>Feature sequence001 67 432 gene locus_tag LOCUS_00010 67 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 535 1110 gene locus_tag LOCUS_00020 535 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5711 1164 gene locus_tag LOCUS_00030 5711 1164 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_00030 6940 5729 gene locus_tag LOCUS_00040 6940 5729 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387779.1 protein_id gnl|my_center|LOCUS_00040 6967 7191 gene locus_tag LOCUS_00050 6967 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7371 8219 gene locus_tag LOCUS_00060 gene uppP1 7371 8219 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYH3 protein_id gnl|my_center|LOCUS_00060 8231 10099 gene locus_tag LOCUS_00070 8231 10099 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_00070 11943 10108 gene locus_tag LOCUS_00080 11943 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12285 13289 gene locus_tag LOCUS_00090 12285 13289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13782 17486 gene locus_tag LOCUS_00100 13782 17486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339516.1 protein_id gnl|my_center|LOCUS_00100 17674 19995 gene locus_tag LOCUS_00110 17674 19995 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4N8 protein_id gnl|my_center|LOCUS_00110 20064 20906 gene locus_tag LOCUS_00120 20064 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 20981 21655 gene locus_tag LOCUS_00130 20981 21655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 21655 22077 gene locus_tag LOCUS_00140 21655 22077 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066848.1 protein_id gnl|my_center|LOCUS_00140 22083 22964 gene locus_tag LOCUS_00150 22083 22964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 23551 22961 gene locus_tag LOCUS_00160 23551 22961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 23686 24252 gene locus_tag LOCUS_00170 23686 24252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00170 25882 24419 gene locus_tag LOCUS_00180 25882 24419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 26907 25978 gene locus_tag LOCUS_00190 26907 25978 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310475.1 protein_id gnl|my_center|LOCUS_00190 27000 28292 gene locus_tag LOCUS_00200 gene ahcY 27000 28292 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY7 protein_id gnl|my_center|LOCUS_00200 28324 29517 gene locus_tag LOCUS_00210 gene metK2 28324 29517 CDS product S-adenosylmethionine synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS5 protein_id gnl|my_center|LOCUS_00210 <30133 29523 gene locus_tag LOCUS_00220 <30133 29523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338191.1:gamma-glutamylputrescine oxidase >Feature sequence002 1266 763 gene locus_tag LOCUS_00230 1266 763 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967186.1 protein_id gnl|my_center|LOCUS_00230 2272 1358 gene locus_tag LOCUS_00240 2272 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114400.1 protein_id gnl|my_center|LOCUS_00240 2564 2373 gene locus_tag LOCUS_00250 2564 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 2744 4486 gene locus_tag LOCUS_00260 2744 4486 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_00260 5141 4560 gene locus_tag LOCUS_00270 5141 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 5755 5174 gene locus_tag LOCUS_00280 5755 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 7059 5935 gene locus_tag LOCUS_00290 gene mnmA 7059 5935 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J358 protein_id gnl|my_center|LOCUS_00290 9070 7142 gene locus_tag LOCUS_00300 gene thrS 9070 7142 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_00300 9700 9161 gene locus_tag LOCUS_00310 9700 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 10130 9774 gene locus_tag LOCUS_00320 10130 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 10670 10344 gene locus_tag LOCUS_00330 10670 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00330 12123 10657 gene locus_tag LOCUS_00340 gene pepA 12123 10657 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX86 protein_id gnl|my_center|LOCUS_00340 12572 12150 gene locus_tag LOCUS_00350 12572 12150 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975718.1 protein_id gnl|my_center|LOCUS_00350 13824 12658 gene locus_tag LOCUS_00360 gene metZ 13824 12658 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKS5 protein_id gnl|my_center|LOCUS_00360 14715 13846 gene locus_tag LOCUS_00370 gene pheA 14715 13846 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_00370 14956 15489 gene locus_tag LOCUS_00380 14956 15489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 16515 15559 gene locus_tag LOCUS_00390 16515 15559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 18251 16683 gene locus_tag LOCUS_00400 18251 16683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 19135 18368 gene locus_tag LOCUS_00410 19135 18368 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_00410 19906 19142 gene locus_tag LOCUS_00420 gene nadK 19906 19142 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX24 protein_id gnl|my_center|LOCUS_00420 20086 20583 gene locus_tag LOCUS_00430 20086 20583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 20659 21552 gene locus_tag LOCUS_00440 20659 21552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 21575 22207 gene locus_tag LOCUS_00450 21575 22207 CDS product DNA-3-methyladenine glycosylase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_00450 >Feature sequence003 154 78 gene locus_tag LOCUS_t00010 154 78 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 304 906 gene locus_tag LOCUS_00460 304 906 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532569.1 protein_id gnl|my_center|LOCUS_00460 924 2186 gene locus_tag LOCUS_00470 924 2186 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 protein_id gnl|my_center|LOCUS_00470 2229 2705 gene locus_tag LOCUS_00480 2229 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 2805 2880 gene locus_tag LOCUS_t00020 2805 2880 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2994 3758 gene locus_tag LOCUS_00490 gene lgt 2994 3758 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFJ4 protein_id gnl|my_center|LOCUS_00490 3755 4813 gene locus_tag LOCUS_00500 3755 4813 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_00500 6589 4787 gene locus_tag LOCUS_00510 gene mutL 6589 4787 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ52 protein_id gnl|my_center|LOCUS_00510 6749 7267 gene locus_tag LOCUS_00520 gene apt 6749 7267 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT4 protein_id gnl|my_center|LOCUS_00520 7271 8056 gene locus_tag LOCUS_00530 gene surE 7271 8056 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L02 protein_id gnl|my_center|LOCUS_00530 8061 8759 gene locus_tag LOCUS_00540 8061 8759 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CIM5 protein_id gnl|my_center|LOCUS_00540 11042 8901 gene locus_tag LOCUS_00550 11042 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 14018 11289 gene locus_tag LOCUS_00560 14018 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 14318 15286 gene locus_tag LOCUS_00570 14318 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 15297 16217 gene locus_tag LOCUS_00580 15297 16217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 16793 16224 gene locus_tag LOCUS_00590 gene pth 16793 16224 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV4 protein_id gnl|my_center|LOCUS_00590 17407 16793 gene locus_tag LOCUS_00600 gene rplY 17407 16793 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV5 protein_id gnl|my_center|LOCUS_00600 18475 17516 gene locus_tag LOCUS_00610 gene prs 18475 17516 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDA9 protein_id gnl|my_center|LOCUS_00610 18742 18818 gene locus_tag LOCUS_t00030 18742 18818 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19032 18883 gene locus_tag LOCUS_00620 19032 18883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 19025 20515 gene locus_tag LOCUS_00630 19025 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 >Feature sequence004 467 90 gene locus_tag LOCUS_00640 467 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 839 914 gene locus_tag LOCUS_t00040 839 914 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1155 5225 gene locus_tag LOCUS_00650 1155 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_00650 5362 5288 gene locus_tag LOCUS_t00050 5362 5288 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5496 6026 gene locus_tag LOCUS_00660 5496 6026 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918000.1 protein_id gnl|my_center|LOCUS_00660 8773 6050 gene locus_tag LOCUS_00670 gene secA 8773 6050 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MI9 protein_id gnl|my_center|LOCUS_00670 9181 8894 gene locus_tag LOCUS_00680 9181 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 11109 9211 gene locus_tag LOCUS_00690 gene wcaG 11109 9211 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338776.1 protein_id gnl|my_center|LOCUS_00690 12293 11106 gene locus_tag LOCUS_00700 gene pglC 12293 11106 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222986.1 protein_id gnl|my_center|LOCUS_00700 14481 12712 gene locus_tag LOCUS_00710 14481 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 16608 14512 gene locus_tag LOCUS_00720 16608 14512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 18266 16707 gene locus_tag LOCUS_00730 18266 16707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 18719 19555 gene locus_tag LOCUS_00740 18719 19555 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787574.1 protein_id gnl|my_center|LOCUS_00740 >Feature sequence005 296 985 gene locus_tag LOCUS_00750 296 985 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708366.1 protein_id gnl|my_center|LOCUS_00750 1085 1906 gene locus_tag LOCUS_00760 gene truA 1085 1906 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TDJ8 protein_id gnl|my_center|LOCUS_00760 2002 2661 gene locus_tag LOCUS_00770 2002 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 3763 2633 gene locus_tag LOCUS_00780 3763 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 6678 4009 gene locus_tag LOCUS_00790 gene mutS 6678 4009 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG0 protein_id gnl|my_center|LOCUS_00790 6921 9212 gene locus_tag LOCUS_00800 6921 9212 CDS product malic protein NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528054.1 protein_id gnl|my_center|LOCUS_00800 9628 9506 gene locus_tag LOCUS_00810 9628 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 9670 10161 gene locus_tag LOCUS_00820 9670 10161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 10191 10706 gene locus_tag LOCUS_00830 10191 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_00830 11126 10818 gene locus_tag LOCUS_00840 11126 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 12060 11293 gene locus_tag LOCUS_00850 12060 11293 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU90 protein_id gnl|my_center|LOCUS_00850 13256 12099 gene locus_tag LOCUS_00860 13256 12099 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337042.1 protein_id gnl|my_center|LOCUS_00860 13392 13468 gene locus_tag LOCUS_t00060 13392 13468 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13695 15512 gene locus_tag LOCUS_00870 13695 15512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 15652 16494 gene locus_tag LOCUS_00880 15652 16494 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C520 protein_id gnl|my_center|LOCUS_00880 16499 17089 gene locus_tag LOCUS_00890 gene maf2 16499 17089 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJC6 protein_id gnl|my_center|LOCUS_00890 17086 17949 gene locus_tag LOCUS_00900 gene aroE 17086 17949 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN88 protein_id gnl|my_center|LOCUS_00900 17952 18620 gene locus_tag LOCUS_00910 gene coaE 17952 18620 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN89 protein_id gnl|my_center|LOCUS_00910 18550 19254 gene locus_tag LOCUS_00920 gene dnaQ 18550 19254 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538049.1 protein_id gnl|my_center|LOCUS_00920 >Feature sequence006 116 772 gene locus_tag LOCUS_00930 gene tal 116 772 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F0 protein_id gnl|my_center|LOCUS_00930 819 1532 gene locus_tag LOCUS_00940 819 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 1478 2458 gene locus_tag LOCUS_00950 gene xerC 1478 2458 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LK1 protein_id gnl|my_center|LOCUS_00950 2588 3175 gene locus_tag LOCUS_00960 gene hisB 2588 3175 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y411 protein_id gnl|my_center|LOCUS_00960 3172 3819 gene locus_tag LOCUS_00970 gene hisH 3172 3819 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA5 protein_id gnl|my_center|LOCUS_00970 3882 6011 gene locus_tag LOCUS_00980 3882 6011 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705707.1 protein_id gnl|my_center|LOCUS_00980 6024 6581 gene locus_tag LOCUS_00990 6024 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 6583 6924 gene locus_tag LOCUS_01000 6583 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 6924 7571 gene locus_tag LOCUS_01010 6924 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 7571 7864 gene locus_tag LOCUS_01020 7571 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640144.1 protein_id gnl|my_center|LOCUS_01020 7978 7903 gene locus_tag LOCUS_t00070 7978 7903 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8337 7999 gene locus_tag LOCUS_01030 8337 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 8610 9503 gene locus_tag LOCUS_01040 8610 9503 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSH8 protein_id gnl|my_center|LOCUS_01040 9801 9505 gene locus_tag LOCUS_01050 9801 9505 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707594.1 protein_id gnl|my_center|LOCUS_01050 10633 9932 gene locus_tag LOCUS_01060 10633 9932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 11529 10897 gene locus_tag LOCUS_01070 gene rnhB 11529 10897 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6M8 protein_id gnl|my_center|LOCUS_01070 11869 11552 gene locus_tag LOCUS_01080 11869 11552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 13290 11911 gene locus_tag LOCUS_01090 13290 11911 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_01090 14032 13457 gene locus_tag LOCUS_01100 14032 13457 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_01100 14487 14032 gene locus_tag LOCUS_01110 14487 14032 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_01110 15013 14492 gene locus_tag LOCUS_01120 15013 14492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969419.1 protein_id gnl|my_center|LOCUS_01120 15304 16056 gene locus_tag LOCUS_01130 15304 16056 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389334.1 protein_id gnl|my_center|LOCUS_01130 16053 16787 gene locus_tag LOCUS_01140 16053 16787 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389333.1 protein_id gnl|my_center|LOCUS_01140 16805 17731 gene locus_tag LOCUS_01150 16805 17731 CDS product putative thiamine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44658 protein_id gnl|my_center|LOCUS_01150 19078 17735 gene locus_tag LOCUS_01160 19078 17735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 >Feature sequence007 334 942 gene locus_tag LOCUS_01170 gene pncA 334 942 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385573.1 protein_id gnl|my_center|LOCUS_01170 2243 939 gene locus_tag LOCUS_01180 gene aprE 2243 939 CDS product alkaline protease secretion protein AprE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03025 protein_id gnl|my_center|LOCUS_01180 3985 2240 gene locus_tag LOCUS_01190 3985 2240 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533172.1 protein_id gnl|my_center|LOCUS_01190 4306 5085 gene locus_tag LOCUS_01200 gene rpsB 4306 5085 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU09 protein_id gnl|my_center|LOCUS_01200 5141 6067 gene locus_tag LOCUS_01210 gene tsf 5141 6067 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU08 protein_id gnl|my_center|LOCUS_01210 6225 6956 gene locus_tag LOCUS_01220 gene pyrH 6225 6956 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BW2 protein_id gnl|my_center|LOCUS_01220 6983 7537 gene locus_tag LOCUS_01230 gene frr 6983 7537 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KP6 protein_id gnl|my_center|LOCUS_01230 7574 8299 gene locus_tag LOCUS_01240 7574 8299 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJN7 protein_id gnl|my_center|LOCUS_01240 8385 8945 gene locus_tag LOCUS_01250 8385 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 8942 10084 gene locus_tag LOCUS_01260 gene dxr 8942 10084 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H0 protein_id gnl|my_center|LOCUS_01260 10093 11148 gene locus_tag LOCUS_01270 10093 11148 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL7 protein_id gnl|my_center|LOCUS_01270 11237 13522 gene locus_tag LOCUS_01280 gene bamA 11237 13522 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU01 protein_id gnl|my_center|LOCUS_01280 13554 14105 gene locus_tag LOCUS_01290 13554 14105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 14105 15133 gene locus_tag LOCUS_01300 gene lpxD 14105 15133 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q47 protein_id gnl|my_center|LOCUS_01300 15188 15673 gene locus_tag LOCUS_01310 gene fabZ 15188 15673 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q46 protein_id gnl|my_center|LOCUS_01310 15663 16463 gene locus_tag LOCUS_01320 gene lpxA 15663 16463 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ8 protein_id gnl|my_center|LOCUS_01320 16475 17344 gene locus_tag LOCUS_01330 16475 17344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969262.1 protein_id gnl|my_center|LOCUS_01330 17341 18486 gene locus_tag LOCUS_01340 gene lpxB 17341 18486 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337682.1 protein_id gnl|my_center|LOCUS_01340 >Feature sequence008 4005 499 gene locus_tag LOCUS_01350 gene mfd 4005 499 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTL9 protein_id gnl|my_center|LOCUS_01350 4349 4101 gene locus_tag LOCUS_01360 4349 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 4490 5008 gene locus_tag LOCUS_01370 gene ilvH 4490 5008 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534906.1 protein_id gnl|my_center|LOCUS_01370 5085 6095 gene locus_tag LOCUS_01380 gene ilvC 5085 6095 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX71 protein_id gnl|my_center|LOCUS_01380 6207 7628 gene locus_tag LOCUS_01390 6207 7628 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_01390 7823 8791 gene locus_tag LOCUS_01400 7823 8791 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339009.1 protein_id gnl|my_center|LOCUS_01400 8870 9880 gene locus_tag LOCUS_01410 8870 9880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810306.1 protein_id gnl|my_center|LOCUS_01410 9891 10961 gene locus_tag LOCUS_01420 9891 10961 CDS product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971231.1 protein_id gnl|my_center|LOCUS_01420 10973 11719 gene locus_tag LOCUS_01430 10973 11719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_01430 13146 11758 gene locus_tag LOCUS_01440 13146 11758 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_01440 13796 13137 gene locus_tag LOCUS_01450 13796 13137 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 protein_id gnl|my_center|LOCUS_01450 14153 13800 gene locus_tag LOCUS_01460 14153 13800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 14354 15241 gene locus_tag LOCUS_01470 14354 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 15252 16829 gene locus_tag LOCUS_01480 15252 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943791.1 protein_id gnl|my_center|LOCUS_01480 >Feature sequence009 19 1347 gene locus_tag LOCUS_01490 gene aroA 19 1347 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP5 protein_id gnl|my_center|LOCUS_01490 1344 2012 gene locus_tag LOCUS_01500 gene cmk 1344 2012 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3C6 protein_id gnl|my_center|LOCUS_01500 2133 3824 gene locus_tag LOCUS_01510 2133 3824 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP7 protein_id gnl|my_center|LOCUS_01510 4028 5368 gene locus_tag LOCUS_01520 gene trmFO 4028 5368 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTI8 protein_id gnl|my_center|LOCUS_01520 5443 6141 gene locus_tag LOCUS_01530 gene sipF 5443 6141 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K52 protein_id gnl|my_center|LOCUS_01530 6145 6846 gene locus_tag LOCUS_01540 gene rnc 6145 6846 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT93 protein_id gnl|my_center|LOCUS_01540 7592 6852 gene locus_tag LOCUS_01550 7592 6852 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP8 protein_id gnl|my_center|LOCUS_01550 9025 7589 gene locus_tag LOCUS_01560 9025 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 9718 9035 gene locus_tag LOCUS_01570 9718 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 9861 10622 gene locus_tag LOCUS_01580 gene spuA 9861 10622 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 protein_id gnl|my_center|LOCUS_01580 11079 10579 gene locus_tag LOCUS_01590 gene np20 11079 10579 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_01590 11591 11899 gene locus_tag LOCUS_01600 11591 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 11981 12589 gene locus_tag LOCUS_01610 11981 12589 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087070.1 protein_id gnl|my_center|LOCUS_01610 14382 12649 gene locus_tag LOCUS_01620 14382 12649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537929.1 protein_id gnl|my_center|LOCUS_01620 14740 15102 gene locus_tag LOCUS_01630 14740 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 16002 15745 gene locus_tag LOCUS_01640 16002 15745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 >Feature sequence010 78 2831 gene locus_tag LOCUS_01650 78 2831 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_01650 3036 3239 gene locus_tag LOCUS_01660 gene rpmI 3036 3239 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNI0 protein_id gnl|my_center|LOCUS_01660 3254 3700 gene locus_tag LOCUS_01670 gene rplT 3254 3700 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC9 protein_id gnl|my_center|LOCUS_01670 4917 4084 gene locus_tag LOCUS_01680 4917 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 6446 5358 gene locus_tag LOCUS_01690 6446 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 7113 6514 gene locus_tag LOCUS_01700 7113 6514 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_01700 7853 7110 gene locus_tag LOCUS_01710 gene rph 7853 7110 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI2 protein_id gnl|my_center|LOCUS_01710 8008 9030 gene locus_tag LOCUS_01720 8008 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 9042 10325 gene locus_tag LOCUS_01730 gene glcF 9042 10325 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CK25 protein_id gnl|my_center|LOCUS_01730 11366 10341 gene locus_tag LOCUS_01740 11366 10341 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923357.1 protein_id gnl|my_center|LOCUS_01740 13922 11379 gene locus_tag LOCUS_01750 gene leuS 13922 11379 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN70 protein_id gnl|my_center|LOCUS_01750 14084 14620 gene locus_tag LOCUS_01760 14084 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 15475 14609 gene locus_tag LOCUS_01770 15475 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 >Feature sequence011 192 908 gene locus_tag LOCUS_01780 192 908 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_01780 905 1267 gene locus_tag LOCUS_01790 905 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 1604 2650 gene locus_tag LOCUS_01800 gene hemE 1604 2650 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN85 protein_id gnl|my_center|LOCUS_01800 2659 3795 gene locus_tag LOCUS_01810 gene hemH 2659 3795 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN84 protein_id gnl|my_center|LOCUS_01810 3795 4220 gene locus_tag LOCUS_01820 3795 4220 CDS product TIGR00701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113170.1 protein_id gnl|my_center|LOCUS_01820 4980 4240 gene locus_tag LOCUS_01830 4980 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 5561 4992 gene locus_tag LOCUS_01840 gene regA 5561 4992 CDS product photosynthetic apparatus regulatory protein RegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53228 protein_id gnl|my_center|LOCUS_01840 6901 5558 gene locus_tag LOCUS_01850 6901 5558 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709892.1 protein_id gnl|my_center|LOCUS_01850 7880 6915 gene locus_tag LOCUS_01860 gene cobT 7880 6915 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92P98 protein_id gnl|my_center|LOCUS_01860 8049 9788 gene locus_tag LOCUS_01870 8049 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974660.1 protein_id gnl|my_center|LOCUS_01870 9792 10604 gene locus_tag LOCUS_01880 gene ispE 9792 10604 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHP8 protein_id gnl|my_center|LOCUS_01880 11625 10690 gene locus_tag LOCUS_01890 11625 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 12002 12075 gene locus_tag LOCUS_t00080 12002 12075 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 12584 12444 gene locus_tag LOCUS_01900 12584 12444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 14733 12769 gene locus_tag LOCUS_01910 gene acsA 14733 12769 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNC6 protein_id gnl|my_center|LOCUS_01910 15404 15087 gene locus_tag LOCUS_01920 15404 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 >Feature sequence012 441 1865 gene locus_tag LOCUS_01930 441 1865 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030798.1 protein_id gnl|my_center|LOCUS_01930 1869 2993 gene locus_tag LOCUS_01940 1869 2993 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267598.1 protein_id gnl|my_center|LOCUS_01940 3866 2988 gene locus_tag LOCUS_01950 3866 2988 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZW3 protein_id gnl|my_center|LOCUS_01950 4278 3937 gene locus_tag LOCUS_01960 4278 3937 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFD5 protein_id gnl|my_center|LOCUS_01960 4544 4302 gene locus_tag LOCUS_01970 4544 4302 CDS product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK2 protein_id gnl|my_center|LOCUS_01970 4858 4556 gene locus_tag LOCUS_01980 4858 4556 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 protein_id gnl|my_center|LOCUS_01980 5209 5979 gene locus_tag LOCUS_01990 5209 5979 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973884.1 protein_id gnl|my_center|LOCUS_01990 5990 6322 gene locus_tag LOCUS_02000 5990 6322 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 protein_id gnl|my_center|LOCUS_02000 6327 7496 gene locus_tag LOCUS_02010 6327 7496 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067156.1 protein_id gnl|my_center|LOCUS_02010 7649 9370 gene locus_tag LOCUS_02020 7649 9370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 9918 9697 gene locus_tag LOCUS_02030 9918 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 10826 9969 gene locus_tag LOCUS_02040 10826 9969 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_02040 11941 10841 gene locus_tag LOCUS_02050 11941 10841 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390052.1 protein_id gnl|my_center|LOCUS_02050 12084 13469 gene locus_tag LOCUS_02060 12084 13469 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390981.1 protein_id gnl|my_center|LOCUS_02060 13595 14500 gene locus_tag LOCUS_02070 gene folD 13595 14500 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 protein_id gnl|my_center|LOCUS_02070 14854 14477 gene locus_tag LOCUS_02080 14854 14477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086291.1 protein_id gnl|my_center|LOCUS_02080 15060 15386 gene locus_tag LOCUS_02090 gene soxZ 15060 15386 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_02090 >Feature sequence013 2611 1310 gene locus_tag LOCUS_02100 2611 1310 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 protein_id gnl|my_center|LOCUS_02100 5295 2779 gene locus_tag LOCUS_02110 gene topA 5295 2779 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5J6 protein_id gnl|my_center|LOCUS_02110 6532 5399 gene locus_tag LOCUS_02120 6532 5399 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_02120 7130 6540 gene locus_tag LOCUS_02130 gene plsY 7130 6540 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF8 protein_id gnl|my_center|LOCUS_02130 7246 7322 gene locus_tag LOCUS_t00090 7246 7322 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7358 8110 gene locus_tag LOCUS_02140 7358 8110 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ82 protein_id gnl|my_center|LOCUS_02140 8456 8650 gene locus_tag LOCUS_02150 8456 8650 CDS product addiction module toxin, HicA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893919.1 protein_id gnl|my_center|LOCUS_02150 8652 9050 gene locus_tag LOCUS_02160 8652 9050 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337712.1 protein_id gnl|my_center|LOCUS_02160 10348 9059 gene locus_tag LOCUS_02170 10348 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 10481 11674 gene locus_tag LOCUS_02180 10481 11674 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_02180 11826 13226 gene locus_tag LOCUS_02190 gene fumC1 11826 13226 CDS product fumarate hydratase class II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28894 protein_id gnl|my_center|LOCUS_02190 13647 13213 gene locus_tag LOCUS_02200 13647 13213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 14713 13694 gene locus_tag LOCUS_02210 14713 13694 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921549.1 protein_id gnl|my_center|LOCUS_02210 14877 15362 gene locus_tag LOCUS_02220 14877 15362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 >Feature sequence014 <1 552 gene locus_tag LOCUS_02230 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208588.1:phosphomannomutase 552 764 gene locus_tag LOCUS_02240 552 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 754 1563 gene locus_tag LOCUS_02250 gene rfbD 754 1563 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086433.1 protein_id gnl|my_center|LOCUS_02250 1577 2290 gene locus_tag LOCUS_02260 1577 2290 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702850.1 protein_id gnl|my_center|LOCUS_02260 2455 2796 gene locus_tag LOCUS_02270 2455 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02270 2819 3766 gene locus_tag LOCUS_02280 2819 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 3821 4267 gene locus_tag LOCUS_02290 3821 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02290 4400 4567 gene locus_tag LOCUS_02300 4400 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02300 4714 5277 gene locus_tag LOCUS_02310 4714 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 5274 5996 gene locus_tag LOCUS_02320 gene hisA 5274 5996 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEK4 protein_id gnl|my_center|LOCUS_02320 5990 6748 gene locus_tag LOCUS_02330 gene hisF 5990 6748 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA7 protein_id gnl|my_center|LOCUS_02330 7496 6759 gene locus_tag LOCUS_02340 gene pdxJ 7496 6759 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEG8 protein_id gnl|my_center|LOCUS_02340 7906 7562 gene locus_tag LOCUS_02350 7906 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 7831 8997 gene locus_tag LOCUS_02360 7831 8997 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7F8 protein_id gnl|my_center|LOCUS_02360 9913 9125 gene locus_tag LOCUS_02370 9913 9125 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_02370 10508 9942 gene locus_tag LOCUS_02380 gene efp 10508 9942 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1B4 protein_id gnl|my_center|LOCUS_02380 10809 12476 gene locus_tag LOCUS_02390 gene fhs 10809 12476 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI03 protein_id gnl|my_center|LOCUS_02390 12610 13341 gene locus_tag LOCUS_02400 12610 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 13360 13719 gene locus_tag LOCUS_02410 13360 13719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 13738 14481 gene locus_tag LOCUS_02420 gene tmk 13738 14481 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MF63 protein_id gnl|my_center|LOCUS_02420 >Feature sequence015 1089 613 gene locus_tag LOCUS_02430 1089 613 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140033.1 protein_id gnl|my_center|LOCUS_02430 2165 1089 gene locus_tag LOCUS_02440 2165 1089 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 protein_id gnl|my_center|LOCUS_02440 2341 2255 gene locus_tag LOCUS_t00100 2341 2255 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2681 4669 gene locus_tag LOCUS_02450 2681 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 4794 6302 gene locus_tag LOCUS_02460 gene gpmI 4794 6302 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV10 protein_id gnl|my_center|LOCUS_02460 6391 7713 gene locus_tag LOCUS_02470 6391 7713 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_02470 7732 8211 gene locus_tag LOCUS_02480 gene rppH 7732 8211 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV14 protein_id gnl|my_center|LOCUS_02480 8214 8540 gene locus_tag LOCUS_02490 gene qacF 8214 8540 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004700493.1 protein_id gnl|my_center|LOCUS_02490 8752 10041 gene locus_tag LOCUS_02500 8752 10041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 11603 10167 gene locus_tag LOCUS_02510 11603 10167 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_02510 12617 11682 gene locus_tag LOCUS_02520 12617 11682 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_02520 13371 12619 gene locus_tag LOCUS_02530 13371 12619 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066753.1 protein_id gnl|my_center|LOCUS_02530 <14440 13586 gene locus_tag LOCUS_02540 <14440 13586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941811.1:hopanoid biosynthesis associated radical SAM protein HpnJ >Feature sequence016 1306 578 gene locus_tag LOCUS_02550 1306 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 2496 1306 gene locus_tag LOCUS_02560 gene argJ 2496 1306 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAK3 protein_id gnl|my_center|LOCUS_02560 2477 2632 gene locus_tag LOCUS_02570 2477 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 2637 3245 gene locus_tag LOCUS_02580 2637 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 3908 3267 gene locus_tag LOCUS_02590 3908 3267 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389482.1 protein_id gnl|my_center|LOCUS_02590 4237 3959 gene locus_tag LOCUS_02600 4237 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5114 4416 gene locus_tag LOCUS_02610 5114 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 5231 6169 gene locus_tag LOCUS_02620 5231 6169 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSJ7 protein_id gnl|my_center|LOCUS_02620 6230 7501 gene locus_tag LOCUS_02630 6230 7501 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086746.1 protein_id gnl|my_center|LOCUS_02630 7494 8291 gene locus_tag LOCUS_02640 gene rlmE 7494 8291 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Q5 protein_id gnl|my_center|LOCUS_02640 8373 9308 gene locus_tag LOCUS_02650 8373 9308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265509.1 protein_id gnl|my_center|LOCUS_02650 9404 9488 gene locus_tag LOCUS_t00110 9404 9488 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9608 10966 gene locus_tag LOCUS_02660 9608 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 10935 13058 gene locus_tag LOCUS_02670 10935 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 13055 13471 gene locus_tag LOCUS_02680 13055 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 14300 13764 gene locus_tag LOCUS_02690 14300 13764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 >Feature sequence017 <1 2250 gene locus_tag LOCUS_02700 <1 2250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P46710:phosphoenolpyruvate carboxylase 2254 3030 gene locus_tag LOCUS_02710 2254 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 3090 3404 gene locus_tag LOCUS_02720 gene trxA 3090 3404 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TC5 protein_id gnl|my_center|LOCUS_02720 4158 3436 gene locus_tag LOCUS_02730 4158 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4244 5047 gene locus_tag LOCUS_02740 4244 5047 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_02740 5178 6392 gene locus_tag LOCUS_02750 5178 6392 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRD7 protein_id gnl|my_center|LOCUS_02750 6411 7469 gene locus_tag LOCUS_02760 gene tsaD 6411 7469 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND2 protein_id gnl|my_center|LOCUS_02760 7473 8456 gene locus_tag LOCUS_02770 gene kdsD 7473 8456 CDS product KpsF/GutQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384625.1 protein_id gnl|my_center|LOCUS_02770 8468 8884 gene locus_tag LOCUS_02780 8468 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 8905 10518 gene locus_tag LOCUS_02790 gene lysS 8905 10518 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C6 protein_id gnl|my_center|LOCUS_02790 11370 10573 gene locus_tag LOCUS_02800 gene dapB 11370 10573 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP9 protein_id gnl|my_center|LOCUS_02800 12365 11382 gene locus_tag LOCUS_02810 12365 11382 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA6 protein_id gnl|my_center|LOCUS_02810 12477 13298 gene locus_tag LOCUS_02820 12477 13298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918193.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence018 2067 1207 gene locus_tag LOCUS_02830 2067 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083409.1 protein_id gnl|my_center|LOCUS_02830 3416 2073 gene locus_tag LOCUS_02840 3416 2073 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705719.1 protein_id gnl|my_center|LOCUS_02840 3951 3424 gene locus_tag LOCUS_02850 3951 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 5299 3944 gene locus_tag LOCUS_02860 5299 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089704.1 protein_id gnl|my_center|LOCUS_02860 6328 5309 gene locus_tag LOCUS_02870 6328 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510181.1 protein_id gnl|my_center|LOCUS_02870 8061 6292 gene locus_tag LOCUS_02880 8061 6292 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189792.1 protein_id gnl|my_center|LOCUS_02880 8515 8078 gene locus_tag LOCUS_02890 8515 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 10002 8527 gene locus_tag LOCUS_02900 10002 8527 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882966.1 protein_id gnl|my_center|LOCUS_02900 10554 10057 gene locus_tag LOCUS_02910 10554 10057 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705712.1 protein_id gnl|my_center|LOCUS_02910 11020 11427 gene locus_tag LOCUS_02920 11020 11427 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_02920 11530 12897 gene locus_tag LOCUS_02930 gene miaB 11530 12897 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5H0 protein_id gnl|my_center|LOCUS_02930 12894 13856 gene locus_tag LOCUS_02940 gene phoH 12894 13856 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083616.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence019 1263 508 gene locus_tag LOCUS_02950 1263 508 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCU1 protein_id gnl|my_center|LOCUS_02950 1702 1445 gene locus_tag LOCUS_02960 gene grxC 1702 1445 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721669.1 protein_id gnl|my_center|LOCUS_02960 2492 1695 gene locus_tag LOCUS_02970 gene comF 2492 1695 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083041.1 protein_id gnl|my_center|LOCUS_02970 3072 2746 gene locus_tag LOCUS_02980 3072 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 3346 3059 gene locus_tag LOCUS_02990 3346 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 3613 4632 gene locus_tag LOCUS_03000 3613 4632 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXW8 protein_id gnl|my_center|LOCUS_03000 5765 4629 gene locus_tag LOCUS_03010 gene dapE 5765 4629 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF28 protein_id gnl|my_center|LOCUS_03010 6612 5758 gene locus_tag LOCUS_03020 gene dapD 6612 5758 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIC6 protein_id gnl|my_center|LOCUS_03020 6840 9488 gene locus_tag LOCUS_03030 6840 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 12170 9513 gene locus_tag LOCUS_03040 12170 9513 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNJ0 protein_id gnl|my_center|LOCUS_03040 12393 13328 gene locus_tag LOCUS_03050 gene lipA 12393 13328 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GW82 protein_id gnl|my_center|LOCUS_03050 13691 13335 gene locus_tag LOCUS_03060 13691 13335 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088517.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence020 <1 1047 gene locus_tag LOCUS_03070 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141343.1:potassium transporter 1056 1730 gene locus_tag LOCUS_03080 1056 1730 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_03080 2440 1751 gene locus_tag LOCUS_03090 2440 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3271 2786 gene locus_tag LOCUS_03100 gene ssb 3271 2786 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89L50 protein_id gnl|my_center|LOCUS_03100 3592 5013 gene locus_tag LOCUS_03110 gene radA 3592 5013 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD4 protein_id gnl|my_center|LOCUS_03110 5290 5886 gene locus_tag LOCUS_03120 5290 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 5883 6554 gene locus_tag LOCUS_03130 5883 6554 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919529.1 protein_id gnl|my_center|LOCUS_03130 10174 6551 gene locus_tag LOCUS_03140 10174 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 12641 10395 gene locus_tag LOCUS_03150 gene parC 12641 10395 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT97 protein_id gnl|my_center|LOCUS_03150 12865 13773 gene locus_tag LOCUS_03160 gene rpoH 12865 13773 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CAW9 protein_id gnl|my_center|LOCUS_03160 >Feature sequence021 239 3 gene locus_tag LOCUS_03170 239 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 614 414 gene locus_tag LOCUS_03180 614 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 549 1382 gene locus_tag LOCUS_03190 gene ispH 549 1382 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8J6 protein_id gnl|my_center|LOCUS_03190 1397 1855 gene locus_tag LOCUS_03200 gene rnhA 1397 1855 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHA7 protein_id gnl|my_center|LOCUS_03200 1846 2304 gene locus_tag LOCUS_03210 1846 2304 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719802.1 protein_id gnl|my_center|LOCUS_03210 2301 2801 gene locus_tag LOCUS_03220 2301 2801 CDS product phosphatidylglycerophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_03220 2806 3336 gene locus_tag LOCUS_03230 gene def 2806 3336 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8K2 protein_id gnl|my_center|LOCUS_03230 3339 4253 gene locus_tag LOCUS_03240 gene fmt 3339 4253 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP00 protein_id gnl|my_center|LOCUS_03240 4250 4642 gene locus_tag LOCUS_03250 4250 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 4856 7411 gene locus_tag LOCUS_03260 gene clpB 4856 7411 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAM5 protein_id gnl|my_center|LOCUS_03260 7583 7900 gene locus_tag LOCUS_03270 7583 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 8037 9050 gene locus_tag LOCUS_03280 gene pdhA2 8037 9050 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBK1 protein_id gnl|my_center|LOCUS_03280 9065 10417 gene locus_tag LOCUS_03290 9065 10417 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389633.1 protein_id gnl|my_center|LOCUS_03290 10433 11707 gene locus_tag LOCUS_03300 gene pdhB 10433 11707 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3J1 protein_id gnl|my_center|LOCUS_03300 11720 13135 gene locus_tag LOCUS_03310 11720 13135 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT67 protein_id gnl|my_center|LOCUS_03310 >Feature sequence022 43 579 gene locus_tag LOCUS_03320 43 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 1385 780 gene locus_tag LOCUS_03330 1385 780 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_03330 2208 1372 gene locus_tag LOCUS_03340 gene ada 2208 1372 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_03340 3112 2315 gene locus_tag LOCUS_03350 3112 2315 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529680.1 protein_id gnl|my_center|LOCUS_03350 3580 3158 gene locus_tag LOCUS_03360 gene ndk 3580 3158 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MS3 protein_id gnl|my_center|LOCUS_03360 3513 3785 gene locus_tag LOCUS_03370 3513 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 4000 5019 gene locus_tag LOCUS_03380 gene bztA 4000 5019 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 protein_id gnl|my_center|LOCUS_03380 5134 6672 gene locus_tag LOCUS_03390 5134 6672 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385288.1 protein_id gnl|my_center|LOCUS_03390 6674 9478 gene locus_tag LOCUS_03400 6674 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 9540 10283 gene locus_tag LOCUS_03410 9540 10283 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388756.1 protein_id gnl|my_center|LOCUS_03410 11718 10306 gene locus_tag LOCUS_03420 11718 10306 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSV0 protein_id gnl|my_center|LOCUS_03420 11823 13199 gene locus_tag LOCUS_03430 gene glnA 11823 13199 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037491.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence023 1246 1058 gene locus_tag LOCUS_03440 1246 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 1524 2741 gene locus_tag LOCUS_03450 1524 2741 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531361.1 protein_id gnl|my_center|LOCUS_03450 2793 3632 gene locus_tag LOCUS_03460 2793 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 3730 4233 gene locus_tag LOCUS_03470 gene accB 3730 4233 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262775.1 protein_id gnl|my_center|LOCUS_03470 4329 5600 gene locus_tag LOCUS_03480 gene accC 4329 5600 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537788.1 protein_id gnl|my_center|LOCUS_03480 5805 6038 gene locus_tag LOCUS_03490 gene acpP 5805 6038 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC3 protein_id gnl|my_center|LOCUS_03490 6160 7425 gene locus_tag LOCUS_03500 6160 7425 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC2 protein_id gnl|my_center|LOCUS_03500 7442 8431 gene locus_tag LOCUS_03510 7442 8431 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919550.1 protein_id gnl|my_center|LOCUS_03510 8532 9341 gene locus_tag LOCUS_03520 8532 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 9307 9471 gene locus_tag LOCUS_03530 9307 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 9478 9714 gene locus_tag LOCUS_03540 9478 9714 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088461.1 protein_id gnl|my_center|LOCUS_03540 9721 10563 gene locus_tag LOCUS_03550 gene dapF 9721 10563 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y853 protein_id gnl|my_center|LOCUS_03550 10560 11834 gene locus_tag LOCUS_03560 10560 11834 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388937.1 protein_id gnl|my_center|LOCUS_03560 >Feature sequence024 261 1721 gene locus_tag LOCUS_03570 gene gatB 261 1721 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U821 protein_id gnl|my_center|LOCUS_03570 1718 2668 gene locus_tag LOCUS_03580 1718 2668 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 protein_id gnl|my_center|LOCUS_03580 2678 2872 gene locus_tag LOCUS_03590 2678 2872 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABW2 protein_id gnl|my_center|LOCUS_03590 3154 2885 gene locus_tag LOCUS_03600 3154 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 4587 3163 gene locus_tag LOCUS_03610 gene atpD 4587 3163 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV18 protein_id gnl|my_center|LOCUS_03610 5518 4625 gene locus_tag LOCUS_03620 gene atpG 5518 4625 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV19 protein_id gnl|my_center|LOCUS_03620 7121 5589 gene locus_tag LOCUS_03630 gene atpA 7121 5589 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV20 protein_id gnl|my_center|LOCUS_03630 7888 7121 gene locus_tag LOCUS_03640 7888 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 9572 7926 gene locus_tag LOCUS_03650 9572 7926 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529012.1 protein_id gnl|my_center|LOCUS_03650 11039 9732 gene locus_tag LOCUS_03660 gene sun 11039 9732 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_03660 11950 11039 gene locus_tag LOCUS_03670 gene htpX 11950 11039 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KX3 protein_id gnl|my_center|LOCUS_03670 12430 11996 gene locus_tag LOCUS_03680 12430 11996 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090878.1 protein_id gnl|my_center|LOCUS_03680 >Feature sequence025 3470 8878 gene locus_tag LOCUS_03690 3470 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 8939 10375 gene locus_tag LOCUS_03700 gene glcD 8939 10375 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338664.1 protein_id gnl|my_center|LOCUS_03700 10372 11457 gene locus_tag LOCUS_03710 gene glcE 10372 11457 CDS product 2-hydroxy-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968809.1 protein_id gnl|my_center|LOCUS_03710 >Feature sequence026 1532 264 gene locus_tag LOCUS_03720 1532 264 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH7 protein_id gnl|my_center|LOCUS_03720 2102 1569 gene locus_tag LOCUS_03730 2102 1569 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV52 protein_id gnl|my_center|LOCUS_03730 2487 2978 gene locus_tag LOCUS_03740 2487 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 2971 3714 gene locus_tag LOCUS_03750 gene atpB 2971 3714 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA4 protein_id gnl|my_center|LOCUS_03750 3762 3986 gene locus_tag LOCUS_03760 gene atpE 3762 3986 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA5 protein_id gnl|my_center|LOCUS_03760 4221 4709 gene locus_tag LOCUS_03770 gene atpF 4221 4709 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C3F7 protein_id gnl|my_center|LOCUS_03770 4713 5312 gene locus_tag LOCUS_03780 4713 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 5354 5560 gene locus_tag LOCUS_03790 5354 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 5564 6127 gene locus_tag LOCUS_03800 5564 6127 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_03800 6189 7409 gene locus_tag LOCUS_03810 gene lysA 6189 7409 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8H9 protein_id gnl|my_center|LOCUS_03810 9203 7413 gene locus_tag LOCUS_03820 9203 7413 CDS product elongation factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_03820 9645 9205 gene locus_tag LOCUS_03830 9645 9205 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709924.1 protein_id gnl|my_center|LOCUS_03830 9771 10466 gene locus_tag LOCUS_03840 gene yiaD 9771 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422307.1 protein_id gnl|my_center|LOCUS_03840 10677 10516 gene locus_tag LOCUS_03850 10677 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 11435 10863 gene locus_tag LOCUS_03860 11435 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence027 <1 2335 gene locus_tag LOCUS_03870 <1 2335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083576.1:double-strand break repair protein AddB 2332 5733 gene locus_tag LOCUS_03880 2332 5733 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_03880 5814 7607 gene locus_tag LOCUS_03890 5814 7607 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066900.1 protein_id gnl|my_center|LOCUS_03890 9490 8057 gene locus_tag LOCUS_03900 gene der 9490 8057 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPR6 protein_id gnl|my_center|LOCUS_03900 10873 9521 gene locus_tag LOCUS_03910 gene bamB 10873 9521 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S13 protein_id gnl|my_center|LOCUS_03910 11635 10946 gene locus_tag LOCUS_03920 11635 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence028 1202 1327 gene locus_tag LOCUS_03930 1202 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 1329 1577 gene locus_tag LOCUS_03940 1329 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 1564 2001 gene locus_tag LOCUS_03950 1564 2001 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225858.1 protein_id gnl|my_center|LOCUS_03950 3140 2310 gene locus_tag LOCUS_03960 3140 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 4681 3146 gene locus_tag LOCUS_03970 4681 3146 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_03970 4894 5313 gene locus_tag LOCUS_03980 4894 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 5921 5379 gene locus_tag LOCUS_03990 5921 5379 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB07 protein_id gnl|my_center|LOCUS_03990 7214 5988 gene locus_tag LOCUS_04000 7214 5988 CDS product DNA packaging protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975977.1 protein_id gnl|my_center|LOCUS_04000 7728 7327 gene locus_tag LOCUS_04010 7728 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 9021 7957 gene locus_tag LOCUS_04020 9021 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 9787 9014 gene locus_tag LOCUS_04030 9787 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 10354 9890 gene locus_tag LOCUS_04040 10354 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 10814 10368 gene locus_tag LOCUS_04050 10814 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 11424 10939 gene locus_tag LOCUS_04060 11424 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence029 66 695 gene locus_tag LOCUS_04070 66 695 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527453.1 protein_id gnl|my_center|LOCUS_04070 658 1680 gene locus_tag LOCUS_04080 gene queA 658 1680 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXQ9 protein_id gnl|my_center|LOCUS_04080 1677 2807 gene locus_tag LOCUS_04090 gene tgt 1677 2807 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR0 protein_id gnl|my_center|LOCUS_04090 2804 3916 gene locus_tag LOCUS_04100 gene queG 2804 3916 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WH3 protein_id gnl|my_center|LOCUS_04100 4591 4031 gene locus_tag LOCUS_04110 4591 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_04110 8050 4592 gene locus_tag LOCUS_04120 8050 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 9181 8054 gene locus_tag LOCUS_04130 9181 8054 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484214.1 protein_id gnl|my_center|LOCUS_04130 9664 9347 gene locus_tag LOCUS_04140 9664 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 10986 9898 gene locus_tag LOCUS_04150 10986 9898 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QE9 protein_id gnl|my_center|LOCUS_04150 >Feature sequence030 363 878 gene locus_tag LOCUS_04160 363 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04160 842 1651 gene locus_tag LOCUS_04170 842 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04170 1893 3116 gene locus_tag LOCUS_04180 1893 3116 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9J2 protein_id gnl|my_center|LOCUS_04180 3119 4888 gene locus_tag LOCUS_04190 gene argS 3119 4888 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J281 protein_id gnl|my_center|LOCUS_04190 4919 6307 gene locus_tag LOCUS_04200 4919 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 6304 7011 gene locus_tag LOCUS_04210 6304 7011 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088307.1 protein_id gnl|my_center|LOCUS_04210 7011 7310 gene locus_tag LOCUS_04220 7011 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 7370 8311 gene locus_tag LOCUS_04230 gene ctaB 7370 8311 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJX3 protein_id gnl|my_center|LOCUS_04230 8333 8485 gene locus_tag LOCUS_04240 8333 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 8537 9049 gene locus_tag LOCUS_04250 8537 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 9099 9992 gene locus_tag LOCUS_04260 gene coxC 9099 9992 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921231.1 protein_id gnl|my_center|LOCUS_04260 10135 10515 gene locus_tag LOCUS_04270 10135 10515 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532773.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence031 3979 1268 gene locus_tag LOCUS_04280 gene gyrA 3979 1268 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK1 protein_id gnl|my_center|LOCUS_04280 5200 4133 gene locus_tag LOCUS_04290 5200 4133 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031356.1 protein_id gnl|my_center|LOCUS_04290 6036 5197 gene locus_tag LOCUS_04300 gene iolB 6036 5197 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973914.1 protein_id gnl|my_center|LOCUS_04300 6820 6050 gene locus_tag LOCUS_04310 6820 6050 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 protein_id gnl|my_center|LOCUS_04310 7903 6824 gene locus_tag LOCUS_04320 7903 6824 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223779.1 protein_id gnl|my_center|LOCUS_04320 8943 8011 gene locus_tag LOCUS_04330 8943 8011 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192875.1 protein_id gnl|my_center|LOCUS_04330 9194 10114 gene locus_tag LOCUS_04340 9194 10114 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528373.1 protein_id gnl|my_center|LOCUS_04340 10175 10972 gene locus_tag LOCUS_04350 gene iolR 10175 10972 CDS product sigma factor regulator FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919174.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence032 701 171 gene locus_tag LOCUS_04360 701 171 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123279.1 protein_id gnl|my_center|LOCUS_04360 2819 996 gene locus_tag LOCUS_04370 gene glmS 2819 996 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX1 protein_id gnl|my_center|LOCUS_04370 4161 2824 gene locus_tag LOCUS_04380 gene glmU 4161 2824 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 protein_id gnl|my_center|LOCUS_04380 6717 4357 gene locus_tag LOCUS_04390 6717 4357 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_04390 8000 6849 gene locus_tag LOCUS_04400 8000 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence033 487 4188 gene locus_tag LOCUS_04410 487 4188 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390194.1 protein_id gnl|my_center|LOCUS_04410 5284 4232 gene locus_tag LOCUS_04420 5284 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076381.1 protein_id gnl|my_center|LOCUS_04420 6458 5346 gene locus_tag LOCUS_04430 6458 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082911.1 protein_id gnl|my_center|LOCUS_04430 7590 6505 gene locus_tag LOCUS_04440 7590 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 7987 7592 gene locus_tag LOCUS_04450 7987 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754946.1 protein_id gnl|my_center|LOCUS_04450 8408 8016 gene locus_tag LOCUS_04460 8408 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717843.1 protein_id gnl|my_center|LOCUS_04460 9574 8663 gene locus_tag LOCUS_04470 9574 8663 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140202.1 protein_id gnl|my_center|LOCUS_04470 9905 9606 gene locus_tag LOCUS_04480 9905 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 protein_id gnl|my_center|LOCUS_04480 <10518 9993 gene locus_tag LOCUS_04490 <10518 9993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89GB0:2-isopropylmalate synthase >Feature sequence034 195 554 gene locus_tag LOCUS_04500 gene rplW 195 554 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW2 protein_id gnl|my_center|LOCUS_04500 568 1395 gene locus_tag LOCUS_04510 gene rplB 568 1395 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW3 protein_id gnl|my_center|LOCUS_04510 1413 1691 gene locus_tag LOCUS_04520 gene rpsS 1413 1691 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW4 protein_id gnl|my_center|LOCUS_04520 1703 2086 gene locus_tag LOCUS_04530 gene rplV 1703 2086 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5D2 protein_id gnl|my_center|LOCUS_04530 2086 2817 gene locus_tag LOCUS_04540 gene rpsC 2086 2817 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW6 protein_id gnl|my_center|LOCUS_04540 2821 3243 gene locus_tag LOCUS_04550 gene rplP 2821 3243 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW7 protein_id gnl|my_center|LOCUS_04550 3249 3470 gene locus_tag LOCUS_04560 gene rpmC 3249 3470 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRH5 protein_id gnl|my_center|LOCUS_04560 3476 3715 gene locus_tag LOCUS_04570 gene rpsQ 3476 3715 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCR4 protein_id gnl|my_center|LOCUS_04570 3772 4140 gene locus_tag LOCUS_04580 gene rplN 3772 4140 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAZ0 protein_id gnl|my_center|LOCUS_04580 4155 4487 gene locus_tag LOCUS_04590 gene rplX 4155 4487 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 protein_id gnl|my_center|LOCUS_04590 4487 5047 gene locus_tag LOCUS_04600 gene rplE 4487 5047 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX2 protein_id gnl|my_center|LOCUS_04600 5040 5345 gene locus_tag LOCUS_04610 gene rpsN 5040 5345 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5C4 protein_id gnl|my_center|LOCUS_04610 5361 5759 gene locus_tag LOCUS_04620 gene rpsH 5361 5759 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX4 protein_id gnl|my_center|LOCUS_04620 5772 6305 gene locus_tag LOCUS_04630 gene rplF 5772 6305 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QF5 protein_id gnl|my_center|LOCUS_04630 6308 6670 gene locus_tag LOCUS_04640 gene rplR 6308 6670 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZAE3 protein_id gnl|my_center|LOCUS_04640 6689 7243 gene locus_tag LOCUS_04650 gene rpsE 6689 7243 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y5C0 protein_id gnl|my_center|LOCUS_04650 7279 7458 gene locus_tag LOCUS_04660 gene rpmD 7279 7458 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SZ5 protein_id gnl|my_center|LOCUS_04660 7467 7961 gene locus_tag LOCUS_04670 gene rplO 7467 7961 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX9 protein_id gnl|my_center|LOCUS_04670 8002 9393 gene locus_tag LOCUS_04680 gene secY 8002 9393 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U879 protein_id gnl|my_center|LOCUS_04680 9390 10037 gene locus_tag LOCUS_04690 gene adk 9390 10037 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0D2 protein_id gnl|my_center|LOCUS_04690 >Feature sequence035 1043 375 gene locus_tag LOCUS_04700 gene pyrE 1043 375 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J555 protein_id gnl|my_center|LOCUS_04700 1511 1107 gene locus_tag LOCUS_04710 1511 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 1668 2621 gene locus_tag LOCUS_04720 gene miaA 1668 2621 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX74 protein_id gnl|my_center|LOCUS_04720 2697 4505 gene locus_tag LOCUS_04730 2697 4505 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX73 protein_id gnl|my_center|LOCUS_04730 4613 7651 gene locus_tag LOCUS_04740 4613 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence036 <1 1148 gene locus_tag LOCUS_04750 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143588.1:myeloperoxidase 1825 1154 gene locus_tag LOCUS_04760 1825 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 2019 4484 gene locus_tag LOCUS_04770 2019 4484 CDS product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971758.1 protein_id gnl|my_center|LOCUS_04770 4739 6193 gene locus_tag LOCUS_04780 gene hsdM 4739 6193 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242272.1 protein_id gnl|my_center|LOCUS_04780 6193 7377 gene locus_tag LOCUS_04790 6193 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 >Feature sequence037 697 969 gene locus_tag LOCUS_04800 697 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 1461 1778 gene locus_tag LOCUS_04810 1461 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 1995 2429 gene locus_tag LOCUS_04820 1995 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2636 2421 gene locus_tag LOCUS_04830 2636 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3162 2719 gene locus_tag LOCUS_04840 3162 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3548 3243 gene locus_tag LOCUS_04850 3548 3243 CDS product ETC complex I subunit region inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389336.1 protein_id gnl|my_center|LOCUS_04850 4230 3712 gene locus_tag LOCUS_04860 4230 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 4365 5759 gene locus_tag LOCUS_04870 gene argH 4365 5759 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY2 protein_id gnl|my_center|LOCUS_04870 5891 6496 gene locus_tag LOCUS_04880 5891 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 <9486 6566 gene locus_tag LOCUS_04890 <9486 6566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256120.1:CSLREA domain-containing protein >Feature sequence038 628 1449 gene locus_tag LOCUS_04900 628 1449 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338394.1 protein_id gnl|my_center|LOCUS_04900 3232 1469 gene locus_tag LOCUS_04910 3232 1469 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_04910 3706 4221 gene locus_tag LOCUS_04920 3706 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142947.1 protein_id gnl|my_center|LOCUS_04920 4278 4526 gene locus_tag LOCUS_04930 4278 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4772 5242 gene locus_tag LOCUS_04940 4772 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5266 5691 gene locus_tag LOCUS_04950 5266 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 5688 6530 gene locus_tag LOCUS_04960 5688 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208561.1 protein_id gnl|my_center|LOCUS_04960 6543 8720 gene locus_tag LOCUS_04970 6543 8720 CDS product type VI secretion protein Vgr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211400.1 protein_id gnl|my_center|LOCUS_04970 8720 9277 gene locus_tag LOCUS_04980 8720 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence039 390 127 gene locus_tag LOCUS_04990 390 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1779 397 gene locus_tag LOCUS_05000 1779 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5405 1782 gene locus_tag LOCUS_05010 5405 1782 CDS product type VI secretion protein IcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882971.1 protein_id gnl|my_center|LOCUS_05010 6302 5430 gene locus_tag LOCUS_05020 6302 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 7828 6281 gene locus_tag LOCUS_05030 7828 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 9414 7831 gene locus_tag LOCUS_05040 9414 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence040 16 381 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtatagcttttcagagttcacggtcaagccgcaac 465 556 gene locus_tag LOCUS_t00120 465 556 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 781 5670 gene locus_tag LOCUS_05050 781 5670 CDS product DNA damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102960.1 protein_id gnl|my_center|LOCUS_05050 6274 5789 gene locus_tag LOCUS_05060 6274 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 6344 7162 gene locus_tag LOCUS_05070 6344 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 7159 8304 gene locus_tag LOCUS_05080 7159 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388904.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence041 2510 843 gene locus_tag LOCUS_05090 2510 843 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_05090 3227 2526 gene locus_tag LOCUS_05100 3227 2526 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_05100 3690 3505 gene locus_tag LOCUS_05110 3690 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 4598 3687 gene locus_tag LOCUS_05120 4598 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 5598 5026 gene locus_tag LOCUS_05130 gene rplI 5598 5026 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1L9 protein_id gnl|my_center|LOCUS_05130 5907 5623 gene locus_tag LOCUS_05140 gene rpsR 5907 5623 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q2 protein_id gnl|my_center|LOCUS_05140 6372 5911 gene locus_tag LOCUS_05150 6372 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 7893 6595 gene locus_tag LOCUS_05160 7893 6595 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388542.1 protein_id gnl|my_center|LOCUS_05160 8069 8533 gene locus_tag LOCUS_05170 8069 8533 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205209.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence042 1298 681 gene locus_tag LOCUS_05180 1298 681 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701134.1 protein_id gnl|my_center|LOCUS_05180 3452 1305 gene locus_tag LOCUS_05190 3452 1305 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532662.1 protein_id gnl|my_center|LOCUS_05190 3580 4791 gene locus_tag LOCUS_05200 gene sucC 3580 4791 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV33 protein_id gnl|my_center|LOCUS_05200 4794 5669 gene locus_tag LOCUS_05210 4794 5669 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV32 protein_id gnl|my_center|LOCUS_05210 5906 6376 gene locus_tag LOCUS_05220 gene PtsN 5906 6376 CDS product PTS lactose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721599.1 protein_id gnl|my_center|LOCUS_05220 7194 6373 gene locus_tag LOCUS_05230 7194 6373 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGY7 protein_id gnl|my_center|LOCUS_05230 7418 8284 gene locus_tag LOCUS_05240 gene era 7418 8284 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8S5 protein_id gnl|my_center|LOCUS_05240 8399 9136 gene locus_tag LOCUS_05250 8399 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence043 <1 1739 gene locus_tag LOCUS_05260 <1 1739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974874.1:lytic transglycosylase 1745 2734 gene locus_tag LOCUS_05270 1745 2734 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528653.1 protein_id gnl|my_center|LOCUS_05270 3302 4399 gene locus_tag LOCUS_05280 3302 4399 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE0 protein_id gnl|my_center|LOCUS_05280 4487 4562 gene locus_tag LOCUS_t00130 4487 4562 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4680 4862 gene locus_tag LOCUS_05290 gene secE 4680 4862 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J67 protein_id gnl|my_center|LOCUS_05290 4865 5404 gene locus_tag LOCUS_05300 gene nusG 4865 5404 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQU8 protein_id gnl|my_center|LOCUS_05300 5583 5891 gene locus_tag LOCUS_05310 gene rpmB 5583 5891 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXY0 protein_id gnl|my_center|LOCUS_05310 6172 5909 gene locus_tag LOCUS_05320 6172 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 7392 6208 gene locus_tag LOCUS_05330 7392 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 9217 7379 gene locus_tag LOCUS_05340 gene nolO 9217 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887298.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence044 988 2184 gene locus_tag LOCUS_05350 988 2184 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_05350 2204 3802 gene locus_tag LOCUS_05360 gene serA 2204 3802 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 protein_id gnl|my_center|LOCUS_05360 3811 4728 gene locus_tag LOCUS_05370 3811 4728 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388224.1 protein_id gnl|my_center|LOCUS_05370 4842 6296 gene locus_tag LOCUS_05380 4842 6296 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABD8 protein_id gnl|my_center|LOCUS_05380 6314 7549 gene locus_tag LOCUS_05390 gene pstA 6314 7549 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKA5 protein_id gnl|my_center|LOCUS_05390 7658 8431 gene locus_tag LOCUS_05400 gene pstB 7658 8431 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J376 protein_id gnl|my_center|LOCUS_05400 >Feature sequence045 70 1758 gene locus_tag LOCUS_05410 70 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 3276 2344 gene locus_tag LOCUS_05420 3276 2344 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_05420 3924 3304 gene locus_tag LOCUS_05430 gene gmhA 3924 3304 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EQ4 protein_id gnl|my_center|LOCUS_05430 4666 3938 gene locus_tag LOCUS_05440 4666 3938 CDS product nucleoside-diphosphate-sugar pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966337.1 protein_id gnl|my_center|LOCUS_05440 5851 4679 gene locus_tag LOCUS_05450 5851 4679 CDS product CDP-4-keto-6-deoxy-D-glucose-3-dehydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_05450 6855 5848 gene locus_tag LOCUS_05460 6855 5848 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_05460 7711 6848 gene locus_tag LOCUS_05470 7711 6848 CDS product transketolase, N-terminal subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228762.1 protein_id gnl|my_center|LOCUS_05470 <8436 7683 gene locus_tag LOCUS_05480 <8436 7683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B7K6:GDP-L-fucose synthase >Feature sequence046 271 720 gene locus_tag LOCUS_05490 gene osmC 271 720 CDS product redox protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033743.1 protein_id gnl|my_center|LOCUS_05490 742 1542 gene locus_tag LOCUS_05500 gene fadB 742 1542 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087728.1 protein_id gnl|my_center|LOCUS_05500 1535 3232 gene locus_tag LOCUS_05510 1535 3232 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532916.1 protein_id gnl|my_center|LOCUS_05510 3290 4360 gene locus_tag LOCUS_05520 3290 4360 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 protein_id gnl|my_center|LOCUS_05520 5100 4378 gene locus_tag LOCUS_05530 5100 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 5249 5440 gene locus_tag LOCUS_05540 5249 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 6542 5508 gene locus_tag LOCUS_05550 gene recA 6542 5508 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH9 protein_id gnl|my_center|LOCUS_05550 7194 6715 gene locus_tag LOCUS_05560 gene dksA 7194 6715 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J325 protein_id gnl|my_center|LOCUS_05560 8145 7219 gene locus_tag LOCUS_05570 gene metA 8145 7219 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDX7 protein_id gnl|my_center|LOCUS_05570 >Feature sequence047 869 1126 gene locus_tag LOCUS_05580 869 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 1133 2047 gene locus_tag LOCUS_05590 gene ispA 1133 2047 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261435.1 protein_id gnl|my_center|LOCUS_05590 2091 3977 gene locus_tag LOCUS_05600 gene dxs1 2091 3977 CDS product 1-deoxy-D-xylulose-5-phosphate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYD6 protein_id gnl|my_center|LOCUS_05600 3974 5278 gene locus_tag LOCUS_05610 3974 5278 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8M7 protein_id gnl|my_center|LOCUS_05610 5907 5275 gene locus_tag LOCUS_05620 5907 5275 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TB14 protein_id gnl|my_center|LOCUS_05620 6028 7560 gene locus_tag LOCUS_05630 gene purH 6028 7560 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN46 protein_id gnl|my_center|LOCUS_05630 >Feature sequence048 401 1438 gene locus_tag LOCUS_05640 401 1438 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337670.1 protein_id gnl|my_center|LOCUS_05640 1456 2811 gene locus_tag LOCUS_05650 1456 2811 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530884.1 protein_id gnl|my_center|LOCUS_05650 2818 4938 gene locus_tag LOCUS_05660 2818 4938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 protein_id gnl|my_center|LOCUS_05660 5089 5490 gene locus_tag LOCUS_05670 gene apaG 5089 5490 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UI68 protein_id gnl|my_center|LOCUS_05670 5501 6961 gene locus_tag LOCUS_05680 gene trkH 5501 6961 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ30 protein_id gnl|my_center|LOCUS_05680 7773 6958 gene locus_tag LOCUS_05690 7773 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence049 196 1605 gene locus_tag LOCUS_05700 196 1605 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067561.1 protein_id gnl|my_center|LOCUS_05700 1571 2479 gene locus_tag LOCUS_05710 1571 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 3126 2581 gene locus_tag LOCUS_05720 3126 2581 CDS product ferrichrome ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261925.1 protein_id gnl|my_center|LOCUS_05720 4876 3392 gene locus_tag LOCUS_05730 4876 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 5610 5428 gene locus_tag LOCUS_05740 5610 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 5775 6668 gene locus_tag LOCUS_05750 gene xerD 5775 6668 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGX8 protein_id gnl|my_center|LOCUS_05750 6764 7738 gene locus_tag LOCUS_05760 6764 7738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 7955 7746 gene locus_tag LOCUS_05770 7955 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 >Feature sequence050 714 85 gene locus_tag LOCUS_05780 714 85 CDS product antioxidant protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114495.1 protein_id gnl|my_center|LOCUS_05780 1310 2758 gene locus_tag LOCUS_05790 1310 2758 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD0 protein_id gnl|my_center|LOCUS_05790 2762 3838 gene locus_tag LOCUS_05800 gene alr 2762 3838 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Q9 protein_id gnl|my_center|LOCUS_05800 3898 4854 gene locus_tag LOCUS_05810 3898 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4865 5812 gene locus_tag LOCUS_05820 gene trxB 4865 5812 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DQ9 protein_id gnl|my_center|LOCUS_05820 6358 5864 gene locus_tag LOCUS_05830 6358 5864 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706636.1 protein_id gnl|my_center|LOCUS_05830 8095 6617 gene locus_tag LOCUS_05840 gene lnt 8095 6617 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS7 protein_id gnl|my_center|LOCUS_05840 >Feature sequence051 <1 1511 gene locus_tag LOCUS_05850 <1 1511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483461.1:sigma-54-dependent Fis family transcriptional regulator 1726 2460 gene locus_tag LOCUS_05860 1726 2460 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709723.1 protein_id gnl|my_center|LOCUS_05860 3234 2587 gene locus_tag LOCUS_05870 3234 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5019 3238 gene locus_tag LOCUS_05880 5019 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 5890 5126 gene locus_tag LOCUS_05890 5890 5126 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337097.1 protein_id gnl|my_center|LOCUS_05890 5996 7744 gene locus_tag LOCUS_05900 gene mnmC 5996 7744 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_05900 >Feature sequence052 1202 1546 gene locus_tag LOCUS_05910 1202 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 1547 1795 gene locus_tag LOCUS_05920 1547 1795 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K9 protein_id gnl|my_center|LOCUS_05920 1801 3684 gene locus_tag LOCUS_05930 gene yidC 1801 3684 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP12 protein_id gnl|my_center|LOCUS_05930 3684 4421 gene locus_tag LOCUS_05940 gene engB 3684 4421 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UIB4 protein_id gnl|my_center|LOCUS_05940 4460 5311 gene locus_tag LOCUS_05950 gene argB 4460 5311 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP10 protein_id gnl|my_center|LOCUS_05950 5610 6839 gene locus_tag LOCUS_05960 5610 6839 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337346.1 protein_id gnl|my_center|LOCUS_05960 6898 7158 gene locus_tag LOCUS_05970 6898 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 7551 8072 gene locus_tag LOCUS_05980 7551 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence053 321 2912 gene locus_tag LOCUS_05990 321 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 3690 2935 gene locus_tag LOCUS_06000 3690 2935 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ44 protein_id gnl|my_center|LOCUS_06000 3799 4701 gene locus_tag LOCUS_06010 gene ubiA 3799 4701 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U6Q4 protein_id gnl|my_center|LOCUS_06010 6082 4733 gene locus_tag LOCUS_06020 6082 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 6900 6079 gene locus_tag LOCUS_06030 6900 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 7480 6890 gene locus_tag LOCUS_06040 7480 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 8106 7489 gene locus_tag LOCUS_06050 8106 7489 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921430.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence054 53 679 gene locus_tag LOCUS_06060 53 679 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_06060 2358 682 gene locus_tag LOCUS_06070 2358 682 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_06070 3195 2476 gene locus_tag LOCUS_06080 3195 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970604.1 protein_id gnl|my_center|LOCUS_06080 3584 3192 gene locus_tag LOCUS_06090 3584 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4386 3541 gene locus_tag LOCUS_06100 gene rsmI 4386 3541 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFQ0 protein_id gnl|my_center|LOCUS_06100 5537 4383 gene locus_tag LOCUS_06110 gene hemN 5537 4383 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310172.1 protein_id gnl|my_center|LOCUS_06110 6208 5540 gene locus_tag LOCUS_06120 6208 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 6831 6400 gene locus_tag LOCUS_06130 gene aroQ 6831 6400 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IWV4 protein_id gnl|my_center|LOCUS_06130 <8044 6887 gene locus_tag LOCUS_06140 <8044 6887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390806.1:suppressor for copper-sensitivity B >Feature sequence055 1066 1872 gene locus_tag LOCUS_06150 1066 1872 CDS product phenazine antibiotic biosynthesis-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709313.1 protein_id gnl|my_center|LOCUS_06150 1941 3725 gene locus_tag LOCUS_06160 1941 3725 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390040.1 protein_id gnl|my_center|LOCUS_06160 5428 3761 gene locus_tag LOCUS_06170 5428 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 5917 5534 gene locus_tag LOCUS_06180 5917 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 6092 6685 gene locus_tag LOCUS_06190 6092 6685 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLL9 protein_id gnl|my_center|LOCUS_06190 6715 7953 gene locus_tag LOCUS_06200 6715 7953 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI4 protein_id gnl|my_center|LOCUS_06200 >Feature sequence056 70 1158 gene locus_tag LOCUS_06210 70 1158 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_06210 1286 2047 gene locus_tag LOCUS_06220 1286 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 2061 4121 gene locus_tag LOCUS_06230 2061 4121 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528213.1 protein_id gnl|my_center|LOCUS_06230 6987 4171 gene locus_tag LOCUS_06240 gene gcvP 6987 4171 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I86 protein_id gnl|my_center|LOCUS_06240 7445 7095 gene locus_tag LOCUS_06250 gene gcvH 7445 7095 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_06250 <8027 7489 gene locus_tag LOCUS_06260 <8027 7489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPU9:aminomethyltransferase >Feature sequence057 <1 1648 gene locus_tag LOCUS_06270 <1 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090838.1:DNA polymerase III subunit gamma/tau 1684 2007 gene locus_tag LOCUS_06280 1684 2007 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF9 protein_id gnl|my_center|LOCUS_06280 2014 2601 gene locus_tag LOCUS_06290 gene recR 2014 2601 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BN4 protein_id gnl|my_center|LOCUS_06290 3631 2645 gene locus_tag LOCUS_06300 3631 2645 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883255.1 protein_id gnl|my_center|LOCUS_06300 4042 3665 gene locus_tag LOCUS_06310 4042 3665 CDS product global cell cycle regulator GcrA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_06310 4285 5583 gene locus_tag LOCUS_06320 4285 5583 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCK6 protein_id gnl|my_center|LOCUS_06320 6370 5636 gene locus_tag LOCUS_06330 gene radC 6370 5636 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385427.1 protein_id gnl|my_center|LOCUS_06330 7197 6385 gene locus_tag LOCUS_06340 gene map 7197 6385 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF8 protein_id gnl|my_center|LOCUS_06340 <7879 7224 gene locus_tag LOCUS_06350 <7879 7224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8H0Z4:sugar fermentation stimulation protein >Feature sequence058 1126 176 gene locus_tag LOCUS_06360 gene accA 1126 176 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXX2 protein_id gnl|my_center|LOCUS_06360 1705 1181 gene locus_tag LOCUS_06370 gene ppa 1705 1181 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC37 protein_id gnl|my_center|LOCUS_06370 3007 1772 gene locus_tag LOCUS_06380 3007 1772 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106438.1 protein_id gnl|my_center|LOCUS_06380 3926 3000 gene locus_tag LOCUS_06390 gene thiL 3926 3000 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY5 protein_id gnl|my_center|LOCUS_06390 5208 3919 gene locus_tag LOCUS_06400 5208 3919 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_06400 6650 5205 gene locus_tag LOCUS_06410 6650 5205 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390412.1 protein_id gnl|my_center|LOCUS_06410 7570 6779 gene locus_tag LOCUS_06420 7570 6779 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384819.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence059 557 6 gene locus_tag LOCUS_06430 557 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 734 2452 gene locus_tag LOCUS_06440 734 2452 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933520.1 protein_id gnl|my_center|LOCUS_06440 2498 3610 gene locus_tag LOCUS_06450 2498 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4383 3622 gene locus_tag LOCUS_06460 4383 3622 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389389.1 protein_id gnl|my_center|LOCUS_06460 5174 4380 gene locus_tag LOCUS_06470 5174 4380 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531574.1 protein_id gnl|my_center|LOCUS_06470 6719 5178 gene locus_tag LOCUS_06480 gene metG 6719 5178 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP4 protein_id gnl|my_center|LOCUS_06480 6929 7243 gene locus_tag LOCUS_06490 gene rplU 6929 7243 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F3 protein_id gnl|my_center|LOCUS_06490 7288 7554 gene locus_tag LOCUS_06500 gene rpmA 7288 7554 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y970 protein_id gnl|my_center|LOCUS_06500 >Feature sequence060 704 1582 gene locus_tag LOCUS_06510 704 1582 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532622.1 protein_id gnl|my_center|LOCUS_06510 1586 3457 gene locus_tag LOCUS_06520 1586 3457 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_06520 3458 4000 gene locus_tag LOCUS_06530 3458 4000 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_06530 4005 4823 gene locus_tag LOCUS_06540 gene murI 4005 4823 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ID7 protein_id gnl|my_center|LOCUS_06540 4814 5482 gene locus_tag LOCUS_06550 4814 5482 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUK4 protein_id gnl|my_center|LOCUS_06550 5497 6831 gene locus_tag LOCUS_06560 5497 6831 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388440.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence061 <1 1326 gene locus_tag LOCUS_06570 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVV5:DNA ligase 1313 2290 gene locus_tag LOCUS_06580 1313 2290 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534112.1 protein_id gnl|my_center|LOCUS_06580 2331 3368 gene locus_tag LOCUS_06590 2331 3368 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_06590 3552 3887 gene locus_tag LOCUS_06600 3552 3887 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531657.1 protein_id gnl|my_center|LOCUS_06600 3964 5634 gene locus_tag LOCUS_06610 gene pgi 3964 5634 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDQ7 protein_id gnl|my_center|LOCUS_06610 5709 6317 gene locus_tag LOCUS_06620 gene sodB 5709 6317 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD44 protein_id gnl|my_center|LOCUS_06620 7374 6358 gene locus_tag LOCUS_06630 7374 6358 CDS product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence062 844 392 gene locus_tag LOCUS_06640 gene trmL 844 392 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH5 protein_id gnl|my_center|LOCUS_06640 1566 841 gene locus_tag LOCUS_06650 1566 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2013 1570 gene locus_tag LOCUS_06660 gene dut 2013 1570 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66592 protein_id gnl|my_center|LOCUS_06660 3227 2022 gene locus_tag LOCUS_06670 3227 2022 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391543.1 protein_id gnl|my_center|LOCUS_06670 4525 3224 gene locus_tag LOCUS_06680 gene ugdH 4525 3224 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313911.1 protein_id gnl|my_center|LOCUS_06680 5711 4542 gene locus_tag LOCUS_06690 gene patB 5711 4542 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338556.1 protein_id gnl|my_center|LOCUS_06690 6401 5925 gene locus_tag LOCUS_06700 gene infC 6401 5925 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_06700 <7454 6584 gene locus_tag LOCUS_06710 <7454 6584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391123.1:glycosyl transferase >Feature sequence063 1608 697 gene locus_tag LOCUS_06720 1608 697 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528239.1 protein_id gnl|my_center|LOCUS_06720 3917 1605 gene locus_tag LOCUS_06730 gene xdhB1 3917 1605 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975647.1 protein_id gnl|my_center|LOCUS_06730 5395 3929 gene locus_tag LOCUS_06740 5395 3929 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887365.1 protein_id gnl|my_center|LOCUS_06740 5754 5398 gene locus_tag LOCUS_06750 5754 5398 CDS product 5-hydroxyisourate hydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UG5 protein_id gnl|my_center|LOCUS_06750 5901 6809 gene locus_tag LOCUS_06760 5901 6809 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975651.1 protein_id gnl|my_center|LOCUS_06760 6998 7174 gene locus_tag LOCUS_06770 6998 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence064 2218 749 gene locus_tag LOCUS_06780 2218 749 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_06780 2436 3170 gene locus_tag LOCUS_06790 2436 3170 CDS product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532296.1 protein_id gnl|my_center|LOCUS_06790 3182 3382 gene locus_tag LOCUS_06800 3182 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3385 3825 gene locus_tag LOCUS_06810 gene ccmE 3385 3825 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF4 protein_id gnl|my_center|LOCUS_06810 3818 5791 gene locus_tag LOCUS_06820 3818 5791 CDS product cytochrome c biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 protein_id gnl|my_center|LOCUS_06820 5792 6346 gene locus_tag LOCUS_06830 5792 6346 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence065 835 2001 gene locus_tag LOCUS_06840 gene rlmN 835 2001 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP22 protein_id gnl|my_center|LOCUS_06840 2025 3245 gene locus_tag LOCUS_06850 gene argG 2025 3245 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXL9 protein_id gnl|my_center|LOCUS_06850 4289 3285 gene locus_tag LOCUS_06860 4289 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 4825 4466 gene locus_tag LOCUS_06870 4825 4466 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_06870 5097 6527 gene locus_tag LOCUS_06880 5097 6527 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709055.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence066 53 2449 gene locus_tag LOCUS_06890 gene lon 53 2449 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU43 protein_id gnl|my_center|LOCUS_06890 2555 2403 gene locus_tag LOCUS_06900 2555 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3810 2644 gene locus_tag LOCUS_06910 3810 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4764 3820 gene locus_tag LOCUS_06920 4764 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5442 4765 gene locus_tag LOCUS_06930 5442 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 6391 5432 gene locus_tag LOCUS_06940 gene hemC 6391 5432 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJV6 protein_id gnl|my_center|LOCUS_06940 >Feature sequence067 4775 3174 gene locus_tag LOCUS_06950 4775 3174 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528784.1 protein_id gnl|my_center|LOCUS_06950 5517 4789 gene locus_tag LOCUS_06960 5517 4789 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090346.1 protein_id gnl|my_center|LOCUS_06960 5613 6413 gene locus_tag LOCUS_06970 5613 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 >Feature sequence068 211 888 gene locus_tag LOCUS_06980 211 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1309 2268 gene locus_tag LOCUS_06990 gene prfB 1309 2268 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAC3 protein_id gnl|my_center|LOCUS_06990 2287 5121 gene locus_tag LOCUS_07000 gene uvrA 2287 5121 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8V5 protein_id gnl|my_center|LOCUS_07000 5924 5145 gene locus_tag LOCUS_07010 gene ubiG 5924 5145 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM5 protein_id gnl|my_center|LOCUS_07010 >Feature sequence069 529 110 gene locus_tag LOCUS_07020 529 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 626 3100 gene locus_tag LOCUS_07030 626 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3607 4332 gene locus_tag LOCUS_07040 gene pyrF 3607 4332 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3D7 protein_id gnl|my_center|LOCUS_07040 4421 4505 gene locus_tag LOCUS_t00140 4421 4505 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4603 5940 gene locus_tag LOCUS_07050 gene tig 4603 5940 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU46 protein_id gnl|my_center|LOCUS_07050 5971 6615 gene locus_tag LOCUS_07060 gene clpP 5971 6615 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNN2 protein_id gnl|my_center|LOCUS_07060 >Feature sequence070 <1 620 gene locus_tag LOCUS_07070 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KQS1:C4-dicarboxylate TRAP transporter large permease protein DctM 741 2195 gene locus_tag LOCUS_07080 gene gabD 741 2195 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 protein_id gnl|my_center|LOCUS_07080 3190 2453 gene locus_tag LOCUS_07090 gene fabG 3190 2453 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_07090 4184 3183 gene locus_tag LOCUS_07100 4184 3183 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC5 protein_id gnl|my_center|LOCUS_07100 5279 4350 gene locus_tag LOCUS_07110 gene gpsA 5279 4350 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UC48 protein_id gnl|my_center|LOCUS_07110 6144 5272 gene locus_tag LOCUS_07120 6144 5272 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140207.1 protein_id gnl|my_center|LOCUS_07120 <6937 6175 gene locus_tag LOCUS_07130 <6937 6175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083018.1:membrane protein >Feature sequence071 2195 1227 gene locus_tag LOCUS_07140 2195 1227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529631.1 protein_id gnl|my_center|LOCUS_07140 3313 2195 gene locus_tag LOCUS_07150 3313 2195 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970668.1 protein_id gnl|my_center|LOCUS_07150 4950 3310 gene locus_tag LOCUS_07160 4950 3310 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 protein_id gnl|my_center|LOCUS_07160 5264 6397 gene locus_tag LOCUS_07170 5264 6397 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681145.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence072 5 1663 gene locus_tag LOCUS_07180 5 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 1742 2473 gene locus_tag LOCUS_07190 1742 2473 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958593.1 protein_id gnl|my_center|LOCUS_07190 2461 3870 gene locus_tag LOCUS_07200 gene envZ 2461 3870 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706312.1 protein_id gnl|my_center|LOCUS_07200 3959 5185 gene locus_tag LOCUS_07210 gene trpB 3959 5185 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E5 protein_id gnl|my_center|LOCUS_07210 5218 6066 gene locus_tag LOCUS_07220 gene trpA 5218 6066 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE4 protein_id gnl|my_center|LOCUS_07220 >Feature sequence073 3243 2512 gene locus_tag LOCUS_07230 3243 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3483 5012 gene locus_tag LOCUS_07240 3483 5012 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_07240 5097 5825 gene locus_tag LOCUS_07250 gene trmD 5097 5825 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ05 protein_id gnl|my_center|LOCUS_07250 5800 6228 gene locus_tag LOCUS_07260 5800 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 6238 6855 gene locus_tag LOCUS_07270 gene nadD 6238 6855 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0C4 protein_id gnl|my_center|LOCUS_07270 >Feature sequence074 <1 976 gene locus_tag LOCUS_07280 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7D0M8:chromosome partition protein Smc 977 1852 gene locus_tag LOCUS_07290 977 1852 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383375.1 protein_id gnl|my_center|LOCUS_07290 2472 2792 gene locus_tag LOCUS_07300 2472 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 2776 3666 gene locus_tag LOCUS_07310 2776 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4316 3723 gene locus_tag LOCUS_07320 4316 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 <6831 4309 gene locus_tag LOCUS_07330 <6831 4309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269189.1:sarcosine oxidase subunit alpha >Feature sequence075 264 1676 gene locus_tag LOCUS_07340 gene dnaA 264 1676 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY61 protein_id gnl|my_center|LOCUS_07340 1822 2964 gene locus_tag LOCUS_07350 1822 2964 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLS9 protein_id gnl|my_center|LOCUS_07350 2979 4178 gene locus_tag LOCUS_07360 gene recF 2979 4178 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT0 protein_id gnl|my_center|LOCUS_07360 4209 6632 gene locus_tag LOCUS_07370 gene gyrB 4209 6632 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92TE4 protein_id gnl|my_center|LOCUS_07370 >Feature sequence076 1233 337 gene locus_tag LOCUS_07380 1233 337 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_07380 1379 1831 gene locus_tag LOCUS_07390 gene codA 1379 1831 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAJ0 protein_id gnl|my_center|LOCUS_07390 2019 2648 gene locus_tag LOCUS_07400 gene rimP 2019 2648 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS3 protein_id gnl|my_center|LOCUS_07400 2653 4287 gene locus_tag LOCUS_07410 gene nusA 2653 4287 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS2 protein_id gnl|my_center|LOCUS_07410 4294 5052 gene locus_tag LOCUS_07420 4294 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence077 3061 953 gene locus_tag LOCUS_07430 gene pnp 3061 953 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR6 protein_id gnl|my_center|LOCUS_07430 3563 3294 gene locus_tag LOCUS_07440 gene rpsO 3563 3294 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ECB7 protein_id gnl|my_center|LOCUS_07440 4510 3578 gene locus_tag LOCUS_07450 gene truB 4510 3578 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR8 protein_id gnl|my_center|LOCUS_07450 4951 4532 gene locus_tag LOCUS_07460 gene rbfA 4951 4532 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6P6 protein_id gnl|my_center|LOCUS_07460 5899 5009 gene locus_tag LOCUS_07470 5899 5009 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_07470 <6680 6067 gene locus_tag LOCUS_07480 <6680 6067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391522.1:transcriptional regulator >Feature sequence078 948 2099 gene locus_tag LOCUS_07490 948 2099 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 protein_id gnl|my_center|LOCUS_07490 2092 3249 gene locus_tag LOCUS_07500 2092 3249 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973788.1 protein_id gnl|my_center|LOCUS_07500 3500 4567 gene locus_tag LOCUS_07510 3500 4567 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391354.1 protein_id gnl|my_center|LOCUS_07510 4618 5085 gene locus_tag LOCUS_07520 4618 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 5097 5657 gene locus_tag LOCUS_07530 5097 5657 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083471.1 protein_id gnl|my_center|LOCUS_07530 5654 6013 gene locus_tag LOCUS_07540 5654 6013 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311080.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence079 1062 598 gene locus_tag LOCUS_07550 1062 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3339 1168 gene locus_tag LOCUS_07560 3339 1168 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389477.1 protein_id gnl|my_center|LOCUS_07560 3476 4873 gene locus_tag LOCUS_07570 gene gltX2 3476 4873 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 protein_id gnl|my_center|LOCUS_07570 4918 6345 gene locus_tag LOCUS_07580 4918 6345 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ5 protein_id gnl|my_center|LOCUS_07580 6642 6439 gene locus_tag LOCUS_07590 6642 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence080 828 1199 gene locus_tag LOCUS_07600 gene rpsL 828 1199 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV5 protein_id gnl|my_center|LOCUS_07600 1220 1687 gene locus_tag LOCUS_07610 gene rpsG 1220 1687 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAX6 protein_id gnl|my_center|LOCUS_07610 1703 3811 gene locus_tag LOCUS_07620 gene fusA 1703 3811 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U856 protein_id gnl|my_center|LOCUS_07620 3881 5071 gene locus_tag LOCUS_07630 gene tuf 3881 5071 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSZ8 protein_id gnl|my_center|LOCUS_07630 5149 5463 gene locus_tag LOCUS_07640 gene rpsJ 5149 5463 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_07640 5467 6201 gene locus_tag LOCUS_07650 gene rplC 5467 6201 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8V3 protein_id gnl|my_center|LOCUS_07650 >Feature sequence081 420 899 gene locus_tag LOCUS_07660 420 899 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_07660 2418 991 gene locus_tag LOCUS_07670 gene pntB 2418 991 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB4 protein_id gnl|my_center|LOCUS_07670 2790 2431 gene locus_tag LOCUS_07680 2790 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3932 2793 gene locus_tag LOCUS_07690 3932 2793 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923248.1 protein_id gnl|my_center|LOCUS_07690 4952 4137 gene locus_tag LOCUS_07700 gene ate 4952 4137 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y485 protein_id gnl|my_center|LOCUS_07700 >Feature sequence082 110 991 gene locus_tag LOCUS_07710 110 991 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031409.1 protein_id gnl|my_center|LOCUS_07710 1010 1522 gene locus_tag LOCUS_07720 gene mobB 1010 1522 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_07720 1509 2741 gene locus_tag LOCUS_07730 gene moeA 1509 2741 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085100.1 protein_id gnl|my_center|LOCUS_07730 2794 3042 gene locus_tag LOCUS_07740 gene moaD 2794 3042 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYX8 protein_id gnl|my_center|LOCUS_07740 3046 3510 gene locus_tag LOCUS_07750 3046 3510 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390442.1 protein_id gnl|my_center|LOCUS_07750 3510 4514 gene locus_tag LOCUS_07760 gene moaA 3510 4514 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Y5 protein_id gnl|my_center|LOCUS_07760 4686 4898 gene locus_tag LOCUS_07770 4686 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 5043 4968 gene locus_tag LOCUS_t00150 5043 4968 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5202 5275 gene locus_tag LOCUS_t00160 5202 5275 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5568 5278 gene locus_tag LOCUS_07780 5568 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 6455 5568 gene locus_tag LOCUS_07790 6455 5568 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382858.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence083 1345 356 gene locus_tag LOCUS_07800 1345 356 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_07800 2262 1342 gene locus_tag LOCUS_07810 2262 1342 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_07810 3382 2348 gene locus_tag LOCUS_07820 3382 2348 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X28 protein_id gnl|my_center|LOCUS_07820 3494 4222 gene locus_tag LOCUS_07830 3494 4222 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706675.1 protein_id gnl|my_center|LOCUS_07830 4222 5634 gene locus_tag LOCUS_07840 4222 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07840 >Feature sequence084 756 478 gene locus_tag LOCUS_07850 756 478 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531142.1 protein_id gnl|my_center|LOCUS_07850 2079 790 gene locus_tag LOCUS_07860 gene soxB 2079 790 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821029.1 protein_id gnl|my_center|LOCUS_07860 2187 2717 gene locus_tag LOCUS_07870 gene rplK 2187 2717 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QI1 protein_id gnl|my_center|LOCUS_07870 2722 3411 gene locus_tag LOCUS_07880 gene rplA 2722 3411 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV0 protein_id gnl|my_center|LOCUS_07880 5526 3940 gene locus_tag LOCUS_07890 gene hutU 5526 3940 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UIH3 protein_id gnl|my_center|LOCUS_07890 6392 5610 gene locus_tag LOCUS_07900 6392 5610 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887421.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence085 5007 2686 gene locus_tag LOCUS_07910 5007 2686 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_07910 <6400 5015 gene locus_tag LOCUS_07920 <6400 5015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389368.1:nitrogen regulation protein NR(I) >Feature sequence086 894 1268 gene locus_tag LOCUS_07930 894 1268 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720317.1 protein_id gnl|my_center|LOCUS_07930 1252 1533 gene locus_tag LOCUS_07940 1252 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 1530 4214 gene locus_tag LOCUS_07950 1530 4214 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 protein_id gnl|my_center|LOCUS_07950 4302 5159 gene locus_tag LOCUS_07960 4302 5159 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974664.1 protein_id gnl|my_center|LOCUS_07960 5173 5382 gene locus_tag LOCUS_07970 5173 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 6185 5493 gene locus_tag LOCUS_07980 6185 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence087 731 2263 gene locus_tag LOCUS_07990 731 2263 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_07990 2508 3797 gene locus_tag LOCUS_08000 2508 3797 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003733.1 protein_id gnl|my_center|LOCUS_08000 3866 5161 gene locus_tag LOCUS_08010 3866 5161 CDS product putative zinc protease-like protein y4wB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55680 protein_id gnl|my_center|LOCUS_08010 5158 5553 gene locus_tag LOCUS_08020 5158 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 6256 5582 gene locus_tag LOCUS_08030 6256 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence088 77 1141 gene locus_tag LOCUS_08040 77 1141 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_08040 1138 1815 gene locus_tag LOCUS_08050 gene thiM 1138 1815 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNM4 protein_id gnl|my_center|LOCUS_08050 1992 2282 gene locus_tag LOCUS_08060 gene groES1 1992 2282 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W1D4 protein_id gnl|my_center|LOCUS_08060 2332 3972 gene locus_tag LOCUS_08070 gene groL2 2332 3972 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV4 protein_id gnl|my_center|LOCUS_08070 4807 4157 gene locus_tag LOCUS_08080 gene ccmB 4807 4157 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N6 protein_id gnl|my_center|LOCUS_08080 5424 4804 gene locus_tag LOCUS_08090 gene ccmA 5424 4804 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L55 protein_id gnl|my_center|LOCUS_08090 5980 5486 gene locus_tag LOCUS_08100 5980 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175145.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence089 2408 414 gene locus_tag LOCUS_08110 2408 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064023.1 protein_id gnl|my_center|LOCUS_08110 2982 2410 gene locus_tag LOCUS_08120 2982 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 3696 3148 gene locus_tag LOCUS_08130 3696 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 4576 3647 gene locus_tag LOCUS_08140 4576 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4896 4657 gene locus_tag LOCUS_08150 4896 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 5044 4820 gene locus_tag LOCUS_08160 5044 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 5270 5046 gene locus_tag LOCUS_08170 5270 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 5722 5378 gene locus_tag LOCUS_08180 5722 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence090 183 1262 gene locus_tag LOCUS_08190 gene mraY 183 1262 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 protein_id gnl|my_center|LOCUS_08190 1263 2552 gene locus_tag LOCUS_08200 gene murD 1263 2552 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU2 protein_id gnl|my_center|LOCUS_08200 2569 3699 gene locus_tag LOCUS_08210 2569 3699 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_08210 3716 3862 gene locus_tag LOCUS_08220 3716 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 3926 4807 gene locus_tag LOCUS_08230 gene murG 3926 4807 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UB85 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08230 4804 6204 gene locus_tag LOCUS_08240 gene murC 4804 6204 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FU8 protein_id gnl|my_center|LOCUS_08240 >Feature sequence091 135 1304 gene locus_tag LOCUS_08250 135 1304 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 protein_id gnl|my_center|LOCUS_08250 1425 1237 gene locus_tag LOCUS_08260 1425 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1436 2530 gene locus_tag LOCUS_08270 1436 2530 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5A4 protein_id gnl|my_center|LOCUS_08270 2644 3729 gene locus_tag LOCUS_08280 2644 3729 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720305.1 protein_id gnl|my_center|LOCUS_08280 3840 5138 gene locus_tag LOCUS_08290 3840 5138 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_08290 5154 6005 gene locus_tag LOCUS_08300 5154 6005 CDS product polyamine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722803.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence092 1003 521 gene locus_tag LOCUS_08310 1003 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 1342 2790 gene locus_tag LOCUS_08320 1342 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2793 4862 gene locus_tag LOCUS_08330 2793 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6111 5080 gene locus_tag LOCUS_08340 6111 5080 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDX1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence093 1821 13 gene locus_tag LOCUS_08350 gene edd 1821 13 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3S0 protein_id gnl|my_center|LOCUS_08350 2528 1833 gene locus_tag LOCUS_08360 gene pgl 2528 1833 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2N2 protein_id gnl|my_center|LOCUS_08360 4012 2537 gene locus_tag LOCUS_08370 gene zwf 4012 2537 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U679 protein_id gnl|my_center|LOCUS_08370 >Feature sequence094 3 1620 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcggcttgaccgtgaactctgaaaagctatact 2032 1694 gene locus_tag LOCUS_08380 gene cas2 2032 1694 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_08380 2952 2029 gene locus_tag LOCUS_08390 gene cas1 2952 2029 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_08390 6110 2949 gene locus_tag LOCUS_08400 6110 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence095 1668 373 gene locus_tag LOCUS_08410 1668 373 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538085.1 protein_id gnl|my_center|LOCUS_08410 2192 1668 gene locus_tag LOCUS_08420 2192 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 3224 2217 gene locus_tag LOCUS_08430 3224 2217 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382874.1 protein_id gnl|my_center|LOCUS_08430 4537 3356 gene locus_tag LOCUS_08440 4537 3356 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886725.1 protein_id gnl|my_center|LOCUS_08440 4694 5938 gene locus_tag LOCUS_08450 4694 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence096 <1 1485 gene locus_tag LOCUS_08460 <1 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RYB8:chaperone protein HtpG 2465 1545 gene locus_tag LOCUS_08470 2465 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 3634 2462 gene locus_tag LOCUS_08480 3634 2462 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_08480 4553 3639 gene locus_tag LOCUS_08490 4553 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5935 4646 gene locus_tag LOCUS_08500 5935 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence097 549 67 gene locus_tag LOCUS_08510 549 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707888.1 protein_id gnl|my_center|LOCUS_08510 835 3498 gene locus_tag LOCUS_08520 gene alaS 835 3498 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE87 protein_id gnl|my_center|LOCUS_08520 3495 4331 gene locus_tag LOCUS_08530 3495 4331 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039383.1 protein_id gnl|my_center|LOCUS_08530 5251 4379 gene locus_tag LOCUS_08540 5251 4379 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTQ8 protein_id gnl|my_center|LOCUS_08540 6056 5370 gene locus_tag LOCUS_08550 6056 5370 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038388.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence098 2814 400 gene locus_tag LOCUS_08560 gene pheT 2814 400 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC6 protein_id gnl|my_center|LOCUS_08560 3859 2816 gene locus_tag LOCUS_08570 gene pheS 3859 2816 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH8 protein_id gnl|my_center|LOCUS_08570 4141 4806 gene locus_tag LOCUS_08580 4141 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531751.1 protein_id gnl|my_center|LOCUS_08580 5548 5060 gene locus_tag LOCUS_08590 5548 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583048.1 protein_id gnl|my_center|LOCUS_08590 5720 5553 gene locus_tag LOCUS_08600 5720 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence099 212 871 gene locus_tag LOCUS_08610 212 871 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU1 protein_id gnl|my_center|LOCUS_08610 2445 850 gene locus_tag LOCUS_08620 2445 850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968391.1 protein_id gnl|my_center|LOCUS_08620 3395 2448 gene locus_tag LOCUS_08630 3395 2448 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_08630 4555 3485 gene locus_tag LOCUS_08640 4555 3485 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739846.1 protein_id gnl|my_center|LOCUS_08640 <6088 4559 gene locus_tag LOCUS_08650 <6088 4559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390914.1:ABC transporter substrate-binding protein >Feature sequence100 1245 37 gene locus_tag LOCUS_08660 gene carA 1245 37 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB3 protein_id gnl|my_center|LOCUS_08660 1628 3511 gene locus_tag LOCUS_08670 gene dnaG 1628 3511 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TK91 protein_id gnl|my_center|LOCUS_08670 3663 5633 gene locus_tag LOCUS_08680 gene rpoD 3663 5633 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB6 protein_id gnl|my_center|LOCUS_08680 >Feature sequence101 1266 487 gene locus_tag LOCUS_08690 gene sdhB 1266 487 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHJ9 protein_id gnl|my_center|LOCUS_08690 3093 1300 gene locus_tag LOCUS_08700 3093 1300 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2N0 protein_id gnl|my_center|LOCUS_08700 3463 3101 gene locus_tag LOCUS_08710 3463 3101 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_08710 3855 3472 gene locus_tag LOCUS_08720 3855 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 4060 4440 gene locus_tag LOCUS_08730 4060 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 4935 4456 gene locus_tag LOCUS_08740 4935 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 5804 4926 gene locus_tag LOCUS_08750 5804 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence102 529 816 gene locus_tag LOCUS_08760 gene borD 529 816 CDS product prophage lipoprotein Bor homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77330 protein_id gnl|my_center|LOCUS_08760 1181 813 gene locus_tag LOCUS_08770 1181 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 1638 1168 gene locus_tag LOCUS_08780 gene msrA 1638 1168 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066219.1 protein_id gnl|my_center|LOCUS_08780 2678 1641 gene locus_tag LOCUS_08790 gene cysK 2678 1641 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 protein_id gnl|my_center|LOCUS_08790 3597 2737 gene locus_tag LOCUS_08800 gene rsmA 3597 2737 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA9 protein_id gnl|my_center|LOCUS_08800 4595 3597 gene locus_tag LOCUS_08810 gene pdxA 4595 3597 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKN3 protein_id gnl|my_center|LOCUS_08810 5850 4579 gene locus_tag LOCUS_08820 5850 4579 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2C1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence103 645 2693 gene locus_tag LOCUS_08830 645 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08830 3001 3180 gene locus_tag LOCUS_08840 3001 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 3708 3256 gene locus_tag LOCUS_08850 3708 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3779 4834 gene locus_tag LOCUS_08860 3779 4834 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390999.1 protein_id gnl|my_center|LOCUS_08860 5437 4829 gene locus_tag LOCUS_08870 5437 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence104 168 1202 gene locus_tag LOCUS_08880 168 1202 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089097.1 protein_id gnl|my_center|LOCUS_08880 1322 1125 gene locus_tag LOCUS_08890 1322 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1560 1381 gene locus_tag LOCUS_08900 1560 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2673 1573 gene locus_tag LOCUS_08910 2673 1573 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_08910 4102 2696 gene locus_tag LOCUS_08920 gene leuC 4102 2696 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZI8 protein_id gnl|my_center|LOCUS_08920 4267 4929 gene locus_tag LOCUS_08930 4267 4929 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390534.1 protein_id gnl|my_center|LOCUS_08930 5058 5237 gene locus_tag LOCUS_08940 gene rpmF 5058 5237 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7C7 protein_id gnl|my_center|LOCUS_08940 >Feature sequence105 108 428 gene locus_tag LOCUS_08950 108 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 598 1830 gene locus_tag LOCUS_08960 598 1830 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887546.1 protein_id gnl|my_center|LOCUS_08960 1836 4622 gene locus_tag LOCUS_08970 1836 4622 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_08970 5034 4642 gene locus_tag LOCUS_08980 gene msrB1 5034 4642 CDS product peptide methionine sulfoxide reductase MsrB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RA4 protein_id gnl|my_center|LOCUS_08980 <5859 5012 gene locus_tag LOCUS_08990 <5859 5012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020246.1:tetratricopeptide repeat protein >Feature sequence106 498 716 gene locus_tag LOCUS_09000 498 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2903 867 gene locus_tag LOCUS_09010 gene pccA 2903 867 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140126.1 protein_id gnl|my_center|LOCUS_09010 4432 2900 gene locus_tag LOCUS_09020 gene pccB 4432 2900 CDS product propionyl-CoA carboxylase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4E3 protein_id gnl|my_center|LOCUS_09020 >Feature sequence107 591 676 gene locus_tag LOCUS_t00170 591 676 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1372 725 gene locus_tag LOCUS_09030 1372 725 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_09030 1573 1845 gene locus_tag LOCUS_09040 1573 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1842 2504 gene locus_tag LOCUS_09050 1842 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140061.1 protein_id gnl|my_center|LOCUS_09050 3207 2536 gene locus_tag LOCUS_09060 3207 2536 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391381.1 protein_id gnl|my_center|LOCUS_09060 3520 4320 gene locus_tag LOCUS_09070 3520 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 4608 5561 gene locus_tag LOCUS_09080 4608 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence108 468 76 gene locus_tag LOCUS_09090 gene rplL 468 76 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAX1 protein_id gnl|my_center|LOCUS_09090 1077 520 gene locus_tag LOCUS_09100 gene rplJ 1077 520 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV1 protein_id gnl|my_center|LOCUS_09100 1406 1597 gene locus_tag LOCUS_09110 1406 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1530 1745 gene locus_tag LOCUS_09120 gene rpmE 1530 1745 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM38 protein_id gnl|my_center|LOCUS_09120 1962 2402 gene locus_tag LOCUS_09130 1962 2402 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090465.1 protein_id gnl|my_center|LOCUS_09130 3942 2503 gene locus_tag LOCUS_09140 3942 2503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385399.1 protein_id gnl|my_center|LOCUS_09140 4760 3939 gene locus_tag LOCUS_09150 4760 3939 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 protein_id gnl|my_center|LOCUS_09150 <5679 4760 gene locus_tag LOCUS_09160 <5679 4760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531217.1:peptide ABC transporter >Feature sequence109 1356 532 gene locus_tag LOCUS_09170 1356 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1990 1364 gene locus_tag LOCUS_09180 gene folE 1990 1364 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UEK8 protein_id gnl|my_center|LOCUS_09180 2120 2578 gene locus_tag LOCUS_09190 2120 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037396.1 protein_id gnl|my_center|LOCUS_09190 4192 2573 gene locus_tag LOCUS_09200 4192 2573 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_09200 5328 4219 gene locus_tag LOCUS_09210 5328 4219 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence110 109 558 gene locus_tag LOCUS_09220 109 558 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709589.1 protein_id gnl|my_center|LOCUS_09220 993 559 gene locus_tag LOCUS_09230 993 559 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_09230 1503 1003 gene locus_tag LOCUS_09240 1503 1003 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385193.1 protein_id gnl|my_center|LOCUS_09240 2044 1508 gene locus_tag LOCUS_09250 2044 1508 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268480.1 protein_id gnl|my_center|LOCUS_09250 2552 2118 gene locus_tag LOCUS_09260 2552 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2839 5259 gene locus_tag LOCUS_09270 2839 5259 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence111 55 783 gene locus_tag LOCUS_09280 55 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1346 942 gene locus_tag LOCUS_09290 1346 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1660 1343 gene locus_tag LOCUS_09300 gene ihfA 1660 1343 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H546 protein_id gnl|my_center|LOCUS_09300 2709 1657 gene locus_tag LOCUS_09310 gene plsX 2709 1657 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89K88 protein_id gnl|my_center|LOCUS_09310 3357 2845 gene locus_tag LOCUS_09320 3357 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3914 3354 gene locus_tag LOCUS_09330 3914 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 3846 4151 gene locus_tag LOCUS_09340 3846 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4096 4476 gene locus_tag LOCUS_09350 4096 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4553 5416 gene locus_tag LOCUS_09360 4553 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence112 1710 334 gene locus_tag LOCUS_09370 gene trkA 1710 334 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_09370 3098 1707 gene locus_tag LOCUS_09380 3098 1707 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_09380 4397 3237 gene locus_tag LOCUS_09390 gene ivdA 4397 3237 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 protein_id gnl|my_center|LOCUS_09390 4480 5307 gene locus_tag LOCUS_09400 4480 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537544.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence113 181 2973 gene locus_tag LOCUS_09410 181 2973 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533669.1 protein_id gnl|my_center|LOCUS_09410 2970 3737 gene locus_tag LOCUS_09420 2970 3737 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 protein_id gnl|my_center|LOCUS_09420 3737 4588 gene locus_tag LOCUS_09430 3737 4588 CDS product DMSO reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_09430 4697 5452 gene locus_tag LOCUS_09440 4697 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence114 2546 879 gene locus_tag LOCUS_09450 2546 879 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV4 protein_id gnl|my_center|LOCUS_09450 3410 2556 gene locus_tag LOCUS_09460 3410 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3836 4288 gene locus_tag LOCUS_09470 gene ribH 3836 4288 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6M2 protein_id gnl|my_center|LOCUS_09470 4291 5421 gene locus_tag LOCUS_09480 4291 5421 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0V6 protein_id gnl|my_center|LOCUS_09480 >Feature sequence115 1415 621 gene locus_tag LOCUS_09490 1415 621 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388857.1 protein_id gnl|my_center|LOCUS_09490 2752 1412 gene locus_tag LOCUS_09500 gene glmM 2752 1412 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN1 protein_id gnl|my_center|LOCUS_09500 2884 4338 gene locus_tag LOCUS_09510 gene dinB 2884 4338 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CQ6 protein_id gnl|my_center|LOCUS_09510 5105 4584 gene locus_tag LOCUS_09520 5105 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence116 1865 261 gene locus_tag LOCUS_09530 gene coxA 1865 261 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U5I4 protein_id gnl|my_center|LOCUS_09530 2797 1913 gene locus_tag LOCUS_09540 2797 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 3646 2954 gene locus_tag LOCUS_09550 3646 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 4030 3650 gene locus_tag LOCUS_09560 4030 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_09560 5013 4036 gene locus_tag LOCUS_09570 5013 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5483 5040 gene locus_tag LOCUS_09580 5483 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence117 1972 812 gene locus_tag LOCUS_09590 gene pgk 1972 812 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9I9 protein_id gnl|my_center|LOCUS_09590 3912 1978 gene locus_tag LOCUS_09600 gene tkt2 3912 1978 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M82 protein_id gnl|my_center|LOCUS_09600 4212 5465 gene locus_tag LOCUS_09610 gene clpX 4212 5465 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU44 protein_id gnl|my_center|LOCUS_09610 >Feature sequence118 32 619 gene locus_tag LOCUS_09620 32 619 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL87 protein_id gnl|my_center|LOCUS_09620 616 1653 gene locus_tag LOCUS_09630 616 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1650 1817 gene locus_tag LOCUS_09640 1650 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2984 2064 gene locus_tag LOCUS_09650 gene xerD 2984 2064 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCL7 protein_id gnl|my_center|LOCUS_09650 3206 2994 gene locus_tag LOCUS_09660 3206 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 3366 3980 gene locus_tag LOCUS_09670 3366 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3974 5074 gene locus_tag LOCUS_09680 gene aroB 3974 5074 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 protein_id gnl|my_center|LOCUS_09680 >Feature sequence119 <1 930 gene locus_tag LOCUS_09690 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083884.1:branched-chain amino acid ABC transporter permease 935 2068 gene locus_tag LOCUS_09700 935 2068 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435245.1 protein_id gnl|my_center|LOCUS_09700 2072 2824 gene locus_tag LOCUS_09710 2072 2824 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142277.1 protein_id gnl|my_center|LOCUS_09710 2824 3528 gene locus_tag LOCUS_09720 2824 3528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088972.1 protein_id gnl|my_center|LOCUS_09720 5368 3536 gene locus_tag LOCUS_09730 gene lepA 5368 3536 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UF57 protein_id gnl|my_center|LOCUS_09730 >Feature sequence120 247 1197 gene locus_tag LOCUS_09740 gene lpxK 247 1197 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6I0 protein_id gnl|my_center|LOCUS_09740 2169 1339 gene locus_tag LOCUS_09750 2169 1339 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_09750 2272 2604 gene locus_tag LOCUS_09760 2272 2604 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389534.1 protein_id gnl|my_center|LOCUS_09760 2609 3382 gene locus_tag LOCUS_09770 gene xth 2609 3382 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383038.1 protein_id gnl|my_center|LOCUS_09770 3379 4326 gene locus_tag LOCUS_09780 3379 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4335 5324 gene locus_tag LOCUS_09790 4335 5324 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337253.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence121 16 759 gene locus_tag LOCUS_09800 16 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 904 1995 gene locus_tag LOCUS_09810 gene leuB 904 1995 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAQ5 protein_id gnl|my_center|LOCUS_09810 2034 3047 gene locus_tag LOCUS_09820 gene asd 2034 3047 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV48 protein_id gnl|my_center|LOCUS_09820 4352 3081 gene locus_tag LOCUS_09830 gene fccB-2 4352 3081 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933736.1 protein_id gnl|my_center|LOCUS_09830 4610 4843 gene locus_tag LOCUS_09840 gene tatA 4610 4843 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKB6 protein_id gnl|my_center|LOCUS_09840 4856 5305 gene locus_tag LOCUS_09850 4856 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence122 <1 629 gene locus_tag LOCUS_09860 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388528.1:peptidase M23 1515 640 gene locus_tag LOCUS_09870 gene ttcA 1515 640 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KS29 protein_id gnl|my_center|LOCUS_09870 2886 1531 gene locus_tag LOCUS_09880 gene gsh1 2886 1531 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_09880 3060 4862 gene locus_tag LOCUS_09890 gene aspS 3060 4862 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM3 protein_id gnl|my_center|LOCUS_09890 >Feature sequence123 1596 4046 gene locus_tag LOCUS_09900 1596 4046 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531133.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence124 1026 1238 gene locus_tag LOCUS_09910 1026 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09910 1309 4563 gene locus_tag LOCUS_09920 1309 4563 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB2 protein_id gnl|my_center|LOCUS_09920 >Feature sequence125 282 785 gene locus_tag LOCUS_09930 gene rimM 282 785 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAG2 protein_id gnl|my_center|LOCUS_09930 2078 999 gene locus_tag LOCUS_09940 2078 999 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_09940 3027 2098 gene locus_tag LOCUS_09950 3027 2098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_09950 4179 3031 gene locus_tag LOCUS_09960 4179 3031 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_09960 <4999 4169 gene locus_tag LOCUS_09970 <4999 4169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383091.1:ABC transporter >Feature sequence126 2430 253 gene locus_tag LOCUS_09980 gene ndh 2430 253 CDS product bifunctional NADH dehydrogenase FAD-containing subunit/selenide,water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124488.1 protein_id gnl|my_center|LOCUS_09980 3003 2440 gene locus_tag LOCUS_09990 3003 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 3227 4195 gene locus_tag LOCUS_10000 3227 4195 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720078.1 protein_id gnl|my_center|LOCUS_10000 4287 4371 gene locus_tag LOCUS_t00180 4287 4371 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4415 4488 gene locus_tag LOCUS_t00190 4415 4488 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence127 293 1276 gene locus_tag LOCUS_10010 gene pyrD 293 1276 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUH7 protein_id gnl|my_center|LOCUS_10010 1452 2708 gene locus_tag LOCUS_10020 gene rho 1452 2708 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN82 protein_id gnl|my_center|LOCUS_10020 2717 4021 gene locus_tag LOCUS_10030 gene mnmE 2717 4021 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYH3 protein_id gnl|my_center|LOCUS_10030 <4937 4054 gene locus_tag LOCUS_10040 <4937 4054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89X65:dihydrolipoyl dehydrogenase >Feature sequence128 1937 1248 gene locus_tag LOCUS_10050 gene gmk 1937 1248 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MV4 protein_id gnl|my_center|LOCUS_10050 2561 1974 gene locus_tag LOCUS_10060 2561 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2640 3440 gene locus_tag LOCUS_10070 2640 3440 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 protein_id gnl|my_center|LOCUS_10070 3456 4631 gene locus_tag LOCUS_10080 gene argD 3456 4631 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKT0 protein_id gnl|my_center|LOCUS_10080 >Feature sequence129 244 1518 gene locus_tag LOCUS_10090 gene eno 244 1518 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7J9 protein_id gnl|my_center|LOCUS_10090 1528 2331 gene locus_tag LOCUS_10100 1528 2331 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531293.1 protein_id gnl|my_center|LOCUS_10100 2328 2954 gene locus_tag LOCUS_10110 2328 2954 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH1 protein_id gnl|my_center|LOCUS_10110 2954 4015 gene locus_tag LOCUS_10120 2954 4015 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 protein_id gnl|my_center|LOCUS_10120 4703 4158 gene locus_tag LOCUS_10130 4703 4158 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8G5 protein_id gnl|my_center|LOCUS_10130 >Feature sequence130 356 949 gene locus_tag LOCUS_10140 356 949 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_10140 1116 3815 gene locus_tag LOCUS_10150 1116 3815 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence131 531 229 gene locus_tag LOCUS_10160 531 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084855.1 protein_id gnl|my_center|LOCUS_10160 1875 580 gene locus_tag LOCUS_10170 1875 580 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869179.1 protein_id gnl|my_center|LOCUS_10170 2480 2001 gene locus_tag LOCUS_10180 2480 2001 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 protein_id gnl|my_center|LOCUS_10180 2614 4722 gene locus_tag LOCUS_10190 2614 4722 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531908.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence132 343 1389 gene locus_tag LOCUS_10200 gene trpS 343 1389 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG6 protein_id gnl|my_center|LOCUS_10200 1432 2343 gene locus_tag LOCUS_10210 1432 2343 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSJ5 protein_id gnl|my_center|LOCUS_10210 2349 3083 gene locus_tag LOCUS_10220 2349 3083 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968644.1 protein_id gnl|my_center|LOCUS_10220 3157 3633 gene locus_tag LOCUS_10230 3157 3633 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390254.1 protein_id gnl|my_center|LOCUS_10230 3664 4209 gene locus_tag LOCUS_10240 3664 4209 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence133 2780 318 gene locus_tag LOCUS_10250 2780 318 CDS product dimethylglycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708706.1 protein_id gnl|my_center|LOCUS_10250 3167 4024 gene locus_tag LOCUS_10260 3167 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence134 1084 1335 gene locus_tag LOCUS_10270 1084 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1503 2072 gene locus_tag LOCUS_10280 1503 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2094 2855 gene locus_tag LOCUS_10290 2094 2855 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338188.1 protein_id gnl|my_center|LOCUS_10290 2973 3707 gene locus_tag LOCUS_10300 2973 3707 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720536.1 protein_id gnl|my_center|LOCUS_10300 3756 4643 gene locus_tag LOCUS_10310 3756 4643 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383561.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence135 1136 573 gene locus_tag LOCUS_10320 1136 573 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_10320 1844 1155 gene locus_tag LOCUS_10330 gene cbbE 1844 1155 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2N7 protein_id gnl|my_center|LOCUS_10330 2356 2538 gene locus_tag LOCUS_10340 2356 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2535 3029 gene locus_tag LOCUS_10350 2535 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708585.1 protein_id gnl|my_center|LOCUS_10350 3051 4667 gene locus_tag LOCUS_10360 gene prfC 3051 4667 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE8 protein_id gnl|my_center|LOCUS_10360 >Feature sequence136 79 957 gene locus_tag LOCUS_10370 79 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090813.1 protein_id gnl|my_center|LOCUS_10370 1777 1124 gene locus_tag LOCUS_10380 1777 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388355.1 protein_id gnl|my_center|LOCUS_10380 1961 3130 gene locus_tag LOCUS_10390 gene ispDF 1961 3130 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LQ8 protein_id gnl|my_center|LOCUS_10390 3215 4195 gene locus_tag LOCUS_10400 gene fabH 3215 4195 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QT4 protein_id gnl|my_center|LOCUS_10400 >Feature sequence137 161 1726 gene locus_tag LOCUS_10410 161 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090720.1 protein_id gnl|my_center|LOCUS_10410 1801 2577 gene locus_tag LOCUS_10420 gene purC1 1801 2577 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IB0 protein_id gnl|my_center|LOCUS_10420 2589 3803 gene locus_tag LOCUS_10430 gene bcr 2589 3803 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123170.1 protein_id gnl|my_center|LOCUS_10430 3906 3982 gene locus_tag LOCUS_t00200 3906 3982 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 <4611 4046 gene locus_tag LOCUS_10440 <4611 4046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061777.1:taurine ABC transporter permease >Feature sequence138 1311 394 gene locus_tag LOCUS_10450 1311 394 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706748.1 protein_id gnl|my_center|LOCUS_10450 2198 1311 gene locus_tag LOCUS_10460 gene rbsK 2198 1311 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYI7 protein_id gnl|my_center|LOCUS_10460 2406 2576 gene locus_tag LOCUS_10470 2406 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10470 2583 3911 gene locus_tag LOCUS_10480 gene bauC 2583 3911 CDS product putative 3-oxopropanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I702 protein_id gnl|my_center|LOCUS_10480 >Feature sequence139 239 1084 gene locus_tag LOCUS_10490 gene glyQ 239 1084 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ44 protein_id gnl|my_center|LOCUS_10490 1086 3137 gene locus_tag LOCUS_10500 gene glyS 1086 3137 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ43 protein_id gnl|my_center|LOCUS_10500 3190 4044 gene locus_tag LOCUS_10510 gene thyX 3190 4044 CDS product flavin-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9L5 protein_id gnl|my_center|LOCUS_10510 >Feature sequence140 1117 2376 gene locus_tag LOCUS_10520 gene hisS 1117 2376 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 protein_id gnl|my_center|LOCUS_10520 2379 3449 gene locus_tag LOCUS_10530 gene prfA 2379 3449 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE1 protein_id gnl|my_center|LOCUS_10530 3442 4275 gene locus_tag LOCUS_10540 gene prmC 3442 4275 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CG70 protein_id gnl|my_center|LOCUS_10540 >Feature sequence141 1219 20 gene locus_tag LOCUS_10550 gene hutI 1219 20 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U8Z6 protein_id gnl|my_center|LOCUS_10550 1321 2694 gene locus_tag LOCUS_10560 gene hutF 1321 2694 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140219.1 protein_id gnl|my_center|LOCUS_10560 2788 3483 gene locus_tag LOCUS_10570 gene hutC 2788 3483 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 protein_id gnl|my_center|LOCUS_10570 3523 3807 gene locus_tag LOCUS_10580 3523 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence142 414 22 gene locus_tag LOCUS_10590 414 22 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_10590 829 407 gene locus_tag LOCUS_10600 829 407 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_10600 1257 829 gene locus_tag LOCUS_10610 1257 829 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814993.1 protein_id gnl|my_center|LOCUS_10610 2012 1254 gene locus_tag LOCUS_10620 2012 1254 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_10620 4294 2009 gene locus_tag LOCUS_10630 4294 2009 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527977.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence143 479 1510 gene locus_tag LOCUS_10640 gene argC 479 1510 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRM4 protein_id gnl|my_center|LOCUS_10640 2040 1717 gene locus_tag LOCUS_10650 2040 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 2452 2189 gene locus_tag LOCUS_10660 2452 2189 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_10660 2519 3154 gene locus_tag LOCUS_10670 2519 3154 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_10670 3279 4229 gene locus_tag LOCUS_10680 gene mdh 3279 4229 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV34 protein_id gnl|my_center|LOCUS_10680 >Feature sequence144 740 1885 gene locus_tag LOCUS_10690 740 1885 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529988.1 protein_id gnl|my_center|LOCUS_10690 2098 4134 gene locus_tag LOCUS_10700 gene parE 2098 4134 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQT8 protein_id gnl|my_center|LOCUS_10700 >Feature sequence145 386 1741 gene locus_tag LOCUS_10710 386 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1743 3818 gene locus_tag LOCUS_10720 1743 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence146 <1 877 gene locus_tag LOCUS_10730 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337401.1:peptidoglycan glycosyltransferase 907 2106 gene locus_tag LOCUS_10740 907 2106 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391426.1 protein_id gnl|my_center|LOCUS_10740 3018 2131 gene locus_tag LOCUS_10750 3018 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_10750 3176 4210 gene locus_tag LOCUS_10760 gene gly1 3176 4210 CDS product L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UF70 protein_id gnl|my_center|LOCUS_10760 >Feature sequence147 1028 240 gene locus_tag LOCUS_10770 gene trpC 1028 240 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T2 protein_id gnl|my_center|LOCUS_10770 2059 1025 gene locus_tag LOCUS_10780 gene trpD 2059 1025 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCF3 protein_id gnl|my_center|LOCUS_10780 2870 2238 gene locus_tag LOCUS_10790 gene trpF 2870 2238 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4E3 protein_id gnl|my_center|LOCUS_10790 3703 2882 gene locus_tag LOCUS_10800 3703 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4077 3721 gene locus_tag LOCUS_10810 4077 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence148 200 1009 gene locus_tag LOCUS_10820 gene gloB 200 1009 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MF8 protein_id gnl|my_center|LOCUS_10820 1016 1867 gene locus_tag LOCUS_10830 1016 1867 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_10830 1965 3104 gene locus_tag LOCUS_10840 1965 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3108 4184 gene locus_tag LOCUS_10850 3108 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence149 3001 887 gene locus_tag LOCUS_10860 gene bhbA 3001 887 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888158.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence150 505 1287 gene locus_tag LOCUS_10870 505 1287 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083446.1 protein_id gnl|my_center|LOCUS_10870 1284 1784 gene locus_tag LOCUS_10880 1284 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1784 3319 gene locus_tag LOCUS_10890 gene guaA 1784 3319 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFA3 protein_id gnl|my_center|LOCUS_10890 3453 4169 gene locus_tag LOCUS_10900 gene rimL 3453 4169 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617027.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence151 144 542 gene locus_tag LOCUS_10910 gene staR 144 542 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920112.1 protein_id gnl|my_center|LOCUS_10910 684 1571 gene locus_tag LOCUS_10920 684 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975032.1 protein_id gnl|my_center|LOCUS_10920 1696 3114 gene locus_tag LOCUS_10930 1696 3114 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975644.1 protein_id gnl|my_center|LOCUS_10930 3131 3952 gene locus_tag LOCUS_10940 3131 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086528.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence152 1683 2972 gene locus_tag LOCUS_10950 gene purA 1683 2972 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0Z3 protein_id gnl|my_center|LOCUS_10950 3208 4113 gene locus_tag LOCUS_10960 3208 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence153 <4209 458 gene locus_tag LOCUS_10970 <4209 458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQV3:DNA-directed RNA polymerase subunit beta >Feature sequence154 222 1151 gene locus_tag LOCUS_10980 gene rsmH 222 1151 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT6 protein_id gnl|my_center|LOCUS_10980 1235 1681 gene locus_tag LOCUS_10990 1235 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1678 3438 gene locus_tag LOCUS_11000 1678 3438 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_11000 <4123 3477 gene locus_tag LOCUS_11010 <4123 3477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002724361.1:calcium-binding protein >Feature sequence155 637 128 gene locus_tag LOCUS_11020 637 128 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Y8 protein_id gnl|my_center|LOCUS_11020 1617 691 gene locus_tag LOCUS_11030 gene glpX 1617 691 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BU5 protein_id gnl|my_center|LOCUS_11030 3235 1664 gene locus_tag LOCUS_11040 gene cydC 3235 1664 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211344.1 protein_id gnl|my_center|LOCUS_11040 <4120 3232 gene locus_tag LOCUS_11050 <4120 3232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973554.1:thiol reductant ABC exporter subunit CydD >Feature sequence156 1679 585 gene locus_tag LOCUS_11060 gene mscR 1679 585 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899236.1 protein_id gnl|my_center|LOCUS_11060 2916 1885 gene locus_tag LOCUS_11070 2916 1885 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887779.1 protein_id gnl|my_center|LOCUS_11070 3448 2918 gene locus_tag LOCUS_11080 3448 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3699 3624 gene locus_tag LOCUS_t00210 3699 3624 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence157 1741 53 gene locus_tag LOCUS_11090 gene soxB 1741 53 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086299.1 protein_id gnl|my_center|LOCUS_11090 2687 1851 gene locus_tag LOCUS_11100 gene soxA 2687 1851 CDS product SoxAX cytochrome complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89PG6 protein_id gnl|my_center|LOCUS_11100 3079 2753 gene locus_tag LOCUS_11110 gene soxZ 3079 2753 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_11110 3589 3137 gene locus_tag LOCUS_11120 gene soxY 3589 3137 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence158 3872 2655 gene locus_tag LOCUS_11130 3872 2655 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336784.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence159 1074 64 gene locus_tag LOCUS_11140 1074 64 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 protein_id gnl|my_center|LOCUS_11140 1301 2680 gene locus_tag LOCUS_11150 gene yhxA 1301 2680 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537561.1 protein_id gnl|my_center|LOCUS_11150 2803 3681 gene locus_tag LOCUS_11160 2803 3681 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25043 protein_id gnl|my_center|LOCUS_11160 >Feature sequence160 100 894 gene locus_tag LOCUS_11170 100 894 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529188.1 protein_id gnl|my_center|LOCUS_11170 920 1840 gene locus_tag LOCUS_11180 920 1840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972040.1 protein_id gnl|my_center|LOCUS_11180 1845 2612 gene locus_tag LOCUS_11190 gene hpcH 1845 2612 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085757.1 protein_id gnl|my_center|LOCUS_11190 4009 2705 gene locus_tag LOCUS_11200 gene hisD 4009 2705 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_11200 >Feature sequence161 <1 1016 gene locus_tag LOCUS_11210 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532159.1:Fe-S cluster assembly protein SufD 1020 2252 gene locus_tag LOCUS_11220 1020 2252 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAQ0 protein_id gnl|my_center|LOCUS_11220 3833 2289 gene locus_tag LOCUS_11230 3833 2289 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531279.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence162 771 1151 gene locus_tag LOCUS_11240 771 1151 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 protein_id gnl|my_center|LOCUS_11240 1994 1254 gene locus_tag LOCUS_11250 1994 1254 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947521.1 protein_id gnl|my_center|LOCUS_11250 3346 1997 gene locus_tag LOCUS_11260 3346 1997 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058014.1 protein_id gnl|my_center|LOCUS_11260 <3955 3390 gene locus_tag LOCUS_11270 <3955 3390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088722.1:glycosyl hydrolase >Feature sequence163 2270 627 gene locus_tag LOCUS_11280 2270 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2486 3823 gene locus_tag LOCUS_11290 2486 3823 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083818.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence164 1496 120 gene locus_tag LOCUS_11300 1496 120 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I000 protein_id gnl|my_center|LOCUS_11300 1860 3005 gene locus_tag LOCUS_11310 1860 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence165 134 1048 gene locus_tag LOCUS_11320 gene mtsA 134 1048 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123738.1 protein_id gnl|my_center|LOCUS_11320 1048 1797 gene locus_tag LOCUS_11330 gene troB 1048 1797 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678718.1 protein_id gnl|my_center|LOCUS_11330 1794 2975 gene locus_tag LOCUS_11340 1794 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2972 3871 gene locus_tag LOCUS_11350 gene mntD 2972 3871 CDS product manganese transport system membrane protein MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34500 protein_id gnl|my_center|LOCUS_11350 >Feature sequence166 <1 1217 gene locus_tag LOCUS_11360 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338059.1:ABC transporter permease 1214 1846 gene locus_tag LOCUS_11370 1214 1846 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968331.1 protein_id gnl|my_center|LOCUS_11370 1978 2715 gene locus_tag LOCUS_11380 1978 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11380 2706 3089 gene locus_tag LOCUS_11390 2706 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11390 >Feature sequence167 <3854 2806 gene locus_tag LOCUS_11400 <3854 2806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WD04:methyltransferase >Feature sequence168 3742 833 gene locus_tag LOCUS_11410 gene sucA 3742 833 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972453.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence169 314 60 gene locus_tag LOCUS_11420 gene tusA 314 60 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAI0 protein_id gnl|my_center|LOCUS_11420 625 314 gene locus_tag LOCUS_11430 625 314 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720517.1 protein_id gnl|my_center|LOCUS_11430 738 2213 gene locus_tag LOCUS_11440 gene xseA 738 2213 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY31 protein_id gnl|my_center|LOCUS_11440 2241 3431 gene locus_tag LOCUS_11450 2241 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence170 154 2550 gene locus_tag LOCUS_11460 154 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence171 3323 951 gene locus_tag LOCUS_11470 3323 951 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence172 1894 266 gene locus_tag LOCUS_11480 gene pyrG 1894 266 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QA0 protein_id gnl|my_center|LOCUS_11480 2332 1955 gene locus_tag LOCUS_11490 2332 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence173 326 1777 gene locus_tag LOCUS_11500 326 1777 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_11500 1934 2590 gene locus_tag LOCUS_11510 1934 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391355.1 protein_id gnl|my_center|LOCUS_11510 3648 2647 gene locus_tag LOCUS_11520 3648 2647 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479089.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence174 771 430 gene locus_tag LOCUS_11530 771 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 986 1558 gene locus_tag LOCUS_11540 986 1558 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_11540 1596 2150 gene locus_tag LOCUS_11550 1596 2150 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529420.1 protein_id gnl|my_center|LOCUS_11550 2147 2806 gene locus_tag LOCUS_11560 2147 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975391.1 protein_id gnl|my_center|LOCUS_11560 3449 2826 gene locus_tag LOCUS_11570 gene upp 3449 2826 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U4H2 protein_id gnl|my_center|LOCUS_11570 3754 3494 gene locus_tag LOCUS_11580 3754 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence175 2120 318 gene locus_tag LOCUS_11590 2120 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2196 3284 gene locus_tag LOCUS_11600 gene hrcA 2196 3284 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN59 protein_id gnl|my_center|LOCUS_11600 >Feature sequence176 <1 626 gene locus_tag LOCUS_11610 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083498.1:penicillin-binding protein activator 731 1246 gene locus_tag LOCUS_11620 731 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391379.1 protein_id gnl|my_center|LOCUS_11620 1860 1243 gene locus_tag LOCUS_11630 1860 1243 CDS product electron transporter SCO1/SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976183.1 protein_id gnl|my_center|LOCUS_11630 2332 1874 gene locus_tag LOCUS_11640 2332 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3681 2506 gene locus_tag LOCUS_11650 3681 2506 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence177 816 1883 gene locus_tag LOCUS_11660 816 1883 CDS product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064255.1 protein_id gnl|my_center|LOCUS_11660 1880 3040 gene locus_tag LOCUS_11670 gene yqhT 1880 3040 CDS product putative peptidase YqhT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54518 protein_id gnl|my_center|LOCUS_11670 >Feature sequence178 <1 1172 gene locus_tag LOCUS_11680 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434070.1:restriction endonuclease 1174 2664 gene locus_tag LOCUS_11690 1174 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence179 <1 1025 gene locus_tag LOCUS_11700 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268771.1:serralysin 1099 2364 gene locus_tag LOCUS_11710 1099 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2381 3553 gene locus_tag LOCUS_11720 2381 3553 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088709.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence180 84 524 gene locus_tag LOCUS_11730 84 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1736 552 gene locus_tag LOCUS_11740 1736 552 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530333.1 protein_id gnl|my_center|LOCUS_11740 2435 1776 gene locus_tag LOCUS_11750 2435 1776 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969610.1 protein_id gnl|my_center|LOCUS_11750 3252 2377 gene locus_tag LOCUS_11760 3252 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390587.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence181 <1 1867 gene locus_tag LOCUS_11770 <1 1867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQ34:isoleucine--tRNA ligase 1921 2412 gene locus_tag LOCUS_11780 gene lspA 1921 2412 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI5 protein_id gnl|my_center|LOCUS_11780 2412 2969 gene locus_tag LOCUS_11790 2412 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence182 688 599 gene locus_tag LOCUS_t00220 688 599 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 769 2226 gene locus_tag LOCUS_11800 769 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708188.1 protein_id gnl|my_center|LOCUS_11800 2223 3287 gene locus_tag LOCUS_11810 2223 3287 CDS product UPF0283 membrane protein R01807 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PF5 protein_id gnl|my_center|LOCUS_11810 >Feature sequence183 206 1042 gene locus_tag LOCUS_11820 gene kynA 206 1042 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MN4 protein_id gnl|my_center|LOCUS_11820 >Feature sequence184 144 1331 gene locus_tag LOCUS_11830 144 1331 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337145.1 protein_id gnl|my_center|LOCUS_11830 1483 2175 gene locus_tag LOCUS_11840 gene lexA 1483 2175 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3S9 protein_id gnl|my_center|LOCUS_11840 2246 3385 gene locus_tag LOCUS_11850 2246 3385 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388442.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence185 922 1359 gene locus_tag LOCUS_11860 gene ypeA 922 1359 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804508.1 protein_id gnl|my_center|LOCUS_11860 2337 1375 gene locus_tag LOCUS_11870 gene yedY 2337 1375 CDS product mononuclear molybdenum enzyme YedY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_11870 3160 2384 gene locus_tag LOCUS_11880 3160 2384 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence186 290 862 gene locus_tag LOCUS_11890 290 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 995 2197 gene locus_tag LOCUS_11900 995 2197 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336782.1 protein_id gnl|my_center|LOCUS_11900 2200 3411 gene locus_tag LOCUS_11910 2200 3411 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971333.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence187 1962 1294 gene locus_tag LOCUS_11920 1962 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence188 <1 1036 gene locus_tag LOCUS_11930 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVU9:cell division protein FtsA 1075 2694 gene locus_tag LOCUS_11940 1075 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence189 585 1574 gene locus_tag LOCUS_11950 585 1574 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920857.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence190 <1 819 gene locus_tag LOCUS_11960 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391290.1:histidine kinase 839 1528 gene locus_tag LOCUS_11970 839 1528 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_11970 1623 1973 gene locus_tag LOCUS_11980 1623 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11980 2094 3170 gene locus_tag LOCUS_11990 2094 3170 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGL1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence191 661 2181 gene locus_tag LOCUS_12000 661 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2178 3173 gene locus_tag LOCUS_12010 2178 3173 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence192 379 1137 gene locus_tag LOCUS_12020 379 1137 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969919.1 protein_id gnl|my_center|LOCUS_12020 1276 2613 gene locus_tag LOCUS_12030 1276 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence193 <1 758 gene locus_tag LOCUS_12040 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020246.1:tetratricopeptide repeat protein 1358 825 gene locus_tag LOCUS_12050 1358 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2395 1367 gene locus_tag LOCUS_12060 2395 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3109 2405 gene locus_tag LOCUS_12070 3109 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence194 1160 99 gene locus_tag LOCUS_12080 1160 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1517 1176 gene locus_tag LOCUS_12090 1517 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1954 1565 gene locus_tag LOCUS_12100 1954 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2583 1954 gene locus_tag LOCUS_12110 2583 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 3352 2597 gene locus_tag LOCUS_12120 3352 2597 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719559.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence195 <1 627 gene locus_tag LOCUS_12130 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003534376.1:beta-ketoacyl-[acyl-carrier-protein] synthase I 640 1440 gene locus_tag LOCUS_12140 gene fabI 640 1440 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WC1 protein_id gnl|my_center|LOCUS_12140 1562 2356 gene locus_tag LOCUS_12150 1562 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2356 2715 gene locus_tag LOCUS_12160 2356 2715 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533616.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence196 <1 2088 gene locus_tag LOCUS_12170 <1 2088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU13:DNA-directed DNA polymerase >Feature sequence197 2795 507 gene locus_tag LOCUS_12180 2795 507 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_12180 3283 2903 gene locus_tag LOCUS_12190 gene clpS 3283 2903 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5I0 protein_id gnl|my_center|LOCUS_12190 >Feature sequence198 258 734 gene locus_tag LOCUS_12200 258 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 776 1114 gene locus_tag LOCUS_12210 776 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1744 1175 gene locus_tag LOCUS_12220 1744 1175 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708199.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12220 2147 1761 gene locus_tag LOCUS_12230 2147 1761 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886710.1 protein_id gnl|my_center|LOCUS_12230 <3282 2225 gene locus_tag LOCUS_12240 <3282 2225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MC66:translation initiation factor IF-2 >Feature sequence199 >Feature sequence200 105 659 gene locus_tag LOCUS_12250 105 659 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQZ3 protein_id gnl|my_center|LOCUS_12250 684 1622 gene locus_tag LOCUS_12260 684 1622 CDS product malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531656.1 protein_id gnl|my_center|LOCUS_12260 1682 3103 gene locus_tag LOCUS_12270 gene sdaA 1682 3103 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930277.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence201 <1 736 gene locus_tag LOCUS_12280 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZS9:proline--tRNA ligase 740 1942 gene locus_tag LOCUS_12290 740 1942 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531108.1 protein_id gnl|my_center|LOCUS_12290 1986 3155 gene locus_tag LOCUS_12300 1986 3155 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence202 2114 1068 gene locus_tag LOCUS_12310 2114 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3030 2740 gene locus_tag LOCUS_12320 3030 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence203 1017 556 gene locus_tag LOCUS_12330 1017 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1125 2726 gene locus_tag LOCUS_12340 1125 2726 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388453.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence204 <1 934 gene locus_tag LOCUS_12350 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058151.1:fucosyltransferase 938 2086 gene locus_tag LOCUS_12360 938 2086 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057044.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence205 314 961 gene locus_tag LOCUS_12370 gene ruvA 314 961 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89U81 protein_id gnl|my_center|LOCUS_12370 958 2007 gene locus_tag LOCUS_12380 gene ruvB 958 2007 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF5 protein_id gnl|my_center|LOCUS_12380 <3185 2097 gene locus_tag LOCUS_12390 <3185 2097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZZ17:catalase-peroxidase 2 >Feature sequence206 1929 214 gene locus_tag LOCUS_12400 1929 214 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_12400 2838 2011 gene locus_tag LOCUS_12410 2838 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267192.1 protein_id gnl|my_center|LOCUS_12410 3007 3083 gene locus_tag LOCUS_t00230 3007 3083 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence207 <1 239 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agttcagcatgacggctatttttacagccgactgagac 320 1879 gene locus_tag LOCUS_12420 320 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2432 1947 gene locus_tag LOCUS_12430 2432 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2686 2429 gene locus_tag LOCUS_12440 2686 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2885 3091 gene locus_tag LOCUS_12450 2885 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence208 139 876 gene locus_tag LOCUS_12460 139 876 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX69 protein_id gnl|my_center|LOCUS_12460 858 1406 gene locus_tag LOCUS_12470 858 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1863 1393 gene locus_tag LOCUS_12480 1863 1393 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Z5 protein_id gnl|my_center|LOCUS_12480 1980 2267 gene locus_tag LOCUS_12490 gene gatC 1980 2267 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J460 protein_id gnl|my_center|LOCUS_12490 >Feature sequence209 1262 786 gene locus_tag LOCUS_12500 gene nusB 1262 786 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M9I9 protein_id gnl|my_center|LOCUS_12500 1892 1266 gene locus_tag LOCUS_12510 gene ribE 1892 1266 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_12510 1990 3045 gene locus_tag LOCUS_12520 gene pyrC 1990 3045 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SC7 protein_id gnl|my_center|LOCUS_12520 >Feature sequence210 430 197 gene locus_tag LOCUS_12530 430 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1057 512 gene locus_tag LOCUS_12540 1057 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12540 2168 1158 gene locus_tag LOCUS_12550 2168 1158 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815692.1 protein_id gnl|my_center|LOCUS_12550 <3126 2311 gene locus_tag LOCUS_12560 <3126 2311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531742.1:esterase >Feature sequence211 1560 901 gene locus_tag LOCUS_12570 gene nuoC 1560 901 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU38 protein_id gnl|my_center|LOCUS_12570 2144 1566 gene locus_tag LOCUS_12580 gene nuoB 2144 1566 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU39 protein_id gnl|my_center|LOCUS_12580 2603 2187 gene locus_tag LOCUS_12590 gene nuoA 2603 2187 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU40 protein_id gnl|my_center|LOCUS_12590 >Feature sequence212 394 894 gene locus_tag LOCUS_12600 gene secB 394 894 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEF8 protein_id gnl|my_center|LOCUS_12600 962 1885 gene locus_tag LOCUS_12610 962 1885 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207504.1 protein_id gnl|my_center|LOCUS_12610 2702 1914 gene locus_tag LOCUS_12620 2702 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence213 1 366 gene locus_tag LOCUS_12630 1 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 431 2200 gene locus_tag LOCUS_12640 gene xsc 431 2200 CDS product putative sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92UW6 protein_id gnl|my_center|LOCUS_12640 >Feature sequence214 572 706 gene locus_tag LOCUS_12650 572 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1058 729 gene locus_tag LOCUS_12660 1058 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1642 1055 gene locus_tag LOCUS_12670 gene tag 1642 1055 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_12670 2846 1632 gene locus_tag LOCUS_12680 2846 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence215 <1 1566 gene locus_tag LOCUS_12690 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389446.1:MBL fold hydrolase 1576 1974 gene locus_tag LOCUS_12700 1576 1974 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969152.1 protein_id gnl|my_center|LOCUS_12700 1975 2223 gene locus_tag LOCUS_12710 1975 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 <3079 2265 gene locus_tag LOCUS_12720 <3079 2265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035843.1:glycosyl transferase >Feature sequence216 313 2511 gene locus_tag LOCUS_12730 313 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2520 2867 gene locus_tag LOCUS_12740 2520 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence217 993 2240 gene locus_tag LOCUS_12750 993 2240 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529656.1 protein_id gnl|my_center|LOCUS_12750 2281 2580 gene locus_tag LOCUS_12760 gene soxD 2281 2580 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229308.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence218 2 2038 gene locus_tag LOCUS_12770 gene uvrC 2 2038 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS75 protein_id gnl|my_center|LOCUS_12770 2328 2747 gene locus_tag LOCUS_12780 2328 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence219 1413 172 gene locus_tag LOCUS_12790 1413 172 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103851.1 protein_id gnl|my_center|LOCUS_12790 2362 1415 gene locus_tag LOCUS_12800 gene gshB 2362 1415 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UFD2 protein_id gnl|my_center|LOCUS_12800 >Feature sequence220 177 557 gene locus_tag LOCUS_12810 177 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 561 1100 gene locus_tag LOCUS_12820 561 1100 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_12820 1308 2132 gene locus_tag LOCUS_12830 1308 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence221 505 2043 gene locus_tag LOCUS_12840 505 2043 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_12840 <3012 2052 gene locus_tag LOCUS_12850 <3012 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861734.1:transcriptional regulator >Feature sequence222 983 567 gene locus_tag LOCUS_12860 gene rplQ 983 567 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY5 protein_id gnl|my_center|LOCUS_12860 2134 1115 gene locus_tag LOCUS_12870 gene rpoA 2134 1115 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY4 protein_id gnl|my_center|LOCUS_12870 2676 2287 gene locus_tag LOCUS_12880 gene rpsK 2676 2287 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F7 protein_id gnl|my_center|LOCUS_12880 2895 2695 gene locus_tag LOCUS_12890 2895 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence223 1 429 gene locus_tag LOCUS_12900 1 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 490 1107 gene locus_tag LOCUS_12910 490 1107 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CHE0 protein_id gnl|my_center|LOCUS_12910 <3005 1167 gene locus_tag LOCUS_12920 <3005 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140040.1:propionyl-CoA synthetase >Feature sequence224 <1 566 gene locus_tag LOCUS_12930 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583016.1:5-deoxy-glucuronate isomerase 563 1405 gene locus_tag LOCUS_12940 563 1405 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_12940 1526 1696 gene locus_tag LOCUS_12950 1526 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1813 2328 gene locus_tag LOCUS_12960 gene fabA 1813 2328 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A246 protein_id gnl|my_center|LOCUS_12960 >Feature sequence225 465 223 gene locus_tag LOCUS_12970 465 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1309 554 gene locus_tag LOCUS_12980 1309 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1566 1324 gene locus_tag LOCUS_12990 1566 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2270 1581 gene locus_tag LOCUS_13000 2270 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2817 2287 gene locus_tag LOCUS_13010 2817 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence226 593 919 gene locus_tag LOCUS_13020 593 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2279 948 gene locus_tag LOCUS_13030 2279 948 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387979.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence227 342 812 gene locus_tag LOCUS_13040 gene rplM 342 812 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QR4 protein_id gnl|my_center|LOCUS_13040 809 1303 gene locus_tag LOCUS_13050 gene rpsI 809 1303 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSE4 protein_id gnl|my_center|LOCUS_13050 1545 1766 gene locus_tag LOCUS_13060 1545 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1763 2410 gene locus_tag LOCUS_13070 1763 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2414 2818 gene locus_tag LOCUS_13080 2414 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence228 1429 536 gene locus_tag LOCUS_13090 1429 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13090 2268 1426 gene locus_tag LOCUS_13100 2268 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13100 2696 2899 gene locus_tag LOCUS_13110 2696 2899 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720550.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence229 204 1490 gene locus_tag LOCUS_13120 gene ordL1 204 1490 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969983.1 protein_id gnl|my_center|LOCUS_13120 1493 2389 gene locus_tag LOCUS_13130 1493 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence230 1603 1112 gene locus_tag LOCUS_13140 1603 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388121.1 protein_id gnl|my_center|LOCUS_13140 2148 1606 gene locus_tag LOCUS_13150 2148 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 2725 2180 gene locus_tag LOCUS_13160 2725 2180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708402.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence231 <1 578 gene locus_tag LOCUS_13170 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921220.1:cytochrome b561 551 883 gene locus_tag LOCUS_13180 551 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1259 861 gene locus_tag LOCUS_13190 gene acpS 1259 861 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69159 protein_id gnl|my_center|LOCUS_13190 1837 1256 gene locus_tag LOCUS_13200 1837 1256 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084142.1 protein_id gnl|my_center|LOCUS_13200 2721 1846 gene locus_tag LOCUS_13210 2721 1846 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920766.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence232 73 1098 gene locus_tag LOCUS_13220 73 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1091 1468 gene locus_tag LOCUS_13230 1091 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1701 1997 gene locus_tag LOCUS_13240 1701 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2482 2622 gene locus_tag LOCUS_13250 2482 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence233 140 964 gene locus_tag LOCUS_13260 140 964 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_13260 961 1668 gene locus_tag LOCUS_13270 961 1668 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384137.1 protein_id gnl|my_center|LOCUS_13270 1684 2697 gene locus_tag LOCUS_13280 1684 2697 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence234 488 1090 gene locus_tag LOCUS_13290 488 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1091 1720 gene locus_tag LOCUS_13300 1091 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1772 2002 gene locus_tag LOCUS_13310 1772 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 2062 2532 gene locus_tag LOCUS_13320 2062 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence235 <1 906 gene locus_tag LOCUS_13330 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946051.1:lipoprotein 1101 1176 gene locus_tag LOCUS_t00240 1101 1176 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1317 2216 gene locus_tag LOCUS_13340 1317 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2220 2435 gene locus_tag LOCUS_13350 2220 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence236 1577 1176 gene locus_tag LOCUS_13360 1577 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 <2842 1577 gene locus_tag LOCUS_13370 <2842 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387909.1:GTP-binding protein >Feature sequence237 72 1058 gene locus_tag LOCUS_13380 72 1058 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896426.1 protein_id gnl|my_center|LOCUS_13380 1073 1363 gene locus_tag LOCUS_13390 1073 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814039.1 protein_id gnl|my_center|LOCUS_13390 1377 2555 gene locus_tag LOCUS_13400 1377 2555 CDS product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence238 1289 576 gene locus_tag LOCUS_13410 1289 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1584 1282 gene locus_tag LOCUS_13420 1584 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 2179 1724 gene locus_tag LOCUS_13430 2179 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2516 2166 gene locus_tag LOCUS_13440 2516 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence239 930 700 gene locus_tag LOCUS_13450 930 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2785 1676 gene locus_tag LOCUS_13460 2785 1676 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_13460 >Feature sequence240 >Feature sequence241 1511 384 gene locus_tag LOCUS_13470 gene dnaJ 1511 384 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50018 protein_id gnl|my_center|LOCUS_13470 <2752 1625 gene locus_tag LOCUS_13480 <2752 1625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P42374:chaperone protein DnaK >Feature sequence242 488 9 gene locus_tag LOCUS_13490 488 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1047 433 gene locus_tag LOCUS_13500 1047 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 protein_id gnl|my_center|LOCUS_13500 1267 1470 gene locus_tag LOCUS_13510 gene rpsU 1267 1470 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK1 protein_id gnl|my_center|LOCUS_13510 1483 2091 gene locus_tag LOCUS_13520 1483 2091 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705440.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence243 175 810 gene locus_tag LOCUS_13530 175 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 804 1277 gene locus_tag LOCUS_13540 804 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2623 1274 gene locus_tag LOCUS_13550 2623 1274 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599197.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence244 196 44 gene locus_tag LOCUS_13560 196 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1539 181 gene locus_tag LOCUS_13570 gene cysS 1539 181 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK2 protein_id gnl|my_center|LOCUS_13570 2732 1536 gene locus_tag LOCUS_13580 gene gltX1 2732 1536 CDS product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK3 protein_id gnl|my_center|LOCUS_13580 >Feature sequence245 1440 181 gene locus_tag LOCUS_13590 1440 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1548 1835 gene locus_tag LOCUS_13600 1548 1835 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_13600 <2722 1827 gene locus_tag LOCUS_13610 <2722 1827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338742.1:acetoin utilization protein >Feature sequence246 1484 306 gene locus_tag LOCUS_13620 1484 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2284 1481 gene locus_tag LOCUS_13630 2284 1481 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388851.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence247 <1 1072 gene locus_tag LOCUS_13640 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWE4:4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) 1075 2001 gene locus_tag LOCUS_13650 1075 2001 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ35 protein_id gnl|my_center|LOCUS_13650 <2704 2016 gene locus_tag LOCUS_13660 <2704 2016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TKA4:dihydroxy-acid dehydratase >Feature sequence248 759 280 gene locus_tag LOCUS_13670 759 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931865.1 protein_id gnl|my_center|LOCUS_13670 1451 687 gene locus_tag LOCUS_13680 1451 687 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267576.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence249 217 1362 gene locus_tag LOCUS_13690 217 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1381 2670 gene locus_tag LOCUS_13700 1381 2670 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388829.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence250 225 2375 gene locus_tag LOCUS_13710 gene glcB 225 2375 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBD2 protein_id gnl|my_center|LOCUS_13710 >Feature sequence251 404 1585 gene locus_tag LOCUS_13720 404 1585 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_13720 1582 1824 gene locus_tag LOCUS_13730 1582 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1881 2363 gene locus_tag LOCUS_13740 gene gpt 1881 2363 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3U1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence252 115 1584 gene locus_tag LOCUS_13750 115 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence253 874 485 gene locus_tag LOCUS_13760 874 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13760 1273 1064 gene locus_tag LOCUS_13770 1273 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13770 1902 1270 gene locus_tag LOCUS_13780 gene rsmG 1902 1270 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN75 protein_id gnl|my_center|LOCUS_13780 <2632 1940 gene locus_tag LOCUS_13790 <2632 1940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8GW33:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG >Feature sequence254 992 213 gene locus_tag LOCUS_13800 992 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968155.1 protein_id gnl|my_center|LOCUS_13800 1214 2446 gene locus_tag LOCUS_13810 1214 2446 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975652.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence255 311 1678 gene locus_tag LOCUS_13820 311 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1680 2276 gene locus_tag LOCUS_13830 1680 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence256 1341 559 gene locus_tag LOCUS_13840 1341 559 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_13840 1608 1532 gene locus_tag LOCUS_t00250 1608 1532 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1813 2151 gene locus_tag LOCUS_13850 gene glnB 1813 2151 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 protein_id gnl|my_center|LOCUS_13850 >Feature sequence257 1013 237 gene locus_tag LOCUS_13860 1013 237 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011169330.1 protein_id gnl|my_center|LOCUS_13860 <2610 1105 gene locus_tag LOCUS_13870 <2610 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086561.1:NAD+ synthase >Feature sequence258 1582 56 gene locus_tag LOCUS_13880 1582 56 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974636.1 protein_id gnl|my_center|LOCUS_13880 1771 2388 gene locus_tag LOCUS_13890 1771 2388 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706095.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence259 1896 2105 gene locus_tag LOCUS_13900 1896 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence260 146 742 gene locus_tag LOCUS_13910 146 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708368.1 protein_id gnl|my_center|LOCUS_13910 742 1896 gene locus_tag LOCUS_13920 gene rsmB 742 1896 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence261 1954 455 gene locus_tag LOCUS_13930 1954 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence262 <1 1746 gene locus_tag LOCUS_13940 <1 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU34:NADH-quinone oxidoreductase >Feature sequence263 355 1032 gene locus_tag LOCUS_13950 355 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1246 1881 gene locus_tag LOCUS_13960 1246 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1883 2260 gene locus_tag LOCUS_13970 1883 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence264 824 129 gene locus_tag LOCUS_13980 gene trmB 824 129 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS4 protein_id gnl|my_center|LOCUS_13980 >Feature sequence265 1137 373 gene locus_tag LOCUS_13990 1137 373 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A321 protein_id gnl|my_center|LOCUS_13990 1215 1841 gene locus_tag LOCUS_14000 gene tdk 1215 1841 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03221 protein_id gnl|my_center|LOCUS_14000 >Feature sequence266 805 1689 gene locus_tag LOCUS_14010 gene fabI1 805 1689 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58380 protein_id gnl|my_center|LOCUS_14010 >Feature sequence267 >Feature sequence268 2299 92 gene locus_tag LOCUS_14020 gene priA 2299 92 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL27 protein_id gnl|my_center|LOCUS_14020 >Feature sequence269 2000 705 gene locus_tag LOCUS_14030 gene glyA 2000 705 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 protein_id gnl|my_center|LOCUS_14030 >Feature sequence270 30 857 gene locus_tag LOCUS_14040 30 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 913 1470 gene locus_tag LOCUS_14050 913 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1924 1457 gene locus_tag LOCUS_14060 1924 1457 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE17 protein_id gnl|my_center|LOCUS_14060 <2437 1921 gene locus_tag LOCUS_14070 <2437 1921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920603.1:c-type cytochrome biogenesis protein CcmI >Feature sequence271 506 27 gene locus_tag LOCUS_14080 506 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 581 1375 gene locus_tag LOCUS_14090 gene ubiE 581 1375 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ3 protein_id gnl|my_center|LOCUS_14090 <2433 1390 gene locus_tag LOCUS_14100 <2433 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918936.1:glycosyl transferase family 1 >Feature sequence272 1159 515 gene locus_tag LOCUS_14110 1159 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 <2431 1198 gene locus_tag LOCUS_14120 <2431 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390042.1:ABC transporter ATP-binding protein >Feature sequence273 2342 1071 gene locus_tag LOCUS_14130 gene murA 2342 1071 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHW9 protein_id gnl|my_center|LOCUS_14130 >Feature sequence274 2 898 gene locus_tag LOCUS_14140 2 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 918 2309 gene locus_tag LOCUS_14150 918 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence275 738 1280 gene locus_tag LOCUS_14160 738 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2319 1345 gene locus_tag LOCUS_14170 2319 1345 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence276 1110 466 gene locus_tag LOCUS_14180 gene soxD 1110 466 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086301.1 protein_id gnl|my_center|LOCUS_14180 2344 1115 gene locus_tag LOCUS_14190 gene soxC 2344 1115 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence277 506 970 gene locus_tag LOCUS_14200 506 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1484 999 gene locus_tag LOCUS_14210 gene smpB 1484 999 CDS product ssrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Z9 protein_id gnl|my_center|LOCUS_14210 <2357 1496 gene locus_tag LOCUS_14220 <2357 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RT80:4-hydroxy-tetrahydrodipicolinate synthase >Feature sequence278 <1 919 gene locus_tag LOCUS_14230 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UBS0:glutamate 5-kinase 916 2181 gene locus_tag LOCUS_14240 gene proA 916 2181 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV06 protein_id gnl|my_center|LOCUS_14240 >Feature sequence279 206 805 gene locus_tag LOCUS_14250 206 805 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_14250 820 2100 gene locus_tag LOCUS_14260 gene nuoF1 820 2100 CDS product NADH-quinone oxidoreductase subunit F 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56912 protein_id gnl|my_center|LOCUS_14260 2100 2321 gene locus_tag LOCUS_14270 2100 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence280 713 21 gene locus_tag LOCUS_14280 713 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090674.1 protein_id gnl|my_center|LOCUS_14280 2121 721 gene locus_tag LOCUS_14290 2121 721 CDS product selenium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090675.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence281 >Feature sequence282 974 225 gene locus_tag LOCUS_14300 gene coaX 974 225 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU25 protein_id gnl|my_center|LOCUS_14300 1693 971 gene locus_tag LOCUS_14310 gene birA 1693 971 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140172.1 protein_id gnl|my_center|LOCUS_14310 <2289 1702 gene locus_tag LOCUS_14320 <2289 1702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU27:NADH-quinone oxidoreductase subunit N >Feature sequence283 >Feature sequence284 2105 1524 gene locus_tag LOCUS_14330 gene coaD 2105 1524 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK2 protein_id gnl|my_center|LOCUS_14330 >Feature sequence285 <2243 399 gene locus_tag LOCUS_14340 <2243 399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVE6:ATP-dependent zinc metalloprotease FtsH >Feature sequence286 1106 243 gene locus_tag LOCUS_14350 1106 243 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388494.1 protein_id gnl|my_center|LOCUS_14350 1840 1127 gene locus_tag LOCUS_14360 gene ctpA 1840 1127 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918195.1 protein_id gnl|my_center|LOCUS_14360 2147 1899 gene locus_tag LOCUS_14370 2147 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence287 966 331 gene locus_tag LOCUS_14380 gene wecD 966 331 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_14380 1586 963 gene locus_tag LOCUS_14390 1586 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112977.1 protein_id gnl|my_center|LOCUS_14390 <2233 1590 gene locus_tag LOCUS_14400 <2233 1590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525503.1:agmatinase >Feature sequence288 1000 365 gene locus_tag LOCUS_14410 1000 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 2118 1066 gene locus_tag LOCUS_14420 2118 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence289 >Feature sequence290 <1 640 gene locus_tag LOCUS_14430 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118084.1:group II intron reverse transcriptase/maturase 609 1646 gene locus_tag LOCUS_14440 609 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1648 1938 gene locus_tag LOCUS_14450 1648 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence291 <1 690 gene locus_tag LOCUS_14460 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338460.1:methyltransferase 794 2128 gene locus_tag LOCUS_14470 794 2128 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence292 1541 1465 gene locus_tag LOCUS_t00260 1541 1465 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2188 1601 gene locus_tag LOCUS_14480 2188 1601 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence293 <2163 272 gene locus_tag LOCUS_14490 <2163 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113499.1:acetoacetyl-CoA synthetase >Feature sequence294 872 51 gene locus_tag LOCUS_14500 872 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 2106 1099 gene locus_tag LOCUS_14510 2106 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence295 1863 1402 gene locus_tag LOCUS_14520 1863 1402 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence296 1282 857 gene locus_tag LOCUS_14530 1282 857 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720950.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence297 1290 478 gene locus_tag LOCUS_14540 1290 478 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567445.1 protein_id gnl|my_center|LOCUS_14540 1958 1287 gene locus_tag LOCUS_14550 1958 1287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227690.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence298 105 224 gene locus_tag LOCUS_14560 105 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 385 1761 gene locus_tag LOCUS_14570 gene tolB 385 1761 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 protein_id gnl|my_center|LOCUS_14570 >Feature sequence299 1233 496 gene locus_tag LOCUS_14580 1233 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14580 1593 1291 gene locus_tag LOCUS_14590 1593 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence300 1404 70 gene locus_tag LOCUS_14600 1404 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14600 1931 1416 gene locus_tag LOCUS_14610 1931 1416 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808807.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence301 139 214 gene locus_tag LOCUS_t00270 139 214 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1227 271 gene locus_tag LOCUS_14620 1227 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1606 1238 gene locus_tag LOCUS_14630 1606 1238 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390193.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence302 >Feature sequence303 454 1047 gene locus_tag LOCUS_14640 gene petR 454 1047 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385503.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence304 1421 555 gene locus_tag LOCUS_14650 1421 555 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532275.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence305 34 1179 gene locus_tag LOCUS_14660 34 1179 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 protein_id gnl|my_center|LOCUS_14660 1841 1221 gene locus_tag LOCUS_14670 gene pdxH 1841 1221 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H292 protein_id gnl|my_center|LOCUS_14670 >Feature sequence306 >Feature sequence307 176 90 gene locus_tag LOCUS_t00280 176 90 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 296 958 gene locus_tag LOCUS_14680 gene lipB 296 958 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA5 protein_id gnl|my_center|LOCUS_14680 >Feature sequence308 <1966 203 gene locus_tag LOCUS_14690 <1966 203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388247.1:TonB-dependent receptor >Feature sequence309 963 70 gene locus_tag LOCUS_14700 963 70 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 protein_id gnl|my_center|LOCUS_14700 1460 1221 gene locus_tag LOCUS_14710 1460 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence310 >Feature sequence311 840 22 gene locus_tag LOCUS_14720 840 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1679 837 gene locus_tag LOCUS_14730 1679 837 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090615.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence312 >Feature sequence313 >Feature sequence314 463 35 gene locus_tag LOCUS_14740 463 35 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183065.1 protein_id gnl|my_center|LOCUS_14740 <1860 480 gene locus_tag LOCUS_14750 <1860 480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967775.1:methyltransferase >Feature sequence315 <1 692 gene locus_tag LOCUS_14760 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389782.1:serine acetyltransferase 698 1732 gene locus_tag LOCUS_14770 gene nifS 698 1732 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087110.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence316 <1828 778 gene locus_tag LOCUS_14780 <1828 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125914.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase >Feature sequence317 1668 1045 gene locus_tag LOCUS_14790 gene thiE 1668 1045 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3N4K1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence318 <1 748 gene locus_tag LOCUS_14800 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385282.1:GTP-binding protein 1760 759 gene locus_tag LOCUS_14810 gene iolG 1760 759 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence319 559 1602 gene locus_tag LOCUS_14820 gene obg 559 1602 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CB41 protein_id gnl|my_center|LOCUS_14820 >Feature sequence320 <1 1221 gene locus_tag LOCUS_14830 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNA1:ATP-dependent protease ATPase subunit HslU 1335 1422 gene locus_tag LOCUS_t00290 1335 1422 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence321 1236 253 gene locus_tag LOCUS_14840 gene guaC 1236 253 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRU7 protein_id gnl|my_center|LOCUS_14840 1756 1397 gene locus_tag LOCUS_14850 1756 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence322 >Feature sequence323 >Feature sequence324 90 827 gene locus_tag LOCUS_14860 gene tpiA 90 827 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT56 protein_id gnl|my_center|LOCUS_14860 >Feature sequence325 <1 949 gene locus_tag LOCUS_14870 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CAA4:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence326 1632 322 gene locus_tag LOCUS_14880 1632 322 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence327 >Feature sequence328 >Feature sequence329 3 428 gene locus_tag LOCUS_14890 gene rlmH 3 428 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB0 protein_id gnl|my_center|LOCUS_14890 490 948 gene locus_tag LOCUS_14900 490 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 936 1349 gene locus_tag LOCUS_14910 936 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence330 45 1325 gene locus_tag LOCUS_14920 45 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence331 <1660 363 gene locus_tag LOCUS_14930 <1660 363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390528.1:DEAD/DEAH box helicase >Feature sequence332 >Feature sequence333 612 537 gene locus_tag LOCUS_t00300 612 537 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence334 383 1126 gene locus_tag LOCUS_14940 383 1126 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521491.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence335 1100 183 gene locus_tag LOCUS_14950 gene ddl 1100 183 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4L8 protein_id gnl|my_center|LOCUS_14950 <1638 1100 gene locus_tag LOCUS_14960 <1638 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TF56:UDP-N-acetylenolpyruvoylglucosamine reductase >Feature sequence336 1396 248 gene locus_tag LOCUS_14970 1396 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence337 <1 919 gene locus_tag LOCUS_14980 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8TFP3:glucokinase 916 1569 gene locus_tag LOCUS_14990 gene eda 916 1569 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416953.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence338 <1 741 gene locus_tag LOCUS_15000 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969576.1:cytochrome c <1593 753 gene locus_tag LOCUS_15010 <1593 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707684.1:agmatine deiminase >Feature sequence339 >Feature sequence340 563 1429 gene locus_tag LOCUS_15020 gene fdhD 563 1429 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU0 protein_id gnl|my_center|LOCUS_15020 >Feature sequence341 1376 1531 gene locus_tag LOCUS_15030 1376 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence342 <1536 354 gene locus_tag LOCUS_15040 <1536 354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067755.1:3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) >Feature sequence343 >Feature sequence344 >Feature sequence345 1366 227 gene locus_tag LOCUS_15050 1366 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence346 <1497 710 gene locus_tag LOCUS_15060 <1497 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92UX0:Taurine import ATP-binding protein TauB >Feature sequence347 1277 636 gene locus_tag LOCUS_15070 1277 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence348 >Feature sequence349 >Feature sequence350 803 684 gene locus_tag LOCUS_15080 803 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1294 818 gene locus_tag LOCUS_15090 1294 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence351 <1 1116 gene locus_tag LOCUS_15100 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000426093.1:type VI secretion-associated protein >Feature sequence352 >Feature sequence353 >Feature sequence354 <1 645 gene locus_tag LOCUS_15110 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HIK4:5-dehydro-2-deoxygluconokinase >Feature sequence355 <1424 852 gene locus_tag LOCUS_15120 <1424 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EHM1:dihydropteroate synthase >Feature sequence356 <1 512 gene locus_tag LOCUS_15130 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389520.1:peptidase M23 >Feature sequence357 >Feature sequence358 1390 449 gene locus_tag LOCUS_15140 gene dctP 1390 449 CDS product C4-dicarboxylate-binding periplasmic protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQR9 protein_id gnl|my_center|LOCUS_15140 >Feature sequence359 405 926 gene locus_tag LOCUS_15150 405 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence360 156 458 gene locus_tag LOCUS_15160 156 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 626 865 gene locus_tag LOCUS_15170 626 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence361 2 586 gene locus_tag LOCUS_15180 2 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence362 <1 890 gene locus_tag LOCUS_15190 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9YAJ1:pseudouridine synthase >Feature sequence363 <1 568 gene locus_tag LOCUS_15200 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390952.1:peptidase S41 678 845 gene locus_tag LOCUS_15210 gene rpmG 678 845 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5I8 protein_id gnl|my_center|LOCUS_15210 >Feature sequence364 <1 898 gene locus_tag LOCUS_15220 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537682.1:branched-chain amino acid ABC transporter permease >Feature sequence365 >Feature sequence366 <1303 21 gene locus_tag LOCUS_15230 <1303 21 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391178.1:bifunctional folylpolyglutamate synthase/dihydrofolate synthase >Feature sequence367 1198 464 gene locus_tag LOCUS_15240 gene nth 1198 464 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WJ8 protein_id gnl|my_center|LOCUS_15240 >Feature sequence368 990 118 gene locus_tag LOCUS_15250 990 118 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 protein_id gnl|my_center|LOCUS_15250 >Feature sequence369 >Feature sequence370 >Feature sequence371 >Feature sequence372 803 231 gene locus_tag LOCUS_15260 803 231 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_15260 1082 816 gene locus_tag LOCUS_15270 1082 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence373 >Feature sequence374 1253 948 gene locus_tag LOCUS_15280 1253 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence375 <1253 114 gene locus_tag LOCUS_15290 <1253 114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528234.1:guanine deaminase >Feature sequence376 <1253 346 gene locus_tag LOCUS_15300 <1253 346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J0W2:glutamate dehydrogenase >Feature sequence377 <1 793 gene locus_tag LOCUS_15310 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067483.1:ABC transporter substrate-binding protein >Feature sequence378 263 922 gene locus_tag LOCUS_15320 263 922 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920463.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence379 <1 1058 gene locus_tag LOCUS_15330 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7D1M9:putative lipid II flippase MurJ >Feature sequence380 78 398 gene locus_tag LOCUS_15340 78 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 702 1004 gene locus_tag LOCUS_15350 702 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence381 >Feature sequence382 <1184 420 gene locus_tag LOCUS_15360 <1184 420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951079.1:site-specific DNA-methyltransferase >Feature sequence383 1 792 gene locus_tag LOCUS_15370 1 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence384 >Feature sequence385 <1 748 gene locus_tag LOCUS_15380 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262215.1:oxidoreductase >Feature sequence386 <1164 93 gene locus_tag LOCUS_15390 <1164 93 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531033.1:serine protease >Feature sequence387 >Feature sequence388 402 136 gene locus_tag LOCUS_15400 gene rpsT 402 136 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4E3 protein_id gnl|my_center|LOCUS_15400 >Feature sequence389 <1125 249 gene locus_tag LOCUS_15410 <1125 249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880440.1:cytochrome C biogenesis protein CcdA >Feature sequence390 >Feature sequence391 >Feature sequence392 >Feature sequence393 720 34 gene locus_tag LOCUS_15420 720 34 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence394 >Feature sequence395 453 983 gene locus_tag LOCUS_15430 453 983 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFR5 protein_id gnl|my_center|LOCUS_15430 >Feature sequence396 635 81 gene locus_tag LOCUS_15440 gene dcd 635 81 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYC9 protein_id gnl|my_center|LOCUS_15440 >Feature sequence397 963 616 gene locus_tag LOCUS_15450 963 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence398 >Feature sequence399 967 221 gene locus_tag LOCUS_15460 967 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence400 >Feature sequence401 797 333 gene locus_tag LOCUS_15470 797 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence402 >Feature sequence403 1023 475 gene locus_tag LOCUS_15480 1023 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence404 199 528 gene locus_tag LOCUS_15490 199 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence405