_11920 18596 19174 gene locus_tag LOCUS_11930 18596 19174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 19155 19487 gene locus_tag LOCUS_11940 19155 19487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368398.1 protein_id gnl|my_center|LOCUS_11940 19677 20393 gene locus_tag LOCUS_11950 19677 20393 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368399.1 protein_id gnl|my_center|LOCUS_11950 20632 22392 gene locus_tag LOCUS_11960 20632 22392 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388572.1 protein_id gnl|my_center|LOCUS_11960 22408 24390 gene locus_tag LOCUS_11970 22408 24390 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368406.1 protein_id gnl|my_center|LOCUS_11970 24400 24825 gene locus_tag LOCUS_11980 24400 24825 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388569.1 protein_id gnl|my_center|LOCUS_11980 24996 25982 gene locus_tag LOCUS_11990 gene trbB 24996 25982 CDS product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090996.1 protein_id gnl|my_center|LOCUS_11990 25979 26329 gene locus_tag LOCUS_12000 25979 26329 CDS product conjugal transfer protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533269.1 protein_id gnl|my_center|LOCUS_12000 26326 26607 gene locus_tag LOCUS_12010 26326 26607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 26607 29048 gene locus_tag LOCUS_12020 gene trbE 26607 29048 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090993.1 protein_id gnl|my_center|LOCUS_12020 29045 29764 gene locus_tag LOCUS_12030 29045 29764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 29778 30008 gene locus_tag LOCUS_12040 29778 30008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 30008 31315 gene locus_tag LOCUS_12050 gene trbL1 30008 31315 CDS product conjugal transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368414.1 protein_id gnl|my_center|LOCUS_12050 31322 32005 gene locus_tag LOCUS_12060 gene trbF 31322 32005 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090989.1 protein_id gnl|my_center|LOCUS_12060 32032 33006 gene locus_tag LOCUS_12070 gene trbG 32032 33006 CDS product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090988.1 protein_id gnl|my_center|LOCUS_12070 33003 34238 gene locus_tag LOCUS_12080 33003 34238 CDS product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368417.1 protein_id gnl|my_center|LOCUS_12080 34235 34477 gene locus_tag LOCUS_12090 34235 34477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368418.1 protein_id gnl|my_center|LOCUS_12090 35364 34450 gene locus_tag LOCUS_12100 35364 34450 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532551.1 protein_id gnl|my_center|LOCUS_12100 35766 35371 gene locus_tag LOCUS_12110 35766 35371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 37369 35828 gene locus_tag LOCUS_12120 37369 35828 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019055.1 protein_id gnl|my_center|LOCUS_12120 38554 37388 gene locus_tag LOCUS_12130 38554 37388 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889654.1 protein_id gnl|my_center|LOCUS_12130 39953 38568 gene locus_tag LOCUS_12140 39953 38568 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798631.1 protein_id gnl|my_center|LOCUS_12140 40105 40722 gene locus_tag LOCUS_12150 40105 40722 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037814.1 protein_id gnl|my_center|LOCUS_12150 40741 41106 gene locus_tag LOCUS_12160 40741 41106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 41120 41455 gene locus_tag LOCUS_12170 41120 41455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 41892 41431 gene locus_tag LOCUS_12180 41892 41431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 42258 41947 gene locus_tag LOCUS_12190 42258 41947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 42142 42876 gene locus_tag LOCUS_12200 42142 42876 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708515.1 protein_id gnl|my_center|LOCUS_12200 42882 43511 gene locus_tag LOCUS_12210 42882 43511 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974277.1 protein_id gnl|my_center|LOCUS_12210 43611 44201 gene locus_tag LOCUS_12220 43611 44201 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530052.1 protein_id gnl|my_center|LOCUS_12220 45824 44373 gene locus_tag LOCUS_12230 gene cobQ 45824 44373 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZR0 protein_id gnl|my_center|LOCUS_12230 47480 45864 gene locus_tag LOCUS_12240 47480 45864 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971737.1 protein_id gnl|my_center|LOCUS_12240 47914 47477 gene locus_tag LOCUS_12250 47914 47477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 48981 48082 gene locus_tag LOCUS_12260 48981 48082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 49299 49078 gene locus_tag LOCUS_12270 49299 49078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 50589 49330 gene locus_tag LOCUS_12280 gene astB 50589 49330 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C554 protein_id gnl|my_center|LOCUS_12280 51605 50586 gene locus_tag LOCUS_12290 51605 50586 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918468.1 protein_id gnl|my_center|LOCUS_12290 52828 51602 gene locus_tag LOCUS_12300 52828 51602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947432.1 protein_id gnl|my_center|LOCUS_12300 53798 52926 gene locus_tag LOCUS_12310 53798 52926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 54365 53880 gene locus_tag LOCUS_12320 gene rppH 54365 53880 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZC1 protein_id gnl|my_center|LOCUS_12320 54582 55958 gene locus_tag LOCUS_12330 gene phrA 54582 55958 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJC9 protein_id gnl|my_center|LOCUS_12330 55995 57260 gene locus_tag LOCUS_12340 55995 57260 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_12340 57978 57265 gene locus_tag LOCUS_12350 57978 57265 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532529.1 protein_id gnl|my_center|LOCUS_12350 59533 58055 gene locus_tag LOCUS_12360 gene purF 59533 58055 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ7 protein_id gnl|my_center|LOCUS_12360 60878 59682 gene locus_tag LOCUS_12370 60878 59682 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140568.1 protein_id gnl|my_center|LOCUS_12370 61112 61840 gene locus_tag LOCUS_12380 61112 61840 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387799.1 protein_id gnl|my_center|LOCUS_12380 61845 61976 gene locus_tag LOCUS_12390 61845 61976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 61973 62419 gene locus_tag LOCUS_12400 gene ccmE 61973 62419 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGR1 protein_id gnl|my_center|LOCUS_12400 62475 64400 gene locus_tag LOCUS_12410 gene ccmF 62475 64400 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337621.1 protein_id gnl|my_center|LOCUS_12410 64376 64924 gene locus_tag LOCUS_12420 gene ccmG 64376 64924 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336994.1 protein_id gnl|my_center|LOCUS_12420 64921 65328 gene locus_tag LOCUS_12430 64921 65328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 65325 65966 gene locus_tag LOCUS_12440 65325 65966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 66299 65967 gene locus_tag LOCUS_12450 66299 65967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 66213 68027 gene locus_tag LOCUS_12460 gene kup 66213 68027 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I540 protein_id gnl|my_center|LOCUS_12460 68542 68069 gene locus_tag LOCUS_12470 gene hspD 68542 68069 CDS product small heat shock protein HspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69241 protein_id gnl|my_center|LOCUS_12470 69065 70315 gene locus_tag LOCUS_12480 69065 70315 CDS product LolC/E family lipoprotein releasing system, protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_12480 70308 70979 gene locus_tag LOCUS_12490 gene lolD1 70308 70979 CDS product lipoprotein-releasing system ATP-binding protein LolD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU16 protein_id gnl|my_center|LOCUS_12490 71055 74588 gene locus_tag LOCUS_12500 71055 74588 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU13 protein_id gnl|my_center|LOCUS_12500 75659 74592 gene locus_tag LOCUS_12510 75659 74592 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337252.1 protein_id gnl|my_center|LOCUS_12510 76268 75741 gene locus_tag LOCUS_12520 76268 75741 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_12520 78061 76268 gene locus_tag LOCUS_12530 78061 76268 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_12530 78837 78058 gene locus_tag LOCUS_12540 78837 78058 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388019.1 protein_id gnl|my_center|LOCUS_12540 78919 80571 gene locus_tag LOCUS_12550 gene fzeA 78919 80571 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919211.1 protein_id gnl|my_center|LOCUS_12550 80591 82210 gene locus_tag LOCUS_12560 80591 82210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974660.1 protein_id gnl|my_center|LOCUS_12560 82197 83072 gene locus_tag LOCUS_12570 gene ispE 82197 83072 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 protein_id gnl|my_center|LOCUS_12570 83069 83785 gene locus_tag LOCUS_12580 83069 83785 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_12580 83782 84153 gene locus_tag LOCUS_12590 83782 84153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 84150 85535 gene locus_tag LOCUS_12600 84150 85535 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU48 protein_id gnl|my_center|LOCUS_12600 85532 86737 gene locus_tag LOCUS_12610 gene TrmA 85532 86737 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338785.1 protein_id gnl|my_center|LOCUS_12610 87996 86806 gene locus_tag LOCUS_12620 87996 86806 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_12620 89319 88147 gene locus_tag LOCUS_12630 gene nspC 89319 88147 CDS product carboxynorspermidine/carboxyspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A53 protein_id gnl|my_center|LOCUS_12630 90623 89418 gene locus_tag LOCUS_12640 gene lys1 90623 89418 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_12640 90826 91389 gene locus_tag LOCUS_12650 90826 91389 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528503.1 protein_id gnl|my_center|LOCUS_12650 93047 91464 gene locus_tag LOCUS_12660 93047 91464 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527948.1 protein_id gnl|my_center|LOCUS_12660 94137 93142 gene locus_tag LOCUS_12670 94137 93142 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067018.1 protein_id gnl|my_center|LOCUS_12670 94272 95501 gene locus_tag LOCUS_12680 94272 95501 CDS product S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 protein_id gnl|my_center|LOCUS_12680 95501 96145 gene locus_tag LOCUS_12690 95501 96145 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_12690 97403 96177 gene locus_tag LOCUS_12700 97403 96177 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6H4 protein_id gnl|my_center|LOCUS_12700 98350 97547 gene locus_tag LOCUS_12710 gene murI 98350 97547 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z315 protein_id gnl|my_center|LOCUS_12710 98851 98402 gene locus_tag LOCUS_12720 98851 98402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 99006 99605 gene locus_tag LOCUS_12730 gene plsY 99006 99605 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8G9 protein_id gnl|my_center|LOCUS_12730 99602 100684 gene locus_tag LOCUS_12740 gene smf 99602 100684 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087864.1 protein_id gnl|my_center|LOCUS_12740 100893 103466 gene locus_tag LOCUS_12750 gene topA 100893 103466 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J6 protein_id gnl|my_center|LOCUS_12750 104207 103470 gene locus_tag LOCUS_12760 104207 103470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 105174 104260 gene locus_tag LOCUS_12770 gene era 105174 104260 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT94 protein_id gnl|my_center|LOCUS_12770 105983 105300 gene locus_tag LOCUS_12780 gene rnc 105983 105300 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5W1 protein_id gnl|my_center|LOCUS_12780 106819 105980 gene locus_tag LOCUS_12790 gene sipF 106819 105980 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K52 protein_id gnl|my_center|LOCUS_12790 106956 108503 gene locus_tag LOCUS_12800 gene pgi 106956 108503 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V31 protein_id gnl|my_center|LOCUS_12800 108674 110020 gene locus_tag LOCUS_12810 108674 110020 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920161.1 protein_id gnl|my_center|LOCUS_12810 110771 110052 gene locus_tag LOCUS_12820 110771 110052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 protein_id gnl|my_center|LOCUS_12820 112242 110827 gene locus_tag LOCUS_12830 112242 110827 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969867.1 protein_id gnl|my_center|LOCUS_12830 112398 113930 gene locus_tag LOCUS_12840 112398 113930 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_12840 114206 114643 gene locus_tag LOCUS_12850 114206 114643 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919799.1 protein_id gnl|my_center|LOCUS_12850 114831 116984 gene locus_tag LOCUS_12860 gene mcmA 114831 116984 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_12860 117100 118110 gene locus_tag LOCUS_12870 gene bioB 117100 118110 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM71 protein_id gnl|my_center|LOCUS_12870 118305 120305 gene locus_tag LOCUS_12880 gene pccA 118305 120305 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973161.1 protein_id gnl|my_center|LOCUS_12880 120706 121395 gene locus_tag LOCUS_12890 120706 121395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919167.1 protein_id gnl|my_center|LOCUS_12890 121564 123153 gene locus_tag LOCUS_12900 121564 123153 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106293.1 protein_id gnl|my_center|LOCUS_12900 124554 123382 gene locus_tag LOCUS_12910 124554 123382 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841641.1 protein_id gnl|my_center|LOCUS_12910 125692 124604 gene locus_tag LOCUS_12920 125692 124604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 125691 126269 gene locus_tag LOCUS_12930 125691 126269 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529185.1 protein_id gnl|my_center|LOCUS_12930 126276 126620 gene locus_tag LOCUS_12940 126276 126620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 126708 128234 gene locus_tag LOCUS_12950 gene proS 126708 128234 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGJ7 protein_id gnl|my_center|LOCUS_12950 129761 128460 gene locus_tag LOCUS_12960 gene hslU 129761 128460 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y699 protein_id gnl|my_center|LOCUS_12960 130432 129866 gene locus_tag LOCUS_12970 gene hslV 130432 129866 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM9 protein_id gnl|my_center|LOCUS_12970 130606 130794 gene locus_tag LOCUS_12980 130606 130794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 131094 130810 gene locus_tag LOCUS_12990 131094 130810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 131067 131141 gene locus_tag LOCUS_t00240 131067 131141 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 131261 133489 gene locus_tag LOCUS_13000 131261 133489 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920015.1 protein_id gnl|my_center|LOCUS_13000 133643 134668 gene locus_tag LOCUS_13010 gene asd 133643 134668 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY28 protein_id gnl|my_center|LOCUS_13010 134676 135347 gene locus_tag LOCUS_13020 134676 135347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120574.1 protein_id gnl|my_center|LOCUS_13020 135358 136119 gene locus_tag LOCUS_13030 135358 136119 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225205.1 protein_id gnl|my_center|LOCUS_13030 136175 138052 gene locus_tag LOCUS_13040 136175 138052 CDS product angiotensin-converting enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143136.1 protein_id gnl|my_center|LOCUS_13040 138084 139235 gene locus_tag LOCUS_13050 138084 139235 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090075.1 protein_id gnl|my_center|LOCUS_13050 140698 139244 gene locus_tag LOCUS_13060 gene amn 140698 139244 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C461 protein_id gnl|my_center|LOCUS_13060 141254 140772 gene locus_tag LOCUS_13070 141254 140772 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_13070 141354 141935 gene locus_tag LOCUS_13080 141354 141935 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU1 protein_id gnl|my_center|LOCUS_13080 142091 143509 gene locus_tag LOCUS_13090 gene ahcY 142091 143509 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABH0 protein_id gnl|my_center|LOCUS_13090 143776 146121 gene locus_tag LOCUS_13100 143776 146121 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 protein_id gnl|my_center|LOCUS_13100 146114 146572 gene locus_tag LOCUS_13110 146114 146572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13110 146557 147555 gene locus_tag LOCUS_13120 146557 147555 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_13120 147552 148262 gene locus_tag LOCUS_13130 147552 148262 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_13130 148255 151224 gene locus_tag LOCUS_13140 148255 151224 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_13140 151205 154606 gene locus_tag LOCUS_13150 151205 154606 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_13150 154667 154987 gene locus_tag LOCUS_13160 154667 154987 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNR8 protein_id gnl|my_center|LOCUS_13160 155827 155030 gene locus_tag LOCUS_13170 155827 155030 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810133.1 protein_id gnl|my_center|LOCUS_13170 157053 155827 gene locus_tag LOCUS_13180 gene argJ 157053 155827 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE6 protein_id gnl|my_center|LOCUS_13180 158028 160754 gene locus_tag LOCUS_13190 gene secA 158028 160754 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAK0 protein_id gnl|my_center|LOCUS_13190 160879 161244 gene locus_tag LOCUS_13200 160879 161244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence07 <1 1156 gene locus_tag LOCUS_13210 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I4P5:flagellar P-ring protein 1156 1467 gene locus_tag LOCUS_13220 1156 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13220 1464 2801 gene locus_tag LOCUS_13230 gene flgK 1464 2801 CDS product flagellar hook-associated protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39810 protein_id gnl|my_center|LOCUS_13230 2821 3666 gene locus_tag LOCUS_13240 gene flgL 2821 3666 CDS product flagellar hook-filament junction protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097131.1 protein_id gnl|my_center|LOCUS_13240 3795 4658 gene locus_tag LOCUS_13250 gene motA1 3795 4658 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721884.1 protein_id gnl|my_center|LOCUS_13250 4662 5714 gene locus_tag LOCUS_13260 gene motB1 4662 5714 CDS product chemotaxis MotB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003749.1 protein_id gnl|my_center|LOCUS_13260 6594 6076 gene locus_tag LOCUS_13270 6594 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 6937 6713 gene locus_tag LOCUS_13280 6937 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 7146 7904 gene locus_tag LOCUS_13290 7146 7904 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229007.1 protein_id gnl|my_center|LOCUS_13290 8958 8038 gene locus_tag LOCUS_13300 8958 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 8957 9616 gene locus_tag LOCUS_13310 8957 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 11252 9642 gene locus_tag LOCUS_13320 11252 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086389.1 protein_id gnl|my_center|LOCUS_13320 11455 12129 gene locus_tag LOCUS_13330 11455 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 12126 13757 gene locus_tag LOCUS_13340 12126 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 13819 14733 gene locus_tag LOCUS_13350 13819 14733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 14760 16304 gene locus_tag LOCUS_13360 14760 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 16313 18424 gene locus_tag LOCUS_13370 16313 18424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 18412 19179 gene locus_tag LOCUS_13380 18412 19179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 19176 19832 gene locus_tag LOCUS_13390 19176 19832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 20442 19849 gene locus_tag LOCUS_13400 20442 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 21434 20439 gene locus_tag LOCUS_13410 21434 20439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 25065 21481 gene locus_tag LOCUS_13420 25065 21481 CDS product N-methylhydantoinase HyuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265799.1 protein_id gnl|my_center|LOCUS_13420 25170 27029 gene locus_tag LOCUS_13430 25170 27029 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529458.1 protein_id gnl|my_center|LOCUS_13430 27091 28335 gene locus_tag LOCUS_13440 27091 28335 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538189.1 protein_id gnl|my_center|LOCUS_13440 28423 28770 gene locus_tag LOCUS_13450 28423 28770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 28829 29293 gene locus_tag LOCUS_13460 28829 29293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 29301 30698 gene locus_tag LOCUS_13470 29301 30698 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528231.1 protein_id gnl|my_center|LOCUS_13470 30918 31250 gene locus_tag LOCUS_13480 30918 31250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 31821 31423 gene locus_tag LOCUS_13490 31821 31423 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087921.1 protein_id gnl|my_center|LOCUS_13490 33286 31853 gene locus_tag LOCUS_13500 33286 31853 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSV0 protein_id gnl|my_center|LOCUS_13500 33455 33910 gene locus_tag LOCUS_13510 33455 33910 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Y5 protein_id gnl|my_center|LOCUS_13510 34708 34022 gene locus_tag LOCUS_13520 34708 34022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 35379 34708 gene locus_tag LOCUS_13530 35379 34708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 35692 36243 gene locus_tag LOCUS_13540 35692 36243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 39063 36361 gene locus_tag LOCUS_13550 gene ppc 39063 36361 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P944 protein_id gnl|my_center|LOCUS_13550 41032 39128 gene locus_tag LOCUS_13560 41032 39128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 41114 42565 gene locus_tag LOCUS_13570 41114 42565 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969467.1 protein_id gnl|my_center|LOCUS_13570 42577 43044 gene locus_tag LOCUS_13580 42577 43044 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920226.1 protein_id gnl|my_center|LOCUS_13580 43448 43119 gene locus_tag LOCUS_13590 gene ihfA 43448 43119 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J366 protein_id gnl|my_center|LOCUS_13590 44486 43518 gene locus_tag LOCUS_13600 gene fabH 44486 43518 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG62 protein_id gnl|my_center|LOCUS_13600 45538 44483 gene locus_tag LOCUS_13610 gene plsX 45538 44483 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K88 protein_id gnl|my_center|LOCUS_13610 45752 45573 gene locus_tag LOCUS_13620 gene rpmF 45752 45573 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTT0 protein_id gnl|my_center|LOCUS_13620 45961 46392 gene locus_tag LOCUS_13630 45961 46392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 47128 46445 gene locus_tag LOCUS_13640 47128 46445 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_13640 47592 47167 gene locus_tag LOCUS_13650 47592 47167 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920478.1 protein_id gnl|my_center|LOCUS_13650 48672 47629 gene locus_tag LOCUS_13660 48672 47629 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921105.1 protein_id gnl|my_center|LOCUS_13660 49025 48669 gene locus_tag LOCUS_13670 49025 48669 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067705.1 protein_id gnl|my_center|LOCUS_13670 49412 49032 gene locus_tag LOCUS_13680 49412 49032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531294.1 protein_id gnl|my_center|LOCUS_13680 49560 49847 gene locus_tag LOCUS_13690 49560 49847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 50270 49857 gene locus_tag LOCUS_13700 50270 49857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 50482 50943 gene locus_tag LOCUS_13710 50482 50943 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707170.1 protein_id gnl|my_center|LOCUS_13710 51547 50981 gene locus_tag LOCUS_13720 51547 50981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 53089 51728 gene locus_tag LOCUS_13730 53089 51728 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084348.1 protein_id gnl|my_center|LOCUS_13730 54095 53178 gene locus_tag LOCUS_13740 54095 53178 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974286.1 protein_id gnl|my_center|LOCUS_13740 55181 54126 gene locus_tag LOCUS_13750 55181 54126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919988.1 protein_id gnl|my_center|LOCUS_13750 55466 55233 gene locus_tag LOCUS_13760 55466 55233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 57148 55589 gene locus_tag LOCUS_13770 57148 55589 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9H7 protein_id gnl|my_center|LOCUS_13770 57855 57211 gene locus_tag LOCUS_13780 57855 57211 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529231.1 protein_id gnl|my_center|LOCUS_13780 58326 60257 gene locus_tag LOCUS_13790 58326 60257 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC10 protein_id gnl|my_center|LOCUS_13790 60318 60581 gene locus_tag LOCUS_13800 60318 60581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 60594 61643 gene locus_tag LOCUS_13810 60594 61643 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4U9 protein_id gnl|my_center|LOCUS_13810 61640 62866 gene locus_tag LOCUS_13820 61640 62866 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528843.1 protein_id gnl|my_center|LOCUS_13820 63396 62881 gene locus_tag LOCUS_13830 63396 62881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 64037 63480 gene locus_tag LOCUS_13840 64037 63480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 64126 64707 gene locus_tag LOCUS_13850 64126 64707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 64697 65122 gene locus_tag LOCUS_13860 64697 65122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 65163 67346 gene locus_tag LOCUS_13870 65163 67346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 67576 69348 gene locus_tag LOCUS_13880 67576 69348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930067.1 protein_id gnl|my_center|LOCUS_13880 69868 69359 gene locus_tag LOCUS_13890 69868 69359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230911.1 protein_id gnl|my_center|LOCUS_13890 70313 69915 gene locus_tag LOCUS_13900 70313 69915 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_13900 72516 70429 gene locus_tag LOCUS_13910 gene ptrB 72516 70429 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083208.1 protein_id gnl|my_center|LOCUS_13910 72626 74407 gene locus_tag LOCUS_13920 72626 74407 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089329.1 protein_id gnl|my_center|LOCUS_13920 74532 74404 gene locus_tag LOCUS_13930 74532 74404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 74646 74720 gene locus_tag LOCUS_t00250 74646 74720 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 75787 74753 gene locus_tag LOCUS_13940 75787 74753 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919363.1 protein_id gnl|my_center|LOCUS_13940 77865 75853 gene locus_tag LOCUS_13950 77865 75853 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640158.1 protein_id gnl|my_center|LOCUS_13950 79372 77987 gene locus_tag LOCUS_13960 79372 77987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 80603 79503 gene locus_tag LOCUS_13970 80603 79503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 81365 80721 gene locus_tag LOCUS_13980 81365 80721 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176066.1 protein_id gnl|my_center|LOCUS_13980 83779 81494 gene locus_tag LOCUS_13990 83779 81494 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021816.1 protein_id gnl|my_center|LOCUS_13990 84122 84991 gene locus_tag LOCUS_14000 84122 84991 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530654.1 protein_id gnl|my_center|LOCUS_14000 85061 86221 gene locus_tag LOCUS_14010 gene dgcB 85061 86221 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919716.1 protein_id gnl|my_center|LOCUS_14010 86915 86244 gene locus_tag LOCUS_14020 86915 86244 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_14020 87101 89044 gene locus_tag LOCUS_14030 gene acsA 87101 89044 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2I0 protein_id gnl|my_center|LOCUS_14030 89067 89579 gene locus_tag LOCUS_14040 89067 89579 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947309.1 protein_id gnl|my_center|LOCUS_14040 90860 89652 gene locus_tag LOCUS_14050 90860 89652 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_14050 92048 90957 gene locus_tag LOCUS_14060 gene ilvE 92048 90957 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC47 protein_id gnl|my_center|LOCUS_14060 92187 93206 gene locus_tag LOCUS_14070 gene ltaE 92187 93206 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTF1 protein_id gnl|my_center|LOCUS_14070 93199 94098 gene locus_tag LOCUS_14080 93199 94098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527626.1 protein_id gnl|my_center|LOCUS_14080 96534 94117 gene locus_tag LOCUS_14090 gene pheT 96534 94117 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SS9 protein_id gnl|my_center|LOCUS_14090 97622 96531 gene locus_tag LOCUS_14100 gene pheS 97622 96531 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H307 protein_id gnl|my_center|LOCUS_14100 98304 97690 gene locus_tag LOCUS_14110 98304 97690 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387809.1 protein_id gnl|my_center|LOCUS_14110 98881 98519 gene locus_tag LOCUS_14120 gene rplT 98881 98519 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9E3 protein_id gnl|my_center|LOCUS_14120 99098 98895 gene locus_tag LOCUS_14130 gene rpmI 99098 98895 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9E2 protein_id gnl|my_center|LOCUS_14130 100038 99229 gene locus_tag LOCUS_14140 100038 99229 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_14140 100104 100526 gene locus_tag LOCUS_14150 100104 100526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085641.1 protein_id gnl|my_center|LOCUS_14150 100582 100818 gene locus_tag LOCUS_14160 100582 100818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 101759 100824 gene locus_tag LOCUS_14170 gene prs 101759 100824 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N73 protein_id gnl|my_center|LOCUS_14170 101858 103555 gene locus_tag LOCUS_14180 gene nadE 101858 103555 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_14180 103595 104923 gene locus_tag LOCUS_14190 gene gltX 103595 104923 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC35 protein_id gnl|my_center|LOCUS_14190 105704 104961 gene locus_tag LOCUS_14200 105704 104961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 106689 105814 gene locus_tag LOCUS_14210 106689 105814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 107333 106719 gene locus_tag LOCUS_14220 107333 106719 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639872.1 protein_id gnl|my_center|LOCUS_14220 108313 107387 gene locus_tag LOCUS_14230 gene hemC 108313 107387 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAA6 protein_id gnl|my_center|LOCUS_14230 108346 109392 gene locus_tag LOCUS_14240 gene tsaD 108346 109392 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAF2 protein_id gnl|my_center|LOCUS_14240 109404 110375 gene locus_tag LOCUS_14250 gene gpsA 109404 110375 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4E8 protein_id gnl|my_center|LOCUS_14250 110443 111939 gene locus_tag LOCUS_14260 110443 111939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 112953 111940 gene locus_tag LOCUS_14270 112953 111940 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083626.1 protein_id gnl|my_center|LOCUS_14270 113065 113733 gene locus_tag LOCUS_14280 113065 113733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 113730 114104 gene locus_tag LOCUS_14290 113730 114104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 115147 114101 gene locus_tag LOCUS_14300 gene queG 115147 114101 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP6 protein_id gnl|my_center|LOCUS_14300 115170 116135 gene locus_tag LOCUS_14310 115170 116135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921131.1 protein_id gnl|my_center|LOCUS_14310 116132 117322 gene locus_tag LOCUS_14320 116132 117322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 117147 117238 gene locus_tag LOCUS_t00260 117147 117238 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 117326 117817 gene locus_tag LOCUS_14330 117326 117817 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528493.1 protein_id gnl|my_center|LOCUS_14330 119552 117798 gene locus_tag LOCUS_14340 119552 117798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 119934 119539 gene locus_tag LOCUS_14350 119934 119539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 121462 119939 gene locus_tag LOCUS_14360 121462 119939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918985.1 protein_id gnl|my_center|LOCUS_14360 121977 121645 gene locus_tag LOCUS_14370 121977 121645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 123776 122187 gene locus_tag LOCUS_14380 gene purH 123776 122187 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYU8 protein_id gnl|my_center|LOCUS_14380 124886 123855 gene locus_tag LOCUS_14390 124886 123855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 126658 124889 gene locus_tag LOCUS_14400 126658 124889 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083409.1 protein_id gnl|my_center|LOCUS_14400 127317 126655 gene locus_tag LOCUS_14410 127317 126655 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW9 protein_id gnl|my_center|LOCUS_14410 127887 127396 gene locus_tag LOCUS_14420 127887 127396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 129229 127940 gene locus_tag LOCUS_14430 gene rsmB 129229 127940 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917991.1 protein_id gnl|my_center|LOCUS_14430 129368 129541 gene locus_tag LOCUS_14440 129368 129541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 129679 130146 gene locus_tag LOCUS_14450 129679 130146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 130250 131146 gene locus_tag LOCUS_14460 gene ugpG 130250 131146 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3B1 protein_id gnl|my_center|LOCUS_14460 132166 131204 gene locus_tag LOCUS_14470 132166 131204 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968518.1 protein_id gnl|my_center|LOCUS_14470 132748 132200 gene locus_tag LOCUS_14480 132748 132200 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MD07 protein_id gnl|my_center|LOCUS_14480 134636 132777 gene locus_tag LOCUS_14490 134636 132777 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5G5 protein_id gnl|my_center|LOCUS_14490 134887 134633 gene locus_tag LOCUS_14500 134887 134633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 135641 134976 gene locus_tag LOCUS_14510 135641 134976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 136532 135651 gene locus_tag LOCUS_14520 136532 135651 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969981.1 protein_id gnl|my_center|LOCUS_14520 136602 137696 gene locus_tag LOCUS_14530 gene nerA 136602 137696 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036508.1 protein_id gnl|my_center|LOCUS_14530 138229 137807 gene locus_tag LOCUS_14540 gene ribH1 138229 137807 CDS product 6,7-dimethyl-8-ribityllumazine synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QU0 protein_id gnl|my_center|LOCUS_14540 139520 138240 gene locus_tag LOCUS_14550 gene ribBA 139520 138240 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZU9 protein_id gnl|my_center|LOCUS_14550 140207 139593 gene locus_tag LOCUS_14560 140207 139593 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_14560 141241 140288 gene locus_tag LOCUS_14570 141241 140288 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC0 protein_id gnl|my_center|LOCUS_14570 141852 141277 gene locus_tag LOCUS_14580 141852 141277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 142572 141853 gene locus_tag LOCUS_14590 gene tonB-2 142572 141853 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQW4 protein_id gnl|my_center|LOCUS_14590 143954 142689 gene locus_tag LOCUS_14600 143954 142689 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930766.1 protein_id gnl|my_center|LOCUS_14600 147187 144023 gene locus_tag LOCUS_14610 147187 144023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083188.1 protein_id gnl|my_center|LOCUS_14610 148474 147269 gene locus_tag LOCUS_14620 148474 147269 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921032.1 protein_id gnl|my_center|LOCUS_14620 148662 148949 gene locus_tag LOCUS_14630 148662 148949 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037910.1 protein_id gnl|my_center|LOCUS_14630 149281 149024 gene locus_tag LOCUS_14640 149281 149024 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039113.1 protein_id gnl|my_center|LOCUS_14640 149864 149565 gene locus_tag LOCUS_14650 gene sciP 149864 149565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918787.1 protein_id gnl|my_center|LOCUS_14650 150267 149971 gene locus_tag LOCUS_14660 150267 149971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 150375 151496 gene locus_tag LOCUS_14670 gene mnmA 150375 151496 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6U5 protein_id gnl|my_center|LOCUS_14670 151980 152642 gene locus_tag LOCUS_14680 gene hisG 151980 152642 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM6 protein_id gnl|my_center|LOCUS_14680 >Feature sequence08 58 1197 gene locus_tag LOCUS_14690 58 1197 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083498.1 protein_id gnl|my_center|LOCUS_14690 1989 1198 gene locus_tag LOCUS_14700 1989 1198 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_14700 2978 1983 gene locus_tag LOCUS_14710 2978 1983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 protein_id gnl|my_center|LOCUS_14710 3056 3925 gene locus_tag LOCUS_14720 3056 3925 CDS product cobalamin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337465.1 protein_id gnl|my_center|LOCUS_14720 5798 3963 gene locus_tag LOCUS_14730 5798 3963 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_14730 7053 6259 gene locus_tag LOCUS_14740 gene fdhD 7053 6259 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P888 protein_id gnl|my_center|LOCUS_14740 7283 7050 gene locus_tag LOCUS_14750 gene fdsD 7283 7050 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563132.1 protein_id gnl|my_center|LOCUS_14750 10140 7294 gene locus_tag LOCUS_14760 gene fdsA 10140 7294 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709576.1 protein_id gnl|my_center|LOCUS_14760 11786 10137 gene locus_tag LOCUS_14770 gene nuoF 11786 10137 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085921.1 protein_id gnl|my_center|LOCUS_14770 12235 11783 gene locus_tag LOCUS_14780 gene nuoE 12235 11783 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085922.1 protein_id gnl|my_center|LOCUS_14780 13273 12335 gene locus_tag LOCUS_14790 13273 12335 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528010.1 protein_id gnl|my_center|LOCUS_14790 13283 13804 gene locus_tag LOCUS_14800 gene mobA 13283 13804 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UYZ6 protein_id gnl|my_center|LOCUS_14800 15343 13811 gene locus_tag LOCUS_14810 gene emrB 15343 13811 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205993.1 protein_id gnl|my_center|LOCUS_14810 16524 15355 gene locus_tag LOCUS_14820 gene emrA 16524 15355 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121732.1 protein_id gnl|my_center|LOCUS_14820 18046 16517 gene locus_tag LOCUS_14830 18046 16517 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798631.1 protein_id gnl|my_center|LOCUS_14830 18130 18792 gene locus_tag LOCUS_14840 18130 18792 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940085.1 protein_id gnl|my_center|LOCUS_14840 19343 18747 gene locus_tag LOCUS_14850 19343 18747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 20309 19410 gene locus_tag LOCUS_14860 20309 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 21106 20297 gene locus_tag LOCUS_14870 21106 20297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 21258 21118 gene locus_tag LOCUS_14880 21258 21118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 21408 22031 gene locus_tag LOCUS_14890 21408 22031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 22837 22067 gene locus_tag LOCUS_14900 22837 22067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 24102 22837 gene locus_tag LOCUS_14910 gene lysA 24102 22837 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8H9 protein_id gnl|my_center|LOCUS_14910 24378 24121 gene locus_tag LOCUS_14920 24378 24121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 25745 24375 gene locus_tag LOCUS_14930 gene argH 25745 24375 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE3 protein_id gnl|my_center|LOCUS_14930 25879 26385 gene locus_tag LOCUS_14940 25879 26385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 26577 29189 gene locus_tag LOCUS_14950 26577 29189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113356.1 protein_id gnl|my_center|LOCUS_14950 29269 29691 gene locus_tag LOCUS_14960 29269 29691 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_14960 29897 29709 gene locus_tag LOCUS_14970 29897 29709 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW2 protein_id gnl|my_center|LOCUS_14970 30532 29918 gene locus_tag LOCUS_14980 30532 29918 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528774.1 protein_id gnl|my_center|LOCUS_14980 31455 30544 gene locus_tag LOCUS_14990 31455 30544 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709674.1 protein_id gnl|my_center|LOCUS_14990 32516 31674 gene locus_tag LOCUS_15000 32516 31674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 33026 32589 gene locus_tag LOCUS_15010 33026 32589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 33754 33023 gene locus_tag LOCUS_15020 33754 33023 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057754.1 protein_id gnl|my_center|LOCUS_15020 34858 33968 gene locus_tag LOCUS_15030 34858 33968 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390910.1 protein_id gnl|my_center|LOCUS_15030 35023 35664 gene locus_tag LOCUS_15040 35023 35664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 35698 36279 gene locus_tag LOCUS_15050 35698 36279 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 protein_id gnl|my_center|LOCUS_15050 36700 36287 gene locus_tag LOCUS_15060 36700 36287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 38101 36767 gene locus_tag LOCUS_15070 38101 36767 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530058.1 protein_id gnl|my_center|LOCUS_15070 38267 38947 gene locus_tag LOCUS_15080 38267 38947 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531371.1 protein_id gnl|my_center|LOCUS_15080 39632 39012 gene locus_tag LOCUS_15090 39632 39012 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C8 protein_id gnl|my_center|LOCUS_15090 40297 39629 gene locus_tag LOCUS_15100 40297 39629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 41193 40300 gene locus_tag LOCUS_15110 gene folD 41193 40300 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 protein_id gnl|my_center|LOCUS_15110 41507 41190 gene locus_tag LOCUS_15120 41507 41190 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAE3 protein_id gnl|my_center|LOCUS_15120 41794 41504 gene locus_tag LOCUS_15130 41794 41504 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528977.1 protein_id gnl|my_center|LOCUS_15130 42541 41987 gene locus_tag LOCUS_15140 42541 41987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199185.1 protein_id gnl|my_center|LOCUS_15140 43481 42576 gene locus_tag LOCUS_15150 gene argB 43481 42576 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP10 protein_id gnl|my_center|LOCUS_15150 44385 43714 gene locus_tag LOCUS_15160 44385 43714 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_15160 46007 44493 gene locus_tag LOCUS_15170 46007 44493 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_15170 48175 46022 gene locus_tag LOCUS_15180 gene ppk 48175 46022 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSD4 protein_id gnl|my_center|LOCUS_15180 48804 48166 gene locus_tag LOCUS_15190 48804 48166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707509.1 protein_id gnl|my_center|LOCUS_15190 50138 48801 gene locus_tag LOCUS_15200 50138 48801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 50322 51416 gene locus_tag LOCUS_15210 gene purM 50322 51416 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC8 protein_id gnl|my_center|LOCUS_15210 51503 52453 gene locus_tag LOCUS_15220 51503 52453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 52495 53433 gene locus_tag LOCUS_15230 52495 53433 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_15230 53840 53478 gene locus_tag LOCUS_15240 53840 53478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 53897 55501 gene locus_tag LOCUS_15250 gene nadB 53897 55501 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF3 protein_id gnl|my_center|LOCUS_15250 56459 55617 gene locus_tag LOCUS_15260 56459 55617 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639946.1 protein_id gnl|my_center|LOCUS_15260 56681 57766 gene locus_tag LOCUS_15270 56681 57766 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Y19 protein_id gnl|my_center|LOCUS_15270 57852 60659 gene locus_tag LOCUS_15280 57852 60659 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338672.1 protein_id gnl|my_center|LOCUS_15280 60777 61070 gene locus_tag LOCUS_15290 60777 61070 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969264.1 protein_id gnl|my_center|LOCUS_15290 61455 61162 gene locus_tag LOCUS_15300 61455 61162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533011.1 protein_id gnl|my_center|LOCUS_15300 62170 61460 gene locus_tag LOCUS_15310 62170 61460 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723575.1 protein_id gnl|my_center|LOCUS_15310 62454 64001 gene locus_tag LOCUS_15320 gene cysS 62454 64001 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E391 protein_id gnl|my_center|LOCUS_15320 64117 67008 gene locus_tag LOCUS_15330 64117 67008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090864.1 protein_id gnl|my_center|LOCUS_15330 68881 67016 gene locus_tag LOCUS_15340 68881 67016 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_15340 70074 69220 gene locus_tag LOCUS_15350 70074 69220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 71226 70078 gene locus_tag LOCUS_15360 71226 70078 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7G5 protein_id gnl|my_center|LOCUS_15360 71349 72656 gene locus_tag LOCUS_15370 gene fucP 71349 72656 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_15370 73432 72752 gene locus_tag LOCUS_15380 73432 72752 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919296.1 protein_id gnl|my_center|LOCUS_15380 73722 74714 gene locus_tag LOCUS_15390 73722 74714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919295.1 protein_id gnl|my_center|LOCUS_15390 74720 75646 gene locus_tag LOCUS_15400 74720 75646 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971402.1 protein_id gnl|my_center|LOCUS_15400 75666 77228 gene locus_tag LOCUS_15410 75666 77228 CDS product alpha-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036388.1 protein_id gnl|my_center|LOCUS_15410 77292 78323 gene locus_tag LOCUS_15420 77292 78323 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976379.1 protein_id gnl|my_center|LOCUS_15420 78345 79772 gene locus_tag LOCUS_15430 78345 79772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 80026 82848 gene locus_tag LOCUS_15440 80026 82848 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918330.1 protein_id gnl|my_center|LOCUS_15440 84279 82975 gene locus_tag LOCUS_15450 gene fahA 84279 82975 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100400.1 protein_id gnl|my_center|LOCUS_15450 85547 84276 gene locus_tag LOCUS_15460 gene hmgA 85547 84276 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H072 protein_id gnl|my_center|LOCUS_15460 86615 85575 gene locus_tag LOCUS_15470 86615 85575 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920390.1 protein_id gnl|my_center|LOCUS_15470 87499 86612 gene locus_tag LOCUS_15480 87499 86612 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919486.1 protein_id gnl|my_center|LOCUS_15480 87815 87576 gene locus_tag LOCUS_15490 87815 87576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 87747 88070 gene locus_tag LOCUS_15500 87747 88070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 88205 88993 gene locus_tag LOCUS_15510 88205 88993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083547.1 protein_id gnl|my_center|LOCUS_15510 89039 90565 gene locus_tag LOCUS_15520 89039 90565 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI0 protein_id gnl|my_center|LOCUS_15520 90854 90567 gene locus_tag LOCUS_15530 90854 90567 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390813.1 protein_id gnl|my_center|LOCUS_15530 91192 90851 gene locus_tag LOCUS_15540 91192 90851 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513548.1 protein_id gnl|my_center|LOCUS_15540 91498 92349 gene locus_tag LOCUS_15550 91498 92349 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090323.1 protein_id gnl|my_center|LOCUS_15550 92582 93586 gene locus_tag LOCUS_15560 92582 93586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 93642 93717 gene locus_tag LOCUS_t00270 93642 93717 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 94035 94262 gene locus_tag LOCUS_15570 94035 94262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 94306 95748 gene locus_tag LOCUS_15580 94306 95748 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388325.1 protein_id gnl|my_center|LOCUS_15580 95804 96379 gene locus_tag LOCUS_15590 95804 96379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720128.1 protein_id gnl|my_center|LOCUS_15590 96538 96876 gene locus_tag LOCUS_15600 96538 96876 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388885.1 protein_id gnl|my_center|LOCUS_15600 96890 98236 gene locus_tag LOCUS_15610 gene amtB 96890 98236 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZG5 protein_id gnl|my_center|LOCUS_15610 99232 98360 gene locus_tag LOCUS_15620 99232 98360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 99885 99313 gene locus_tag LOCUS_15630 99885 99313 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_15630 101440 99950 gene locus_tag LOCUS_15640 gene crtI 101440 99950 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_15640 102588 101440 gene locus_tag LOCUS_15650 102588 101440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 102830 103102 gene locus_tag LOCUS_15660 102830 103102 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267062.1 protein_id gnl|my_center|LOCUS_15660 103105 104097 gene locus_tag LOCUS_15670 103105 104097 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806898.1 protein_id gnl|my_center|LOCUS_15670 104154 104825 gene locus_tag LOCUS_15680 104154 104825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003546.1 protein_id gnl|my_center|LOCUS_15680 104861 105565 gene locus_tag LOCUS_15690 104861 105565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 105994 105566 gene locus_tag LOCUS_15700 105994 105566 CDS product TIGR01244 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918808.1 protein_id gnl|my_center|LOCUS_15700 107827 106055 gene locus_tag LOCUS_15710 gene recQ 107827 106055 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 protein_id gnl|my_center|LOCUS_15710 107814 108269 gene locus_tag LOCUS_15720 107814 108269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 108845 108525 gene locus_tag LOCUS_15730 108845 108525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 108884 110008 gene locus_tag LOCUS_15740 108884 110008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 110793 110005 gene locus_tag LOCUS_15750 110793 110005 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096623.1 protein_id gnl|my_center|LOCUS_15750 112655 110874 gene locus_tag LOCUS_15760 gene sac1 112655 110874 CDS product dATP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339215.1 protein_id gnl|my_center|LOCUS_15760 112874 113395 gene locus_tag LOCUS_15770 112874 113395 CDS product pilus biosynthesis protein TadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086719.1 protein_id gnl|my_center|LOCUS_15770 113397 113945 gene locus_tag LOCUS_15780 113397 113945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086720.1 protein_id gnl|my_center|LOCUS_15780 113947 115290 gene locus_tag LOCUS_15790 113947 115290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086718.1 protein_id gnl|my_center|LOCUS_15790 116587 115502 gene locus_tag LOCUS_15800 gene aroC 116587 115502 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H3W7 protein_id gnl|my_center|LOCUS_15800 116937 116584 gene locus_tag LOCUS_15810 116937 116584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975642.1 protein_id gnl|my_center|LOCUS_15810 117169 116930 gene locus_tag LOCUS_15820 117169 116930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 117979 117173 gene locus_tag LOCUS_15830 gene fabI-2 117979 117173 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3U2 protein_id gnl|my_center|LOCUS_15830 118932 117997 gene locus_tag LOCUS_15840 118932 117997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388189.1 protein_id gnl|my_center|LOCUS_15840 119856 118948 gene locus_tag LOCUS_15850 119856 118948 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390376.1 protein_id gnl|my_center|LOCUS_15850 120034 121377 gene locus_tag LOCUS_15860 120034 121377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 121478 122053 gene locus_tag LOCUS_15870 gene pdxH 121478 122053 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR21 protein_id gnl|my_center|LOCUS_15870 122233 123564 gene locus_tag LOCUS_15880 122233 123564 CDS product membrane attached sodium:dicarboxylate symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526889.1 protein_id gnl|my_center|LOCUS_15880 124534 123650 gene locus_tag LOCUS_15890 124534 123650 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_15890 124680 125990 gene locus_tag LOCUS_15900 gene gltP 124680 125990 CDS product proton glutamate symport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038324.1 protein_id gnl|my_center|LOCUS_15900 125987 126583 gene locus_tag LOCUS_15910 125987 126583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229800.1 protein_id gnl|my_center|LOCUS_15910 126759 126580 gene locus_tag LOCUS_15920 126759 126580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 128097 126808 gene locus_tag LOCUS_15930 gene purA 128097 126808 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9F8 protein_id gnl|my_center|LOCUS_15930 128334 129200 gene locus_tag LOCUS_15940 128334 129200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529363.1 protein_id gnl|my_center|LOCUS_15940 130327 129197 gene locus_tag LOCUS_15950 gene hisZ 130327 129197 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD9 protein_id gnl|my_center|LOCUS_15950 132040 130460 gene locus_tag LOCUS_15960 gene serA 132040 130460 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 protein_id gnl|my_center|LOCUS_15960 133328 132168 gene locus_tag LOCUS_15970 gene serC 133328 132168 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382854.1 protein_id gnl|my_center|LOCUS_15970 133520 134185 gene locus_tag LOCUS_15980 133520 134185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 134227 135102 gene locus_tag LOCUS_15990 134227 135102 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYR8 protein_id gnl|my_center|LOCUS_15990 135277 135948 gene locus_tag LOCUS_16000 135277 135948 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918171.1 protein_id gnl|my_center|LOCUS_16000 135945 136781 gene locus_tag LOCUS_16010 gene dapD 135945 136781 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 protein_id gnl|my_center|LOCUS_16010 137802 136789 gene locus_tag LOCUS_16020 137802 136789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919081.1 protein_id gnl|my_center|LOCUS_16020 138734 137799 gene locus_tag LOCUS_16030 138734 137799 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919082.1 protein_id gnl|my_center|LOCUS_16030 139399 138731 gene locus_tag LOCUS_16040 139399 138731 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919083.1 protein_id gnl|my_center|LOCUS_16040 139997 139410 gene locus_tag LOCUS_16050 139997 139410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 140119 140736 gene locus_tag LOCUS_16060 gene folE 140119 140736 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B0 protein_id gnl|my_center|LOCUS_16060 140794 141732 gene locus_tag LOCUS_16070 140794 141732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 142330 141737 gene locus_tag LOCUS_16080 142330 141737 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267101.1 protein_id gnl|my_center|LOCUS_16080 142567 142397 gene locus_tag LOCUS_16090 142567 142397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 143041 142781 gene locus_tag LOCUS_16100 143041 142781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 143884 143231 gene locus_tag LOCUS_16110 143884 143231 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261975.1 protein_id gnl|my_center|LOCUS_16110 144230 >144586 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcgatccacgcctccgcgtgggaggcgac >Feature sequence09 826 350 gene locus_tag LOCUS_16120 826 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531016.1 protein_id gnl|my_center|LOCUS_16120 937 1524 gene locus_tag LOCUS_16130 gene hisB 937 1524 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33564 protein_id gnl|my_center|LOCUS_16130 1521 2138 gene locus_tag LOCUS_16140 gene hisH 1521 2138 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA5 protein_id gnl|my_center|LOCUS_16140 2244 2981 gene locus_tag LOCUS_16150 gene hisA 2244 2981 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WM5 protein_id gnl|my_center|LOCUS_16150 2986 3750 gene locus_tag LOCUS_16160 gene hisF 2986 3750 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50937 protein_id gnl|my_center|LOCUS_16160 3918 4181 gene locus_tag LOCUS_16170 3918 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 4226 4546 gene locus_tag LOCUS_16180 gene hisE 4226 4546 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y414 protein_id gnl|my_center|LOCUS_16180 4618 5184 gene locus_tag LOCUS_16190 4618 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 6117 5218 gene locus_tag LOCUS_16200 6117 5218 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533619.1 protein_id gnl|my_center|LOCUS_16200 6174 7652 gene locus_tag LOCUS_16210 6174 7652 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919385.1 protein_id gnl|my_center|LOCUS_16210 7659 7967 gene locus_tag LOCUS_16220 7659 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 8020 8694 gene locus_tag LOCUS_16230 8020 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 9569 8796 gene locus_tag LOCUS_16240 9569 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 10366 9671 gene locus_tag LOCUS_16250 10366 9671 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385290.1 protein_id gnl|my_center|LOCUS_16250 10617 10363 gene locus_tag LOCUS_16260 10617 10363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 11273 10614 gene locus_tag LOCUS_16270 11273 10614 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_16270 12652 11285 gene locus_tag LOCUS_16280 12652 11285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 13035 12649 gene locus_tag LOCUS_16290 gene crcB 13035 12649 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A6V2 protein_id gnl|my_center|LOCUS_16290 13844 13101 gene locus_tag LOCUS_16300 13844 13101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 14004 14225 gene locus_tag LOCUS_16310 14004 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 14369 14983 gene locus_tag LOCUS_16320 14369 14983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16320 14999 15124 gene locus_tag LOCUS_16330 14999 15124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 16702 15371 gene locus_tag LOCUS_16340 gene pyrC 16702 15371 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ62 protein_id gnl|my_center|LOCUS_16340 16751 17491 gene locus_tag LOCUS_16350 16751 17491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 17488 18234 gene locus_tag LOCUS_16360 17488 18234 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_16360 19222 18353 gene locus_tag LOCUS_16370 19222 18353 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640170.1 protein_id gnl|my_center|LOCUS_16370 20734 19334 gene locus_tag LOCUS_16380 20734 19334 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_16380 21414 20779 gene locus_tag LOCUS_16390 21414 20779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 21857 21411 gene locus_tag LOCUS_16400 21857 21411 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532773.1 protein_id gnl|my_center|LOCUS_16400 22727 21897 gene locus_tag LOCUS_16410 22727 21897 CDS product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 protein_id gnl|my_center|LOCUS_16410 23347 22772 gene locus_tag LOCUS_16420 gene ctaG 23347 22772 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ5 protein_id gnl|my_center|LOCUS_16420 23484 23347 gene locus_tag LOCUS_16430 23484 23347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 24377 23481 gene locus_tag LOCUS_16440 gene ctaB 24377 23481 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RM98 protein_id gnl|my_center|LOCUS_16440 26174 24480 gene locus_tag LOCUS_16450 gene coxA 26174 24480 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDH9 protein_id gnl|my_center|LOCUS_16450 27209 26193 gene locus_tag LOCUS_16460 27209 26193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 27484 28074 gene locus_tag LOCUS_16470 gene pyrE 27484 28074 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A810 protein_id gnl|my_center|LOCUS_16470 28078 28815 gene locus_tag LOCUS_16480 gene pdxJ 28078 28815 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT91 protein_id gnl|my_center|LOCUS_16480 28812 29213 gene locus_tag LOCUS_16490 gene acpS 28812 29213 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H624 protein_id gnl|my_center|LOCUS_16490 29210 30121 gene locus_tag LOCUS_16500 gene sipF 29210 30121 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K52 protein_id gnl|my_center|LOCUS_16500 30146 31228 gene locus_tag LOCUS_16510 30146 31228 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338163.1 protein_id gnl|my_center|LOCUS_16510 32607 31252 gene locus_tag LOCUS_16520 32607 31252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 33326 32607 gene locus_tag LOCUS_16530 33326 32607 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970997.1 protein_id gnl|my_center|LOCUS_16530 34085 33462 gene locus_tag LOCUS_16540 34085 33462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 34892 34233 gene locus_tag LOCUS_16550 34892 34233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 36185 34968 gene locus_tag LOCUS_16560 gene argG 36185 34968 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYJ1 protein_id gnl|my_center|LOCUS_16560 37310 36327 gene locus_tag LOCUS_16570 37310 36327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 37682 37452 gene locus_tag LOCUS_16580 37682 37452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 37744 38733 gene locus_tag LOCUS_16590 37744 38733 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919916.1 protein_id gnl|my_center|LOCUS_16590 38823 38750 gene locus_tag LOCUS_t00280 38823 38750 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 38874 39854 gene locus_tag LOCUS_16600 38874 39854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 39937 41052 gene locus_tag LOCUS_16610 39937 41052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 41074 42072 gene locus_tag LOCUS_16620 41074 42072 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709972.1 protein_id gnl|my_center|LOCUS_16620 42333 42136 gene locus_tag LOCUS_16630 42333 42136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 42474 43883 gene locus_tag LOCUS_16640 42474 43883 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640327.1 protein_id gnl|my_center|LOCUS_16640 44110 45885 gene locus_tag LOCUS_16650 44110 45885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 46603 46058 gene locus_tag LOCUS_16660 46603 46058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 46493 47131 gene locus_tag LOCUS_16670 46493 47131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 47128 47745 gene locus_tag LOCUS_16680 gene rnd1 47128 47745 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338751.1 protein_id gnl|my_center|LOCUS_16680 47767 48414 gene locus_tag LOCUS_16690 47767 48414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 48414 48974 gene locus_tag LOCUS_16700 48414 48974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 49096 49269 gene locus_tag LOCUS_16710 49096 49269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 49924 49334 gene locus_tag LOCUS_16720 49924 49334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 50630 49929 gene locus_tag LOCUS_16730 50630 49929 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787574.1 protein_id gnl|my_center|LOCUS_16730 51691 50732 gene locus_tag LOCUS_16740 51691 50732 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920124.1 protein_id gnl|my_center|LOCUS_16740 53045 52044 gene locus_tag LOCUS_16750 53045 52044 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_16750 53227 54357 gene locus_tag LOCUS_16760 53227 54357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529437.1 protein_id gnl|my_center|LOCUS_16760 54354 55223 gene locus_tag LOCUS_16770 54354 55223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 56271 55201 gene locus_tag LOCUS_16780 56271 55201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 56682 56317 gene locus_tag LOCUS_16790 56682 56317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_16790 57739 56741 gene locus_tag LOCUS_16800 57739 56741 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN19 protein_id gnl|my_center|LOCUS_16800 57826 58512 gene locus_tag LOCUS_16810 gene ung 57826 58512 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UCM8 protein_id gnl|my_center|LOCUS_16810 58520 58699 gene locus_tag LOCUS_16820 58520 58699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 59152 58808 gene locus_tag LOCUS_16830 59152 58808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 59272 60474 gene locus_tag LOCUS_16840 gene clsB 59272 60474 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBP5 protein_id gnl|my_center|LOCUS_16840 60881 60513 gene locus_tag LOCUS_16850 60881 60513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 61570 61004 gene locus_tag LOCUS_16860 61570 61004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 62931 61567 gene locus_tag LOCUS_16870 62931 61567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 63661 62924 gene locus_tag LOCUS_16880 63661 62924 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527354.1 protein_id gnl|my_center|LOCUS_16880 64562 63732 gene locus_tag LOCUS_16890 64562 63732 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y832 protein_id gnl|my_center|LOCUS_16890 65897 64782 gene locus_tag LOCUS_16900 65897 64782 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN15 protein_id gnl|my_center|LOCUS_16900 66759 65956 gene locus_tag LOCUS_16910 66759 65956 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_16910 66940 67030 gene locus_tag LOCUS_t00290 66940 67030 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 67342 69627 gene locus_tag LOCUS_16920 67342 69627 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918342.1 protein_id gnl|my_center|LOCUS_16920 69651 71297 gene locus_tag LOCUS_16930 gene phoD 69651 71297 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_16930 72714 71392 gene locus_tag LOCUS_16940 72714 71392 CDS product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886769.1 protein_id gnl|my_center|LOCUS_16940 74221 72785 gene locus_tag LOCUS_16950 74221 72785 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886819.1 protein_id gnl|my_center|LOCUS_16950 75552 74275 gene locus_tag LOCUS_16960 75552 74275 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103048.1 protein_id gnl|my_center|LOCUS_16960 76433 75564 gene locus_tag LOCUS_16970 76433 75564 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967978.1 protein_id gnl|my_center|LOCUS_16970 76866 76456 gene locus_tag LOCUS_16980 76866 76456 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268409.1 protein_id gnl|my_center|LOCUS_16980 77948 76866 gene locus_tag LOCUS_16990 77948 76866 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886817.1 protein_id gnl|my_center|LOCUS_16990 78150 79091 gene locus_tag LOCUS_17000 78150 79091 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886818.1 protein_id gnl|my_center|LOCUS_17000 80413 79067 gene locus_tag LOCUS_17010 80413 79067 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123571.1 protein_id gnl|my_center|LOCUS_17010 80412 80561 gene locus_tag LOCUS_17020 80412 80561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 81621 80602 gene locus_tag LOCUS_17030 81621 80602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 83402 81681 gene locus_tag LOCUS_17040 83402 81681 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_17040 84474 83464 gene locus_tag LOCUS_17050 84474 83464 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920175.1 protein_id gnl|my_center|LOCUS_17050 87607 84758 gene locus_tag LOCUS_17060 87607 84758 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071521.1 protein_id gnl|my_center|LOCUS_17060 89857 87914 gene locus_tag LOCUS_17070 89857 87914 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_17070 90011 91501 gene locus_tag LOCUS_17080 90011 91501 CDS product putative sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702286.1 protein_id gnl|my_center|LOCUS_17080 91693 92652 gene locus_tag LOCUS_17090 gene salR 91693 92652 CDS product sal operon transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639440.2 protein_id gnl|my_center|LOCUS_17090 93310 92675 gene locus_tag LOCUS_17100 93310 92675 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082941.1 protein_id gnl|my_center|LOCUS_17100 93998 93303 gene locus_tag LOCUS_17110 93998 93303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089781.1 protein_id gnl|my_center|LOCUS_17110 95059 93995 gene locus_tag LOCUS_17120 95059 93995 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082942.1 protein_id gnl|my_center|LOCUS_17120 96764 95070 gene locus_tag LOCUS_17130 96764 95070 CDS product glycoside hydrolase family 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383260.1 protein_id gnl|my_center|LOCUS_17130 99199 96824 gene locus_tag LOCUS_17140 99199 96824 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918074.1 protein_id gnl|my_center|LOCUS_17140 99463 100800 gene locus_tag LOCUS_17150 99463 100800 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_17150 100829 102331 gene locus_tag LOCUS_17160 100829 102331 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_17160 102418 104148 gene locus_tag LOCUS_17170 102418 104148 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_17170 104145 106040 gene locus_tag LOCUS_17180 gene atsG 104145 106040 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121854.1 protein_id gnl|my_center|LOCUS_17180 106082 107017 gene locus_tag LOCUS_17190 106082 107017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087510.1 protein_id gnl|my_center|LOCUS_17190 107174 107356 gene locus_tag LOCUS_17200 107174 107356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 108826 107462 gene locus_tag LOCUS_17210 gene ragB 108826 107462 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971303.1 protein_id gnl|my_center|LOCUS_17210 109531 108851 gene locus_tag LOCUS_17220 109531 108851 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_17220 109919 109545 gene locus_tag LOCUS_17230 109919 109545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 110051 110785 gene locus_tag LOCUS_17240 110051 110785 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706483.1 protein_id gnl|my_center|LOCUS_17240 110789 111211 gene locus_tag LOCUS_17250 110789 111211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 111190 113784 gene locus_tag LOCUS_17260 111190 113784 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104819.1 protein_id gnl|my_center|LOCUS_17260 113883 115316 gene locus_tag LOCUS_17270 gene acvB 113883 115316 CDS product virulence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036514.1 protein_id gnl|my_center|LOCUS_17270 116142 115327 gene locus_tag LOCUS_17280 gene citE 116142 115327 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_17280 116218 117189 gene locus_tag LOCUS_17290 116218 117189 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038004.1 protein_id gnl|my_center|LOCUS_17290 117470 117913 gene locus_tag LOCUS_17300 117470 117913 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888773.1 protein_id gnl|my_center|LOCUS_17300 119512 117974 gene locus_tag LOCUS_17310 119512 117974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 119820 120293 gene locus_tag LOCUS_17320 119820 120293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 120379 122217 gene locus_tag LOCUS_17330 120379 122217 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919880.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence10 229 1716 gene locus_tag LOCUS_17340 gene gumJ 229 1716 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037587.1 protein_id gnl|my_center|LOCUS_17340 2191 1763 gene locus_tag LOCUS_17350 2191 1763 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_17350 2332 2574 gene locus_tag LOCUS_17360 2332 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2555 2932 gene locus_tag LOCUS_17370 gene yciA 2555 2932 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948520.1 protein_id gnl|my_center|LOCUS_17370 4445 2937 gene locus_tag LOCUS_17380 4445 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918921.1 protein_id gnl|my_center|LOCUS_17380 5941 4541 gene locus_tag LOCUS_17390 5941 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918922.1 protein_id gnl|my_center|LOCUS_17390 7009 6071 gene locus_tag LOCUS_17400 7009 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 8170 7301 gene locus_tag LOCUS_17410 gene prmC 8170 7301 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE0 protein_id gnl|my_center|LOCUS_17410 9258 8167 gene locus_tag LOCUS_17420 gene prfA 9258 8167 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE1 protein_id gnl|my_center|LOCUS_17420 10717 9392 gene locus_tag LOCUS_17430 gene hisS 10717 9392 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 protein_id gnl|my_center|LOCUS_17430 10856 12787 gene locus_tag LOCUS_17440 10856 12787 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640643.1 protein_id gnl|my_center|LOCUS_17440 12823 13362 gene locus_tag LOCUS_17450 gene ppa 12823 13362 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WY0 protein_id gnl|my_center|LOCUS_17450 13587 15305 gene locus_tag LOCUS_17460 13587 15305 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884115.1 protein_id gnl|my_center|LOCUS_17460 15816 15325 gene locus_tag LOCUS_17470 15816 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 16287 15871 gene locus_tag LOCUS_17480 16287 15871 CDS product cysteine desulfurase, sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816974.1 protein_id gnl|my_center|LOCUS_17480 16572 16339 gene locus_tag LOCUS_17490 16572 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 16852 16601 gene locus_tag LOCUS_17500 16852 16601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 17190 16879 gene locus_tag LOCUS_17510 17190 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 17505 17215 gene locus_tag LOCUS_17520 17505 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 17921 17541 gene locus_tag LOCUS_17530 gene pspC 17921 17541 CDS product phage-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071930.1 protein_id gnl|my_center|LOCUS_17530 18204 17923 gene locus_tag LOCUS_17540 18204 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 18877 18209 gene locus_tag LOCUS_17550 gene pspA 18877 18209 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096403.1 protein_id gnl|my_center|LOCUS_17550 19092 18919 gene locus_tag LOCUS_17560 19092 18919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 19278 20297 gene locus_tag LOCUS_17570 19278 20297 CDS product PSP operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705753.1 protein_id gnl|my_center|LOCUS_17570 20278 20457 gene locus_tag LOCUS_17580 20278 20457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 21356 20478 gene locus_tag LOCUS_17590 gene hbdA 21356 20478 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970098.1 protein_id gnl|my_center|LOCUS_17590 21526 21996 gene locus_tag LOCUS_17600 21526 21996 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921067.1 protein_id gnl|my_center|LOCUS_17600 21993 22700 gene locus_tag LOCUS_17610 gene tolQ 21993 22700 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089890.1 protein_id gnl|my_center|LOCUS_17610 22804 23262 gene locus_tag LOCUS_17620 gene tolR 22804 23262 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089889.1 protein_id gnl|my_center|LOCUS_17620 23269 24237 gene locus_tag LOCUS_17630 23269 24237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 24234 25568 gene locus_tag LOCUS_17640 gene tolB 24234 25568 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 protein_id gnl|my_center|LOCUS_17640 25687 26196 gene locus_tag LOCUS_17650 gene omp16 25687 26196 CDS product outer membrane lipoprotein Omp16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9L5 protein_id gnl|my_center|LOCUS_17650 26800 26306 gene locus_tag LOCUS_17660 26800 26306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 27203 26901 gene locus_tag LOCUS_17670 27203 26901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088538.1 protein_id gnl|my_center|LOCUS_17670 30197 27315 gene locus_tag LOCUS_17680 30197 27315 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038616.1 protein_id gnl|my_center|LOCUS_17680 30531 33110 gene locus_tag LOCUS_17690 gene clpB 30531 33110 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHQ2 protein_id gnl|my_center|LOCUS_17690 33405 33148 gene locus_tag LOCUS_17700 33405 33148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 34755 33475 gene locus_tag LOCUS_17710 34755 33475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 34867 35901 gene locus_tag LOCUS_17720 34867 35901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 38956 35984 gene locus_tag LOCUS_17730 38956 35984 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_17730 39553 39921 gene locus_tag LOCUS_17740 39553 39921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 40766 39927 gene locus_tag LOCUS_17750 40766 39927 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037402.1 protein_id gnl|my_center|LOCUS_17750 40975 40763 gene locus_tag LOCUS_17760 40975 40763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707009.1 protein_id gnl|my_center|LOCUS_17760 42489 40996 gene locus_tag LOCUS_17770 gene xseA 42489 40996 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9G2 protein_id gnl|my_center|LOCUS_17770 42488 43774 gene locus_tag LOCUS_17780 gene purD 42488 43774 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T902 protein_id gnl|my_center|LOCUS_17780 43840 44379 gene locus_tag LOCUS_17790 43840 44379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 45255 44413 gene locus_tag LOCUS_17800 45255 44413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 46447 45653 gene locus_tag LOCUS_17810 46447 45653 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918197.1 protein_id gnl|my_center|LOCUS_17810 47780 46434 gene locus_tag LOCUS_17820 47780 46434 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090251.1 protein_id gnl|my_center|LOCUS_17820 48746 47823 gene locus_tag LOCUS_17830 48746 47823 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_17830 49791 48727 gene locus_tag LOCUS_17840 gene mutY 49791 48727 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538060.1 protein_id gnl|my_center|LOCUS_17840 49824 50378 gene locus_tag LOCUS_17850 49824 50378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085285.1 protein_id gnl|my_center|LOCUS_17850 50424 51089 gene locus_tag LOCUS_17860 50424 51089 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336760.1 protein_id gnl|my_center|LOCUS_17860 51126 51869 gene locus_tag LOCUS_17870 51126 51869 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336760.1 protein_id gnl|my_center|LOCUS_17870 51986 55429 gene locus_tag LOCUS_17880 gene smc 51986 55429 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SA9 protein_id gnl|my_center|LOCUS_17880 55539 55811 gene locus_tag LOCUS_17890 55539 55811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140411.1 protein_id gnl|my_center|LOCUS_17890 55771 56049 gene locus_tag LOCUS_17900 55771 56049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337726.1 protein_id gnl|my_center|LOCUS_17900 57521 56046 gene locus_tag LOCUS_17910 57521 56046 CDS product phospholipase D/transphosphatidylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003668.1 protein_id gnl|my_center|LOCUS_17910 58420 57518 gene locus_tag LOCUS_17920 gene ubiA 58420 57518 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CBU3 protein_id gnl|my_center|LOCUS_17920 58517 59263 gene locus_tag LOCUS_17930 58517 59263 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ44 protein_id gnl|my_center|LOCUS_17930 59364 60737 gene locus_tag LOCUS_17940 59364 60737 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_17940 62057 60756 gene locus_tag LOCUS_17950 62057 60756 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533232.1 protein_id gnl|my_center|LOCUS_17950 62208 62528 gene locus_tag LOCUS_17960 62208 62528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 63184 62549 gene locus_tag LOCUS_17970 63184 62549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115060.1 protein_id gnl|my_center|LOCUS_17970 63767 63192 gene locus_tag LOCUS_17980 63767 63192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 63895 64503 gene locus_tag LOCUS_17990 gene ruvA 63895 64503 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF6 protein_id gnl|my_center|LOCUS_17990 64576 64902 gene locus_tag LOCUS_18000 64576 64902 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_18000 64940 65959 gene locus_tag LOCUS_18010 gene ruvB 64940 65959 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCT7 protein_id gnl|my_center|LOCUS_18010 66050 67828 gene locus_tag LOCUS_18020 66050 67828 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_18020 67833 68732 gene locus_tag LOCUS_18030 67833 68732 CDS product subclass B3 metallo-beta-lactamase BJP-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088970.1 protein_id gnl|my_center|LOCUS_18030 69147 68743 gene locus_tag LOCUS_18040 69147 68743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 69920 69198 gene locus_tag LOCUS_18050 gene gloB 69920 69198 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4Z8 protein_id gnl|my_center|LOCUS_18050 70360 69926 gene locus_tag LOCUS_18060 gene gloA 70360 69926 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383985.1 protein_id gnl|my_center|LOCUS_18060 70463 71170 gene locus_tag LOCUS_18070 70463 71170 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869321.1 protein_id gnl|my_center|LOCUS_18070 72092 71211 gene locus_tag LOCUS_18080 72092 71211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 72847 72092 gene locus_tag LOCUS_18090 72847 72092 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391124.1 protein_id gnl|my_center|LOCUS_18090 72978 73064 gene locus_tag LOCUS_t00300 72978 73064 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 73223 74461 gene locus_tag LOCUS_18100 73223 74461 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_18100 75107 77182 gene locus_tag LOCUS_18110 75107 77182 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919029.1 protein_id gnl|my_center|LOCUS_18110 77318 78310 gene locus_tag LOCUS_18120 gene hoxN 77318 78310 CDS product nickel/cobalt efflux system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63U46 protein_id gnl|my_center|LOCUS_18120 79231 80298 gene locus_tag LOCUS_18130 gene cobW 79231 80298 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337769.1 protein_id gnl|my_center|LOCUS_18130 80309 83593 gene locus_tag LOCUS_18140 gene cobN 80309 83593 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337770.1 protein_id gnl|my_center|LOCUS_18140 83590 84735 gene locus_tag LOCUS_18150 83590 84735 CDS product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086048.1 protein_id gnl|my_center|LOCUS_18150 84735 85364 gene locus_tag LOCUS_18160 gene cobH 84735 85364 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086049.1 protein_id gnl|my_center|LOCUS_18160 85361 86098 gene locus_tag LOCUS_18170 gene cobI 85361 86098 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003616.1 protein_id gnl|my_center|LOCUS_18170 86110 86883 gene locus_tag LOCUS_18180 gene cobJ 86110 86883 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337773.1 protein_id gnl|my_center|LOCUS_18180 87644 86847 gene locus_tag LOCUS_18190 gene cobK 87644 86847 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337774.1 protein_id gnl|my_center|LOCUS_18190 87607 88815 gene locus_tag LOCUS_18200 gene cobL 87607 88815 CDS product precorrin-6Y methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337775.1 protein_id gnl|my_center|LOCUS_18200 88812 89192 gene locus_tag LOCUS_18210 gene cobE 88812 89192 CDS product precorrin methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337776.1 protein_id gnl|my_center|LOCUS_18210 89189 89974 gene locus_tag LOCUS_18220 gene cobM 89189 89974 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086055.1 protein_id gnl|my_center|LOCUS_18220 89971 91305 gene locus_tag LOCUS_18230 gene cobB 89971 91305 CDS product hydrogenobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXD4 protein_id gnl|my_center|LOCUS_18230 91302 92081 gene locus_tag LOCUS_18240 gene cobF 91302 92081 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086059.1 protein_id gnl|my_center|LOCUS_18240 92071 92697 gene locus_tag LOCUS_18250 gene cobO 92071 92697 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086044.1 protein_id gnl|my_center|LOCUS_18250 92712 93341 gene locus_tag LOCUS_18260 92712 93341 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG5 protein_id gnl|my_center|LOCUS_18260 93367 93774 gene locus_tag LOCUS_18270 93367 93774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 93771 94787 gene locus_tag LOCUS_18280 gene cobT 93771 94787 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MDH9 protein_id gnl|my_center|LOCUS_18280 94784 95353 gene locus_tag LOCUS_18290 94784 95353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_18290 95449 96090 gene locus_tag LOCUS_18300 95449 96090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 96087 97070 gene locus_tag LOCUS_18310 gene cobC 96087 97070 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972583.1 protein_id gnl|my_center|LOCUS_18310 97063 98013 gene locus_tag LOCUS_18320 gene cobD 97063 98013 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Q73 protein_id gnl|my_center|LOCUS_18320 98013 99488 gene locus_tag LOCUS_18330 gene cobQ 98013 99488 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Q71 protein_id gnl|my_center|LOCUS_18330 99485 100012 gene locus_tag LOCUS_18340 99485 100012 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 protein_id gnl|my_center|LOCUS_18340 101635 100619 gene locus_tag LOCUS_18350 101635 100619 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391189.1 protein_id gnl|my_center|LOCUS_18350 101948 101724 gene locus_tag LOCUS_18360 101948 101724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence11 4862 186 gene locus_tag LOCUS_18370 4862 186 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_18370 5379 5218 gene locus_tag LOCUS_18380 5379 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 6887 5802 gene locus_tag LOCUS_18390 gene tnp 6887 5802 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973848.1 protein_id gnl|my_center|LOCUS_18390 7847 6930 gene locus_tag LOCUS_18400 7847 6930 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723784.1 protein_id gnl|my_center|LOCUS_18400 8006 8890 gene locus_tag LOCUS_18410 8006 8890 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339122.1 protein_id gnl|my_center|LOCUS_18410 9459 8971 gene locus_tag LOCUS_18420 9459 8971 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869250.1 protein_id gnl|my_center|LOCUS_18420 9727 10215 gene locus_tag LOCUS_18430 gene ectA 9727 10215 CDS product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263923.1 protein_id gnl|my_center|LOCUS_18430 10232 11542 gene locus_tag LOCUS_18440 gene ectB 10232 11542 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NZ7 protein_id gnl|my_center|LOCUS_18440 11558 11971 gene locus_tag LOCUS_18450 gene ectC 11558 11971 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NZ8 protein_id gnl|my_center|LOCUS_18450 12082 13002 gene locus_tag LOCUS_18460 12082 13002 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 protein_id gnl|my_center|LOCUS_18460 12999 14441 gene locus_tag LOCUS_18470 12999 14441 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263925.1 protein_id gnl|my_center|LOCUS_18470 14462 15697 gene locus_tag LOCUS_18480 14462 15697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958306.1 protein_id gnl|my_center|LOCUS_18480 15694 17049 gene locus_tag LOCUS_18490 15694 17049 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893847.1 protein_id gnl|my_center|LOCUS_18490 19603 17156 gene locus_tag LOCUS_18500 19603 17156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 23616 19864 gene locus_tag LOCUS_18510 23616 19864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 24085 25950 gene locus_tag LOCUS_18520 24085 25950 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140190.1 protein_id gnl|my_center|LOCUS_18520 25947 27101 gene locus_tag LOCUS_18530 25947 27101 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086145.1 protein_id gnl|my_center|LOCUS_18530 27275 27859 gene locus_tag LOCUS_18540 27275 27859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 27957 29456 gene locus_tag LOCUS_18550 27957 29456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 29453 30496 gene locus_tag LOCUS_18560 29453 30496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 30974 31390 gene locus_tag LOCUS_18570 30974 31390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 31847 33703 gene locus_tag LOCUS_18580 31847 33703 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140190.1 protein_id gnl|my_center|LOCUS_18580 33766 35514 gene locus_tag LOCUS_18590 33766 35514 CDS product type I secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090638.1 protein_id gnl|my_center|LOCUS_18590 35536 36873 gene locus_tag LOCUS_18600 35536 36873 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525075.1 protein_id gnl|my_center|LOCUS_18600 38247 36976 gene locus_tag LOCUS_18610 38247 36976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639895.1 protein_id gnl|my_center|LOCUS_18610 38436 39671 gene locus_tag LOCUS_18620 38436 39671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 41228 40467 gene locus_tag LOCUS_18630 41228 40467 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N75 protein_id gnl|my_center|LOCUS_18630 41385 42965 gene locus_tag LOCUS_18640 gene yhdG 41385 42965 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036992.1 protein_id gnl|my_center|LOCUS_18640 44215 43025 gene locus_tag LOCUS_18650 44215 43025 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390719.1 protein_id gnl|my_center|LOCUS_18650 44526 44822 gene locus_tag LOCUS_18660 44526 44822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 45952 44819 gene locus_tag LOCUS_18670 45952 44819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 protein_id gnl|my_center|LOCUS_18670 46505 46041 gene locus_tag LOCUS_18680 46505 46041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 protein_id gnl|my_center|LOCUS_18680 47158 46502 gene locus_tag LOCUS_18690 47158 46502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 47442 47155 gene locus_tag LOCUS_18700 47442 47155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972655.1 protein_id gnl|my_center|LOCUS_18700 47514 47876 gene locus_tag LOCUS_18710 47514 47876 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920321.1 protein_id gnl|my_center|LOCUS_18710 48011 49876 gene locus_tag LOCUS_18720 48011 49876 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097695.1 protein_id gnl|my_center|LOCUS_18720 50225 50058 gene locus_tag LOCUS_18730 gene rpmG 50225 50058 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZL9 protein_id gnl|my_center|LOCUS_18730 50429 50755 gene locus_tag LOCUS_18740 50429 50755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 50769 51335 gene locus_tag LOCUS_18750 50769 51335 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265800.1 protein_id gnl|my_center|LOCUS_18750 51435 51926 gene locus_tag LOCUS_18760 51435 51926 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083122.1 protein_id gnl|my_center|LOCUS_18760 52458 51988 gene locus_tag LOCUS_18770 gene greB 52458 51988 CDS product transcription elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973144.1 protein_id gnl|my_center|LOCUS_18770 54386 52560 gene locus_tag LOCUS_18780 54386 52560 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 protein_id gnl|my_center|LOCUS_18780 54730 54383 gene locus_tag LOCUS_18790 54730 54383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 55016 54720 gene locus_tag LOCUS_18800 55016 54720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 56040 55033 gene locus_tag LOCUS_18810 56040 55033 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_18810 57431 56127 gene locus_tag LOCUS_18820 57431 56127 CDS product molecular chaperone Hsp70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919351.1 protein_id gnl|my_center|LOCUS_18820 57695 57934 gene locus_tag LOCUS_18830 57695 57934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 58555 57935 gene locus_tag LOCUS_18840 gene dnaJ 58555 57935 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083016.1 protein_id gnl|my_center|LOCUS_18840 58600 58887 gene locus_tag LOCUS_18850 58600 58887 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920847.1 protein_id gnl|my_center|LOCUS_18850 58887 59792 gene locus_tag LOCUS_18860 58887 59792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707077.1 protein_id gnl|my_center|LOCUS_18860 60814 59972 gene locus_tag LOCUS_18870 60814 59972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 60985 61695 gene locus_tag LOCUS_18880 60985 61695 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970104.1 protein_id gnl|my_center|LOCUS_18880 61695 62600 gene locus_tag LOCUS_18890 61695 62600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 62597 63127 gene locus_tag LOCUS_18900 62597 63127 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066766.1 protein_id gnl|my_center|LOCUS_18900 63143 63850 gene locus_tag LOCUS_18910 63143 63850 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391005.1 protein_id gnl|my_center|LOCUS_18910 64820 63915 gene locus_tag LOCUS_18920 64820 63915 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529388.1 protein_id gnl|my_center|LOCUS_18920 65946 64825 gene locus_tag LOCUS_18930 gene hisC 65946 64825 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP86 protein_id gnl|my_center|LOCUS_18930 66104 67171 gene locus_tag LOCUS_18940 gene metX 66104 67171 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9J1 protein_id gnl|my_center|LOCUS_18940 67168 67761 gene locus_tag LOCUS_18950 67168 67761 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_18950 68262 67768 gene locus_tag LOCUS_18960 68262 67768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 68935 68321 gene locus_tag LOCUS_18970 68935 68321 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407700.1 protein_id gnl|my_center|LOCUS_18970 69094 71451 gene locus_tag LOCUS_18980 69094 71451 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 protein_id gnl|my_center|LOCUS_18980 71559 72830 gene locus_tag LOCUS_18990 71559 72830 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918225.1 protein_id gnl|my_center|LOCUS_18990 74420 72843 gene locus_tag LOCUS_19000 gene prfC 74420 72843 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9B9 protein_id gnl|my_center|LOCUS_19000 75448 74564 gene locus_tag LOCUS_19010 75448 74564 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531513.1 protein_id gnl|my_center|LOCUS_19010 75597 76067 gene locus_tag LOCUS_19020 75597 76067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265635.1 protein_id gnl|my_center|LOCUS_19020 76335 77603 gene locus_tag LOCUS_19030 gene proA 76335 77603 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV06 protein_id gnl|my_center|LOCUS_19030 77998 77639 gene locus_tag LOCUS_19040 77998 77639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 79036 78200 gene locus_tag LOCUS_19050 gene kdsA 79036 78200 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT59 protein_id gnl|my_center|LOCUS_19050 79326 79033 gene locus_tag LOCUS_19060 79326 79033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 79348 80481 gene locus_tag LOCUS_19070 79348 80481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 80478 81854 gene locus_tag LOCUS_19080 80478 81854 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780438.1 protein_id gnl|my_center|LOCUS_19080 82763 81873 gene locus_tag LOCUS_19090 82763 81873 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085763.1 protein_id gnl|my_center|LOCUS_19090 85225 82760 gene locus_tag LOCUS_19100 85225 82760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085762.1 protein_id gnl|my_center|LOCUS_19100 88595 85236 gene locus_tag LOCUS_19110 88595 85236 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529825.1 protein_id gnl|my_center|LOCUS_19110 88887 90833 gene locus_tag LOCUS_19120 gene thiC 88887 90833 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KNV0 protein_id gnl|my_center|LOCUS_19120 >Feature sequence12 1840 911 gene locus_tag LOCUS_19130 gene cysK 1840 911 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5G2 protein_id gnl|my_center|LOCUS_19130 3141 1837 gene locus_tag LOCUS_19140 3141 1837 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918291.1 protein_id gnl|my_center|LOCUS_19140 4974 3343 gene locus_tag LOCUS_19150 4974 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532671.1 protein_id gnl|my_center|LOCUS_19150 6648 5083 gene locus_tag LOCUS_19160 6648 5083 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003689.1 protein_id gnl|my_center|LOCUS_19160 7565 6717 gene locus_tag LOCUS_19170 7565 6717 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_19170 8668 7565 gene locus_tag LOCUS_19180 8668 7565 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_19180 8763 9728 gene locus_tag LOCUS_19190 8763 9728 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y993 protein_id gnl|my_center|LOCUS_19190 9899 10333 gene locus_tag LOCUS_19200 9899 10333 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097249.1 protein_id gnl|my_center|LOCUS_19200 10372 12639 gene locus_tag LOCUS_19210 10372 12639 CDS product exported oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063689.1 protein_id gnl|my_center|LOCUS_19210 12636 13646 gene locus_tag LOCUS_19220 gene hemH 12636 13646 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCZ1 protein_id gnl|my_center|LOCUS_19220 13665 14387 gene locus_tag LOCUS_19230 13665 14387 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_19230 14387 14686 gene locus_tag LOCUS_19240 14387 14686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 14739 17045 gene locus_tag LOCUS_19250 gene fhuA 14739 17045 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037900.1 protein_id gnl|my_center|LOCUS_19250 17217 17987 gene locus_tag LOCUS_19260 17217 17987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 18003 18686 gene locus_tag LOCUS_19270 18003 18686 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63L05 protein_id gnl|my_center|LOCUS_19270 19037 18690 gene locus_tag LOCUS_19280 19037 18690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640079.1 protein_id gnl|my_center|LOCUS_19280 19910 19041 gene locus_tag LOCUS_19290 19910 19041 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3Y8 protein_id gnl|my_center|LOCUS_19290 20881 20009 gene locus_tag LOCUS_19300 20881 20009 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 protein_id gnl|my_center|LOCUS_19300 21417 20893 gene locus_tag LOCUS_19310 21417 20893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920896.1 protein_id gnl|my_center|LOCUS_19310 22076 21429 gene locus_tag LOCUS_19320 22076 21429 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920895.1 protein_id gnl|my_center|LOCUS_19320 22938 22198 gene locus_tag LOCUS_19330 22938 22198 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919296.1 protein_id gnl|my_center|LOCUS_19330 23878 22955 gene locus_tag LOCUS_19340 gene gal 23878 22955 CDS product D-galactose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969077.1 protein_id gnl|my_center|LOCUS_19340 25452 23875 gene locus_tag LOCUS_19350 25452 23875 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_19350 27284 25482 gene locus_tag LOCUS_19360 gene ilvD 27284 25482 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919297.1 protein_id gnl|my_center|LOCUS_19360 27421 28326 gene locus_tag LOCUS_19370 27421 28326 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918670.1 protein_id gnl|my_center|LOCUS_19370 28323 28952 gene locus_tag LOCUS_19380 28323 28952 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_419601.2 protein_id gnl|my_center|LOCUS_19380 29019 30041 gene locus_tag LOCUS_19390 gene ctaA 29019 30041 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KD9 protein_id gnl|my_center|LOCUS_19390 30047 30835 gene locus_tag LOCUS_19400 30047 30835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 30971 31450 gene locus_tag LOCUS_19410 gene rplM 30971 31450 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGF3 protein_id gnl|my_center|LOCUS_19410 31450 32010 gene locus_tag LOCUS_19420 31450 32010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 33523 32219 gene locus_tag LOCUS_19430 33523 32219 CDS product teichoic acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919050.1 protein_id gnl|my_center|LOCUS_19430 33701 34465 gene locus_tag LOCUS_19440 33701 34465 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 protein_id gnl|my_center|LOCUS_19440 34931 34494 gene locus_tag LOCUS_19450 34931 34494 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919041.1 protein_id gnl|my_center|LOCUS_19450 36049 34928 gene locus_tag LOCUS_19460 36049 34928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919043.1 protein_id gnl|my_center|LOCUS_19460 37185 36046 gene locus_tag LOCUS_19470 37185 36046 CDS product glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919051.1 protein_id gnl|my_center|LOCUS_19470 37353 38141 gene locus_tag LOCUS_19480 gene sdhB 37353 38141 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V5 protein_id gnl|my_center|LOCUS_19480 38165 38605 gene locus_tag LOCUS_19490 38165 38605 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919948.1 protein_id gnl|my_center|LOCUS_19490 38602 39714 gene locus_tag LOCUS_19500 38602 39714 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921360.1 protein_id gnl|my_center|LOCUS_19500 40018 40980 gene locus_tag LOCUS_19510 gene mdh 40018 40980 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ83 protein_id gnl|my_center|LOCUS_19510 41079 41963 gene locus_tag LOCUS_19520 gene sucD 41079 41963 CDS product succinyl-CoA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918227.1 protein_id gnl|my_center|LOCUS_19520 42043 44841 gene locus_tag LOCUS_19530 gene sucA 42043 44841 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972453.1 protein_id gnl|my_center|LOCUS_19530 44850 46100 gene locus_tag LOCUS_19540 44850 46100 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDN9 protein_id gnl|my_center|LOCUS_19540 46179 46442 gene locus_tag LOCUS_19550 46179 46442 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_19550 46493 47893 gene locus_tag LOCUS_19560 46493 47893 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV29 protein_id gnl|my_center|LOCUS_19560 48881 48120 gene locus_tag LOCUS_19570 gene paaG 48881 48120 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227109.1 protein_id gnl|my_center|LOCUS_19570 49546 48878 gene locus_tag LOCUS_19580 gene gph 49546 48878 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEY9 protein_id gnl|my_center|LOCUS_19580 49668 50999 gene locus_tag LOCUS_19590 gene glmU 49668 50999 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 protein_id gnl|my_center|LOCUS_19590 51085 51954 gene locus_tag LOCUS_19600 51085 51954 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529142.1 protein_id gnl|my_center|LOCUS_19600 52084 53907 gene locus_tag LOCUS_19610 gene glmS 52084 53907 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX1 protein_id gnl|my_center|LOCUS_19610 54476 54267 gene locus_tag LOCUS_19620 54476 54267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 56337 54724 gene locus_tag LOCUS_19630 gene yhcX 56337 54724 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_19630 57692 56472 gene locus_tag LOCUS_19640 57692 56472 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI4 protein_id gnl|my_center|LOCUS_19640 57861 58595 gene locus_tag LOCUS_19650 gene psd 57861 58595 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY9 protein_id gnl|my_center|LOCUS_19650 58646 59374 gene locus_tag LOCUS_19660 58646 59374 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_19660 59608 59381 gene locus_tag LOCUS_19670 59608 59381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 59866 60624 gene locus_tag LOCUS_19680 gene rpsB 59866 60624 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8K2 protein_id gnl|my_center|LOCUS_19680 60737 61666 gene locus_tag LOCUS_19690 gene tsf 60737 61666 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU08 protein_id gnl|my_center|LOCUS_19690 61847 62572 gene locus_tag LOCUS_19700 gene pyrH 61847 62572 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A705 protein_id gnl|my_center|LOCUS_19700 62577 63134 gene locus_tag LOCUS_19710 gene frr 62577 63134 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KP6 protein_id gnl|my_center|LOCUS_19710 63178 63918 gene locus_tag LOCUS_19720 63178 63918 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9Z8 protein_id gnl|my_center|LOCUS_19720 63924 64700 gene locus_tag LOCUS_19730 63924 64700 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU04 protein_id gnl|my_center|LOCUS_19730 64697 65857 gene locus_tag LOCUS_19740 gene dxr 64697 65857 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_19740 65854 66987 gene locus_tag LOCUS_19750 65854 66987 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL7 protein_id gnl|my_center|LOCUS_19750 67129 69762 gene locus_tag LOCUS_19760 gene bamA 67129 69762 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9L0 protein_id gnl|my_center|LOCUS_19760 69762 70418 gene locus_tag LOCUS_19770 69762 70418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 70425 70904 gene locus_tag LOCUS_19780 gene fabZ 70425 70904 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GWR2 protein_id gnl|my_center|LOCUS_19780 71093 71317 gene locus_tag LOCUS_19790 gene rpmE 71093 71317 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9I5 protein_id gnl|my_center|LOCUS_19790 73044 71938 gene locus_tag LOCUS_19800 gene aroB 73044 71938 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 protein_id gnl|my_center|LOCUS_19800 73583 73035 gene locus_tag LOCUS_19810 gene aroK 73583 73035 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XW7 protein_id gnl|my_center|LOCUS_19810 73678 73866 gene locus_tag LOCUS_19820 73678 73866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 73872 75683 gene locus_tag LOCUS_19830 73872 75683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 75683 76612 gene locus_tag LOCUS_19840 gene xerD 75683 76612 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9G0 protein_id gnl|my_center|LOCUS_19840 76624 77568 gene locus_tag LOCUS_19850 gene accA 76624 77568 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XW4 protein_id gnl|my_center|LOCUS_19850 77640 79118 gene locus_tag LOCUS_19860 77640 79118 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529171.1 protein_id gnl|my_center|LOCUS_19860 79343 79182 gene locus_tag LOCUS_19870 79343 79182 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939393.1 protein_id gnl|my_center|LOCUS_19870 79667 79482 gene locus_tag LOCUS_19880 79667 79482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 79749 80156 gene locus_tag LOCUS_19890 79749 80156 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388152.1 protein_id gnl|my_center|LOCUS_19890 80672 80193 gene locus_tag LOCUS_19900 gene bfr 80672 80193 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPS5 protein_id gnl|my_center|LOCUS_19900 81111 80824 gene locus_tag LOCUS_19910 81111 80824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 82292 81054 gene locus_tag LOCUS_19920 82292 81054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259268.1 protein_id gnl|my_center|LOCUS_19920 82350 83132 gene locus_tag LOCUS_19930 82350 83132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 83440 83093 gene locus_tag LOCUS_19940 83440 83093 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 protein_id gnl|my_center|LOCUS_19940 85797 83608 gene locus_tag LOCUS_19950 gene purL 85797 83608 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWI3 protein_id gnl|my_center|LOCUS_19950 86506 85871 gene locus_tag LOCUS_19960 86506 85871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence13 1116 88 gene locus_tag LOCUS_19970 1116 88 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972993.1 protein_id gnl|my_center|LOCUS_19970 1639 1034 gene locus_tag LOCUS_19980 1639 1034 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265652.1 protein_id gnl|my_center|LOCUS_19980 2014 1817 gene locus_tag LOCUS_19990 2014 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 2142 2226 gene locus_tag LOCUS_t00310 2142 2226 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2274 3890 gene locus_tag LOCUS_20000 gene tig 2274 3890 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y440 protein_id gnl|my_center|LOCUS_20000 4035 5012 gene locus_tag LOCUS_20010 4035 5012 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261984.1 protein_id gnl|my_center|LOCUS_20010 5102 5737 gene locus_tag LOCUS_20020 gene clpP2 5102 5737 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFY6 protein_id gnl|my_center|LOCUS_20020 5878 7146 gene locus_tag LOCUS_20030 gene clpX 5878 7146 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KG2 protein_id gnl|my_center|LOCUS_20030 7796 7512 gene locus_tag LOCUS_20040 7796 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 7765 10857 gene locus_tag LOCUS_20050 7765 10857 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640052.1 protein_id gnl|my_center|LOCUS_20050 11641 10910 gene locus_tag LOCUS_20060 gene mtgA 11641 10910 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYX9 protein_id gnl|my_center|LOCUS_20060 12924 11638 gene locus_tag LOCUS_20070 12924 11638 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086725.1 protein_id gnl|my_center|LOCUS_20070 13993 13079 gene locus_tag LOCUS_20080 gene rpoH 13993 13079 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW9 protein_id gnl|my_center|LOCUS_20080 15027 14071 gene locus_tag LOCUS_20090 15027 14071 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4T0 protein_id gnl|my_center|LOCUS_20090 15045 15446 gene locus_tag LOCUS_20100 15045 15446 CDS product Mov34/MPN/PAD-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388868.1 protein_id gnl|my_center|LOCUS_20100 15547 16194 gene locus_tag LOCUS_20110 15547 16194 CDS product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709264.1 protein_id gnl|my_center|LOCUS_20110 17264 16320 gene locus_tag LOCUS_20120 gene corC 17264 16320 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917943.1 protein_id gnl|my_center|LOCUS_20120 17788 17273 gene locus_tag LOCUS_20130 17788 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 18912 17911 gene locus_tag LOCUS_20140 18912 17911 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 protein_id gnl|my_center|LOCUS_20140 20363 19014 gene locus_tag LOCUS_20150 gene miaB 20363 19014 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF08 protein_id gnl|my_center|LOCUS_20150 21027 20371 gene locus_tag LOCUS_20160 21027 20371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 21580 21158 gene locus_tag LOCUS_20170 21580 21158 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917946.1 protein_id gnl|my_center|LOCUS_20170 22132 21704 gene locus_tag LOCUS_20180 22132 21704 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_20180 22723 22244 gene locus_tag LOCUS_20190 22723 22244 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIW9 protein_id gnl|my_center|LOCUS_20190 23349 22720 gene locus_tag LOCUS_20200 23349 22720 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_20200 24008 23433 gene locus_tag LOCUS_20210 24008 23433 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_20210 24106 24576 gene locus_tag LOCUS_20220 24106 24576 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037408.1 protein_id gnl|my_center|LOCUS_20220 24919 26301 gene locus_tag LOCUS_20230 24919 26301 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_20230 26435 29323 gene locus_tag LOCUS_20240 26435 29323 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920490.1 protein_id gnl|my_center|LOCUS_20240 29964 29362 gene locus_tag LOCUS_20250 29964 29362 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640067.1 protein_id gnl|my_center|LOCUS_20250 30080 31228 gene locus_tag LOCUS_20260 gene mexA 30080 31228 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037813.1 protein_id gnl|my_center|LOCUS_20260 31232 34384 gene locus_tag LOCUS_20270 gene acrB2 31232 34384 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918692.1 protein_id gnl|my_center|LOCUS_20270 34388 35788 gene locus_tag LOCUS_20280 gene oprM 34388 35788 CDS product outer membrane protein OprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51487 protein_id gnl|my_center|LOCUS_20280 35834 36325 gene locus_tag LOCUS_20290 gene ogt 35834 36325 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4X4 protein_id gnl|my_center|LOCUS_20290 36469 37248 gene locus_tag LOCUS_20300 36469 37248 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266208.1 protein_id gnl|my_center|LOCUS_20300 37339 38022 gene locus_tag LOCUS_20310 37339 38022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 38060 38761 gene locus_tag LOCUS_20320 gene modB 38060 38761 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158971.1 protein_id gnl|my_center|LOCUS_20320 38877 38801 gene locus_tag LOCUS_t00320 38877 38801 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39342 38965 gene locus_tag LOCUS_20330 39342 38965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 40084 39443 gene locus_tag LOCUS_20340 gene nth 40084 39443 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKH2 protein_id gnl|my_center|LOCUS_20340 40866 40102 gene locus_tag LOCUS_20350 gene dapB 40866 40102 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 protein_id gnl|my_center|LOCUS_20350 41654 40932 gene locus_tag LOCUS_20360 41654 40932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 42355 41606 gene locus_tag LOCUS_20370 42355 41606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 42476 44065 gene locus_tag LOCUS_20380 42476 44065 CDS product M28-family zinc peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265821.1 protein_id gnl|my_center|LOCUS_20380 44458 44072 gene locus_tag LOCUS_20390 44458 44072 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528522.1 protein_id gnl|my_center|LOCUS_20390 44667 45596 gene locus_tag LOCUS_20400 44667 45596 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWR2 protein_id gnl|my_center|LOCUS_20400 45598 46167 gene locus_tag LOCUS_20410 45598 46167 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_20410 46835 46326 gene locus_tag LOCUS_20420 46835 46326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 47520 46897 gene locus_tag LOCUS_20430 47520 46897 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_20430 48497 47523 gene locus_tag LOCUS_20440 gene glk 48497 47523 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8U7 protein_id gnl|my_center|LOCUS_20440 50450 48609 gene locus_tag LOCUS_20450 gene edd 50450 48609 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_20450 51846 50443 gene locus_tag LOCUS_20460 gene zwf 51846 50443 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D148 protein_id gnl|my_center|LOCUS_20460 52136 52220 gene locus_tag LOCUS_t00330 52136 52220 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 53609 52473 gene locus_tag LOCUS_20470 53609 52473 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J2 protein_id gnl|my_center|LOCUS_20470 53675 53938 gene locus_tag LOCUS_20480 53675 53938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 54066 54332 gene locus_tag LOCUS_20490 54066 54332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 54685 56421 gene locus_tag LOCUS_20500 54685 56421 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114720.1 protein_id gnl|my_center|LOCUS_20500 57270 56575 gene locus_tag LOCUS_20510 gene trmB 57270 56575 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WA4 protein_id gnl|my_center|LOCUS_20510 58405 57314 gene locus_tag LOCUS_20520 58405 57314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 59507 58581 gene locus_tag LOCUS_20530 59507 58581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 60796 59597 gene locus_tag LOCUS_20540 gene metK 60796 59597 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917940.1 protein_id gnl|my_center|LOCUS_20540 62509 60854 gene locus_tag LOCUS_20550 gene lnt 62509 60854 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WA1 protein_id gnl|my_center|LOCUS_20550 63146 62511 gene locus_tag LOCUS_20560 63146 62511 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_20560 63285 63527 gene locus_tag LOCUS_20570 63285 63527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 63734 64459 gene locus_tag LOCUS_20580 63734 64459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 64535 65185 gene locus_tag LOCUS_20590 64535 65185 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919946.1 protein_id gnl|my_center|LOCUS_20590 65345 65884 gene locus_tag LOCUS_20600 65345 65884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 65948 67270 gene locus_tag LOCUS_20610 65948 67270 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_20610 67823 67335 gene locus_tag LOCUS_20620 67823 67335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 68039 69358 gene locus_tag LOCUS_20630 68039 69358 CDS product DNA-packaging protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971281.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence14 187 747 gene locus_tag LOCUS_20640 187 747 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 protein_id gnl|my_center|LOCUS_20640 3140 966 gene locus_tag LOCUS_20650 3140 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_20650 4204 3296 gene locus_tag LOCUS_20660 4204 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 5529 4219 gene locus_tag LOCUS_20670 gene hfsI 5529 4219 CDS product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918387.1 protein_id gnl|my_center|LOCUS_20670 5857 6672 gene locus_tag LOCUS_20680 5857 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 8122 6746 gene locus_tag LOCUS_20690 8122 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 9007 8432 gene locus_tag LOCUS_20700 9007 8432 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265507.1 protein_id gnl|my_center|LOCUS_20700 9136 9933 gene locus_tag LOCUS_20710 9136 9933 CDS product UDP-hexose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972271.1 protein_id gnl|my_center|LOCUS_20710 10838 9867 gene locus_tag LOCUS_20720 10838 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 11956 11033 gene locus_tag LOCUS_20730 11956 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 12066 13388 gene locus_tag LOCUS_20740 12066 13388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 13560 14972 gene locus_tag LOCUS_20750 gene rsaFb 13560 14972 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919195.1 protein_id gnl|my_center|LOCUS_20750 15074 15385 gene locus_tag LOCUS_20760 15074 15385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 15578 15390 gene locus_tag LOCUS_20770 15578 15390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 17002 15734 gene locus_tag LOCUS_20780 17002 15734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 17268 17002 gene locus_tag LOCUS_20790 17268 17002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 17842 17354 gene locus_tag LOCUS_20800 17842 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 18139 18924 gene locus_tag LOCUS_20810 18139 18924 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RF8 protein_id gnl|my_center|LOCUS_20810 18931 20055 gene locus_tag LOCUS_20820 18931 20055 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_20820 20232 20714 gene locus_tag LOCUS_20830 20232 20714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 20905 20829 gene locus_tag LOCUS_t00340 20905 20829 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21108 21443 gene locus_tag LOCUS_20840 gene YajC 21108 21443 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 protein_id gnl|my_center|LOCUS_20840 21451 23049 gene locus_tag LOCUS_20850 gene secD 21451 23049 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L13 protein_id gnl|my_center|LOCUS_20850 23168 24151 gene locus_tag LOCUS_20860 23168 24151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 24241 24549 gene locus_tag LOCUS_20870 24241 24549 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919855.1 protein_id gnl|my_center|LOCUS_20870 24975 24559 gene locus_tag LOCUS_20880 24975 24559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 25218 25796 gene locus_tag LOCUS_20890 25218 25796 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265800.1 protein_id gnl|my_center|LOCUS_20890 25861 26799 gene locus_tag LOCUS_20900 25861 26799 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_20900 26926 27735 gene locus_tag LOCUS_20910 gene uppP 26926 27735 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4R5 protein_id gnl|my_center|LOCUS_20910 27901 29349 gene locus_tag LOCUS_20920 gene gltD 27901 29349 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921433.1 protein_id gnl|my_center|LOCUS_20920 29346 29882 gene locus_tag LOCUS_20930 29346 29882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 29879 34417 gene locus_tag LOCUS_20940 29879 34417 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_20940 34917 34423 gene locus_tag LOCUS_20950 34917 34423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 35087 35173 gene locus_tag LOCUS_t00350 35087 35173 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35339 35578 gene locus_tag LOCUS_20960 35339 35578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 35676 36215 gene locus_tag LOCUS_20970 35676 36215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166765.1 protein_id gnl|my_center|LOCUS_20970 36299 36562 gene locus_tag LOCUS_20980 36299 36562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 37597 36566 gene locus_tag LOCUS_20990 37597 36566 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085869.1 protein_id gnl|my_center|LOCUS_20990 38007 37597 gene locus_tag LOCUS_21000 38007 37597 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UJK4 protein_id gnl|my_center|LOCUS_21000 38356 38024 gene locus_tag LOCUS_21010 38356 38024 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971665.1 protein_id gnl|my_center|LOCUS_21010 39045 38827 gene locus_tag LOCUS_21020 39045 38827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 39107 39430 gene locus_tag LOCUS_21030 39107 39430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 39679 40047 gene locus_tag LOCUS_21040 gene rpsM 39679 40047 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F6 protein_id gnl|my_center|LOCUS_21040 40121 40510 gene locus_tag LOCUS_21050 gene rpsK 40121 40510 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8T0 protein_id gnl|my_center|LOCUS_21050 40630 41694 gene locus_tag LOCUS_21060 gene rpoA 40630 41694 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY4 protein_id gnl|my_center|LOCUS_21060 41864 42289 gene locus_tag LOCUS_21070 gene rplQ 41864 42289 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA8 protein_id gnl|my_center|LOCUS_21070 42390 44561 gene locus_tag LOCUS_21080 42390 44561 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_21080 44623 45201 gene locus_tag LOCUS_21090 44623 45201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 45211 45864 gene locus_tag LOCUS_21100 45211 45864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704137.1 protein_id gnl|my_center|LOCUS_21100 45892 47124 gene locus_tag LOCUS_21110 gene tetA 45892 47124 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086830.1 protein_id gnl|my_center|LOCUS_21110 47205 48764 gene locus_tag LOCUS_21120 gene guaA 47205 48764 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIL2 protein_id gnl|my_center|LOCUS_21120 49810 48794 gene locus_tag LOCUS_21130 49810 48794 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_21130 51876 49810 gene locus_tag LOCUS_21140 51876 49810 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921025.1 protein_id gnl|my_center|LOCUS_21140 53404 51878 gene locus_tag LOCUS_21150 gene ydiD 53404 51878 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553652.1 protein_id gnl|my_center|LOCUS_21150 54191 53397 gene locus_tag LOCUS_21160 54191 53397 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919165.1 protein_id gnl|my_center|LOCUS_21160 54522 54184 gene locus_tag LOCUS_21170 54522 54184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 55323 54526 gene locus_tag LOCUS_21180 55323 54526 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_21180 56072 55365 gene locus_tag LOCUS_21190 56072 55365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 56292 57494 gene locus_tag LOCUS_21200 56292 57494 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088203.1 protein_id gnl|my_center|LOCUS_21200 57491 58573 gene locus_tag LOCUS_21210 57491 58573 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_21210 58809 61526 gene locus_tag LOCUS_21220 58809 61526 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919497.1 protein_id gnl|my_center|LOCUS_21220 61618 62916 gene locus_tag LOCUS_21230 61618 62916 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_21230 62913 64397 gene locus_tag LOCUS_21240 62913 64397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 65251 64400 gene locus_tag LOCUS_21250 65251 64400 CDS product 3-alpha-hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224298.1 protein_id gnl|my_center|LOCUS_21250 66155 65157 gene locus_tag LOCUS_21260 66155 65157 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728212.1 protein_id gnl|my_center|LOCUS_21260 67334 66159 gene locus_tag LOCUS_21270 67334 66159 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090530.1 protein_id gnl|my_center|LOCUS_21270 <68516 67352 gene locus_tag LOCUS_21280 <68516 67352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090005.1:acyl-CoA dehydrogenase >Feature sequence15 195 1076 gene locus_tag LOCUS_21290 195 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 1132 1410 gene locus_tag LOCUS_21300 1132 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1530 1775 gene locus_tag LOCUS_21310 1530 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1887 3113 gene locus_tag LOCUS_21320 1887 3113 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_21320 3175 5166 gene locus_tag LOCUS_21330 3175 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 5998 5123 gene locus_tag LOCUS_21340 5998 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640162.1 protein_id gnl|my_center|LOCUS_21340 6729 6094 gene locus_tag LOCUS_21350 6729 6094 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_21350 8294 6726 gene locus_tag LOCUS_21360 8294 6726 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPV2 protein_id gnl|my_center|LOCUS_21360 9774 8416 gene locus_tag LOCUS_21370 gene gcvPA 9774 8416 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4V4 protein_id gnl|my_center|LOCUS_21370 10264 9893 gene locus_tag LOCUS_21380 gene gcvH 10264 9893 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I87 protein_id gnl|my_center|LOCUS_21380 11445 10294 gene locus_tag LOCUS_21390 11445 10294 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A351 protein_id gnl|my_center|LOCUS_21390 12923 11769 gene locus_tag LOCUS_21400 12923 11769 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8M8 protein_id gnl|my_center|LOCUS_21400 14758 12935 gene locus_tag LOCUS_21410 14758 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 16339 14918 gene locus_tag LOCUS_21420 16339 14918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 15254 15329 gene locus_tag LOCUS_t00360 15254 15329 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17734 16448 gene locus_tag LOCUS_21430 gene ftsA 17734 16448 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UB78 protein_id gnl|my_center|LOCUS_21430 18684 17740 gene locus_tag LOCUS_21440 18684 17740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 19639 18677 gene locus_tag LOCUS_21450 gene ddl 19639 18677 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92NM4 protein_id gnl|my_center|LOCUS_21450 20654 19782 gene locus_tag LOCUS_21460 gene murB 20654 19782 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5A7 protein_id gnl|my_center|LOCUS_21460 20875 20678 gene locus_tag LOCUS_21470 20875 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 22302 20875 gene locus_tag LOCUS_21480 gene murC 22302 20875 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UB84 protein_id gnl|my_center|LOCUS_21480 23643 22477 gene locus_tag LOCUS_21490 gene murG 23643 22477 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU4 protein_id gnl|my_center|LOCUS_21490 24842 23640 gene locus_tag LOCUS_21500 gene ftsW 24842 23640 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972054.1 protein_id gnl|my_center|LOCUS_21500 26275 24881 gene locus_tag LOCUS_21510 gene murD 26275 24881 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A597 protein_id gnl|my_center|LOCUS_21510 27345 26272 gene locus_tag LOCUS_21520 gene mraY 27345 26272 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEN2 protein_id gnl|my_center|LOCUS_21520 28736 27345 gene locus_tag LOCUS_21530 gene murF 28736 27345 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C9K8 protein_id gnl|my_center|LOCUS_21530 30306 28861 gene locus_tag LOCUS_21540 gene murE 30306 28861 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU2 protein_id gnl|my_center|LOCUS_21540 32009 30303 gene locus_tag LOCUS_21550 32009 30303 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_21550 32661 32011 gene locus_tag LOCUS_21560 32661 32011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 33617 32658 gene locus_tag LOCUS_21570 gene rsmH 33617 32658 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N3 protein_id gnl|my_center|LOCUS_21570 34111 33614 gene locus_tag LOCUS_21580 34111 33614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 35536 34352 gene locus_tag LOCUS_21590 35536 34352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 35922 35548 gene locus_tag LOCUS_21600 35922 35548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 36914 35919 gene locus_tag LOCUS_21610 gene cysK 36914 35919 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 protein_id gnl|my_center|LOCUS_21610 37072 38076 gene locus_tag LOCUS_21620 37072 38076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 38427 38555 gene locus_tag LOCUS_21630 38427 38555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 39407 38628 gene locus_tag LOCUS_21640 gene tatC 39407 38628 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KZ9 protein_id gnl|my_center|LOCUS_21640 39811 39404 gene locus_tag LOCUS_21650 39811 39404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 40095 39844 gene locus_tag LOCUS_21660 gene tatA 40095 39844 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKB6 protein_id gnl|my_center|LOCUS_21660 40716 40123 gene locus_tag LOCUS_21670 40716 40123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 41507 40713 gene locus_tag LOCUS_21680 41507 40713 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_21680 42720 41707 gene locus_tag LOCUS_21690 42720 41707 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087522.1 protein_id gnl|my_center|LOCUS_21690 43833 42778 gene locus_tag LOCUS_21700 43833 42778 CDS product vanillate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225964.1 protein_id gnl|my_center|LOCUS_21700 44468 43920 gene locus_tag LOCUS_21710 44468 43920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 45240 44518 gene locus_tag LOCUS_21720 45240 44518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 46989 45262 gene locus_tag LOCUS_21730 gene argS 46989 45262 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J281 protein_id gnl|my_center|LOCUS_21730 47851 47105 gene locus_tag LOCUS_21740 47851 47105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 47897 48856 gene locus_tag LOCUS_21750 gene ispH 47897 48856 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5X0 protein_id gnl|my_center|LOCUS_21750 48860 49837 gene locus_tag LOCUS_21760 gene thrB 48860 49837 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RG1 protein_id gnl|my_center|LOCUS_21760 49944 50393 gene locus_tag LOCUS_21770 gene rnhA 49944 50393 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHA7 protein_id gnl|my_center|LOCUS_21770 50539 51156 gene locus_tag LOCUS_21780 50539 51156 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920959.1 protein_id gnl|my_center|LOCUS_21780 51263 51826 gene locus_tag LOCUS_21790 51263 51826 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920756.1 protein_id gnl|my_center|LOCUS_21790 51919 53499 gene locus_tag LOCUS_21800 51919 53499 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389171.1 protein_id gnl|my_center|LOCUS_21800 54298 53732 gene locus_tag LOCUS_21810 54298 53732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 55611 54433 gene locus_tag LOCUS_21820 55611 54433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141024.1 protein_id gnl|my_center|LOCUS_21820 56483 55836 gene locus_tag LOCUS_21830 56483 55836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 57306 56707 gene locus_tag LOCUS_21840 gene rnhB 57306 56707 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_21840 58066 57299 gene locus_tag LOCUS_21850 58066 57299 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_21850 58287 58063 gene locus_tag LOCUS_21860 58287 58063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066610.1 protein_id gnl|my_center|LOCUS_21860 59640 58300 gene locus_tag LOCUS_21870 gene glmM 59640 58300 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9L9 protein_id gnl|my_center|LOCUS_21870 59725 61143 gene locus_tag LOCUS_21880 59725 61143 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031501.1 protein_id gnl|my_center|LOCUS_21880 61362 61180 gene locus_tag LOCUS_21890 61362 61180 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886I3 protein_id gnl|my_center|LOCUS_21890 61911 61441 gene locus_tag LOCUS_21900 61911 61441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 62797 61925 gene locus_tag LOCUS_21910 62797 61925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764776.1 protein_id gnl|my_center|LOCUS_21910 62913 63527 gene locus_tag LOCUS_21920 62913 63527 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104910.1 protein_id gnl|my_center|LOCUS_21920 63605 65836 gene locus_tag LOCUS_21930 63605 65836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence16 841 488 gene locus_tag LOCUS_21940 841 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563264.1 protein_id gnl|my_center|LOCUS_21940 2371 1010 gene locus_tag LOCUS_21950 2371 1010 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306363.1 protein_id gnl|my_center|LOCUS_21950 3164 2499 gene locus_tag LOCUS_21960 3164 2499 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_21960 3537 3199 gene locus_tag LOCUS_21970 3537 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 4359 3631 gene locus_tag LOCUS_21980 gene bp26 4359 3631 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037741.1 protein_id gnl|my_center|LOCUS_21980 4502 6400 gene locus_tag LOCUS_21990 4502 6400 CDS product elongation factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_21990 6544 7251 gene locus_tag LOCUS_22000 6544 7251 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_22000 7289 7834 gene locus_tag LOCUS_22010 gene btuE 7289 7834 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJH2 protein_id gnl|my_center|LOCUS_22010 7837 9144 gene locus_tag LOCUS_22020 7837 9144 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_22020 9266 9907 gene locus_tag LOCUS_22030 9266 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265992.1 protein_id gnl|my_center|LOCUS_22030 11947 10064 gene locus_tag LOCUS_22040 11947 10064 CDS product protease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EJP1 protein_id gnl|my_center|LOCUS_22040 12220 12906 gene locus_tag LOCUS_22050 gene gpmA 12220 12906 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYN6 protein_id gnl|my_center|LOCUS_22050 13087 13575 gene locus_tag LOCUS_22060 gene purE 13087 13575 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CC72 protein_id gnl|my_center|LOCUS_22060 13584 14654 gene locus_tag LOCUS_22070 gene purK 13584 14654 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ3 protein_id gnl|my_center|LOCUS_22070 14651 15163 gene locus_tag LOCUS_22080 gene folA 14651 15163 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G37 protein_id gnl|my_center|LOCUS_22080 15192 16016 gene locus_tag LOCUS_22090 15192 16016 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269056.1 protein_id gnl|my_center|LOCUS_22090 16094 17035 gene locus_tag LOCUS_22100 16094 17035 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_22100 17177 20092 gene locus_tag LOCUS_22110 gene ileS 17177 20092 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ34 protein_id gnl|my_center|LOCUS_22110 20202 20717 gene locus_tag LOCUS_22120 gene lspA 20202 20717 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEK8 protein_id gnl|my_center|LOCUS_22120 20714 21127 gene locus_tag LOCUS_22130 20714 21127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 23233 21314 gene locus_tag LOCUS_22140 gene dxs 23233 21314 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RW1 protein_id gnl|my_center|LOCUS_22140 23759 23292 gene locus_tag LOCUS_22150 23759 23292 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037815.1 protein_id gnl|my_center|LOCUS_22150 24130 23804 gene locus_tag LOCUS_22160 24130 23804 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919113.1 protein_id gnl|my_center|LOCUS_22160 25929 24127 gene locus_tag LOCUS_22170 gene kefB 25929 24127 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037333.1 protein_id gnl|my_center|LOCUS_22170 26351 25929 gene locus_tag LOCUS_22180 gene nifU 26351 25929 CDS product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719774.1 protein_id gnl|my_center|LOCUS_22180 26482 26931 gene locus_tag LOCUS_22190 26482 26931 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N76 protein_id gnl|my_center|LOCUS_22190 26928 28103 gene locus_tag LOCUS_22200 26928 28103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 protein_id gnl|my_center|LOCUS_22200 30193 28256 gene locus_tag LOCUS_22210 30193 28256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 30075 30401 gene locus_tag LOCUS_22220 30075 30401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 30419 30616 gene locus_tag LOCUS_22230 30419 30616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 32054 30744 gene locus_tag LOCUS_22240 32054 30744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 32110 32763 gene locus_tag LOCUS_22250 32110 32763 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_22250 32773 33027 gene locus_tag LOCUS_22260 gene moaD 32773 33027 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI4 protein_id gnl|my_center|LOCUS_22260 33039 33467 gene locus_tag LOCUS_22270 33039 33467 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390442.1 protein_id gnl|my_center|LOCUS_22270 34436 33510 gene locus_tag LOCUS_22280 34436 33510 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388087.1 protein_id gnl|my_center|LOCUS_22280 35249 34476 gene locus_tag LOCUS_22290 35249 34476 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UKF4 protein_id gnl|my_center|LOCUS_22290 35439 36152 gene locus_tag LOCUS_22300 35439 36152 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389782.1 protein_id gnl|my_center|LOCUS_22300 36152 36490 gene locus_tag LOCUS_22310 36152 36490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721547.1 protein_id gnl|my_center|LOCUS_22310 37591 36533 gene locus_tag LOCUS_22320 37591 36533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338941.1 protein_id gnl|my_center|LOCUS_22320 37730 38659 gene locus_tag LOCUS_22330 37730 38659 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 protein_id gnl|my_center|LOCUS_22330 39674 38796 gene locus_tag LOCUS_22340 39674 38796 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_22340 41748 39754 gene locus_tag LOCUS_22350 41748 39754 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TP86 protein_id gnl|my_center|LOCUS_22350 41887 42801 gene locus_tag LOCUS_22360 gene kdgK 41887 42801 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037562.1 protein_id gnl|my_center|LOCUS_22360 45826 43022 gene locus_tag LOCUS_22370 45826 43022 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254117.1 protein_id gnl|my_center|LOCUS_22370 45985 45912 gene locus_tag LOCUS_t00370 45985 45912 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 46569 46036 gene locus_tag LOCUS_22380 46569 46036 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082987.1 protein_id gnl|my_center|LOCUS_22380 47884 46559 gene locus_tag LOCUS_22390 47884 46559 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 protein_id gnl|my_center|LOCUS_22390 48579 47881 gene locus_tag LOCUS_22400 48579 47881 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Y02 protein_id gnl|my_center|LOCUS_22400 48893 48576 gene locus_tag LOCUS_22410 48893 48576 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531503.1 protein_id gnl|my_center|LOCUS_22410 49591 48947 gene locus_tag LOCUS_22420 49591 48947 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531504.1 protein_id gnl|my_center|LOCUS_22420 51615 49597 gene locus_tag LOCUS_22430 51615 49597 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531505.1 protein_id gnl|my_center|LOCUS_22430 52926 51787 gene locus_tag LOCUS_22440 gene cyoA 52926 51787 CDS product cytochrome ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976134.1 protein_id gnl|my_center|LOCUS_22440 53091 54425 gene locus_tag LOCUS_22450 53091 54425 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531507.1 protein_id gnl|my_center|LOCUS_22450 55302 54457 gene locus_tag LOCUS_22460 55302 54457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 56579 55308 gene locus_tag LOCUS_22470 56579 55308 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB5 protein_id gnl|my_center|LOCUS_22470 56689 57390 gene locus_tag LOCUS_22480 gene cobB 56689 57390 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKN9 protein_id gnl|my_center|LOCUS_22480 >Feature sequence17 739 428 gene locus_tag LOCUS_22490 739 428 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338944.1 protein_id gnl|my_center|LOCUS_22490 1002 745 gene locus_tag LOCUS_22500 1002 745 CDS product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338945.1 protein_id gnl|my_center|LOCUS_22500 2154 1141 gene locus_tag LOCUS_22510 2154 1141 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_22510 2295 3197 gene locus_tag LOCUS_22520 2295 3197 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267754.1 protein_id gnl|my_center|LOCUS_22520 3931 3260 gene locus_tag LOCUS_22530 gene fabG 3931 3260 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_22530 5404 3956 gene locus_tag LOCUS_22540 gene gabD 5404 3956 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187560.1 protein_id gnl|my_center|LOCUS_22540 5629 6672 gene locus_tag LOCUS_22550 5629 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 8486 7206 gene locus_tag LOCUS_22560 8486 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 9586 8567 gene locus_tag LOCUS_22570 9586 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 10722 9583 gene locus_tag LOCUS_22580 10722 9583 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368560.1 protein_id gnl|my_center|LOCUS_22580 12080 11355 gene locus_tag LOCUS_22590 12080 11355 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_22590 12067 12768 gene locus_tag LOCUS_22600 12067 12768 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724571.1 protein_id gnl|my_center|LOCUS_22600 12765 15278 gene locus_tag LOCUS_22610 12765 15278 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528822.1 protein_id gnl|my_center|LOCUS_22610 15389 16096 gene locus_tag LOCUS_22620 15389 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 16937 16101 gene locus_tag LOCUS_22630 16937 16101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 17348 16968 gene locus_tag LOCUS_22640 17348 16968 CDS product copper resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204068.1 protein_id gnl|my_center|LOCUS_22640 17493 17753 gene locus_tag LOCUS_22650 17493 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 17750 18190 gene locus_tag LOCUS_22660 17750 18190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 18187 18762 gene locus_tag LOCUS_22670 18187 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_22670 18769 20508 gene locus_tag LOCUS_22680 18769 20508 CDS product multicopper oxidase PcoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265648.1 protein_id gnl|my_center|LOCUS_22680 20505 21422 gene locus_tag LOCUS_22690 gene pcoB 20505 21422 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 protein_id gnl|my_center|LOCUS_22690 23067 21445 gene locus_tag LOCUS_22700 23067 21445 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529857.1 protein_id gnl|my_center|LOCUS_22700 23519 23067 gene locus_tag LOCUS_22710 23519 23067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 23990 23532 gene locus_tag LOCUS_22720 23990 23532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 25475 24000 gene locus_tag LOCUS_22730 25475 24000 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113043.1 protein_id gnl|my_center|LOCUS_22730 25688 26617 gene locus_tag LOCUS_22740 25688 26617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 26764 28065 gene locus_tag LOCUS_22750 26764 28065 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265814.1 protein_id gnl|my_center|LOCUS_22750 28799 28281 gene locus_tag LOCUS_22760 28799 28281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 29880 29005 gene locus_tag LOCUS_22770 29880 29005 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038431.1 protein_id gnl|my_center|LOCUS_22770 30517 29900 gene locus_tag LOCUS_22780 30517 29900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 32663 30561 gene locus_tag LOCUS_22790 32663 30561 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 protein_id gnl|my_center|LOCUS_22790 33039 34328 gene locus_tag LOCUS_22800 33039 34328 CDS product 4-hydroxybenzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731479.1 protein_id gnl|my_center|LOCUS_22800 34321 36624 gene locus_tag LOCUS_22810 34321 36624 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085450.1 protein_id gnl|my_center|LOCUS_22810 36813 39149 gene locus_tag LOCUS_22820 36813 39149 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085452.1 protein_id gnl|my_center|LOCUS_22820 39253 40239 gene locus_tag LOCUS_22830 39253 40239 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976557.1 protein_id gnl|my_center|LOCUS_22830 40391 42679 gene locus_tag LOCUS_22840 40391 42679 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_22840 44035 42887 gene locus_tag LOCUS_22850 44035 42887 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820761.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence18 508 128 gene locus_tag LOCUS_22860 508 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 677 949 gene locus_tag LOCUS_22870 gene xseB 677 949 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RW0 protein_id gnl|my_center|LOCUS_22870 946 1869 gene locus_tag LOCUS_22880 946 1869 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 protein_id gnl|my_center|LOCUS_22880 1875 2387 gene locus_tag LOCUS_22890 gene coaD 1875 2387 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GVE7 protein_id gnl|my_center|LOCUS_22890 2468 3187 gene locus_tag LOCUS_22900 2468 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3307 4335 gene locus_tag LOCUS_22910 gene queA 3307 4335 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXQ9 protein_id gnl|my_center|LOCUS_22910 4380 4958 gene locus_tag LOCUS_22920 4380 4958 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_22920 5842 4955 gene locus_tag LOCUS_22930 5842 4955 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113868.1 protein_id gnl|my_center|LOCUS_22930 5944 7053 gene locus_tag LOCUS_22940 gene adhC 5944 7053 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GY0 protein_id gnl|my_center|LOCUS_22940 7068 7451 gene locus_tag LOCUS_22950 7068 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 7457 8302 gene locus_tag LOCUS_22960 7457 8302 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89H09 protein_id gnl|my_center|LOCUS_22960 8299 8694 gene locus_tag LOCUS_22970 8299 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 protein_id gnl|my_center|LOCUS_22970 10720 8873 gene locus_tag LOCUS_22980 gene ilvD 10720 8873 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H367 protein_id gnl|my_center|LOCUS_22980 10827 11702 gene locus_tag LOCUS_22990 10827 11702 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920881.1 protein_id gnl|my_center|LOCUS_22990 11764 12552 gene locus_tag LOCUS_23000 11764 12552 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_23000 12556 13281 gene locus_tag LOCUS_23010 12556 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113852.1 protein_id gnl|my_center|LOCUS_23010 14922 13393 gene locus_tag LOCUS_23020 14922 13393 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_23020 16876 14924 gene locus_tag LOCUS_23030 16876 14924 CDS product rotamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919760.1 protein_id gnl|my_center|LOCUS_23030 17046 17786 gene locus_tag LOCUS_23040 gene tpiA 17046 17786 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5I0 protein_id gnl|my_center|LOCUS_23040 17972 18328 gene locus_tag LOCUS_23050 17972 18328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 18419 20050 gene locus_tag LOCUS_23060 gene pyrG 18419 20050 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEY5 protein_id gnl|my_center|LOCUS_23060 21275 20142 gene locus_tag LOCUS_23070 gene yliI 21275 20142 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038894.1 protein_id gnl|my_center|LOCUS_23070 21545 22069 gene locus_tag LOCUS_23080 gene rimP 21545 22069 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYN8 protein_id gnl|my_center|LOCUS_23080 22081 23679 gene locus_tag LOCUS_23090 gene nusA 22081 23679 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLU9 protein_id gnl|my_center|LOCUS_23090 23686 23922 gene locus_tag LOCUS_23100 23686 23922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 23986 24699 gene locus_tag LOCUS_23110 23986 24699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 24710 27316 gene locus_tag LOCUS_23120 24710 27316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 27364 27762 gene locus_tag LOCUS_23130 gene rbfA 27364 27762 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WB0 protein_id gnl|my_center|LOCUS_23130 27858 28757 gene locus_tag LOCUS_23140 27858 28757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 28767 29345 gene locus_tag LOCUS_23150 gene tdk 28767 29345 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QJ8 protein_id gnl|my_center|LOCUS_23150 29378 30304 gene locus_tag LOCUS_23160 gene truB 29378 30304 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5T2 protein_id gnl|my_center|LOCUS_23160 30305 30574 gene locus_tag LOCUS_23170 gene rpsO 30305 30574 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF33 protein_id gnl|my_center|LOCUS_23170 30873 33209 gene locus_tag LOCUS_23180 gene pnp 30873 33209 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC32 protein_id gnl|my_center|LOCUS_23180 33358 34377 gene locus_tag LOCUS_23190 gene narX 33358 34377 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921034.1 protein_id gnl|my_center|LOCUS_23190 34434 35219 gene locus_tag LOCUS_23200 gene bamD 34434 35219 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8V9 protein_id gnl|my_center|LOCUS_23200 35271 36935 gene locus_tag LOCUS_23210 35271 36935 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV4 protein_id gnl|my_center|LOCUS_23210 37000 37353 gene locus_tag LOCUS_23220 37000 37353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 37406 39517 gene locus_tag LOCUS_23230 gene ligA 37406 39517 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV5 protein_id gnl|my_center|LOCUS_23230 39938 39546 gene locus_tag LOCUS_23240 39938 39546 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088578.1 protein_id gnl|my_center|LOCUS_23240 40044 40655 gene locus_tag LOCUS_23250 40044 40655 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390275.1 protein_id gnl|my_center|LOCUS_23250 41546 40677 gene locus_tag LOCUS_23260 gene yghU 41546 40677 CDS product disulfide-bond oxidoreductase YghU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46845 protein_id gnl|my_center|LOCUS_23260 >Feature sequence19 1629 3254 gene locus_tag LOCUS_23270 1629 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 4018 3239 gene locus_tag LOCUS_23280 4018 3239 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJ92 protein_id gnl|my_center|LOCUS_23280 5177 4149 gene locus_tag LOCUS_23290 5177 4149 CDS product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_23290 5281 5559 gene locus_tag LOCUS_23300 5281 5559 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709705.1 protein_id gnl|my_center|LOCUS_23300 6453 5560 gene locus_tag LOCUS_23310 6453 5560 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200991.1 protein_id gnl|my_center|LOCUS_23310 7190 6558 gene locus_tag LOCUS_23320 gene cycW 7190 6558 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30964 protein_id gnl|my_center|LOCUS_23320 7813 7202 gene locus_tag LOCUS_23330 gene ccmA 7813 7202 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF0 protein_id gnl|my_center|LOCUS_23330 8343 7810 gene locus_tag LOCUS_23340 8343 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 8258 8545 gene locus_tag LOCUS_23350 8258 8545 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WZ6 protein_id gnl|my_center|LOCUS_23350 8778 8569 gene locus_tag LOCUS_23360 8778 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 8680 9000 gene locus_tag LOCUS_23370 8680 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 11399 9066 gene locus_tag LOCUS_23380 11399 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 12179 11442 gene locus_tag LOCUS_23390 12179 11442 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338250.1 protein_id gnl|my_center|LOCUS_23390 12197 13594 gene locus_tag LOCUS_23400 gene radA 12197 13594 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD4 protein_id gnl|my_center|LOCUS_23400 13606 14118 gene locus_tag LOCUS_23410 13606 14118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 15056 14142 gene locus_tag LOCUS_23420 15056 14142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_708793.1 protein_id gnl|my_center|LOCUS_23420 16188 15061 gene locus_tag LOCUS_23430 gene proB 16188 15061 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9Y0 protein_id gnl|my_center|LOCUS_23430 17419 16301 gene locus_tag LOCUS_23440 gene obg 17419 16301 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X89 protein_id gnl|my_center|LOCUS_23440 18070 17492 gene locus_tag LOCUS_23450 18070 17492 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640214.1 protein_id gnl|my_center|LOCUS_23450 18174 19019 gene locus_tag LOCUS_23460 18174 19019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919221.1 protein_id gnl|my_center|LOCUS_23460 19016 19582 gene locus_tag LOCUS_23470 19016 19582 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529300.1 protein_id gnl|my_center|LOCUS_23470 19579 20121 gene locus_tag LOCUS_23480 19579 20121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972976.1 protein_id gnl|my_center|LOCUS_23480 20683 20108 gene locus_tag LOCUS_23490 20683 20108 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918206.1 protein_id gnl|my_center|LOCUS_23490 21225 20956 gene locus_tag LOCUS_23500 gene rpmA 21225 20956 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV3 protein_id gnl|my_center|LOCUS_23500 21623 21258 gene locus_tag LOCUS_23510 gene rplU 21623 21258 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDV2 protein_id gnl|my_center|LOCUS_23510 21804 22205 gene locus_tag LOCUS_23520 21804 22205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 22431 24068 gene locus_tag LOCUS_23530 22431 24068 CDS product potassium efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114136.1 protein_id gnl|my_center|LOCUS_23530 25603 24065 gene locus_tag LOCUS_23540 gene phrB 25603 24065 CDS product (6-4) photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CH39 protein_id gnl|my_center|LOCUS_23540 25432 25502 gene locus_tag LOCUS_t00380 25432 25502 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 27695 25869 gene locus_tag LOCUS_23550 gene deaD 27695 25869 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088310.1 protein_id gnl|my_center|LOCUS_23550 28678 27980 gene locus_tag LOCUS_23560 gene rplA 28678 27980 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QI0 protein_id gnl|my_center|LOCUS_23560 29114 28683 gene locus_tag LOCUS_23570 gene rplK 29114 28683 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAF9 protein_id gnl|my_center|LOCUS_23570 29868 29332 gene locus_tag LOCUS_23580 gene nusG 29868 29332 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCY8 protein_id gnl|my_center|LOCUS_23580 30114 29908 gene locus_tag LOCUS_23590 30114 29908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 30360 30285 gene locus_tag LOCUS_t00390 30360 30285 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 31331 30414 gene locus_tag LOCUS_23600 31331 30414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 32620 31397 gene locus_tag LOCUS_23610 gene pyrC 32620 31397 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K18 protein_id gnl|my_center|LOCUS_23610 33733 32738 gene locus_tag LOCUS_23620 gene pyrB 33733 32738 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ49 protein_id gnl|my_center|LOCUS_23620 35464 33854 gene locus_tag LOCUS_23630 35464 33854 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_23630 36621 35461 gene locus_tag LOCUS_23640 36621 35461 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 protein_id gnl|my_center|LOCUS_23640 37675 36689 gene locus_tag LOCUS_23650 37675 36689 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919530.1 protein_id gnl|my_center|LOCUS_23650 37771 38529 gene locus_tag LOCUS_23660 37771 38529 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_23660 39433 38516 gene locus_tag LOCUS_23670 39433 38516 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097200.1 protein_id gnl|my_center|LOCUS_23670 39822 39508 gene locus_tag LOCUS_23680 39822 39508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 40372 39893 gene locus_tag LOCUS_23690 40372 39893 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 protein_id gnl|my_center|LOCUS_23690 40697 40771 gene locus_tag LOCUS_t00400 40697 40771 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence20 387 55 gene locus_tag LOCUS_23700 387 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1106 384 gene locus_tag LOCUS_23710 1106 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338238.1 protein_id gnl|my_center|LOCUS_23710 1516 1103 gene locus_tag LOCUS_23720 1516 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720621.1 protein_id gnl|my_center|LOCUS_23720 2808 1594 gene locus_tag LOCUS_23730 2808 1594 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_23730 3048 2973 gene locus_tag LOCUS_t00410 3048 2973 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3237 4589 gene locus_tag LOCUS_23740 3237 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 4877 6103 gene locus_tag LOCUS_23750 4877 6103 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887566.1 protein_id gnl|my_center|LOCUS_23750 6726 6223 gene locus_tag LOCUS_23760 6726 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 7262 6723 gene locus_tag LOCUS_23770 7262 6723 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709012.1 protein_id gnl|my_center|LOCUS_23770 7372 7791 gene locus_tag LOCUS_23780 7372 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071321.1 protein_id gnl|my_center|LOCUS_23780 8860 7889 gene locus_tag LOCUS_23790 8860 7889 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919550.1 protein_id gnl|my_center|LOCUS_23790 10403 9144 gene locus_tag LOCUS_23800 gene fabF 10403 9144 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV7 protein_id gnl|my_center|LOCUS_23800 10817 10584 gene locus_tag LOCUS_23810 gene acpP 10817 10584 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC3 protein_id gnl|my_center|LOCUS_23810 11024 12265 gene locus_tag LOCUS_23820 11024 12265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 12959 12219 gene locus_tag LOCUS_23830 12959 12219 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919547.1 protein_id gnl|my_center|LOCUS_23830 13761 12961 gene locus_tag LOCUS_23840 13761 12961 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925927.1 protein_id gnl|my_center|LOCUS_23840 14693 13758 gene locus_tag LOCUS_23850 14693 13758 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC5 protein_id gnl|my_center|LOCUS_23850 14873 16315 gene locus_tag LOCUS_23860 14873 16315 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_23860 16315 17799 gene locus_tag LOCUS_23870 16315 17799 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971885.1 protein_id gnl|my_center|LOCUS_23870 17805 18506 gene locus_tag LOCUS_23880 17805 18506 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 protein_id gnl|my_center|LOCUS_23880 18697 19902 gene locus_tag LOCUS_23890 18697 19902 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 protein_id gnl|my_center|LOCUS_23890 20101 20505 gene locus_tag LOCUS_23900 20101 20505 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975848.1 protein_id gnl|my_center|LOCUS_23900 20668 21057 gene locus_tag LOCUS_23910 20668 21057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 22477 21077 gene locus_tag LOCUS_23920 22477 21077 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705189.1 protein_id gnl|my_center|LOCUS_23920 22753 23184 gene locus_tag LOCUS_23930 22753 23184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 23198 23422 gene locus_tag LOCUS_23940 gene rpsR 23198 23422 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q2 protein_id gnl|my_center|LOCUS_23940 23436 24035 gene locus_tag LOCUS_23950 gene rplI 23436 24035 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q3 protein_id gnl|my_center|LOCUS_23950 24481 24305 gene locus_tag LOCUS_23960 24481 24305 CDS product DUF1508 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920802.1 protein_id gnl|my_center|LOCUS_23960 25609 24506 gene locus_tag LOCUS_23970 25609 24506 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975701.1 protein_id gnl|my_center|LOCUS_23970 26589 25606 gene locus_tag LOCUS_23980 26589 25606 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529715.1 protein_id gnl|my_center|LOCUS_23980 26610 27074 gene locus_tag LOCUS_23990 26610 27074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 27139 28149 gene locus_tag LOCUS_24000 27139 28149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 28160 29644 gene locus_tag LOCUS_24010 28160 29644 CDS product fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937576.1 protein_id gnl|my_center|LOCUS_24010 29661 30305 gene locus_tag LOCUS_24020 29661 30305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 30307 31602 gene locus_tag LOCUS_24030 gene ctpF 30307 31602 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084254.1 protein_id gnl|my_center|LOCUS_24030 31656 32654 gene locus_tag LOCUS_24040 31656 32654 CDS product secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920778.1 protein_id gnl|my_center|LOCUS_24040 32670 33659 gene locus_tag LOCUS_24050 32670 33659 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968386.1 protein_id gnl|my_center|LOCUS_24050 33791 34207 gene locus_tag LOCUS_24060 33791 34207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090502.1 protein_id gnl|my_center|LOCUS_24060 35026 34337 gene locus_tag LOCUS_24070 35026 34337 CDS product racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461579.1 protein_id gnl|my_center|LOCUS_24070 36564 35143 gene locus_tag LOCUS_24080 36564 35143 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEU9 protein_id gnl|my_center|LOCUS_24080 36848 36564 gene locus_tag LOCUS_24090 36848 36564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 37206 36850 gene locus_tag LOCUS_24100 37206 36850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640587.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence21 739 98 gene locus_tag LOCUS_24110 739 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 1131 3530 gene locus_tag LOCUS_24120 1131 3530 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114997.1 protein_id gnl|my_center|LOCUS_24120 3871 6384 gene locus_tag LOCUS_24130 3871 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 6386 7648 gene locus_tag LOCUS_24140 6386 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 7645 9579 gene locus_tag LOCUS_24150 7645 9579 CDS product alpha-1,2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108864.1 protein_id gnl|my_center|LOCUS_24150 9576 10781 gene locus_tag LOCUS_24160 9576 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920762.1 protein_id gnl|my_center|LOCUS_24160 11055 13832 gene locus_tag LOCUS_24170 gene malA 11055 13832 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 protein_id gnl|my_center|LOCUS_24170 14941 13919 gene locus_tag LOCUS_24180 gene malR 14941 13919 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072259.1 protein_id gnl|my_center|LOCUS_24180 15110 16969 gene locus_tag LOCUS_24190 15110 16969 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265787.1 protein_id gnl|my_center|LOCUS_24190 16966 18576 gene locus_tag LOCUS_24200 16966 18576 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640457.1 protein_id gnl|my_center|LOCUS_24200 18573 20630 gene locus_tag LOCUS_24210 gene aglA 18573 20630 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 protein_id gnl|my_center|LOCUS_24210 20773 22269 gene locus_tag LOCUS_24220 20773 22269 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920144.1 protein_id gnl|my_center|LOCUS_24220 24521 22305 gene locus_tag LOCUS_24230 24521 22305 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969651.1 protein_id gnl|my_center|LOCUS_24230 25624 24530 gene locus_tag LOCUS_24240 25624 24530 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975037.1 protein_id gnl|my_center|LOCUS_24240 25925 26755 gene locus_tag LOCUS_24250 gene rlmJ 25925 26755 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZW8 protein_id gnl|my_center|LOCUS_24250 26796 28094 gene locus_tag LOCUS_24260 26796 28094 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389104.1 protein_id gnl|my_center|LOCUS_24260 30286 28163 gene locus_tag LOCUS_24270 30286 28163 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265515.1 protein_id gnl|my_center|LOCUS_24270 31004 30513 gene locus_tag LOCUS_24280 31004 30513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 32334 31015 gene locus_tag LOCUS_24290 32334 31015 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 protein_id gnl|my_center|LOCUS_24290 33002 32331 gene locus_tag LOCUS_24300 33002 32331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 33330 35309 gene locus_tag LOCUS_24310 33330 35309 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931283.1 protein_id gnl|my_center|LOCUS_24310 35432 36088 gene locus_tag LOCUS_24320 35432 36088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415118.1 protein_id gnl|my_center|LOCUS_24320 36554 36150 gene locus_tag LOCUS_24330 36554 36150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 36640 36933 gene locus_tag LOCUS_24340 36640 36933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence22 686 81 gene locus_tag LOCUS_24350 686 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 937 692 gene locus_tag LOCUS_24360 937 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 1070 1264 gene locus_tag LOCUS_24370 1070 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 1266 1526 gene locus_tag LOCUS_24380 1266 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2783 1866 gene locus_tag LOCUS_24390 2783 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 2903 3898 gene locus_tag LOCUS_24400 2903 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 4254 3952 gene locus_tag LOCUS_24410 4254 3952 CDS product polyhydroxyalkanoic acid system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640665.1 protein_id gnl|my_center|LOCUS_24410 4547 5071 gene locus_tag LOCUS_24420 4547 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 5249 5614 gene locus_tag LOCUS_24430 5249 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 5611 5874 gene locus_tag LOCUS_24440 5611 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 5867 6280 gene locus_tag LOCUS_24450 5867 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 6297 6893 gene locus_tag LOCUS_24460 6297 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 7721 7371 gene locus_tag LOCUS_24470 7721 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 8060 7767 gene locus_tag LOCUS_24480 8060 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 8094 9392 gene locus_tag LOCUS_24490 8094 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 9377 10150 gene locus_tag LOCUS_24500 9377 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 10256 10035 gene locus_tag LOCUS_24510 10256 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 10410 11081 gene locus_tag LOCUS_24520 10410 11081 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8L6 protein_id gnl|my_center|LOCUS_24520 11116 11853 gene locus_tag LOCUS_24530 11116 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708096.1 protein_id gnl|my_center|LOCUS_24530 12363 12178 gene locus_tag LOCUS_24540 12363 12178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 12704 13093 gene locus_tag LOCUS_24550 12704 13093 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090087.1 protein_id gnl|my_center|LOCUS_24550 13729 13196 gene locus_tag LOCUS_24560 13729 13196 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919545.1 protein_id gnl|my_center|LOCUS_24560 14142 13753 gene locus_tag LOCUS_24570 14142 13753 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061392.1 protein_id gnl|my_center|LOCUS_24570 14248 14721 gene locus_tag LOCUS_24580 14248 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 14761 15834 gene locus_tag LOCUS_24590 gene recF 14761 15834 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT0 protein_id gnl|my_center|LOCUS_24590 15979 16485 gene locus_tag LOCUS_24600 15979 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 16590 17315 gene locus_tag LOCUS_24610 16590 17315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 17615 17340 gene locus_tag LOCUS_24620 17615 17340 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920053.1 protein_id gnl|my_center|LOCUS_24620 18006 17716 gene locus_tag LOCUS_24630 18006 17716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 19358 18117 gene locus_tag LOCUS_24640 19358 18117 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707409.1 protein_id gnl|my_center|LOCUS_24640 20136 19390 gene locus_tag LOCUS_24650 20136 19390 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531947.1 protein_id gnl|my_center|LOCUS_24650 20855 20133 gene locus_tag LOCUS_24660 20855 20133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708148.1 protein_id gnl|my_center|LOCUS_24660 21174 21680 gene locus_tag LOCUS_24670 21174 21680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 22159 21737 gene locus_tag LOCUS_24680 22159 21737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_24680 23514 22234 gene locus_tag LOCUS_24690 gene rlmN 23514 22234 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X03 protein_id gnl|my_center|LOCUS_24690 24038 23550 gene locus_tag LOCUS_24700 24038 23550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 24210 25322 gene locus_tag LOCUS_24710 24210 25322 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI8 protein_id gnl|my_center|LOCUS_24710 25469 28039 gene locus_tag LOCUS_24720 25469 28039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 28147 28353 gene locus_tag LOCUS_24730 28147 28353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 28823 28419 gene locus_tag LOCUS_24740 28823 28419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 31677 28918 gene locus_tag LOCUS_24750 31677 28918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 32334 31939 gene locus_tag LOCUS_24760 32334 31939 CDS product death-on-curing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 protein_id gnl|my_center|LOCUS_24760 32579 32334 gene locus_tag LOCUS_24770 32579 32334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence23 876 106 gene locus_tag LOCUS_24780 876 106 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGP9 protein_id gnl|my_center|LOCUS_24780 1805 873 gene locus_tag LOCUS_24790 1805 873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_24790 2508 1879 gene locus_tag LOCUS_24800 2508 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533904.1 protein_id gnl|my_center|LOCUS_24800 3528 2626 gene locus_tag LOCUS_24810 3528 2626 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821371.1 protein_id gnl|my_center|LOCUS_24810 3637 5133 gene locus_tag LOCUS_24820 gene iolA 3637 5133 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640198.1 protein_id gnl|my_center|LOCUS_24820 5475 5215 gene locus_tag LOCUS_24830 5475 5215 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088373.1 protein_id gnl|my_center|LOCUS_24830 5362 5589 gene locus_tag LOCUS_24840 5362 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 5594 6739 gene locus_tag LOCUS_24850 5594 6739 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640215.1 protein_id gnl|my_center|LOCUS_24850 6914 7972 gene locus_tag LOCUS_24860 6914 7972 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919229.1 protein_id gnl|my_center|LOCUS_24860 8127 9011 gene locus_tag LOCUS_24870 8127 9011 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389586.1 protein_id gnl|my_center|LOCUS_24870 10262 9057 gene locus_tag LOCUS_24880 10262 9057 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640575.1 protein_id gnl|my_center|LOCUS_24880 12655 10280 gene locus_tag LOCUS_24890 12655 10280 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921265.1 protein_id gnl|my_center|LOCUS_24890 13661 12885 gene locus_tag LOCUS_24900 13661 12885 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_24900 14583 13747 gene locus_tag LOCUS_24910 14583 13747 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918305.1 protein_id gnl|my_center|LOCUS_24910 15185 14580 gene locus_tag LOCUS_24920 gene folE 15185 14580 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR9 protein_id gnl|my_center|LOCUS_24920 15419 15943 gene locus_tag LOCUS_24930 15419 15943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267648.1 protein_id gnl|my_center|LOCUS_24930 17482 15944 gene locus_tag LOCUS_24940 17482 15944 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710032.1 protein_id gnl|my_center|LOCUS_24940 17787 18995 gene locus_tag LOCUS_24950 17787 18995 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_24950 19196 18996 gene locus_tag LOCUS_24960 19196 18996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 19114 21291 gene locus_tag LOCUS_24970 19114 21291 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_24970 21358 22356 gene locus_tag LOCUS_24980 gene galE 21358 22356 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088672.1 protein_id gnl|my_center|LOCUS_24980 22356 22832 gene locus_tag LOCUS_24990 22356 22832 CDS product cys-tRNA(pro)/cys-tRNA(cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086914.1 protein_id gnl|my_center|LOCUS_24990 22837 23526 gene locus_tag LOCUS_25000 gene pgl 22837 23526 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_25000 24109 23600 gene locus_tag LOCUS_25010 24109 23600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 24552 24298 gene locus_tag LOCUS_25020 24552 24298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 24847 24635 gene locus_tag LOCUS_25030 24847 24635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 24982 26094 gene locus_tag LOCUS_25040 24982 26094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 26100 26843 gene locus_tag LOCUS_25050 26100 26843 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_25050 27264 26932 gene locus_tag LOCUS_25060 27264 26932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 28131 31052 gene locus_tag LOCUS_25070 gene uvrA 28131 31052 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTJ3 protein_id gnl|my_center|LOCUS_25070 31305 32507 gene locus_tag LOCUS_25080 31305 32507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence24 72 1067 gene locus_tag LOCUS_25090 gene prmA 72 1067 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F3 protein_id gnl|my_center|LOCUS_25090 1078 1800 gene locus_tag LOCUS_25100 1078 1800 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769615.1 protein_id gnl|my_center|LOCUS_25100 2411 1920 gene locus_tag LOCUS_25110 gene ruvC 2411 1920 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F5 protein_id gnl|my_center|LOCUS_25110 3333 2590 gene locus_tag LOCUS_25120 3333 2590 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9K1 protein_id gnl|my_center|LOCUS_25120 3730 3404 gene locus_tag LOCUS_25130 3730 3404 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLD9 protein_id gnl|my_center|LOCUS_25130 4074 3832 gene locus_tag LOCUS_25140 4074 3832 CDS product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89EF0 protein_id gnl|my_center|LOCUS_25140 4416 4117 gene locus_tag LOCUS_25150 4416 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919372.1 protein_id gnl|my_center|LOCUS_25150 4547 6001 gene locus_tag LOCUS_25160 4547 6001 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI0 protein_id gnl|my_center|LOCUS_25160 7044 5998 gene locus_tag LOCUS_25170 gene hemN 7044 5998 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310172.1 protein_id gnl|my_center|LOCUS_25170 7184 7861 gene locus_tag LOCUS_25180 7184 7861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 8518 7889 gene locus_tag LOCUS_25190 8518 7889 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_25190 9333 8617 gene locus_tag LOCUS_25200 gene rph 9333 8617 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP2 protein_id gnl|my_center|LOCUS_25200 9459 9932 gene locus_tag LOCUS_25210 9459 9932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206923.1 protein_id gnl|my_center|LOCUS_25210 9988 11034 gene locus_tag LOCUS_25220 gene hrcA 9988 11034 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXP3 protein_id gnl|my_center|LOCUS_25220 11031 11582 gene locus_tag LOCUS_25230 11031 11582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 11657 12898 gene locus_tag LOCUS_25240 11657 12898 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_25240 12991 13620 gene locus_tag LOCUS_25250 12991 13620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 13625 13903 gene locus_tag LOCUS_25260 13625 13903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531327.1 protein_id gnl|my_center|LOCUS_25260 15070 13940 gene locus_tag LOCUS_25270 15070 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106235.1 protein_id gnl|my_center|LOCUS_25270 15666 15067 gene locus_tag LOCUS_25280 15666 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 15866 15991 gene locus_tag LOCUS_25290 gene rpmJ 15866 15991 CDS product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIL5 protein_id gnl|my_center|LOCUS_25290 17759 16233 gene locus_tag LOCUS_25300 17759 16233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 18133 17756 gene locus_tag LOCUS_25310 18133 17756 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921336.1 protein_id gnl|my_center|LOCUS_25310 18822 18490 gene locus_tag LOCUS_25320 gene grlA 18822 18490 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IC8 protein_id gnl|my_center|LOCUS_25320 19113 18880 gene locus_tag LOCUS_25330 19113 18880 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088461.1 protein_id gnl|my_center|LOCUS_25330 19462 19124 gene locus_tag LOCUS_25340 19462 19124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920348.1 protein_id gnl|my_center|LOCUS_25340 20113 19505 gene locus_tag LOCUS_25350 gene leuD 20113 19505 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZJ0 protein_id gnl|my_center|LOCUS_25350 21674 20223 gene locus_tag LOCUS_25360 gene leuC 21674 20223 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L76 protein_id gnl|my_center|LOCUS_25360 22451 21765 gene locus_tag LOCUS_25370 22451 21765 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532554.1 protein_id gnl|my_center|LOCUS_25370 22649 24457 gene locus_tag LOCUS_25380 22649 24457 CDS product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919880.1 protein_id gnl|my_center|LOCUS_25380 26259 24664 gene locus_tag LOCUS_25390 26259 24664 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707978.1 protein_id gnl|my_center|LOCUS_25390 26402 27799 gene locus_tag LOCUS_25400 26402 27799 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707979.1 protein_id gnl|my_center|LOCUS_25400 27990 27796 gene locus_tag LOCUS_25410 27990 27796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 29066 28128 gene locus_tag LOCUS_25420 29066 28128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 29664 29203 gene locus_tag LOCUS_25430 29664 29203 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974220.1 protein_id gnl|my_center|LOCUS_25430 30152 29661 gene locus_tag LOCUS_25440 30152 29661 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 protein_id gnl|my_center|LOCUS_25440 30946 30149 gene locus_tag LOCUS_25450 30946 30149 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530891.1 protein_id gnl|my_center|LOCUS_25450 31331 30969 gene locus_tag LOCUS_25460 gene ybaA 31331 30969 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878140.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence25 1388 36 gene locus_tag LOCUS_25470 1388 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1574 1969 gene locus_tag LOCUS_25480 gene sdhC 1574 1969 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_25480 1969 2358 gene locus_tag LOCUS_25490 1969 2358 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_25490 2358 4160 gene locus_tag LOCUS_25500 gene sdhA 2358 4160 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6R5 protein_id gnl|my_center|LOCUS_25500 4392 5573 gene locus_tag LOCUS_25510 4392 5573 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228095.1 protein_id gnl|my_center|LOCUS_25510 6024 5554 gene locus_tag LOCUS_25520 6024 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 6509 6021 gene locus_tag LOCUS_25530 6509 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 6685 8583 gene locus_tag LOCUS_25540 gene dnaK 6685 8583 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TER2 protein_id gnl|my_center|LOCUS_25540 8651 9784 gene locus_tag LOCUS_25550 gene dnaJ 8651 9784 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50018 protein_id gnl|my_center|LOCUS_25550 11148 9871 gene locus_tag LOCUS_25560 11148 9871 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640670.1 protein_id gnl|my_center|LOCUS_25560 13036 11234 gene locus_tag LOCUS_25570 13036 11234 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968641.1 protein_id gnl|my_center|LOCUS_25570 13498 13088 gene locus_tag LOCUS_25580 13498 13088 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389747.1 protein_id gnl|my_center|LOCUS_25580 13612 14019 gene locus_tag LOCUS_25590 13612 14019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 14211 16253 gene locus_tag LOCUS_25600 14211 16253 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 protein_id gnl|my_center|LOCUS_25600 16271 17539 gene locus_tag LOCUS_25610 16271 17539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921330.1 protein_id gnl|my_center|LOCUS_25610 17697 19316 gene locus_tag LOCUS_25620 17697 19316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919299.1 protein_id gnl|my_center|LOCUS_25620 19379 19564 gene locus_tag LOCUS_25630 19379 19564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 19771 20946 gene locus_tag LOCUS_25640 gene int 19771 20946 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 protein_id gnl|my_center|LOCUS_25640 20946 21563 gene locus_tag LOCUS_25650 20946 21563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 21656 21856 gene locus_tag LOCUS_25660 21656 21856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 21856 22077 gene locus_tag LOCUS_25670 21856 22077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 22067 22255 gene locus_tag LOCUS_25680 22067 22255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 22445 22831 gene locus_tag LOCUS_25690 22445 22831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 22828 23055 gene locus_tag LOCUS_25700 22828 23055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 23052 23222 gene locus_tag LOCUS_25710 23052 23222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 23222 24250 gene locus_tag LOCUS_25720 23222 24250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 24247 25398 gene locus_tag LOCUS_25730 24247 25398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 25527 25811 gene locus_tag LOCUS_25740 25527 25811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 26281 25958 gene locus_tag LOCUS_25750 26281 25958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 26562 26278 gene locus_tag LOCUS_25760 26562 26278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 26813 26556 gene locus_tag LOCUS_25770 26813 26556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 27046 26816 gene locus_tag LOCUS_25780 27046 26816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 27369 27040 gene locus_tag LOCUS_25790 27369 27040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 27800 27366 gene locus_tag LOCUS_25800 27800 27366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 28327 27797 gene locus_tag LOCUS_25810 28327 27797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence26 73 1362 gene locus_tag LOCUS_25820 gene hisD 73 1362 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_25820 1479 1925 gene locus_tag LOCUS_25830 gene nusB 1479 1925 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8J3 protein_id gnl|my_center|LOCUS_25830 2045 2959 gene locus_tag LOCUS_25840 gene thiL 2045 2959 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K82 protein_id gnl|my_center|LOCUS_25840 3178 5304 gene locus_tag LOCUS_25850 gene hppA 3178 5304 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K83 protein_id gnl|my_center|LOCUS_25850 5403 7361 gene locus_tag LOCUS_25860 5403 7361 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074214.1 protein_id gnl|my_center|LOCUS_25860 7475 8155 gene locus_tag LOCUS_25870 7475 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142073.1 protein_id gnl|my_center|LOCUS_25870 8407 9531 gene locus_tag LOCUS_25880 gene bioF 8407 9531 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709027.1 protein_id gnl|my_center|LOCUS_25880 9528 10160 gene locus_tag LOCUS_25890 gene bioD 9528 10160 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8T9 protein_id gnl|my_center|LOCUS_25890 10262 12310 gene locus_tag LOCUS_25900 10262 12310 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921333.1 protein_id gnl|my_center|LOCUS_25900 12363 13646 gene locus_tag LOCUS_25910 gene bioA 12363 13646 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709025.1 protein_id gnl|my_center|LOCUS_25910 13710 13928 gene locus_tag LOCUS_25920 gene infA 13710 13928 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V4 protein_id gnl|my_center|LOCUS_25920 13949 14521 gene locus_tag LOCUS_25930 13949 14521 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQN0 protein_id gnl|my_center|LOCUS_25930 14530 15519 gene locus_tag LOCUS_25940 14530 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 15509 15703 gene locus_tag LOCUS_25950 15509 15703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 15752 15827 gene locus_tag LOCUS_t00420 15752 15827 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 16002 17228 gene locus_tag LOCUS_25960 16002 17228 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 protein_id gnl|my_center|LOCUS_25960 17228 17866 gene locus_tag LOCUS_25970 17228 17866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 17977 18141 gene locus_tag LOCUS_25980 17977 18141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 18348 18659 gene locus_tag LOCUS_25990 18348 18659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 18659 18850 gene locus_tag LOCUS_26000 18659 18850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 19014 19205 gene locus_tag LOCUS_26010 19014 19205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 19202 20116 gene locus_tag LOCUS_26020 19202 20116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 20113 21585 gene locus_tag LOCUS_26030 20113 21585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 21585 22370 gene locus_tag LOCUS_26040 21585 22370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 22672 22818 gene locus_tag LOCUS_26050 22672 22818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 22818 23258 gene locus_tag LOCUS_26060 22818 23258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 23248 24099 gene locus_tag LOCUS_26070 23248 24099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 24355 27264 gene locus_tag LOCUS_26080 24355 27264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 27743 27261 gene locus_tag LOCUS_26090 27743 27261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence27 352 759 gene locus_tag LOCUS_26100 352 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 810 2456 gene locus_tag LOCUS_26110 gene groL2 810 2456 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV4 protein_id gnl|my_center|LOCUS_26110 3195 2521 gene locus_tag LOCUS_26120 3195 2521 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920500.1 protein_id gnl|my_center|LOCUS_26120 3373 5343 gene locus_tag LOCUS_26130 3373 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26130 6326 5364 gene locus_tag LOCUS_26140 6326 5364 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005178198.1 protein_id gnl|my_center|LOCUS_26140 6564 6743 gene locus_tag LOCUS_26150 6564 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 6783 7913 gene locus_tag LOCUS_26160 gene tgt 6783 7913 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2H4 protein_id gnl|my_center|LOCUS_26160 9487 7976 gene locus_tag LOCUS_26170 9487 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 9477 9716 gene locus_tag LOCUS_26180 9477 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 10126 10917 gene locus_tag LOCUS_26190 gene phyR 10126 10917 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 protein_id gnl|my_center|LOCUS_26190 10999 11130 gene locus_tag LOCUS_26200 10999 11130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 11250 11918 gene locus_tag LOCUS_26210 gene sigT 11250 11918 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921304.1 protein_id gnl|my_center|LOCUS_26210 11971 12252 gene locus_tag LOCUS_26220 11971 12252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 12561 13949 gene locus_tag LOCUS_26230 12561 13949 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_26230 13960 16032 gene locus_tag LOCUS_26240 13960 16032 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_26240 16032 17396 gene locus_tag LOCUS_26250 16032 17396 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_26250 17393 19429 gene locus_tag LOCUS_26260 17393 19429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 19963 19583 gene locus_tag LOCUS_26270 19963 19583 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768967.1 protein_id gnl|my_center|LOCUS_26270 20578 20000 gene locus_tag LOCUS_26280 20578 20000 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088288.1 protein_id gnl|my_center|LOCUS_26280 20716 22239 gene locus_tag LOCUS_26290 gene yhiP 20716 22239 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 protein_id gnl|my_center|LOCUS_26290 22248 23621 gene locus_tag LOCUS_26300 22248 23621 CDS product imidazolonepropionase related amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265753.1 protein_id gnl|my_center|LOCUS_26300 23618 24958 gene locus_tag LOCUS_26310 23618 24958 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence28 123 1751 gene locus_tag LOCUS_26320 123 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 1748 4693 gene locus_tag LOCUS_26330 gene trwC 1748 4693 CDS product conjugative relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639975.1 protein_id gnl|my_center|LOCUS_26330 4677 5213 gene locus_tag LOCUS_26340 4677 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 5517 5344 gene locus_tag LOCUS_26350 5517 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 6581 7114 gene locus_tag LOCUS_26360 6581 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 7251 8396 gene locus_tag LOCUS_26370 7251 8396 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 protein_id gnl|my_center|LOCUS_26370 8383 9558 gene locus_tag LOCUS_26380 8383 9558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224715.1 protein_id gnl|my_center|LOCUS_26380 9671 10420 gene locus_tag LOCUS_26390 9671 10420 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 protein_id gnl|my_center|LOCUS_26390 11920 10430 gene locus_tag LOCUS_26400 11920 10430 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228971.1 protein_id gnl|my_center|LOCUS_26400 13539 11917 gene locus_tag LOCUS_26410 13539 11917 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727011.1 protein_id gnl|my_center|LOCUS_26410 14621 13632 gene locus_tag LOCUS_26420 14621 13632 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_26420 14812 17187 gene locus_tag LOCUS_26430 gene fyuA 14812 17187 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036376.1 protein_id gnl|my_center|LOCUS_26430 17306 18721 gene locus_tag LOCUS_26440 17306 18721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 18996 21428 gene locus_tag LOCUS_26450 gene fyuA 18996 21428 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206776.1 protein_id gnl|my_center|LOCUS_26450 21826 23109 gene locus_tag LOCUS_26460 21826 23109 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_26460 23194 24081 gene locus_tag LOCUS_26470 23194 24081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 24234 24428 gene locus_tag LOCUS_26480 24234 24428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence29 1168 20 gene locus_tag LOCUS_26490 1168 20 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225703.1 protein_id gnl|my_center|LOCUS_26490 1587 1165 gene locus_tag LOCUS_26500 1587 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225702.1 protein_id gnl|my_center|LOCUS_26500 2451 1654 gene locus_tag LOCUS_26510 2451 1654 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533660.1 protein_id gnl|my_center|LOCUS_26510 2954 2454 gene locus_tag LOCUS_26520 2954 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 3289 4041 gene locus_tag LOCUS_26530 3289 4041 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_26530 4786 4055 gene locus_tag LOCUS_26540 4786 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 4914 5801 gene locus_tag LOCUS_26550 4914 5801 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894238.1 protein_id gnl|my_center|LOCUS_26550 5798 6550 gene locus_tag LOCUS_26560 5798 6550 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087150.1 protein_id gnl|my_center|LOCUS_26560 6562 7707 gene locus_tag LOCUS_26570 6562 7707 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701081.1 protein_id gnl|my_center|LOCUS_26570 7704 9143 gene locus_tag LOCUS_26580 7704 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729626.1 protein_id gnl|my_center|LOCUS_26580 9140 10210 gene locus_tag LOCUS_26590 9140 10210 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_26590 10207 10989 gene locus_tag LOCUS_26600 10207 10989 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_26600 11457 11242 gene locus_tag LOCUS_26610 11457 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26610 11873 13063 gene locus_tag LOCUS_26620 11873 13063 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918624.1 protein_id gnl|my_center|LOCUS_26620 13093 14547 gene locus_tag LOCUS_26630 13093 14547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 15147 14635 gene locus_tag LOCUS_26640 15147 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 16472 15192 gene locus_tag LOCUS_26650 16472 15192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 17709 16477 gene locus_tag LOCUS_26660 gene metC 17709 16477 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072223.1 protein_id gnl|my_center|LOCUS_26660 18551 17706 gene locus_tag LOCUS_26670 gene SseA 18551 17706 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338566.1 protein_id gnl|my_center|LOCUS_26670 19345 18626 gene locus_tag LOCUS_26680 19345 18626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 19960 20421 gene locus_tag LOCUS_26690 gene queF 19960 20421 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KV4 protein_id gnl|my_center|LOCUS_26690 20674 23337 gene locus_tag LOCUS_26700 gene pepN 20674 23337 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036254.1 protein_id gnl|my_center|LOCUS_26700 >Feature sequence30 2027 75 gene locus_tag LOCUS_26710 2027 75 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920029.1 protein_id gnl|my_center|LOCUS_26710 2515 2024 gene locus_tag LOCUS_26720 2515 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 4116 2515 gene locus_tag LOCUS_26730 4116 2515 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920031.1 protein_id gnl|my_center|LOCUS_26730 4255 4518 gene locus_tag LOCUS_26740 4255 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 5729 4584 gene locus_tag LOCUS_26750 5729 4584 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920033.1 protein_id gnl|my_center|LOCUS_26750 5816 6706 gene locus_tag LOCUS_26760 5816 6706 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144410.1 protein_id gnl|my_center|LOCUS_26760 6793 9240 gene locus_tag LOCUS_26770 6793 9240 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639902.1 protein_id gnl|my_center|LOCUS_26770 9290 9682 gene locus_tag LOCUS_26780 9290 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 9679 10725 gene locus_tag LOCUS_26790 9679 10725 CDS product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085896.1 protein_id gnl|my_center|LOCUS_26790 12659 10635 gene locus_tag LOCUS_26800 12659 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 13456 12647 gene locus_tag LOCUS_26810 13456 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 14219 13467 gene locus_tag LOCUS_26820 14219 13467 CDS product cephalosporin hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306683.1 protein_id gnl|my_center|LOCUS_26820 15159 14254 gene locus_tag LOCUS_26830 15159 14254 CDS product CDP-4-dehydro-6-deoxy-D-gulose 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_26830 15694 15152 gene locus_tag LOCUS_26840 gene rfbC 15694 15152 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142202.1 protein_id gnl|my_center|LOCUS_26840 16935 15694 gene locus_tag LOCUS_26850 16935 15694 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887438.1 protein_id gnl|my_center|LOCUS_26850 18014 16932 gene locus_tag LOCUS_26860 gene rfbG 18014 16932 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205408.1 protein_id gnl|my_center|LOCUS_26860 18775 17996 gene locus_tag LOCUS_26870 gene gcd1 18775 17996 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_26870 >Feature sequence31 140 982 gene locus_tag LOCUS_26880 gene rsmI 140 982 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFD0 protein_id gnl|my_center|LOCUS_26880 979 1332 gene locus_tag LOCUS_26890 979 1332 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN09 protein_id gnl|my_center|LOCUS_26890 1471 2445 gene locus_tag LOCUS_26900 gene gshB 1471 2445 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN11 protein_id gnl|my_center|LOCUS_26900 2550 3149 gene locus_tag LOCUS_26910 2550 3149 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_26910 4039 3146 gene locus_tag LOCUS_26920 gene xerC 4039 3146 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0E8 protein_id gnl|my_center|LOCUS_26920 4460 5347 gene locus_tag LOCUS_26930 4460 5347 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_26930 5482 6033 gene locus_tag LOCUS_26940 5482 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 6067 7053 gene locus_tag LOCUS_26950 gene nadA 6067 7053 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM90 protein_id gnl|my_center|LOCUS_26950 7057 7905 gene locus_tag LOCUS_26960 7057 7905 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_26960 7898 8602 gene locus_tag LOCUS_26970 7898 8602 CDS product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917920.1 protein_id gnl|my_center|LOCUS_26970 9055 8627 gene locus_tag LOCUS_26980 9055 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 10572 9076 gene locus_tag LOCUS_26990 10572 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 12234 10636 gene locus_tag LOCUS_27000 12234 10636 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_27000 12907 12203 gene locus_tag LOCUS_27010 12907 12203 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722430.1 protein_id gnl|my_center|LOCUS_27010 13201 14805 gene locus_tag LOCUS_27020 gene pckA 13201 14805 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ94 protein_id gnl|my_center|LOCUS_27020 14920 15237 gene locus_tag LOCUS_27030 14920 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 15401 16219 gene locus_tag LOCUS_27040 15401 16219 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921041.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence32 122 2008 gene locus_tag LOCUS_27050 122 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2926 2045 gene locus_tag LOCUS_27060 2926 2045 CDS product 2-pyrone-4,6-dicarboxylate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 protein_id gnl|my_center|LOCUS_27060 3978 2923 gene locus_tag LOCUS_27070 gene fldA 3978 2923 CDS product FldA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039102.1 protein_id gnl|my_center|LOCUS_27070 4645 3971 gene locus_tag LOCUS_27080 gene fldZ 4645 3971 CDS product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039101.1 protein_id gnl|my_center|LOCUS_27080 4559 4759 gene locus_tag LOCUS_27090 4559 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 4749 5900 gene locus_tag LOCUS_27100 gene fldY 4749 5900 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039100.1 protein_id gnl|my_center|LOCUS_27100 5965 6855 gene locus_tag LOCUS_27110 5965 6855 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969452.1 protein_id gnl|my_center|LOCUS_27110 6976 8001 gene locus_tag LOCUS_27120 gene fldW 6976 8001 CDS product 4-oxalomesaconate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 protein_id gnl|my_center|LOCUS_27120 7998 8453 gene locus_tag LOCUS_27130 7998 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 8453 9349 gene locus_tag LOCUS_27140 gene pcaH 8453 9349 CDS product protocatechuate 4,5-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 protein_id gnl|my_center|LOCUS_27140 9442 10380 gene locus_tag LOCUS_27150 9442 10380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 10731 10444 gene locus_tag LOCUS_27160 10731 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 11575 10703 gene locus_tag LOCUS_27170 11575 10703 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640485.1 protein_id gnl|my_center|LOCUS_27170 12894 11587 gene locus_tag LOCUS_27180 12894 11587 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112297.1 protein_id gnl|my_center|LOCUS_27180 13471 12911 gene locus_tag LOCUS_27190 13471 12911 CDS product UPF0311 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHM4 protein_id gnl|my_center|LOCUS_27190 13677 14846 gene locus_tag LOCUS_27200 13677 14846 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920262.1 protein_id gnl|my_center|LOCUS_27200 >Feature sequence33 204 656 gene locus_tag LOCUS_27210 204 656 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887882.1 protein_id gnl|my_center|LOCUS_27210 741 816 gene locus_tag LOCUS_t00430 741 816 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 954 1940 gene locus_tag LOCUS_27220 954 1940 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_27220 3268 1952 gene locus_tag LOCUS_27230 3268 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640529.1 protein_id gnl|my_center|LOCUS_27230 4118 3360 gene locus_tag LOCUS_27240 4118 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533664.1 protein_id gnl|my_center|LOCUS_27240 5032 4118 gene locus_tag LOCUS_27250 5032 4118 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9X1 protein_id gnl|my_center|LOCUS_27250 5965 5090 gene locus_tag LOCUS_27260 5965 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 7602 6190 gene locus_tag LOCUS_27270 7602 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 7701 8897 gene locus_tag LOCUS_27280 gene nhaA 7701 8897 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5X8 protein_id gnl|my_center|LOCUS_27280 9019 9198 gene locus_tag LOCUS_27290 9019 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 9611 9210 gene locus_tag LOCUS_27300 9611 9210 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973339.1 protein_id gnl|my_center|LOCUS_27300 9683 10006 gene locus_tag LOCUS_27310 9683 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 10153 11352 gene locus_tag LOCUS_27320 gene sucC 10153 11352 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X60 protein_id gnl|my_center|LOCUS_27320 11449 12198 gene locus_tag LOCUS_27330 gene etfB 11449 12198 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53575 protein_id gnl|my_center|LOCUS_27330 12195 13124 gene locus_tag LOCUS_27340 gene etfA-2 12195 13124 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769647.1 protein_id gnl|my_center|LOCUS_27340 13544 13185 gene locus_tag LOCUS_27350 13544 13185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 13741 13544 gene locus_tag LOCUS_27360 13741 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 14050 13838 gene locus_tag LOCUS_27370 14050 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 14343 14128 gene locus_tag LOCUS_27380 14343 14128 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389667.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence34 1598 375 gene locus_tag LOCUS_27390 1598 375 CDS product poly(3-hydroxybutyrate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089442.1 protein_id gnl|my_center|LOCUS_27390 1723 2379 gene locus_tag LOCUS_27400 1723 2379 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089441.1 protein_id gnl|my_center|LOCUS_27400 2439 4082 gene locus_tag LOCUS_27410 2439 4082 CDS product M28-family zinc peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265906.1 protein_id gnl|my_center|LOCUS_27410 6818 4149 gene locus_tag LOCUS_27420 6818 4149 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNJ0 protein_id gnl|my_center|LOCUS_27420 9988 7223 gene locus_tag LOCUS_27430 gene acnB 9988 7223 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_27430 11820 10153 gene locus_tag LOCUS_27440 11820 10153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_27440 12177 11962 gene locus_tag LOCUS_27450 12177 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 12367 12182 gene locus_tag LOCUS_27460 12367 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 13434 12436 gene locus_tag LOCUS_27470 13434 12436 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_27470 13564 14034 gene locus_tag LOCUS_27480 13564 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 14514 14317 gene locus_tag LOCUS_27490 14514 14317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence35 1131 67 gene locus_tag LOCUS_27500 1131 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 3914 1131 gene locus_tag LOCUS_27510 3914 1131 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_27510 4296 4114 gene locus_tag LOCUS_27520 4296 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 6354 4393 gene locus_tag LOCUS_27530 6354 4393 CDS product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727591.1 protein_id gnl|my_center|LOCUS_27530 7198 6449 gene locus_tag LOCUS_27540 7198 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 protein_id gnl|my_center|LOCUS_27540 7526 7155 gene locus_tag LOCUS_27550 7526 7155 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390117.1 protein_id gnl|my_center|LOCUS_27550 7675 7764 gene locus_tag LOCUS_t00440 7675 7764 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7955 9154 gene locus_tag LOCUS_27560 gene int 7955 9154 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 protein_id gnl|my_center|LOCUS_27560 9384 9842 gene locus_tag LOCUS_27570 9384 9842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 9894 10319 gene locus_tag LOCUS_27580 9894 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 >Feature sequence36 1184 60 gene locus_tag LOCUS_27590 1184 60 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923248.1 protein_id gnl|my_center|LOCUS_27590 1346 1221 gene locus_tag LOCUS_27600 1346 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1500 2948 gene locus_tag LOCUS_27610 1500 2948 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089866.1 protein_id gnl|my_center|LOCUS_27610 3022 3657 gene locus_tag LOCUS_27620 3022 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 4793 3672 gene locus_tag LOCUS_27630 4793 3672 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5C3 protein_id gnl|my_center|LOCUS_27630 6065 4935 gene locus_tag LOCUS_27640 6065 4935 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7Z4 protein_id gnl|my_center|LOCUS_27640 6353 6682 gene locus_tag LOCUS_27650 6353 6682 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089489.1 protein_id gnl|my_center|LOCUS_27650 6739 7068 gene locus_tag LOCUS_27660 6739 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 7137 7298 gene locus_tag LOCUS_27670 7137 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 7410 8342 gene locus_tag LOCUS_27680 7410 8342 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919312.1 protein_id gnl|my_center|LOCUS_27680 8351 9709 gene locus_tag LOCUS_27690 8351 9709 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_27690 9795 10115 gene locus_tag LOCUS_27700 9795 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700