>Feature sequence001 863 1876 gene locus_tag LOCUS_00010 863 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2248 1901 gene locus_tag LOCUS_00020 2248 1901 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XZB8 protein_id gnl|my_center|LOCUS_00020 2316 3572 gene locus_tag LOCUS_00030 2316 3572 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083372.1 protein_id gnl|my_center|LOCUS_00030 4371 3643 gene locus_tag LOCUS_00040 4371 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4985 4542 gene locus_tag LOCUS_00050 4985 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5411 6325 gene locus_tag LOCUS_00060 5411 6325 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 protein_id gnl|my_center|LOCUS_00060 8080 6407 gene locus_tag LOCUS_00070 gene fhs 8080 6407 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFQ8 protein_id gnl|my_center|LOCUS_00070 9152 8295 gene locus_tag LOCUS_00080 9152 8295 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388497.1 protein_id gnl|my_center|LOCUS_00080 9444 9181 gene locus_tag LOCUS_00090 gene grxC 9444 9181 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_00090 9955 9563 gene locus_tag LOCUS_00100 gene pcaC 9955 9563 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206417.1 protein_id gnl|my_center|LOCUS_00100 13364 9993 gene locus_tag LOCUS_00110 13364 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14533 13361 gene locus_tag LOCUS_00120 14533 13361 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_00120 15110 14553 gene locus_tag LOCUS_00130 15110 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15704 15285 gene locus_tag LOCUS_00140 15704 15285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 protein_id gnl|my_center|LOCUS_00140 15825 16373 gene locus_tag LOCUS_00150 15825 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533965.1 protein_id gnl|my_center|LOCUS_00150 16502 18043 gene locus_tag LOCUS_00160 16502 18043 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530887.1 protein_id gnl|my_center|LOCUS_00160 18133 19098 gene locus_tag LOCUS_00170 18133 19098 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720078.1 protein_id gnl|my_center|LOCUS_00170 19103 19906 gene locus_tag LOCUS_00180 19103 19906 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_00180 20837 19917 gene locus_tag LOCUS_00190 20837 19917 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529454.1 protein_id gnl|my_center|LOCUS_00190 20946 21443 gene locus_tag LOCUS_00200 20946 21443 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529453.1 protein_id gnl|my_center|LOCUS_00200 21615 22412 gene locus_tag LOCUS_00210 gene fpr 21615 22412 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537440.1 protein_id gnl|my_center|LOCUS_00210 23401 22409 gene locus_tag LOCUS_00220 23401 22409 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528521.1 protein_id gnl|my_center|LOCUS_00220 24361 23432 gene locus_tag LOCUS_00230 gene fmt 24361 23432 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZH6 protein_id gnl|my_center|LOCUS_00230 24932 24393 gene locus_tag LOCUS_00240 gene def 24932 24393 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5I4 protein_id gnl|my_center|LOCUS_00240 25801 25010 gene locus_tag LOCUS_00250 25801 25010 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528894.1 protein_id gnl|my_center|LOCUS_00250 26581 25823 gene locus_tag LOCUS_00260 gene spuA 26581 25823 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 protein_id gnl|my_center|LOCUS_00260 26690 27484 gene locus_tag LOCUS_00270 26690 27484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 28275 27481 gene locus_tag LOCUS_00280 28275 27481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336996.1 protein_id gnl|my_center|LOCUS_00280 29230 28337 gene locus_tag LOCUS_00290 29230 28337 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389600.1 protein_id gnl|my_center|LOCUS_00290 32118 29353 gene locus_tag LOCUS_00300 32118 29353 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNJ0 protein_id gnl|my_center|LOCUS_00300 33053 32307 gene locus_tag LOCUS_00310 33053 32307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33852 33244 gene locus_tag LOCUS_00320 33852 33244 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086905.1 protein_id gnl|my_center|LOCUS_00320 34211 34579 gene locus_tag LOCUS_00330 34211 34579 CDS product putative HTH-type transcriptional regulator R00410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C5S2 protein_id gnl|my_center|LOCUS_00330 35047 34697 gene locus_tag LOCUS_00340 35047 34697 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265919.1 protein_id gnl|my_center|LOCUS_00340 35279 35887 gene locus_tag LOCUS_00350 35279 35887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36526 35930 gene locus_tag LOCUS_00360 36526 35930 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T94 protein_id gnl|my_center|LOCUS_00360 36626 37489 gene locus_tag LOCUS_00370 36626 37489 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098205.1 protein_id gnl|my_center|LOCUS_00370 37609 37534 gene locus_tag LOCUS_t00010 37609 37534 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 39204 37939 gene locus_tag LOCUS_00380 39204 37939 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391313.1 protein_id gnl|my_center|LOCUS_00380 41528 39201 gene locus_tag LOCUS_00390 41528 39201 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391314.1 protein_id gnl|my_center|LOCUS_00390 42441 41521 gene locus_tag LOCUS_00400 gene hemC 42441 41521 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND3 protein_id gnl|my_center|LOCUS_00400 42528 43610 gene locus_tag LOCUS_00410 gene tsaD 42528 43610 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND2 protein_id gnl|my_center|LOCUS_00410 43607 44605 gene locus_tag LOCUS_00420 gene gpsA 43607 44605 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 protein_id gnl|my_center|LOCUS_00420 45325 44627 gene locus_tag LOCUS_00430 45325 44627 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118588.1 protein_id gnl|my_center|LOCUS_00430 45729 45349 gene locus_tag LOCUS_00440 45729 45349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942200.1 protein_id gnl|my_center|LOCUS_00440 46328 45780 gene locus_tag LOCUS_00450 46328 45780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083916.1 protein_id gnl|my_center|LOCUS_00450 47618 46365 gene locus_tag LOCUS_00460 47618 46365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 47765 47851 gene locus_tag LOCUS_t00020 47765 47851 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48751 49452 gene locus_tag LOCUS_00470 48751 49452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 49805 49512 gene locus_tag LOCUS_00480 49805 49512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 50049 49795 gene locus_tag LOCUS_00490 gene parD-4 50049 49795 CDS product antitoxin protein parD-4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265886.1 protein_id gnl|my_center|LOCUS_00490 50501 51463 gene locus_tag LOCUS_00500 50501 51463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 53604 51421 gene locus_tag LOCUS_00510 53604 51421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 54309 53905 gene locus_tag LOCUS_00520 gene zur 54309 53905 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971685.1 protein_id gnl|my_center|LOCUS_00520 55154 54417 gene locus_tag LOCUS_00530 55154 54417 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_00530 55639 55238 gene locus_tag LOCUS_00540 55639 55238 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_00540 55814 55632 gene locus_tag LOCUS_00550 55814 55632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00550 56066 55872 gene locus_tag LOCUS_00560 56066 55872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00560 56187 56969 gene locus_tag LOCUS_00570 gene pcaD 56187 56969 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973944.1 protein_id gnl|my_center|LOCUS_00570 57160 58962 gene locus_tag LOCUS_00580 57160 58962 CDS product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083745.1 protein_id gnl|my_center|LOCUS_00580 59107 59970 gene locus_tag LOCUS_00590 59107 59970 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWQ1 protein_id gnl|my_center|LOCUS_00590 >Feature sequence002 <1 1703 gene locus_tag LOCUS_00600 <1 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391140.1:penicillin-binding protein 1A 3005 1806 gene locus_tag LOCUS_00610 gene aruH 3005 1806 CDS product arginine--pyruvate transaminase AruH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUI9 protein_id gnl|my_center|LOCUS_00610 4048 3065 gene locus_tag LOCUS_00620 4048 3065 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_00620 5062 4061 gene locus_tag LOCUS_00630 5062 4061 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387830.1 protein_id gnl|my_center|LOCUS_00630 5294 5488 gene locus_tag LOCUS_00640 5294 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 6395 5496 gene locus_tag LOCUS_00650 6395 5496 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531763.1 protein_id gnl|my_center|LOCUS_00650 6480 6998 gene locus_tag LOCUS_00660 6480 6998 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969412.1 protein_id gnl|my_center|LOCUS_00660 7002 9203 gene locus_tag LOCUS_00670 7002 9203 CDS product isoquinoline 1-oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888272.1 protein_id gnl|my_center|LOCUS_00670 9339 9860 gene locus_tag LOCUS_00680 9339 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 9876 10745 gene locus_tag LOCUS_00690 gene citE 9876 10745 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811709.1 protein_id gnl|my_center|LOCUS_00690 11182 10742 gene locus_tag LOCUS_00700 gene phnB 11182 10742 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_00700 12090 11269 gene locus_tag LOCUS_00710 12090 11269 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030664.1 protein_id gnl|my_center|LOCUS_00710 12440 12249 gene locus_tag LOCUS_00720 12440 12249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 12589 13524 gene locus_tag LOCUS_00730 12589 13524 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640150.1 protein_id gnl|my_center|LOCUS_00730 17542 13778 gene locus_tag LOCUS_00740 gene cobN 17542 13778 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391113.1 protein_id gnl|my_center|LOCUS_00740 18396 17584 gene locus_tag LOCUS_00750 18396 17584 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLT9 protein_id gnl|my_center|LOCUS_00750 19628 18405 gene locus_tag LOCUS_00760 19628 18405 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527886.1 protein_id gnl|my_center|LOCUS_00760 20252 19707 gene locus_tag LOCUS_00770 gene fabA 20252 19707 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKK2 protein_id gnl|my_center|LOCUS_00770 20860 21504 gene locus_tag LOCUS_00780 20860 21504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957830.1 protein_id gnl|my_center|LOCUS_00780 21501 22004 gene locus_tag LOCUS_00790 21501 22004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707697.1 protein_id gnl|my_center|LOCUS_00790 22070 23074 gene locus_tag LOCUS_00800 22070 23074 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391404.1 protein_id gnl|my_center|LOCUS_00800 23056 23976 gene locus_tag LOCUS_00810 gene wbiG 23056 23976 CDS product epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550079.1 protein_id gnl|my_center|LOCUS_00810 24080 25993 gene locus_tag LOCUS_00820 24080 25993 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391403.1 protein_id gnl|my_center|LOCUS_00820 26046 27602 gene locus_tag LOCUS_00830 gene purH 26046 27602 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN46 protein_id gnl|my_center|LOCUS_00830 27615 28406 gene locus_tag LOCUS_00840 27615 28406 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266709.1 protein_id gnl|my_center|LOCUS_00840 28487 29206 gene locus_tag LOCUS_00850 28487 29206 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226459.1 protein_id gnl|my_center|LOCUS_00850 29902 29267 gene locus_tag LOCUS_00860 29902 29267 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973697.1 protein_id gnl|my_center|LOCUS_00860 30101 30745 gene locus_tag LOCUS_00870 30101 30745 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090865.1 protein_id gnl|my_center|LOCUS_00870 30998 32605 gene locus_tag LOCUS_00880 gene pckA1 30998 32605 CDS product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKS7 protein_id gnl|my_center|LOCUS_00880 33418 32672 gene locus_tag LOCUS_00890 33418 32672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 34726 33428 gene locus_tag LOCUS_00900 34726 33428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 35621 34869 gene locus_tag LOCUS_00910 35621 34869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 36965 35625 gene locus_tag LOCUS_00920 36965 35625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 37885 37100 gene locus_tag LOCUS_00930 37885 37100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391126.1 protein_id gnl|my_center|LOCUS_00930 37985 38875 gene locus_tag LOCUS_00940 37985 38875 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_00940 38980 40188 gene locus_tag LOCUS_00950 38980 40188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 41065 40250 gene locus_tag LOCUS_00960 41065 40250 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918937.1 protein_id gnl|my_center|LOCUS_00960 41113 42327 gene locus_tag LOCUS_00970 41113 42327 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391123.1 protein_id gnl|my_center|LOCUS_00970 42339 43274 gene locus_tag LOCUS_00980 42339 43274 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_00980 43496 45448 gene locus_tag LOCUS_00990 gene thrS 43496 45448 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL4 protein_id gnl|my_center|LOCUS_00990 45467 46093 gene locus_tag LOCUS_01000 gene infC 45467 46093 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNL3 protein_id gnl|my_center|LOCUS_01000 46220 46762 gene locus_tag LOCUS_01010 46220 46762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 47040 46804 gene locus_tag LOCUS_01020 47040 46804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 47500 47033 gene locus_tag LOCUS_01030 47500 47033 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391502.1 protein_id gnl|my_center|LOCUS_01030 47635 50478 gene locus_tag LOCUS_01040 47635 50478 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391261.1 protein_id gnl|my_center|LOCUS_01040 50478 50954 gene locus_tag LOCUS_01050 50478 50954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 protein_id gnl|my_center|LOCUS_01050 50962 51831 gene locus_tag LOCUS_01060 50962 51831 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030805.1 protein_id gnl|my_center|LOCUS_01060 52778 51810 gene locus_tag LOCUS_01070 52778 51810 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038714.1 protein_id gnl|my_center|LOCUS_01070 52968 54920 gene locus_tag LOCUS_01080 gene acsA2 52968 54920 CDS product acetoacetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3R3 protein_id gnl|my_center|LOCUS_01080 55808 54933 gene locus_tag LOCUS_01090 55808 54933 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970177.1 protein_id gnl|my_center|LOCUS_01090 55917 56945 gene locus_tag LOCUS_01100 55917 56945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933388.1 protein_id gnl|my_center|LOCUS_01100 56979 57116 gene locus_tag LOCUS_01110 56979 57116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 57113 57502 gene locus_tag LOCUS_01120 57113 57502 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532891.1 protein_id gnl|my_center|LOCUS_01120 57971 57510 gene locus_tag LOCUS_01130 57971 57510 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096684.1 protein_id gnl|my_center|LOCUS_01130 58671 58099 gene locus_tag LOCUS_01140 58671 58099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 >Feature sequence003 725 1483 gene locus_tag LOCUS_01150 725 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 1625 2332 gene locus_tag LOCUS_01160 1625 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 2571 3698 gene locus_tag LOCUS_01170 2571 3698 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339633.1 protein_id gnl|my_center|LOCUS_01170 3724 3649 gene locus_tag LOCUS_t00030 3724 3649 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4167 3823 gene locus_tag LOCUS_01180 4167 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 4373 4990 gene locus_tag LOCUS_01190 4373 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 5146 6486 gene locus_tag LOCUS_01200 gene aroA 5146 6486 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP5 protein_id gnl|my_center|LOCUS_01200 6511 7098 gene locus_tag LOCUS_01210 6511 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 7388 8080 gene locus_tag LOCUS_01220 gene cmk 7388 8080 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP6 protein_id gnl|my_center|LOCUS_01220 8318 10006 gene locus_tag LOCUS_01230 8318 10006 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP7 protein_id gnl|my_center|LOCUS_01230 10272 10553 gene locus_tag LOCUS_01240 gene ihfB 10272 10553 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXP8 protein_id gnl|my_center|LOCUS_01240 10591 10959 gene locus_tag LOCUS_01250 10591 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 11098 11721 gene locus_tag LOCUS_01260 gene cobO 11098 11721 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086044.1 protein_id gnl|my_center|LOCUS_01260 11772 12461 gene locus_tag LOCUS_01270 11772 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 12482 13981 gene locus_tag LOCUS_01280 gene cobQ 12482 13981 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNX0 protein_id gnl|my_center|LOCUS_01280 15585 14032 gene locus_tag LOCUS_01290 gene betC 15585 14032 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 protein_id gnl|my_center|LOCUS_01290 15993 16520 gene locus_tag LOCUS_01300 15993 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 18394 16514 gene locus_tag LOCUS_01310 18394 16514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 18606 19820 gene locus_tag LOCUS_01320 gene argG 18606 19820 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV0 protein_id gnl|my_center|LOCUS_01320 20026 21423 gene locus_tag LOCUS_01330 20026 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 21520 22899 gene locus_tag LOCUS_01340 21520 22899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 23609 23157 gene locus_tag LOCUS_01350 23609 23157 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_01350 24096 23641 gene locus_tag LOCUS_01360 gene dut 24096 23641 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 protein_id gnl|my_center|LOCUS_01360 25354 24104 gene locus_tag LOCUS_01370 25354 24104 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391543.1 protein_id gnl|my_center|LOCUS_01370 27125 25578 gene locus_tag LOCUS_01380 27125 25578 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ4 protein_id gnl|my_center|LOCUS_01380 27881 27132 gene locus_tag LOCUS_01390 gene ubiE 27881 27132 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMQ3 protein_id gnl|my_center|LOCUS_01390 27931 28797 gene locus_tag LOCUS_01400 gene mutM 27931 28797 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCY7 protein_id gnl|my_center|LOCUS_01400 28883 29245 gene locus_tag LOCUS_01410 28883 29245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 29285 30061 gene locus_tag LOCUS_01420 29285 30061 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_01420 30183 30449 gene locus_tag LOCUS_01430 gene rpsT 30183 30449 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMP9 protein_id gnl|my_center|LOCUS_01430 31407 32771 gene locus_tag LOCUS_01440 gene dnaA 31407 32771 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI9 protein_id gnl|my_center|LOCUS_01440 33256 34371 gene locus_tag LOCUS_01450 33256 34371 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI8 protein_id gnl|my_center|LOCUS_01450 34421 35572 gene locus_tag LOCUS_01460 gene recF 34421 35572 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI7 protein_id gnl|my_center|LOCUS_01460 35386 35463 gene locus_tag LOCUS_t00040 35386 35463 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 35605 38061 gene locus_tag LOCUS_01470 gene gyrB 35605 38061 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI6 protein_id gnl|my_center|LOCUS_01470 39371 38433 gene locus_tag LOCUS_01480 39371 38433 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557395.1 protein_id gnl|my_center|LOCUS_01480 39907 39467 gene locus_tag LOCUS_01490 39907 39467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 40061 40993 gene locus_tag LOCUS_01500 40061 40993 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039338.1 protein_id gnl|my_center|LOCUS_01500 42039 41134 gene locus_tag LOCUS_01510 42039 41134 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064867.1 protein_id gnl|my_center|LOCUS_01510 42180 43136 gene locus_tag LOCUS_01520 42180 43136 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031608.1 protein_id gnl|my_center|LOCUS_01520 43421 46186 gene locus_tag LOCUS_01530 gene acnB 43421 46186 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_01530 46328 47179 gene locus_tag LOCUS_01540 46328 47179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 47277 47687 gene locus_tag LOCUS_01550 47277 47687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 47684 48580 gene locus_tag LOCUS_01560 47684 48580 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968061.1 protein_id gnl|my_center|LOCUS_01560 48896 48708 gene locus_tag LOCUS_01570 48896 48708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 49701 48907 gene locus_tag LOCUS_01580 49701 48907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 50724 49837 gene locus_tag LOCUS_01590 50724 49837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 52048 50735 gene locus_tag LOCUS_01600 52048 50735 CDS product tripartite transporter large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_01600 52569 52045 gene locus_tag LOCUS_01610 52569 52045 CDS product transporter DctQ-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707213.1 protein_id gnl|my_center|LOCUS_01610 53714 52644 gene locus_tag LOCUS_01620 gene takP 53714 52644 CDS product alpha-keto acid-binding periplasmic protein TakP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J1R2 protein_id gnl|my_center|LOCUS_01620 54065 53769 gene locus_tag LOCUS_01630 54065 53769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 54954 54094 gene locus_tag LOCUS_01640 gene panB 54954 54094 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B8U6 protein_id gnl|my_center|LOCUS_01640 55101 55766 gene locus_tag LOCUS_01650 55101 55766 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390751.1 protein_id gnl|my_center|LOCUS_01650 55796 56188 gene locus_tag LOCUS_01660 55796 56188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114392.1 protein_id gnl|my_center|LOCUS_01660 <57254 56390 gene locus_tag LOCUS_01670 <57254 56390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207643.1:two-component sensor histidine kinase >Feature sequence004 449 784 gene locus_tag LOCUS_01680 449 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384024.1 protein_id gnl|my_center|LOCUS_01680 784 1098 gene locus_tag LOCUS_01690 784 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 1098 1763 gene locus_tag LOCUS_01700 1098 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 1767 2201 gene locus_tag LOCUS_01710 1767 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 2233 3186 gene locus_tag LOCUS_01720 2233 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 3197 3706 gene locus_tag LOCUS_01730 3197 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 3778 3957 gene locus_tag LOCUS_01740 3778 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3961 6519 gene locus_tag LOCUS_01750 3961 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 6549 7028 gene locus_tag LOCUS_01760 6549 7028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 7041 7499 gene locus_tag LOCUS_01770 7041 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7517 8191 gene locus_tag LOCUS_01780 7517 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 8191 9993 gene locus_tag LOCUS_01790 8191 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 9997 10434 gene locus_tag LOCUS_01800 9997 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 10415 10957 gene locus_tag LOCUS_01810 10415 10957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039679.1 protein_id gnl|my_center|LOCUS_01810 10962 11369 gene locus_tag LOCUS_01820 10962 11369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566282.1 protein_id gnl|my_center|LOCUS_01820 11366 13669 gene locus_tag LOCUS_01830 11366 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 13692 13982 gene locus_tag LOCUS_01840 13692 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 14051 14725 gene locus_tag LOCUS_01850 14051 14725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 14722 14979 gene locus_tag LOCUS_01860 14722 14979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 14888 15139 gene locus_tag LOCUS_01870 14888 15139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 15652 15173 gene locus_tag LOCUS_01880 15652 15173 CDS product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552138.1 protein_id gnl|my_center|LOCUS_01880 17949 15691 gene locus_tag LOCUS_01890 17949 15691 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_01890 19397 18090 gene locus_tag LOCUS_01900 19397 18090 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021346.1 protein_id gnl|my_center|LOCUS_01900 19908 19486 gene locus_tag LOCUS_01910 19908 19486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 20477 20034 gene locus_tag LOCUS_01920 gene azu1 20477 20034 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967657.1 protein_id gnl|my_center|LOCUS_01920 21228 20491 gene locus_tag LOCUS_01930 21228 20491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 22983 21238 gene locus_tag LOCUS_01940 gene copA 22983 21238 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_01940 23554 23000 gene locus_tag LOCUS_01950 23554 23000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895638.1 protein_id gnl|my_center|LOCUS_01950 23752 24093 gene locus_tag LOCUS_01960 23752 24093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 24257 24631 gene locus_tag LOCUS_01970 24257 24631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01970 24771 25154 gene locus_tag LOCUS_01980 24771 25154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 25383 26768 gene locus_tag LOCUS_01990 25383 26768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 26793 27239 gene locus_tag LOCUS_02000 26793 27239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886973.1 protein_id gnl|my_center|LOCUS_02000 27252 27407 gene locus_tag LOCUS_02010 27252 27407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 27407 27871 gene locus_tag LOCUS_02020 27407 27871 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339163.1 protein_id gnl|my_center|LOCUS_02020 27868 28413 gene locus_tag LOCUS_02030 27868 28413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886974.1 protein_id gnl|my_center|LOCUS_02030 28410 28706 gene locus_tag LOCUS_02040 28410 28706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 28753 29445 gene locus_tag LOCUS_02050 28753 29445 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886975.1 protein_id gnl|my_center|LOCUS_02050 29442 29963 gene locus_tag LOCUS_02060 29442 29963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 30816 31109 gene locus_tag LOCUS_02070 30816 31109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 31290 31171 gene locus_tag LOCUS_02080 31290 31171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 33574 31334 gene locus_tag LOCUS_02090 33574 31334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 34735 33755 gene locus_tag LOCUS_02100 34735 33755 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727331.1 protein_id gnl|my_center|LOCUS_02100 35854 34949 gene locus_tag LOCUS_02110 35854 34949 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186868.1 protein_id gnl|my_center|LOCUS_02110 36005 36733 gene locus_tag LOCUS_02120 36005 36733 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930696.1 protein_id gnl|my_center|LOCUS_02120 36976 37443 gene locus_tag LOCUS_02130 36976 37443 CDS product preprotein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088962.1 protein_id gnl|my_center|LOCUS_02130 37563 38666 gene locus_tag LOCUS_02140 gene hisC 37563 38666 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP86 protein_id gnl|my_center|LOCUS_02140 40045 38663 gene locus_tag LOCUS_02150 40045 38663 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927872.1 protein_id gnl|my_center|LOCUS_02150 40653 40042 gene locus_tag LOCUS_02160 40653 40042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 protein_id gnl|my_center|LOCUS_02160 42731 40650 gene locus_tag LOCUS_02170 42731 40650 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969300.1 protein_id gnl|my_center|LOCUS_02170 44464 42728 gene locus_tag LOCUS_02180 44464 42728 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528562.1 protein_id gnl|my_center|LOCUS_02180 45350 44466 gene locus_tag LOCUS_02190 45350 44466 CDS product isocitrate lyase family enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064986.1 protein_id gnl|my_center|LOCUS_02190 45835 45347 gene locus_tag LOCUS_02200 45835 45347 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064987.1 protein_id gnl|my_center|LOCUS_02200 >Feature sequence005 <1 997 gene locus_tag LOCUS_02210 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390812.1:isovaleryl-CoA dehydrogenase 1008 1826 gene locus_tag LOCUS_02220 1008 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 1915 3291 gene locus_tag LOCUS_02230 1915 3291 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387899.1 protein_id gnl|my_center|LOCUS_02230 3414 3782 gene locus_tag LOCUS_02240 3414 3782 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_02240 6546 3817 gene locus_tag LOCUS_02250 6546 3817 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389557.1 protein_id gnl|my_center|LOCUS_02250 7176 6619 gene locus_tag LOCUS_02260 7176 6619 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAE4 protein_id gnl|my_center|LOCUS_02260 7732 7190 gene locus_tag LOCUS_02270 gene ppa 7732 7190 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4C9 protein_id gnl|my_center|LOCUS_02270 9142 7874 gene locus_tag LOCUS_02280 9142 7874 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090834.1 protein_id gnl|my_center|LOCUS_02280 9237 9512 gene locus_tag LOCUS_02290 9237 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338213.1 protein_id gnl|my_center|LOCUS_02290 9713 9525 gene locus_tag LOCUS_02300 9713 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 9906 11267 gene locus_tag LOCUS_02310 9906 11267 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531119.1 protein_id gnl|my_center|LOCUS_02310 11731 11243 gene locus_tag LOCUS_02320 11731 11243 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083514.1 protein_id gnl|my_center|LOCUS_02320 11852 12490 gene locus_tag LOCUS_02330 gene nth 11852 12490 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY37 protein_id gnl|my_center|LOCUS_02330 12503 12931 gene locus_tag LOCUS_02340 12503 12931 CDS product putative phenylacetic acid degradation-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701717.1 protein_id gnl|my_center|LOCUS_02340 13029 14123 gene locus_tag LOCUS_02350 13029 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 14970 14407 gene locus_tag LOCUS_02360 14970 14407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 15108 16037 gene locus_tag LOCUS_02370 15108 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 16114 17604 gene locus_tag LOCUS_02380 16114 17604 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530350.1 protein_id gnl|my_center|LOCUS_02380 17609 18826 gene locus_tag LOCUS_02390 17609 18826 CDS product 2-hydroxy-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530351.1 protein_id gnl|my_center|LOCUS_02390 18834 20123 gene locus_tag LOCUS_02400 18834 20123 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNB1 protein_id gnl|my_center|LOCUS_02400 20744 20145 gene locus_tag LOCUS_02410 20744 20145 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389625.1 protein_id gnl|my_center|LOCUS_02410 21022 23040 gene locus_tag LOCUS_02420 21022 23040 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337373.1 protein_id gnl|my_center|LOCUS_02420 23108 23947 gene locus_tag LOCUS_02430 23108 23947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337372.1 protein_id gnl|my_center|LOCUS_02430 23961 24926 gene locus_tag LOCUS_02440 23961 24926 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807265.1 protein_id gnl|my_center|LOCUS_02440 24941 26020 gene locus_tag LOCUS_02450 24941 26020 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 protein_id gnl|my_center|LOCUS_02450 26132 27472 gene locus_tag LOCUS_02460 26132 27472 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 protein_id gnl|my_center|LOCUS_02460 27527 28366 gene locus_tag LOCUS_02470 27527 28366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_02470 28374 29618 gene locus_tag LOCUS_02480 28374 29618 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140134.1 protein_id gnl|my_center|LOCUS_02480 29664 30299 gene locus_tag LOCUS_02490 29664 30299 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530072.1 protein_id gnl|my_center|LOCUS_02490 30597 31571 gene locus_tag LOCUS_02500 30597 31571 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205693.1 protein_id gnl|my_center|LOCUS_02500 31586 31900 gene locus_tag LOCUS_02510 31586 31900 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948078.1 protein_id gnl|my_center|LOCUS_02510 32013 32432 gene locus_tag LOCUS_02520 32013 32432 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_02520 32429 33352 gene locus_tag LOCUS_02530 32429 33352 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ3 protein_id gnl|my_center|LOCUS_02530 33349 33744 gene locus_tag LOCUS_02540 33349 33744 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918129.1 protein_id gnl|my_center|LOCUS_02540 33741 34010 gene locus_tag LOCUS_02550 33741 34010 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391193.1 protein_id gnl|my_center|LOCUS_02550 34018 35793 gene locus_tag LOCUS_02560 34018 35793 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNQ6 protein_id gnl|my_center|LOCUS_02560 35990 36568 gene locus_tag LOCUS_02570 35990 36568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 37868 36606 gene locus_tag LOCUS_02580 gene kynU 37868 36606 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS87 protein_id gnl|my_center|LOCUS_02580 42774 37882 gene locus_tag LOCUS_02590 42774 37882 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_02590 42972 43271 gene locus_tag LOCUS_02600 42972 43271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 >Feature sequence006 567 412 gene locus_tag LOCUS_02610 567 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 1524 1246 gene locus_tag LOCUS_02620 1524 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 1492 1932 gene locus_tag LOCUS_02630 1492 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 1937 2605 gene locus_tag LOCUS_02640 1937 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2602 3189 gene locus_tag LOCUS_02650 2602 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 4013 3432 gene locus_tag LOCUS_02660 4013 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 4128 4307 gene locus_tag LOCUS_02670 4128 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5334 4972 gene locus_tag LOCUS_02680 5334 4972 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391345.1 protein_id gnl|my_center|LOCUS_02680 5689 6081 gene locus_tag LOCUS_02690 gene umuD 5689 6081 CDS product umuD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940167.1 protein_id gnl|my_center|LOCUS_02690 6078 7358 gene locus_tag LOCUS_02700 6078 7358 CDS product protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705000.1 protein_id gnl|my_center|LOCUS_02700 7605 7363 gene locus_tag LOCUS_02710 7605 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 7908 8807 gene locus_tag LOCUS_02720 7908 8807 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090741.1 protein_id gnl|my_center|LOCUS_02720 8878 9096 gene locus_tag LOCUS_02730 8878 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 10276 9293 gene locus_tag LOCUS_02740 10276 9293 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207399.1 protein_id gnl|my_center|LOCUS_02740 11264 10248 gene locus_tag LOCUS_02750 gene ascD 11264 10248 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226170.1 protein_id gnl|my_center|LOCUS_02750 12043 11282 gene locus_tag LOCUS_02760 12043 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 13546 12074 gene locus_tag LOCUS_02770 gene dhaS 13546 12074 CDS product putative aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34660 protein_id gnl|my_center|LOCUS_02770 14796 13561 gene locus_tag LOCUS_02780 14796 13561 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064431.1 protein_id gnl|my_center|LOCUS_02780 15170 14787 gene locus_tag LOCUS_02790 15170 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 15570 15172 gene locus_tag LOCUS_02800 15570 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 15891 17474 gene locus_tag LOCUS_02810 15891 17474 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_02810 17586 18770 gene locus_tag LOCUS_02820 17586 18770 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809839.1 protein_id gnl|my_center|LOCUS_02820 18841 19722 gene locus_tag LOCUS_02830 18841 19722 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_02830 19719 20684 gene locus_tag LOCUS_02840 19719 20684 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_02840 20681 21421 gene locus_tag LOCUS_02850 20681 21421 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_02850 21426 22148 gene locus_tag LOCUS_02860 21426 22148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_02860 22218 22850 gene locus_tag LOCUS_02870 22218 22850 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389687.1 protein_id gnl|my_center|LOCUS_02870 23504 23671 gene locus_tag LOCUS_02880 23504 23671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 24478 24035 gene locus_tag LOCUS_02890 24478 24035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 25211 25540 gene locus_tag LOCUS_02900 25211 25540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390829.1 protein_id gnl|my_center|LOCUS_02900 25533 25862 gene locus_tag LOCUS_02910 25533 25862 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389060.1 protein_id gnl|my_center|LOCUS_02910 25894 26625 gene locus_tag LOCUS_02920 25894 26625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 27269 26676 gene locus_tag LOCUS_02930 27269 26676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 27648 27349 gene locus_tag LOCUS_02940 27648 27349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 27754 28332 gene locus_tag LOCUS_02950 27754 28332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 28346 28795 gene locus_tag LOCUS_02960 28346 28795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 30337 28874 gene locus_tag LOCUS_02970 30337 28874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 30760 30350 gene locus_tag LOCUS_02980 30760 30350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 32355 30757 gene locus_tag LOCUS_02990 32355 30757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 32507 32307 gene locus_tag LOCUS_03000 32507 32307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 34407 33103 gene locus_tag LOCUS_03010 34407 33103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 35763 34414 gene locus_tag LOCUS_03020 35763 34414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 36958 35768 gene locus_tag LOCUS_03030 36958 35768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 37263 36955 gene locus_tag LOCUS_03040 37263 36955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 37489 37301 gene locus_tag LOCUS_03050 37489 37301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 37784 37521 gene locus_tag LOCUS_03060 37784 37521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 38282 37800 gene locus_tag LOCUS_03070 38282 37800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 38574 38299 gene locus_tag LOCUS_03080 38574 38299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 39029 38604 gene locus_tag LOCUS_03090 39029 38604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 39693 39163 gene locus_tag LOCUS_03100 39693 39163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 39930 39745 gene locus_tag LOCUS_03110 39930 39745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 42402 40015 gene locus_tag LOCUS_03120 42402 40015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 42689 42408 gene locus_tag LOCUS_03130 42689 42408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 42918 43094 gene locus_tag LOCUS_03140 42918 43094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 >Feature sequence007 3452 3376 gene locus_tag LOCUS_t00050 3452 3376 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3946 3503 gene locus_tag LOCUS_03150 3946 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4283 3993 gene locus_tag LOCUS_03160 gene ihfA 4283 3993 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS7 protein_id gnl|my_center|LOCUS_03160 5374 4400 gene locus_tag LOCUS_03170 gene fabH 5374 4400 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG62 protein_id gnl|my_center|LOCUS_03170 6429 5371 gene locus_tag LOCUS_03180 gene plsX 6429 5371 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTS9 protein_id gnl|my_center|LOCUS_03180 6831 6646 gene locus_tag LOCUS_03190 gene rpmF 6831 6646 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T7C7 protein_id gnl|my_center|LOCUS_03190 7497 6913 gene locus_tag LOCUS_03200 7497 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389354.1 protein_id gnl|my_center|LOCUS_03200 8092 7502 gene locus_tag LOCUS_03210 8092 7502 CDS product ubiquinol-cytochrome c chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389353.1 protein_id gnl|my_center|LOCUS_03210 8231 8671 gene locus_tag LOCUS_03220 8231 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 10860 8773 gene locus_tag LOCUS_03230 gene hppA 10860 8773 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68460 protein_id gnl|my_center|LOCUS_03230 11269 11433 gene locus_tag LOCUS_03240 11269 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 12523 11498 gene locus_tag LOCUS_03250 12523 11498 CDS product nickel/cobalt efflux system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LY4 protein_id gnl|my_center|LOCUS_03250 13161 12520 gene locus_tag LOCUS_03260 13161 12520 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090480.1 protein_id gnl|my_center|LOCUS_03260 13889 13158 gene locus_tag LOCUS_03270 gene recO 13889 13158 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5V8 protein_id gnl|my_center|LOCUS_03270 15158 13899 gene locus_tag LOCUS_03280 15158 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 17516 15252 gene locus_tag LOCUS_03290 17516 15252 CDS product dimethylsulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103704.1 protein_id gnl|my_center|LOCUS_03290 17645 18670 gene locus_tag LOCUS_03300 17645 18670 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_03300 19430 18903 gene locus_tag LOCUS_03310 19430 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 19963 19463 gene locus_tag LOCUS_03320 19963 19463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 20746 20090 gene locus_tag LOCUS_03330 20746 20090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 23551 20897 gene locus_tag LOCUS_03340 gene alaS 23551 20897 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI0 protein_id gnl|my_center|LOCUS_03340 23751 24683 gene locus_tag LOCUS_03350 23751 24683 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_03350 24860 26860 gene locus_tag LOCUS_03360 24860 26860 CDS product methylamine inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967138.1 protein_id gnl|my_center|LOCUS_03360 28126 26867 gene locus_tag LOCUS_03370 28126 26867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 protein_id gnl|my_center|LOCUS_03370 28366 28187 gene locus_tag LOCUS_03380 28366 28187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 28667 28458 gene locus_tag LOCUS_03390 28667 28458 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970295.1 protein_id gnl|my_center|LOCUS_03390 29880 28984 gene locus_tag LOCUS_03400 29880 28984 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972039.1 protein_id gnl|my_center|LOCUS_03400 29981 30784 gene locus_tag LOCUS_03410 29981 30784 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090538.1 protein_id gnl|my_center|LOCUS_03410 30918 32555 gene locus_tag LOCUS_03420 30918 32555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 33657 32707 gene locus_tag LOCUS_03430 33657 32707 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808790.1 protein_id gnl|my_center|LOCUS_03430 33746 34216 gene locus_tag LOCUS_03440 33746 34216 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602231.1 protein_id gnl|my_center|LOCUS_03440 34213 35511 gene locus_tag LOCUS_03450 34213 35511 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870182.1 protein_id gnl|my_center|LOCUS_03450 35558 36553 gene locus_tag LOCUS_03460 gene dctP 35558 36553 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721134.1 protein_id gnl|my_center|LOCUS_03460 36615 37709 gene locus_tag LOCUS_03470 36615 37709 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808671.1 protein_id gnl|my_center|LOCUS_03470 37690 37983 gene locus_tag LOCUS_03480 gene soxA 37690 37983 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089927.1 protein_id gnl|my_center|LOCUS_03480 37964 39361 gene locus_tag LOCUS_03490 37964 39361 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926009.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence008 1127 639 gene locus_tag LOCUS_03500 1127 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 1328 2710 gene locus_tag LOCUS_03510 gene argH 1328 2710 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCI6 protein_id gnl|my_center|LOCUS_03510 2738 2899 gene locus_tag LOCUS_03520 2738 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2950 4269 gene locus_tag LOCUS_03530 gene lysA 2950 4269 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZX9 protein_id gnl|my_center|LOCUS_03530 4266 6836 gene locus_tag LOCUS_03540 4266 6836 CDS product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529406.1 protein_id gnl|my_center|LOCUS_03540 6918 8243 gene locus_tag LOCUS_03550 6918 8243 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072557.1 protein_id gnl|my_center|LOCUS_03550 8371 8817 gene locus_tag LOCUS_03560 8371 8817 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531328.1 protein_id gnl|my_center|LOCUS_03560 8851 8927 gene locus_tag LOCUS_t00060 8851 8927 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9550 9167 gene locus_tag LOCUS_03570 9550 9167 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268409.1 protein_id gnl|my_center|LOCUS_03570 10913 9783 gene locus_tag LOCUS_03580 10913 9783 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015082.1 protein_id gnl|my_center|LOCUS_03580 12291 11257 gene locus_tag LOCUS_03590 12291 11257 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_03590 13575 12304 gene locus_tag LOCUS_03600 13575 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 15479 14532 gene locus_tag LOCUS_03610 15479 14532 CDS product ferredoxin:oxidoreductase FAD/NAD(P)-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267907.1 protein_id gnl|my_center|LOCUS_03610 17131 15476 gene locus_tag LOCUS_03620 17131 15476 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973582.1 protein_id gnl|my_center|LOCUS_03620 17390 18265 gene locus_tag LOCUS_03630 17390 18265 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_03630 18805 18317 gene locus_tag LOCUS_03640 18805 18317 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869169.1 protein_id gnl|my_center|LOCUS_03640 21072 18802 gene locus_tag LOCUS_03650 21072 18802 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869170.1 protein_id gnl|my_center|LOCUS_03650 21923 21072 gene locus_tag LOCUS_03660 gene cutM 21923 21072 CDS product carbon-monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_03660 22378 21920 gene locus_tag LOCUS_03670 22378 21920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 23265 22375 gene locus_tag LOCUS_03680 23265 22375 CDS product lactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706258.1 protein_id gnl|my_center|LOCUS_03680 23619 25106 gene locus_tag LOCUS_03690 23619 25106 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707191.1 protein_id gnl|my_center|LOCUS_03690 25534 25325 gene locus_tag LOCUS_03700 25534 25325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 26048 25572 gene locus_tag LOCUS_03710 26048 25572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 27446 26112 gene locus_tag LOCUS_03720 gene pgi 27446 26112 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHI1 protein_id gnl|my_center|LOCUS_03720 28353 27460 gene locus_tag LOCUS_03730 28353 27460 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSH8 protein_id gnl|my_center|LOCUS_03730 29802 28402 gene locus_tag LOCUS_03740 29802 28402 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_03740 32258 29835 gene locus_tag LOCUS_03750 gene ppsA 32258 29835 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3G7 protein_id gnl|my_center|LOCUS_03750 33331 32417 gene locus_tag LOCUS_03760 33331 32417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 33809 33333 gene locus_tag LOCUS_03770 33809 33333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 36165 34069 gene locus_tag LOCUS_03780 36165 34069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 36700 36209 gene locus_tag LOCUS_03790 36700 36209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 38051 37023 gene locus_tag LOCUS_03800 38051 37023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 39450 38176 gene locus_tag LOCUS_03810 39450 38176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence009 2284 929 gene locus_tag LOCUS_03820 gene pgi 2284 929 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFP0 protein_id gnl|my_center|LOCUS_03820 2376 4847 gene locus_tag LOCUS_03830 2376 4847 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389298.1 protein_id gnl|my_center|LOCUS_03830 5341 4844 gene locus_tag LOCUS_03840 5341 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 6585 5428 gene locus_tag LOCUS_03850 6585 5428 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388442.1 protein_id gnl|my_center|LOCUS_03850 8052 6664 gene locus_tag LOCUS_03860 8052 6664 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I000 protein_id gnl|my_center|LOCUS_03860 8250 8474 gene locus_tag LOCUS_03870 8250 8474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 8490 8657 gene locus_tag LOCUS_03880 8490 8657 CDS product DUF3012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070858.1 protein_id gnl|my_center|LOCUS_03880 10057 8684 gene locus_tag LOCUS_03890 gene gor 10057 8684 CDS product glutathione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23189 protein_id gnl|my_center|LOCUS_03890 10211 10528 gene locus_tag LOCUS_03900 10211 10528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 10539 10970 gene locus_tag LOCUS_03910 10539 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 11053 11856 gene locus_tag LOCUS_03920 11053 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 12292 11936 gene locus_tag LOCUS_03930 12292 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 13033 12536 gene locus_tag LOCUS_03940 gene folK 13033 12536 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_03940 13875 13030 gene locus_tag LOCUS_03950 gene sul 13875 13030 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F29 protein_id gnl|my_center|LOCUS_03950 14085 14513 gene locus_tag LOCUS_03960 14085 14513 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4M3 protein_id gnl|my_center|LOCUS_03960 14803 17700 gene locus_tag LOCUS_03970 14803 17700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 18859 17705 gene locus_tag LOCUS_03980 18859 17705 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390176.1 protein_id gnl|my_center|LOCUS_03980 20580 18862 gene locus_tag LOCUS_03990 20580 18862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 20583 21977 gene locus_tag LOCUS_04000 20583 21977 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390178.1 protein_id gnl|my_center|LOCUS_04000 22116 22862 gene locus_tag LOCUS_04010 22116 22862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 22859 23593 gene locus_tag LOCUS_04020 gene sfsA 22859 23593 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF6 protein_id gnl|my_center|LOCUS_04020 23624 24439 gene locus_tag LOCUS_04030 gene map 23624 24439 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWF8 protein_id gnl|my_center|LOCUS_04030 24474 25181 gene locus_tag LOCUS_04040 24474 25181 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388490.1 protein_id gnl|my_center|LOCUS_04040 25322 26278 gene locus_tag LOCUS_04050 25322 26278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877974.1 protein_id gnl|my_center|LOCUS_04050 26350 28116 gene locus_tag LOCUS_04060 26350 28116 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459204.1 protein_id gnl|my_center|LOCUS_04060 28594 28133 gene locus_tag LOCUS_04070 gene queF 28594 28133 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBU5 protein_id gnl|my_center|LOCUS_04070 29808 28678 gene locus_tag LOCUS_04080 29808 28678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388368.1 protein_id gnl|my_center|LOCUS_04080 30016 30459 gene locus_tag LOCUS_04090 30016 30459 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338279.1 protein_id gnl|my_center|LOCUS_04090 33694 30473 gene locus_tag LOCUS_04100 33694 30473 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_04100 34846 33716 gene locus_tag LOCUS_04110 34846 33716 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_04110 35935 35009 gene locus_tag LOCUS_04120 35935 35009 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974698.1 protein_id gnl|my_center|LOCUS_04120 36126 36374 gene locus_tag LOCUS_04130 36126 36374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 36449 37336 gene locus_tag LOCUS_04140 36449 37336 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390368.1 protein_id gnl|my_center|LOCUS_04140 >Feature sequence010 <1 1087 gene locus_tag LOCUS_04150 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943545.1:two-component sensor histidine kinase 1730 1242 gene locus_tag LOCUS_04160 1730 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5278 1727 gene locus_tag LOCUS_04170 5278 1727 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104408.1 protein_id gnl|my_center|LOCUS_04170 5495 6058 gene locus_tag LOCUS_04180 gene dcd 5495 6058 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28248 protein_id gnl|my_center|LOCUS_04180 6158 7132 gene locus_tag LOCUS_04190 6158 7132 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_04190 7791 7144 gene locus_tag LOCUS_04200 7791 7144 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532395.1 protein_id gnl|my_center|LOCUS_04200 8783 7917 gene locus_tag LOCUS_04210 8783 7917 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973164.1 protein_id gnl|my_center|LOCUS_04210 9029 9604 gene locus_tag LOCUS_04220 9029 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709250.1 protein_id gnl|my_center|LOCUS_04220 9893 9627 gene locus_tag LOCUS_04230 9893 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 11096 10176 gene locus_tag LOCUS_04240 11096 10176 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140202.1 protein_id gnl|my_center|LOCUS_04240 13199 11127 gene locus_tag LOCUS_04250 13199 11127 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337730.1 protein_id gnl|my_center|LOCUS_04250 14174 13260 gene locus_tag LOCUS_04260 14174 13260 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 protein_id gnl|my_center|LOCUS_04260 15246 14353 gene locus_tag LOCUS_04270 15246 14353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 16117 15251 gene locus_tag LOCUS_04280 16117 15251 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU65 protein_id gnl|my_center|LOCUS_04280 17076 16114 gene locus_tag LOCUS_04290 17076 16114 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708657.1 protein_id gnl|my_center|LOCUS_04290 17257 18258 gene locus_tag LOCUS_04300 17257 18258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 18255 19820 gene locus_tag LOCUS_04310 18255 19820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 20572 19817 gene locus_tag LOCUS_04320 20572 19817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 20744 21349 gene locus_tag LOCUS_04330 20744 21349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 22106 21405 gene locus_tag LOCUS_04340 22106 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 22727 22143 gene locus_tag LOCUS_04350 gene soxG 22727 22143 CDS product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205601.1 protein_id gnl|my_center|LOCUS_04350 25740 22720 gene locus_tag LOCUS_04360 gene soxA 25740 22720 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524300.1 protein_id gnl|my_center|LOCUS_04360 26074 25742 gene locus_tag LOCUS_04370 gene soxD 26074 25742 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524301.1 protein_id gnl|my_center|LOCUS_04370 27331 26087 gene locus_tag LOCUS_04380 27331 26087 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529656.1 protein_id gnl|my_center|LOCUS_04380 27617 28690 gene locus_tag LOCUS_04390 27617 28690 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708387.1 protein_id gnl|my_center|LOCUS_04390 28687 29100 gene locus_tag LOCUS_04400 28687 29100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089870.1 protein_id gnl|my_center|LOCUS_04400 29572 29102 gene locus_tag LOCUS_04410 29572 29102 CDS product putative HTH-type transcriptional regulator y4tD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55658 protein_id gnl|my_center|LOCUS_04410 29721 30893 gene locus_tag LOCUS_04420 29721 30893 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816039.1 protein_id gnl|my_center|LOCUS_04420 30898 32124 gene locus_tag LOCUS_04430 30898 32124 CDS product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532462.1 protein_id gnl|my_center|LOCUS_04430 32121 33305 gene locus_tag LOCUS_04440 32121 33305 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404246.1 protein_id gnl|my_center|LOCUS_04440 33338 34090 gene locus_tag LOCUS_04450 33338 34090 CDS product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530330.1 protein_id gnl|my_center|LOCUS_04450 34433 34101 gene locus_tag LOCUS_04460 34433 34101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 34655 35293 gene locus_tag LOCUS_04470 34655 35293 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_04470 36742 35354 gene locus_tag LOCUS_04480 gene pntB 36742 35354 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB4 protein_id gnl|my_center|LOCUS_04480 37192 36767 gene locus_tag LOCUS_04490 gene pntAB 37192 36767 CDS product NAD(P) transhydrogenase subunit alpha part 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB3 protein_id gnl|my_center|LOCUS_04490 <37775 37196 gene locus_tag LOCUS_04500 <37775 37196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RSB2:NAD(P) transhydrogenase subunit alpha part 1 >Feature sequence011 136 1545 gene locus_tag LOCUS_04510 136 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 2622 1552 gene locus_tag LOCUS_04520 2622 1552 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088453.1 protein_id gnl|my_center|LOCUS_04520 3108 2665 gene locus_tag LOCUS_04530 3108 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529227.1 protein_id gnl|my_center|LOCUS_04530 3219 3590 gene locus_tag LOCUS_04540 3219 3590 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230674.1 protein_id gnl|my_center|LOCUS_04540 3598 4890 gene locus_tag LOCUS_04550 3598 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 4978 5643 gene locus_tag LOCUS_04560 4978 5643 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4H5 protein_id gnl|my_center|LOCUS_04560 5671 7332 gene locus_tag LOCUS_04570 5671 7332 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083409.1 protein_id gnl|my_center|LOCUS_04570 7841 7359 gene locus_tag LOCUS_04580 7841 7359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 9053 7953 gene locus_tag LOCUS_04590 gene ychF 9053 7953 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMV3 protein_id gnl|my_center|LOCUS_04590 9772 9074 gene locus_tag LOCUS_04600 gene pth 9772 9074 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DJ9 protein_id gnl|my_center|LOCUS_04600 10456 9803 gene locus_tag LOCUS_04610 gene rplY 10456 9803 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TI50 protein_id gnl|my_center|LOCUS_04610 11546 10611 gene locus_tag LOCUS_04620 gene prs 11546 10611 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP6 protein_id gnl|my_center|LOCUS_04620 12862 11903 gene locus_tag LOCUS_04630 gene xerC 12862 11903 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV24 protein_id gnl|my_center|LOCUS_04630 13594 12887 gene locus_tag LOCUS_04640 13594 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 14378 13659 gene locus_tag LOCUS_04650 14378 13659 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_04650 14457 16673 gene locus_tag LOCUS_04660 gene priA 14457 16673 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDM6 protein_id gnl|my_center|LOCUS_04660 16809 17363 gene locus_tag LOCUS_04670 16809 17363 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389876.1 protein_id gnl|my_center|LOCUS_04670 17367 17864 gene locus_tag LOCUS_04680 gene mobB 17367 17864 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812685.1 protein_id gnl|my_center|LOCUS_04680 17864 19633 gene locus_tag LOCUS_04690 17864 19633 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087537.1 protein_id gnl|my_center|LOCUS_04690 19667 19906 gene locus_tag LOCUS_04700 19667 19906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 19937 21238 gene locus_tag LOCUS_04710 gene moeA 19937 21238 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085100.1 protein_id gnl|my_center|LOCUS_04710 21235 21486 gene locus_tag LOCUS_04720 gene moaD 21235 21486 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI4 protein_id gnl|my_center|LOCUS_04720 21490 21942 gene locus_tag LOCUS_04730 21490 21942 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390442.1 protein_id gnl|my_center|LOCUS_04730 21933 22421 gene locus_tag LOCUS_04740 21933 22421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 22943 22437 gene locus_tag LOCUS_04750 22943 22437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 23121 24644 gene locus_tag LOCUS_04760 gene gpmI 23121 24644 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV10 protein_id gnl|my_center|LOCUS_04760 24631 25995 gene locus_tag LOCUS_04770 24631 25995 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067223.1 protein_id gnl|my_center|LOCUS_04770 25992 27332 gene locus_tag LOCUS_04780 25992 27332 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388987.1 protein_id gnl|my_center|LOCUS_04780 27409 28719 gene locus_tag LOCUS_04790 27409 28719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 28785 29327 gene locus_tag LOCUS_04800 gene rppH 28785 29327 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV14 protein_id gnl|my_center|LOCUS_04800 30102 29389 gene locus_tag LOCUS_04810 gene cysH 30102 29389 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J542 protein_id gnl|my_center|LOCUS_04810 30369 31334 gene locus_tag LOCUS_04820 30369 31334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 31812 31354 gene locus_tag LOCUS_04830 gene rlmH 31812 31354 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV09 protein_id gnl|my_center|LOCUS_04830 32195 31860 gene locus_tag LOCUS_04840 gene rsfS 32195 31860 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV08 protein_id gnl|my_center|LOCUS_04840 32887 32291 gene locus_tag LOCUS_04850 gene nadD 32887 32291 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV07 protein_id gnl|my_center|LOCUS_04850 34220 32943 gene locus_tag LOCUS_04860 gene proA 34220 32943 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV06 protein_id gnl|my_center|LOCUS_04860 35401 34268 gene locus_tag LOCUS_04870 gene proB1 35401 34268 CDS product glutamate 5-kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LB3 protein_id gnl|my_center|LOCUS_04870 36498 35419 gene locus_tag LOCUS_04880 gene obg 36498 35419 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X89 protein_id gnl|my_center|LOCUS_04880 >Feature sequence012 1978 971 gene locus_tag LOCUS_04890 1978 971 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969996.1 protein_id gnl|my_center|LOCUS_04890 3156 1990 gene locus_tag LOCUS_04900 3156 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337410.1 protein_id gnl|my_center|LOCUS_04900 4454 3198 gene locus_tag LOCUS_04910 4454 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 6199 4451 gene locus_tag LOCUS_04920 gene sdhA 6199 4451 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339081.1 protein_id gnl|my_center|LOCUS_04920 6550 6200 gene locus_tag LOCUS_04930 6550 6200 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339082.1 protein_id gnl|my_center|LOCUS_04930 6885 6547 gene locus_tag LOCUS_04940 6885 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 7598 6882 gene locus_tag LOCUS_04950 gene frdB 7598 6882 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723682.1 protein_id gnl|my_center|LOCUS_04950 7719 7973 gene locus_tag LOCUS_04960 7719 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 8962 7970 gene locus_tag LOCUS_04970 gene dusA 8962 7970 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD0 protein_id gnl|my_center|LOCUS_04970 9139 12570 gene locus_tag LOCUS_04980 9139 12570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 15242 12639 gene locus_tag LOCUS_04990 gene clpB 15242 12639 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWD8 protein_id gnl|my_center|LOCUS_04990 15504 16610 gene locus_tag LOCUS_05000 15504 16610 CDS product gamma-butyrobetaine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_05000 16623 17219 gene locus_tag LOCUS_05010 16623 17219 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194622.1 protein_id gnl|my_center|LOCUS_05010 19031 17229 gene locus_tag LOCUS_05020 19031 17229 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529051.1 protein_id gnl|my_center|LOCUS_05020 19804 19028 gene locus_tag LOCUS_05030 19804 19028 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_05030 19892 20605 gene locus_tag LOCUS_05040 19892 20605 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930779.1 protein_id gnl|my_center|LOCUS_05040 20672 21925 gene locus_tag LOCUS_05050 20672 21925 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940434.1 protein_id gnl|my_center|LOCUS_05050 22953 22117 gene locus_tag LOCUS_05060 22953 22117 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975105.1 protein_id gnl|my_center|LOCUS_05060 23939 22950 gene locus_tag LOCUS_05070 23939 22950 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532571.1 protein_id gnl|my_center|LOCUS_05070 24161 25066 gene locus_tag LOCUS_05080 gene bauR 24161 25066 CDS product HTH-type transcriptional activator BauR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6Z9 protein_id gnl|my_center|LOCUS_05080 24377 24446 gene locus_tag LOCUS_t00070 24377 24446 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 25237 25701 gene locus_tag LOCUS_05090 25237 25701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 26410 25835 gene locus_tag LOCUS_05100 26410 25835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 26516 27328 gene locus_tag LOCUS_05110 26516 27328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 27716 27630 gene locus_tag LOCUS_t00080 27716 27630 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 28304 28900 gene locus_tag LOCUS_05120 28304 28900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530055.1 protein_id gnl|my_center|LOCUS_05120 28989 29660 gene locus_tag LOCUS_05130 28989 29660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082464.1 protein_id gnl|my_center|LOCUS_05130 30236 29673 gene locus_tag LOCUS_05140 30236 29673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 30350 31366 gene locus_tag LOCUS_05150 30350 31366 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389350.1 protein_id gnl|my_center|LOCUS_05150 31509 31748 gene locus_tag LOCUS_05160 31509 31748 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971166.1 protein_id gnl|my_center|LOCUS_05160 32011 31850 gene locus_tag LOCUS_05170 32011 31850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 34308 32146 gene locus_tag LOCUS_05180 gene mcmA 34308 32146 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_05180 34644 35393 gene locus_tag LOCUS_05190 34644 35393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 35506 35811 gene locus_tag LOCUS_05200 35506 35811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence013 <1 686 gene locus_tag LOCUS_05210 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390050.1:serine protease 814 1296 gene locus_tag LOCUS_05220 gene gpt 814 1296 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IM4 protein_id gnl|my_center|LOCUS_05220 2244 1375 gene locus_tag LOCUS_05230 gene bcpA 2244 1375 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808124.1 protein_id gnl|my_center|LOCUS_05230 3527 2253 gene locus_tag LOCUS_05240 3527 2253 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813565.1 protein_id gnl|my_center|LOCUS_05240 4018 3524 gene locus_tag LOCUS_05250 4018 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 5078 4086 gene locus_tag LOCUS_05260 gene dctP 5078 4086 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721134.1 protein_id gnl|my_center|LOCUS_05260 6701 5520 gene locus_tag LOCUS_05270 6701 5520 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391386.1 protein_id gnl|my_center|LOCUS_05270 7297 6698 gene locus_tag LOCUS_05280 7297 6698 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN61 protein_id gnl|my_center|LOCUS_05280 8033 7320 gene locus_tag LOCUS_05290 gene rph 8033 7320 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN60 protein_id gnl|my_center|LOCUS_05290 8187 9242 gene locus_tag LOCUS_05300 gene hrcA 8187 9242 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN59 protein_id gnl|my_center|LOCUS_05300 9358 9987 gene locus_tag LOCUS_05310 gene grpE 9358 9987 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63187 protein_id gnl|my_center|LOCUS_05310 10068 11498 gene locus_tag LOCUS_05320 10068 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 11579 12145 gene locus_tag LOCUS_05330 gene hslV 11579 12145 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA2 protein_id gnl|my_center|LOCUS_05330 12142 13470 gene locus_tag LOCUS_05340 gene hslU 12142 13470 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA1 protein_id gnl|my_center|LOCUS_05340 13555 14202 gene locus_tag LOCUS_05350 13555 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 14281 14667 gene locus_tag LOCUS_05360 14281 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 15275 14697 gene locus_tag LOCUS_05370 15275 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 17098 15401 gene locus_tag LOCUS_05380 17098 15401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 17554 17204 gene locus_tag LOCUS_05390 17554 17204 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 protein_id gnl|my_center|LOCUS_05390 17714 18301 gene locus_tag LOCUS_05400 17714 18301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 18880 18314 gene locus_tag LOCUS_05410 18880 18314 CDS product smr protein/Muts2-like inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391349.1 protein_id gnl|my_center|LOCUS_05410 20364 19120 gene locus_tag LOCUS_05420 20364 19120 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391354.1 protein_id gnl|my_center|LOCUS_05420 21044 20370 gene locus_tag LOCUS_05430 21044 20370 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528722.1 protein_id gnl|my_center|LOCUS_05430 21194 21757 gene locus_tag LOCUS_05440 gene fxsA 21194 21757 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_05440 21754 22326 gene locus_tag LOCUS_05450 21754 22326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 22503 22958 gene locus_tag LOCUS_05460 gene secB 22503 22958 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WN7 protein_id gnl|my_center|LOCUS_05460 23921 23121 gene locus_tag LOCUS_05470 gene kynA 23921 23121 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MN4 protein_id gnl|my_center|LOCUS_05470 25514 24243 gene locus_tag LOCUS_05480 gene rho 25514 24243 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN82 protein_id gnl|my_center|LOCUS_05480 26182 26403 gene locus_tag LOCUS_05490 26182 26403 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266698.1 protein_id gnl|my_center|LOCUS_05490 26403 26783 gene locus_tag LOCUS_05500 gene mvpA 26403 26783 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV79 protein_id gnl|my_center|LOCUS_05500 27221 26799 gene locus_tag LOCUS_05510 27221 26799 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_05510 28411 27392 gene locus_tag LOCUS_05520 gene hemH 28411 27392 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92M52 protein_id gnl|my_center|LOCUS_05520 29483 28437 gene locus_tag LOCUS_05530 gene hemE 29483 28437 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN85 protein_id gnl|my_center|LOCUS_05530 29883 30743 gene locus_tag LOCUS_05540 29883 30743 CDS product putative pyruvate, phosphate dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AC59 protein_id gnl|my_center|LOCUS_05540 30740 31375 gene locus_tag LOCUS_05550 30740 31375 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGU7 protein_id gnl|my_center|LOCUS_05550 31402 32217 gene locus_tag LOCUS_05560 gene aroE 31402 32217 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN88 protein_id gnl|my_center|LOCUS_05560 32214 32831 gene locus_tag LOCUS_05570 gene coaE 32214 32831 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN89 protein_id gnl|my_center|LOCUS_05570 32824 33522 gene locus_tag LOCUS_05580 32824 33522 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391358.1 protein_id gnl|my_center|LOCUS_05580 34609 33749 gene locus_tag LOCUS_05590 34609 33749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 <35439 34646 gene locus_tag LOCUS_05600 <35439 34646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057816.1:MBL fold metallo-hydrolase >Feature sequence014 2400 1639 gene locus_tag LOCUS_05610 2400 1639 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 protein_id gnl|my_center|LOCUS_05610 3140 2427 gene locus_tag LOCUS_05620 3140 2427 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387783.1 protein_id gnl|my_center|LOCUS_05620 4557 3205 gene locus_tag LOCUS_05630 4557 3205 CDS product tripartite transporter large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_05630 5679 4561 gene locus_tag LOCUS_05640 5679 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 6927 5785 gene locus_tag LOCUS_05650 6927 5785 CDS product lactate-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK82 protein_id gnl|my_center|LOCUS_05650 8347 7121 gene locus_tag LOCUS_05660 8347 7121 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257181.1 protein_id gnl|my_center|LOCUS_05660 9951 8344 gene locus_tag LOCUS_05670 9951 8344 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 protein_id gnl|my_center|LOCUS_05670 10149 11801 gene locus_tag LOCUS_05680 10149 11801 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390495.1 protein_id gnl|my_center|LOCUS_05680 11849 13009 gene locus_tag LOCUS_05690 11849 13009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 protein_id gnl|my_center|LOCUS_05690 13105 14355 gene locus_tag LOCUS_05700 13105 14355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 14842 14375 gene locus_tag LOCUS_05710 14842 14375 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_05710 15513 14935 gene locus_tag LOCUS_05720 15513 14935 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921424.1 protein_id gnl|my_center|LOCUS_05720 17340 15805 gene locus_tag LOCUS_05730 17340 15805 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYI0 protein_id gnl|my_center|LOCUS_05730 18455 17358 gene locus_tag LOCUS_05740 18455 17358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 19978 19181 gene locus_tag LOCUS_05750 19978 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387773.1 protein_id gnl|my_center|LOCUS_05750 20663 19992 gene locus_tag LOCUS_05760 20663 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338753.1 protein_id gnl|my_center|LOCUS_05760 21746 20700 gene locus_tag LOCUS_05770 21746 20700 CDS product KpsF/GutQ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387775.1 protein_id gnl|my_center|LOCUS_05770 22406 21792 gene locus_tag LOCUS_05780 22406 21792 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_05780 22708 22622 gene locus_tag LOCUS_t00090 22708 22622 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22935 23885 gene locus_tag LOCUS_05790 22935 23885 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_05790 24748 23939 gene locus_tag LOCUS_05800 gene uppP1 24748 23939 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYH3 protein_id gnl|my_center|LOCUS_05800 25021 26526 gene locus_tag LOCUS_05810 25021 26526 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387779.1 protein_id gnl|my_center|LOCUS_05810 26538 31079 gene locus_tag LOCUS_05820 26538 31079 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387780.1 protein_id gnl|my_center|LOCUS_05820 31874 31086 gene locus_tag LOCUS_05830 31874 31086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 32962 32015 gene locus_tag LOCUS_05840 gene htpX 32962 32015 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UED6 protein_id gnl|my_center|LOCUS_05840 <34227 33042 gene locus_tag LOCUS_05850 <34227 33042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258908.1:MFS transporter >Feature sequence015 <1 1413 gene locus_tag LOCUS_05860 <1 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8H428:protein ImuB 1410 4721 gene locus_tag LOCUS_05870 gene dnaE2-1 1410 4721 CDS product error-prone DNA polymerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LA6 protein_id gnl|my_center|LOCUS_05870 4830 5993 gene locus_tag LOCUS_05880 4830 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 6302 7138 gene locus_tag LOCUS_05890 6302 7138 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389870.1 protein_id gnl|my_center|LOCUS_05890 7242 7622 gene locus_tag LOCUS_05900 7242 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8412 7810 gene locus_tag LOCUS_05910 8412 7810 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708479.1 protein_id gnl|my_center|LOCUS_05910 9328 8549 gene locus_tag LOCUS_05920 gene fadB 9328 8549 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085730.1 protein_id gnl|my_center|LOCUS_05920 10617 9325 gene locus_tag LOCUS_05930 10617 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 11859 10663 gene locus_tag LOCUS_05940 11859 10663 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_05940 13006 11891 gene locus_tag LOCUS_05950 13006 11891 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_05950 14166 13003 gene locus_tag LOCUS_05960 14166 13003 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_05960 14435 15163 gene locus_tag LOCUS_05970 14435 15163 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229194.1 protein_id gnl|my_center|LOCUS_05970 16167 15178 gene locus_tag LOCUS_05980 16167 15178 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533668.1 protein_id gnl|my_center|LOCUS_05980 16248 17261 gene locus_tag LOCUS_05990 16248 17261 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530538.1 protein_id gnl|my_center|LOCUS_05990 18660 17299 gene locus_tag LOCUS_06000 18660 17299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 20204 18693 gene locus_tag LOCUS_06010 20204 18693 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_06010 20506 20285 gene locus_tag LOCUS_06020 20506 20285 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064213.1 protein_id gnl|my_center|LOCUS_06020 22123 20549 gene locus_tag LOCUS_06030 22123 20549 CDS product carboxyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811623.1 protein_id gnl|my_center|LOCUS_06030 23388 22120 gene locus_tag LOCUS_06040 23388 22120 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811630.1 protein_id gnl|my_center|LOCUS_06040 23638 24222 gene locus_tag LOCUS_06050 23638 24222 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140078.1 protein_id gnl|my_center|LOCUS_06050 24330 25247 gene locus_tag LOCUS_06060 24330 25247 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086302.1 protein_id gnl|my_center|LOCUS_06060 25371 26582 gene locus_tag LOCUS_06070 25371 26582 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728222.1 protein_id gnl|my_center|LOCUS_06070 26605 28320 gene locus_tag LOCUS_06080 26605 28320 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_06080 29600 28401 gene locus_tag LOCUS_06090 gene bcd2 29600 28401 CDS product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_06090 29757 30665 gene locus_tag LOCUS_06100 29757 30665 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723694.1 protein_id gnl|my_center|LOCUS_06100 30791 31081 gene locus_tag LOCUS_06110 30791 31081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 31721 31167 gene locus_tag LOCUS_06120 31721 31167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 <33100 31812 gene locus_tag LOCUS_06130 <33100 31812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338375.1:C4-dicarboxylate ABC transporter >Feature sequence016 2 199 gene locus_tag LOCUS_06140 2 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 1225 350 gene locus_tag LOCUS_06150 1225 350 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920157.1 protein_id gnl|my_center|LOCUS_06150 2775 1279 gene locus_tag LOCUS_06160 gene glpK 2775 1279 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAY7 protein_id gnl|my_center|LOCUS_06160 2927 4126 gene locus_tag LOCUS_06170 2927 4126 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930504.1 protein_id gnl|my_center|LOCUS_06170 4132 4971 gene locus_tag LOCUS_06180 4132 4971 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUP6 protein_id gnl|my_center|LOCUS_06180 5869 4979 gene locus_tag LOCUS_06190 5869 4979 CDS product peptidase S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388320.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06190 6037 10545 gene locus_tag LOCUS_06200 6037 10545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 11199 10567 gene locus_tag LOCUS_06210 gene ureG 11199 10567 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUS0 protein_id gnl|my_center|LOCUS_06210 11876 11196 gene locus_tag LOCUS_06220 gene ureF 11876 11196 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UF8 protein_id gnl|my_center|LOCUS_06220 12427 11873 gene locus_tag LOCUS_06230 gene ureE 12427 11873 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCI2 protein_id gnl|my_center|LOCUS_06230 14139 12430 gene locus_tag LOCUS_06240 gene ureC 14139 12430 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCH9 protein_id gnl|my_center|LOCUS_06240 14460 14143 gene locus_tag LOCUS_06250 gene ureB 14460 14143 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9Z1 protein_id gnl|my_center|LOCUS_06250 14776 14474 gene locus_tag LOCUS_06260 gene ureA 14776 14474 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9Z0 protein_id gnl|my_center|LOCUS_06260 15569 14802 gene locus_tag LOCUS_06270 gene ureD 15569 14802 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y9Y9 protein_id gnl|my_center|LOCUS_06270 15537 15785 gene locus_tag LOCUS_06280 15537 15785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 15921 16151 gene locus_tag LOCUS_06290 15921 16151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 16148 17512 gene locus_tag LOCUS_06300 gene hipA 16148 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331342.1 protein_id gnl|my_center|LOCUS_06300 18587 17562 gene locus_tag LOCUS_06310 18587 17562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 18764 19693 gene locus_tag LOCUS_06320 18764 19693 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338430.1 protein_id gnl|my_center|LOCUS_06320 21051 19924 gene locus_tag LOCUS_06330 21051 19924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 21811 21119 gene locus_tag LOCUS_06340 21811 21119 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391306.1 protein_id gnl|my_center|LOCUS_06340 22103 22453 gene locus_tag LOCUS_06350 22103 22453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 22511 23479 gene locus_tag LOCUS_06360 22511 23479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 25011 23476 gene locus_tag LOCUS_06370 25011 23476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390363.1 protein_id gnl|my_center|LOCUS_06370 26050 25019 gene locus_tag LOCUS_06380 gene cobT 26050 25019 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92P98 protein_id gnl|my_center|LOCUS_06380 26120 26917 gene locus_tag LOCUS_06390 gene cobV 26120 26917 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3P7 protein_id gnl|my_center|LOCUS_06390 26927 27601 gene locus_tag LOCUS_06400 26927 27601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 27601 28113 gene locus_tag LOCUS_06410 27601 28113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 28110 28667 gene locus_tag LOCUS_06420 28110 28667 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531119.1 protein_id gnl|my_center|LOCUS_06420 28676 29713 gene locus_tag LOCUS_06430 28676 29713 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388429.1 protein_id gnl|my_center|LOCUS_06430 30169 29714 gene locus_tag LOCUS_06440 30169 29714 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Y2 protein_id gnl|my_center|LOCUS_06440 30290 30652 gene locus_tag LOCUS_06450 30290 30652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 31046 30621 gene locus_tag LOCUS_06460 31046 30621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 32304 31177 gene locus_tag LOCUS_06470 32304 31177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence017 1402 344 gene locus_tag LOCUS_06480 1402 344 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090540.1 protein_id gnl|my_center|LOCUS_06480 1585 2391 gene locus_tag LOCUS_06490 1585 2391 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878366.1 protein_id gnl|my_center|LOCUS_06490 2726 2385 gene locus_tag LOCUS_06500 2726 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391409.1 protein_id gnl|my_center|LOCUS_06500 2956 3801 gene locus_tag LOCUS_06510 gene phcN 2956 3801 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRS7 protein_id gnl|my_center|LOCUS_06510 3894 4808 gene locus_tag LOCUS_06520 3894 4808 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061597.1 protein_id gnl|my_center|LOCUS_06520 4897 5754 gene locus_tag LOCUS_06530 gene phnE 4897 5754 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970702.1 protein_id gnl|my_center|LOCUS_06530 5768 7219 gene locus_tag LOCUS_06540 5768 7219 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061595.1 protein_id gnl|my_center|LOCUS_06540 8248 7241 gene locus_tag LOCUS_06550 8248 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 8434 8721 gene locus_tag LOCUS_06560 8434 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 9556 8741 gene locus_tag LOCUS_06570 9556 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 10099 9560 gene locus_tag LOCUS_06580 10099 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 10141 10728 gene locus_tag LOCUS_06590 10141 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 12180 10741 gene locus_tag LOCUS_06600 gene pleD 12180 10741 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_06600 12580 12215 gene locus_tag LOCUS_06610 12580 12215 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920321.1 protein_id gnl|my_center|LOCUS_06610 12763 13665 gene locus_tag LOCUS_06620 12763 13665 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_06620 13632 14939 gene locus_tag LOCUS_06630 gene dinB1 13632 14939 CDS product DNA polymerase IV 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QM8 protein_id gnl|my_center|LOCUS_06630 16317 14962 gene locus_tag LOCUS_06640 gene chrA 16317 14962 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968790.1 protein_id gnl|my_center|LOCUS_06640 17135 16314 gene locus_tag LOCUS_06650 17135 16314 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528003.1 protein_id gnl|my_center|LOCUS_06650 17345 18310 gene locus_tag LOCUS_06660 17345 18310 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_06660 18387 19481 gene locus_tag LOCUS_06670 18387 19481 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538001.1 protein_id gnl|my_center|LOCUS_06670 19465 20241 gene locus_tag LOCUS_06680 19465 20241 CDS product phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527613.1 protein_id gnl|my_center|LOCUS_06680 20313 20993 gene locus_tag LOCUS_06690 20313 20993 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_06690 21572 21003 gene locus_tag LOCUS_06700 21572 21003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228032.1 protein_id gnl|my_center|LOCUS_06700 21665 22546 gene locus_tag LOCUS_06710 21665 22546 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541157.1 protein_id gnl|my_center|LOCUS_06710 22695 23402 gene locus_tag LOCUS_06720 22695 23402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 23537 24781 gene locus_tag LOCUS_06730 23537 24781 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_06730 26907 24799 gene locus_tag LOCUS_06740 26907 24799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 27966 27010 gene locus_tag LOCUS_06750 27966 27010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 29242 28052 gene locus_tag LOCUS_06760 29242 28052 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 protein_id gnl|my_center|LOCUS_06760 30636 29563 gene locus_tag LOCUS_06770 30636 29563 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388178.1 protein_id gnl|my_center|LOCUS_06770 <31209 30686 gene locus_tag LOCUS_06780 <31209 30686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RXC2:3-oxoacyl-[acyl-carrier-protein] synthase 2 >Feature sequence018 436 885 gene locus_tag LOCUS_06790 436 885 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390191.1 protein_id gnl|my_center|LOCUS_06790 910 1668 gene locus_tag LOCUS_06800 910 1668 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887149.1 protein_id gnl|my_center|LOCUS_06800 1665 2069 gene locus_tag LOCUS_06810 1665 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2614 2093 gene locus_tag LOCUS_06820 2614 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3175 2714 gene locus_tag LOCUS_06830 3175 2714 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_06830 3387 5822 gene locus_tag LOCUS_06840 3387 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 6443 5850 gene locus_tag LOCUS_06850 6443 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7526 6531 gene locus_tag LOCUS_06860 7526 6531 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_06860 7637 8542 gene locus_tag LOCUS_06870 7637 8542 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525273.1 protein_id gnl|my_center|LOCUS_06870 9506 8550 gene locus_tag LOCUS_06880 9506 8550 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112912.1 protein_id gnl|my_center|LOCUS_06880 9720 10613 gene locus_tag LOCUS_06890 9720 10613 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967389.1 protein_id gnl|my_center|LOCUS_06890 10723 11868 gene locus_tag LOCUS_06900 10723 11868 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 protein_id gnl|my_center|LOCUS_06900 11986 12074 gene locus_tag LOCUS_t00100 11986 12074 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13132 12221 gene locus_tag LOCUS_06910 13132 12221 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186868.1 protein_id gnl|my_center|LOCUS_06910 13239 14390 gene locus_tag LOCUS_06920 13239 14390 CDS product gamma-butyrobetaine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_06920 14674 15645 gene locus_tag LOCUS_06930 14674 15645 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315175.1 protein_id gnl|my_center|LOCUS_06930 15656 16156 gene locus_tag LOCUS_06940 15656 16156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 16161 17477 gene locus_tag LOCUS_06950 16161 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063709.1 protein_id gnl|my_center|LOCUS_06950 17490 19643 gene locus_tag LOCUS_06960 17490 19643 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527966.1 protein_id gnl|my_center|LOCUS_06960 19640 21235 gene locus_tag LOCUS_06970 19640 21235 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527965.1 protein_id gnl|my_center|LOCUS_06970 21306 21803 gene locus_tag LOCUS_06980 21306 21803 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527967.1 protein_id gnl|my_center|LOCUS_06980 22193 23332 gene locus_tag LOCUS_06990 gene amiC 22193 23332 CDS product amino acid ABC substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974748.1 protein_id gnl|my_center|LOCUS_06990 23347 24012 gene locus_tag LOCUS_07000 gene amiR 23347 24012 CDS product transcription antitermination regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313570.1 protein_id gnl|my_center|LOCUS_07000 24274 25509 gene locus_tag LOCUS_07010 24274 25509 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974749.1 protein_id gnl|my_center|LOCUS_07010 25599 26468 gene locus_tag LOCUS_07020 25599 26468 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974750.1 protein_id gnl|my_center|LOCUS_07020 26481 27632 gene locus_tag LOCUS_07030 26481 27632 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974751.1 protein_id gnl|my_center|LOCUS_07030 27629 28381 gene locus_tag LOCUS_07040 27629 28381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974752.1 protein_id gnl|my_center|LOCUS_07040 28374 29072 gene locus_tag LOCUS_07050 28374 29072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974753.1 protein_id gnl|my_center|LOCUS_07050 29132 30172 gene locus_tag LOCUS_07060 gene amiE 29132 30172 CDS product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VS2 protein_id gnl|my_center|LOCUS_07060 >Feature sequence019 760 80 gene locus_tag LOCUS_07070 760 80 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389560.1 protein_id gnl|my_center|LOCUS_07070 1572 784 gene locus_tag LOCUS_07080 1572 784 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389559.1 protein_id gnl|my_center|LOCUS_07080 1747 3060 gene locus_tag LOCUS_07090 1747 3060 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389860.1 protein_id gnl|my_center|LOCUS_07090 3932 3057 gene locus_tag LOCUS_07100 3932 3057 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388043.1 protein_id gnl|my_center|LOCUS_07100 4941 3946 gene locus_tag LOCUS_07110 4941 3946 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387910.1 protein_id gnl|my_center|LOCUS_07110 5103 5666 gene locus_tag LOCUS_07120 5103 5666 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_07120 5959 6585 gene locus_tag LOCUS_07130 5959 6585 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546278.1 protein_id gnl|my_center|LOCUS_07130 8203 6725 gene locus_tag LOCUS_07140 8203 6725 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4G3 protein_id gnl|my_center|LOCUS_07140 8663 8190 gene locus_tag LOCUS_07150 8663 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 10183 8828 gene locus_tag LOCUS_07160 gene rimO 10183 8828 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I541 protein_id gnl|my_center|LOCUS_07160 13398 10237 gene locus_tag LOCUS_07170 gene mexF 13398 10237 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709300.1 protein_id gnl|my_center|LOCUS_07170 14595 13411 gene locus_tag LOCUS_07180 14595 13411 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083816.1 protein_id gnl|my_center|LOCUS_07180 14774 15742 gene locus_tag LOCUS_07190 gene speB 14774 15742 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525503.1 protein_id gnl|my_center|LOCUS_07190 15814 16989 gene locus_tag LOCUS_07200 15814 16989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 17152 18384 gene locus_tag LOCUS_07210 17152 18384 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310733.1 protein_id gnl|my_center|LOCUS_07210 18392 19618 gene locus_tag LOCUS_07220 18392 19618 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887335.1 protein_id gnl|my_center|LOCUS_07220 19631 20773 gene locus_tag LOCUS_07230 19631 20773 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387982.1 protein_id gnl|my_center|LOCUS_07230 20770 21369 gene locus_tag LOCUS_07240 gene gpmB 20770 21369 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707099.1 protein_id gnl|my_center|LOCUS_07240 21366 22535 gene locus_tag LOCUS_07250 21366 22535 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887336.1 protein_id gnl|my_center|LOCUS_07250 22532 23287 gene locus_tag LOCUS_07260 22532 23287 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061519.1 protein_id gnl|my_center|LOCUS_07260 23284 23775 gene locus_tag LOCUS_07270 23284 23775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 23841 25724 gene locus_tag LOCUS_07280 23841 25724 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975624.1 protein_id gnl|my_center|LOCUS_07280 25724 27652 gene locus_tag LOCUS_07290 25724 27652 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061526.1 protein_id gnl|my_center|LOCUS_07290 27682 28683 gene locus_tag LOCUS_07300 27682 28683 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887332.1 protein_id gnl|my_center|LOCUS_07300 28680 29876 gene locus_tag LOCUS_07310 28680 29876 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061528.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence020 <1 1611 gene locus_tag LOCUS_07320 <1 1611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530022.1:sulfotransferase 1614 2831 gene locus_tag LOCUS_07330 1614 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3160 4284 gene locus_tag LOCUS_07340 3160 4284 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389866.1 protein_id gnl|my_center|LOCUS_07340 4489 4974 gene locus_tag LOCUS_07350 4489 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391379.1 protein_id gnl|my_center|LOCUS_07350 5016 5567 gene locus_tag LOCUS_07360 5016 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 5577 6626 gene locus_tag LOCUS_07370 gene holA 5577 6626 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_07370 7643 6654 gene locus_tag LOCUS_07380 7643 6654 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391375.1 protein_id gnl|my_center|LOCUS_07380 8464 7640 gene locus_tag LOCUS_07390 8464 7640 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391374.1 protein_id gnl|my_center|LOCUS_07390 9164 8583 gene locus_tag LOCUS_07400 gene rsmG 9164 8583 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN75 protein_id gnl|my_center|LOCUS_07400 11154 9265 gene locus_tag LOCUS_07410 gene mnmG 11154 9265 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN76 protein_id gnl|my_center|LOCUS_07410 12745 11417 gene locus_tag LOCUS_07420 gene mnmE 12745 11417 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN77 protein_id gnl|my_center|LOCUS_07420 13037 12783 gene locus_tag LOCUS_07430 13037 12783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391370.1 protein_id gnl|my_center|LOCUS_07430 13197 15221 gene locus_tag LOCUS_07440 13197 15221 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_07440 15339 16310 gene locus_tag LOCUS_07450 gene qor-1 15339 16310 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186471.1 protein_id gnl|my_center|LOCUS_07450 17693 16548 gene locus_tag LOCUS_07460 17693 16548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 18295 17747 gene locus_tag LOCUS_07470 18295 17747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 19854 18292 gene locus_tag LOCUS_07480 19854 18292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 20778 19870 gene locus_tag LOCUS_07490 20778 19870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 21316 20858 gene locus_tag LOCUS_07500 21316 20858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 21445 21729 gene locus_tag LOCUS_07510 21445 21729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 21815 22924 gene locus_tag LOCUS_07520 21815 22924 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140093.1 protein_id gnl|my_center|LOCUS_07520 23102 23026 gene locus_tag LOCUS_t00110 23102 23026 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24640 23192 gene locus_tag LOCUS_07530 24640 23192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 24912 25304 gene locus_tag LOCUS_07540 24912 25304 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN09 protein_id gnl|my_center|LOCUS_07540 25447 26082 gene locus_tag LOCUS_07550 25447 26082 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391438.1 protein_id gnl|my_center|LOCUS_07550 26087 26953 gene locus_tag LOCUS_07560 26087 26953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 protein_id gnl|my_center|LOCUS_07560 27004 27945 gene locus_tag LOCUS_07570 gene gshB 27004 27945 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN11 protein_id gnl|my_center|LOCUS_07570 28582 28097 gene locus_tag LOCUS_07580 28582 28097 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707436.1 protein_id gnl|my_center|LOCUS_07580 28857 29408 gene locus_tag LOCUS_07590 gene ectA 28857 29408 CDS product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLC1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence021 2207 1149 gene locus_tag LOCUS_07600 2207 1149 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674115.1 protein_id gnl|my_center|LOCUS_07600 4072 2204 gene locus_tag LOCUS_07610 4072 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 5170 4082 gene locus_tag LOCUS_07620 5170 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 6475 5171 gene locus_tag LOCUS_07630 6475 5171 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942610.1 protein_id gnl|my_center|LOCUS_07630 7379 6480 gene locus_tag LOCUS_07640 gene fmt 7379 6480 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0K5 protein_id gnl|my_center|LOCUS_07640 7644 7390 gene locus_tag LOCUS_07650 7644 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 9147 7693 gene locus_tag LOCUS_07660 9147 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9887 9144 gene locus_tag LOCUS_07670 9887 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 11227 9917 gene locus_tag LOCUS_07680 gene hemL 11227 9917 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222491.1 protein_id gnl|my_center|LOCUS_07680 12009 11224 gene locus_tag LOCUS_07690 12009 11224 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_07690 12680 12006 gene locus_tag LOCUS_07700 12680 12006 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940919.1 protein_id gnl|my_center|LOCUS_07700 13764 12682 gene locus_tag LOCUS_07710 13764 12682 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015754.1 protein_id gnl|my_center|LOCUS_07710 14624 13761 gene locus_tag LOCUS_07720 14624 13761 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921442.1 protein_id gnl|my_center|LOCUS_07720 15664 14624 gene locus_tag LOCUS_07730 15664 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 16710 15661 gene locus_tag LOCUS_07740 16710 15661 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869431.1 protein_id gnl|my_center|LOCUS_07740 16797 17663 gene locus_tag LOCUS_07750 16797 17663 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 protein_id gnl|my_center|LOCUS_07750 19433 17682 gene locus_tag LOCUS_07760 19433 17682 CDS product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142193.1 protein_id gnl|my_center|LOCUS_07760 20576 19521 gene locus_tag LOCUS_07770 20576 19521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088735.1 protein_id gnl|my_center|LOCUS_07770 21289 20573 gene locus_tag LOCUS_07780 21289 20573 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465710.1 protein_id gnl|my_center|LOCUS_07780 21907 21293 gene locus_tag LOCUS_07790 gene hisH 21907 21293 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S299 protein_id gnl|my_center|LOCUS_07790 22665 21904 gene locus_tag LOCUS_07800 gene hisF 22665 21904 CDS product imidazole glycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946486.1 protein_id gnl|my_center|LOCUS_07800 23514 22705 gene locus_tag LOCUS_07810 23514 22705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 23847 24380 gene locus_tag LOCUS_07820 23847 24380 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707815.1 protein_id gnl|my_center|LOCUS_07820 24417 25523 gene locus_tag LOCUS_07830 gene yitA 24417 25523 CDS product putative sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06736 protein_id gnl|my_center|LOCUS_07830 25520 26947 gene locus_tag LOCUS_07840 25520 26947 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0P8 protein_id gnl|my_center|LOCUS_07840 27210 26944 gene locus_tag LOCUS_07850 27210 26944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 28197 27283 gene locus_tag LOCUS_07860 28197 27283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07860 29266 28430 gene locus_tag LOCUS_07870 29266 28430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence022 152 1102 gene locus_tag LOCUS_07880 152 1102 CDS product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 protein_id gnl|my_center|LOCUS_07880 623 711 gene locus_tag LOCUS_t00120 623 711 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1099 1926 gene locus_tag LOCUS_07890 1099 1926 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 protein_id gnl|my_center|LOCUS_07890 3118 1931 gene locus_tag LOCUS_07900 3118 1931 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390317.1 protein_id gnl|my_center|LOCUS_07900 3819 3205 gene locus_tag LOCUS_07910 3819 3205 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706979.1 protein_id gnl|my_center|LOCUS_07910 4861 3881 gene locus_tag LOCUS_07920 4861 3881 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 protein_id gnl|my_center|LOCUS_07920 5275 4988 gene locus_tag LOCUS_07930 5275 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975509.1 protein_id gnl|my_center|LOCUS_07930 5891 5325 gene locus_tag LOCUS_07940 5891 5325 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 protein_id gnl|my_center|LOCUS_07940 6876 5980 gene locus_tag LOCUS_07950 6876 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228459.1 protein_id gnl|my_center|LOCUS_07950 8241 7084 gene locus_tag LOCUS_07960 8241 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 9096 8350 gene locus_tag LOCUS_07970 9096 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 10563 9244 gene locus_tag LOCUS_07980 10563 9244 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259719.1 protein_id gnl|my_center|LOCUS_07980 10754 12280 gene locus_tag LOCUS_07990 10754 12280 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888154.1 protein_id gnl|my_center|LOCUS_07990 12400 13422 gene locus_tag LOCUS_08000 12400 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331292.1 protein_id gnl|my_center|LOCUS_08000 13914 13441 gene locus_tag LOCUS_08010 13914 13441 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M8L8 protein_id gnl|my_center|LOCUS_08010 15255 13921 gene locus_tag LOCUS_08020 15255 13921 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391106.1 protein_id gnl|my_center|LOCUS_08020 16123 15266 gene locus_tag LOCUS_08030 gene cobA 16123 15266 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969585.1 protein_id gnl|my_center|LOCUS_08030 16284 17036 gene locus_tag LOCUS_08040 gene cobK 16284 17036 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228821.1 protein_id gnl|my_center|LOCUS_08040 17041 17616 gene locus_tag LOCUS_08050 17041 17616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 19322 17637 gene locus_tag LOCUS_08060 19322 17637 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066587.1 protein_id gnl|my_center|LOCUS_08060 20877 19330 gene locus_tag LOCUS_08070 20877 19330 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528520.1 protein_id gnl|my_center|LOCUS_08070 21341 20952 gene locus_tag LOCUS_08080 21341 20952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 21871 21368 gene locus_tag LOCUS_08090 21871 21368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_08090 21861 22565 gene locus_tag LOCUS_08100 21861 22565 CDS product alkylated DNA repair dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 protein_id gnl|my_center|LOCUS_08100 23197 22562 gene locus_tag LOCUS_08110 gene sigZ 23197 22562 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05409 protein_id gnl|my_center|LOCUS_08110 23701 23255 gene locus_tag LOCUS_08120 23701 23255 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222676.1 protein_id gnl|my_center|LOCUS_08120 24286 23783 gene locus_tag LOCUS_08130 24286 23783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 24494 25969 gene locus_tag LOCUS_08140 24494 25969 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391336.1 protein_id gnl|my_center|LOCUS_08140 26203 25991 gene locus_tag LOCUS_08150 26203 25991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 26858 26322 gene locus_tag LOCUS_08160 26858 26322 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207426.1 protein_id gnl|my_center|LOCUS_08160 27172 27810 gene locus_tag LOCUS_08170 27172 27810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence023 523 1404 gene locus_tag LOCUS_08180 gene ugpA 523 1404 CDS product glycerol-3-phosphate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970809.1 protein_id gnl|my_center|LOCUS_08180 1416 2261 gene locus_tag LOCUS_08190 gene ugpE 1416 2261 CDS product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MCV3 protein_id gnl|my_center|LOCUS_08190 2264 3346 gene locus_tag LOCUS_08200 gene ugpC 2264 3346 CDS product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X6U5 protein_id gnl|my_center|LOCUS_08200 3549 5207 gene locus_tag LOCUS_08210 gene paaG 3549 5207 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230334.1 protein_id gnl|my_center|LOCUS_08210 5239 6666 gene locus_tag LOCUS_08220 5239 6666 CDS product benzoyl-CoA oxygenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_08220 6876 7796 gene locus_tag LOCUS_08230 6876 7796 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118048.1 protein_id gnl|my_center|LOCUS_08230 7968 8642 gene locus_tag LOCUS_08240 7968 8642 CDS product transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_294753.1 protein_id gnl|my_center|LOCUS_08240 8635 9120 gene locus_tag LOCUS_08250 8635 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809668.1 protein_id gnl|my_center|LOCUS_08250 9662 9117 gene locus_tag LOCUS_08260 9662 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 10315 9659 gene locus_tag LOCUS_08270 gene aat 10315 9659 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U825 protein_id gnl|my_center|LOCUS_08270 11716 10376 gene locus_tag LOCUS_08280 11716 10376 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_08280 12224 11742 gene locus_tag LOCUS_08290 gene accB 12224 11742 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384520.1 protein_id gnl|my_center|LOCUS_08290 12720 12271 gene locus_tag LOCUS_08300 gene aroQ 12720 12271 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRL2 protein_id gnl|my_center|LOCUS_08300 13572 12829 gene locus_tag LOCUS_08310 13572 12829 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529221.1 protein_id gnl|my_center|LOCUS_08310 14414 13569 gene locus_tag LOCUS_08320 gene tauD 14414 13569 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_08320 14731 14519 gene locus_tag LOCUS_08330 14731 14519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 15729 14851 gene locus_tag LOCUS_08340 gene paaX 15729 14851 CDS product phenylacetic acid degradation operon negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931077.1 protein_id gnl|my_center|LOCUS_08340 17034 15739 gene locus_tag LOCUS_08350 gene paaA 17034 15739 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QH8 protein_id gnl|my_center|LOCUS_08350 18243 17038 gene locus_tag LOCUS_08360 18243 17038 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528954.1 protein_id gnl|my_center|LOCUS_08360 18654 18247 gene locus_tag LOCUS_08370 gene paaI 18654 18247 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_08370 19507 18713 gene locus_tag LOCUS_08380 gene paaB1 19507 18713 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709123.1 protein_id gnl|my_center|LOCUS_08380 19649 21337 gene locus_tag LOCUS_08390 gene paaZ 19649 21337 CDS product phenylacetic acid degradation oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549951.1 protein_id gnl|my_center|LOCUS_08390 21434 22666 gene locus_tag LOCUS_08400 21434 22666 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550405.1 protein_id gnl|my_center|LOCUS_08400 23100 22675 gene locus_tag LOCUS_08410 23100 22675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 23401 23207 gene locus_tag LOCUS_08420 23401 23207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 23802 23497 gene locus_tag LOCUS_08430 23802 23497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729587.1 protein_id gnl|my_center|LOCUS_08430 23922 25079 gene locus_tag LOCUS_08440 23922 25079 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974018.1 protein_id gnl|my_center|LOCUS_08440 25563 25081 gene locus_tag LOCUS_08450 25563 25081 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555947.1 protein_id gnl|my_center|LOCUS_08450 25690 26652 gene locus_tag LOCUS_08460 25690 26652 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8S4 protein_id gnl|my_center|LOCUS_08460 26666 27874 gene locus_tag LOCUS_08470 gene rocD 26666 27874 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNN5 protein_id gnl|my_center|LOCUS_08470 <28962 28163 gene locus_tag LOCUS_08480 <28962 28163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A2R4:ribonucleoside-diphosphate reductase >Feature sequence024 2791 1916 gene locus_tag LOCUS_08490 2791 1916 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528449.1 protein_id gnl|my_center|LOCUS_08490 3213 4967 gene locus_tag LOCUS_08500 3213 4967 CDS product GGDEF-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083772.1 protein_id gnl|my_center|LOCUS_08500 5673 5053 gene locus_tag LOCUS_08510 5673 5053 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388029.1 protein_id gnl|my_center|LOCUS_08510 5825 6367 gene locus_tag LOCUS_08520 5825 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 6414 7424 gene locus_tag LOCUS_08530 6414 7424 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388028.1 protein_id gnl|my_center|LOCUS_08530 7569 8741 gene locus_tag LOCUS_08540 7569 8741 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388027.1 protein_id gnl|my_center|LOCUS_08540 9400 8801 gene locus_tag LOCUS_08550 9400 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 9455 9868 gene locus_tag LOCUS_08560 9455 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 9957 10361 gene locus_tag LOCUS_08570 9957 10361 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969811.1 protein_id gnl|my_center|LOCUS_08570 10418 11365 gene locus_tag LOCUS_08580 10418 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 11414 12580 gene locus_tag LOCUS_08590 11414 12580 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339579.1 protein_id gnl|my_center|LOCUS_08590 12655 12858 gene locus_tag LOCUS_08600 12655 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722450.1 protein_id gnl|my_center|LOCUS_08600 12861 13424 gene locus_tag LOCUS_08610 gene pduO 12861 13424 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722447.1 protein_id gnl|my_center|LOCUS_08610 13427 13711 gene locus_tag LOCUS_08620 13427 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 13719 14471 gene locus_tag LOCUS_08630 13719 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390709.1 protein_id gnl|my_center|LOCUS_08630 14649 15401 gene locus_tag LOCUS_08640 gene etfB 14649 15401 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813339.1 protein_id gnl|my_center|LOCUS_08640 15426 16358 gene locus_tag LOCUS_08650 15426 16358 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_08650 16571 18202 gene locus_tag LOCUS_08660 16571 18202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 18208 19365 gene locus_tag LOCUS_08670 18208 19365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 19474 20097 gene locus_tag LOCUS_08680 19474 20097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 20566 20153 gene locus_tag LOCUS_08690 20566 20153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 20939 20568 gene locus_tag LOCUS_08700 20939 20568 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529983.1 protein_id gnl|my_center|LOCUS_08700 21014 21937 gene locus_tag LOCUS_08710 21014 21937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 21934 22338 gene locus_tag LOCUS_08720 21934 22338 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089431.1 protein_id gnl|my_center|LOCUS_08720 23560 22367 gene locus_tag LOCUS_08730 23560 22367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 24871 23717 gene locus_tag LOCUS_08740 24871 23717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 25066 25530 gene locus_tag LOCUS_08750 25066 25530 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090697.1 protein_id gnl|my_center|LOCUS_08750 25520 26215 gene locus_tag LOCUS_08760 25520 26215 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090698.1 protein_id gnl|my_center|LOCUS_08760 27662 26265 gene locus_tag LOCUS_08770 gene fumC 27662 26265 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92PB6 protein_id gnl|my_center|LOCUS_08770 >Feature sequence025 490 1968 gene locus_tag LOCUS_08780 490 1968 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894508.1 protein_id gnl|my_center|LOCUS_08780 3663 2212 gene locus_tag LOCUS_08790 3663 2212 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_08790 3723 4649 gene locus_tag LOCUS_08800 gene truB 3723 4649 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58063 protein_id gnl|my_center|LOCUS_08800 4697 4966 gene locus_tag LOCUS_08810 gene rpsO 4697 4966 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR7 protein_id gnl|my_center|LOCUS_08810 5294 7483 gene locus_tag LOCUS_08820 gene pnp 5294 7483 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR6 protein_id gnl|my_center|LOCUS_08820 8204 7746 gene locus_tag LOCUS_08830 8204 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 8350 9615 gene locus_tag LOCUS_08840 8350 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 9984 9700 gene locus_tag LOCUS_08850 9984 9700 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022494.1 protein_id gnl|my_center|LOCUS_08850 11990 10080 gene locus_tag LOCUS_08860 gene htpG 11990 10080 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYB8 protein_id gnl|my_center|LOCUS_08860 12109 13005 gene locus_tag LOCUS_08870 12109 13005 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_08870 13051 13650 gene locus_tag LOCUS_08880 13051 13650 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088377.1 protein_id gnl|my_center|LOCUS_08880 13741 15294 gene locus_tag LOCUS_08890 13741 15294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388309.1 protein_id gnl|my_center|LOCUS_08890 15470 15910 gene locus_tag LOCUS_08900 15470 15910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 17785 15920 gene locus_tag LOCUS_08910 17785 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 18374 17928 gene locus_tag LOCUS_08920 18374 17928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 19132 18383 gene locus_tag LOCUS_08930 19132 18383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387911.1 protein_id gnl|my_center|LOCUS_08930 20099 19221 gene locus_tag LOCUS_08940 20099 19221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709090.1 protein_id gnl|my_center|LOCUS_08940 20288 22078 gene locus_tag LOCUS_08950 20288 22078 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003705.1 protein_id gnl|my_center|LOCUS_08950 22167 22883 gene locus_tag LOCUS_08960 22167 22883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 22903 23706 gene locus_tag LOCUS_08970 22903 23706 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090538.1 protein_id gnl|my_center|LOCUS_08970 23713 25053 gene locus_tag LOCUS_08980 23713 25053 CDS product flagellar protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259035.1 protein_id gnl|my_center|LOCUS_08980 25264 26016 gene locus_tag LOCUS_08990 25264 26016 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528853.1 protein_id gnl|my_center|LOCUS_08990 26125 26805 gene locus_tag LOCUS_09000 26125 26805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 26846 27973 gene locus_tag LOCUS_09010 26846 27973 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972456.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence026 <1 538 gene locus_tag LOCUS_09020 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706820.1:AraC family transcriptional regulator 613 1779 gene locus_tag LOCUS_09030 613 1779 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532677.1 protein_id gnl|my_center|LOCUS_09030 1938 2201 gene locus_tag LOCUS_09040 1938 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2204 2623 gene locus_tag LOCUS_09050 2204 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2673 2906 gene locus_tag LOCUS_09060 2673 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09060 2942 3103 gene locus_tag LOCUS_09070 2942 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 3179 3529 gene locus_tag LOCUS_09080 3179 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3627 5207 gene locus_tag LOCUS_09090 gene hutH 3627 5207 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHT8 protein_id gnl|my_center|LOCUS_09090 5741 5214 gene locus_tag LOCUS_09100 5741 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 6876 5905 gene locus_tag LOCUS_09110 6876 5905 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQA0 protein_id gnl|my_center|LOCUS_09110 7536 7006 gene locus_tag LOCUS_09120 gene folA 7536 7006 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUE2 protein_id gnl|my_center|LOCUS_09120 7910 7533 gene locus_tag LOCUS_09130 7910 7533 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918289.1 protein_id gnl|my_center|LOCUS_09130 8706 7912 gene locus_tag LOCUS_09140 gene thyA 8706 7912 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDS3 protein_id gnl|my_center|LOCUS_09140 9240 10877 gene locus_tag LOCUS_09150 9240 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 12109 10874 gene locus_tag LOCUS_09160 12109 10874 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530861.1 protein_id gnl|my_center|LOCUS_09160 12492 13346 gene locus_tag LOCUS_09170 12492 13346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_09170 13343 14182 gene locus_tag LOCUS_09180 13343 14182 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112952.1 protein_id gnl|my_center|LOCUS_09180 14216 15262 gene locus_tag LOCUS_09190 14216 15262 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084365.1 protein_id gnl|my_center|LOCUS_09190 16525 15338 gene locus_tag LOCUS_09200 gene metZ 16525 15338 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QQI7 protein_id gnl|my_center|LOCUS_09200 16991 16569 gene locus_tag LOCUS_09210 16991 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704970.1 protein_id gnl|my_center|LOCUS_09210 17725 17117 gene locus_tag LOCUS_09220 gene pncA 17725 17117 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338913.1 protein_id gnl|my_center|LOCUS_09220 17855 18325 gene locus_tag LOCUS_09230 17855 18325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531464.1 protein_id gnl|my_center|LOCUS_09230 19120 18326 gene locus_tag LOCUS_09240 19120 18326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 19237 20637 gene locus_tag LOCUS_09250 19237 20637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528441.1 protein_id gnl|my_center|LOCUS_09250 20746 22056 gene locus_tag LOCUS_09260 20746 22056 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528442.1 protein_id gnl|my_center|LOCUS_09260 22130 23020 gene locus_tag LOCUS_09270 22130 23020 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528443.1 protein_id gnl|my_center|LOCUS_09270 23017 23952 gene locus_tag LOCUS_09280 23017 23952 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528444.1 protein_id gnl|my_center|LOCUS_09280 23949 24683 gene locus_tag LOCUS_09290 23949 24683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528445.1 protein_id gnl|my_center|LOCUS_09290 24688 25383 gene locus_tag LOCUS_09300 24688 25383 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528446.1 protein_id gnl|my_center|LOCUS_09300 26778 25498 gene locus_tag LOCUS_09310 26778 25498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 27466 26810 gene locus_tag LOCUS_09320 27466 26810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 28345 27479 gene locus_tag LOCUS_09330 28345 27479 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JL7 protein_id gnl|my_center|LOCUS_09330 >Feature sequence027 1273 278 gene locus_tag LOCUS_09340 1273 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551979.1 protein_id gnl|my_center|LOCUS_09340 1875 1270 gene locus_tag LOCUS_09350 1875 1270 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CKY7 protein_id gnl|my_center|LOCUS_09350 2037 2588 gene locus_tag LOCUS_09360 2037 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2713 3213 gene locus_tag LOCUS_09370 2713 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4933 3236 gene locus_tag LOCUS_09380 gene betA 4933 3236 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H53 protein_id gnl|my_center|LOCUS_09380 5070 5462 gene locus_tag LOCUS_09390 5070 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6765 5464 gene locus_tag LOCUS_09400 gene hmgA 6765 5464 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIF6 protein_id gnl|my_center|LOCUS_09400 6856 7308 gene locus_tag LOCUS_09410 6856 7308 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 protein_id gnl|my_center|LOCUS_09410 7412 8374 gene locus_tag LOCUS_09420 gene yrbG 7412 8374 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_09420 8476 9732 gene locus_tag LOCUS_09430 8476 9732 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947065.1 protein_id gnl|my_center|LOCUS_09430 9807 11459 gene locus_tag LOCUS_09440 9807 11459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 11812 11465 gene locus_tag LOCUS_09450 11812 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD62 protein_id gnl|my_center|LOCUS_09450 12459 11962 gene locus_tag LOCUS_09460 12459 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 13693 12443 gene locus_tag LOCUS_09470 13693 12443 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR78 protein_id gnl|my_center|LOCUS_09470 14910 13690 gene locus_tag LOCUS_09480 14910 13690 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_09480 15662 14907 gene locus_tag LOCUS_09490 15662 14907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390322.1 protein_id gnl|my_center|LOCUS_09490 17255 15786 gene locus_tag LOCUS_09500 17255 15786 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390323.1 protein_id gnl|my_center|LOCUS_09500 17705 17259 gene locus_tag LOCUS_09510 17705 17259 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390324.1 protein_id gnl|my_center|LOCUS_09510 18671 17829 gene locus_tag LOCUS_09520 gene cpdA 18671 17829 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF66 protein_id gnl|my_center|LOCUS_09520 19037 18834 gene locus_tag LOCUS_09530 19037 18834 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006202520.1 protein_id gnl|my_center|LOCUS_09530 19519 19319 gene locus_tag LOCUS_09540 19519 19319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 20886 19531 gene locus_tag LOCUS_09550 gene gdhA 20886 19531 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_09550 21335 21018 gene locus_tag LOCUS_09560 21335 21018 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_09560 22576 21413 gene locus_tag LOCUS_09570 gene iscS 22576 21413 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD60 protein_id gnl|my_center|LOCUS_09570 23702 22590 gene locus_tag LOCUS_09580 23702 22590 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389780.1 protein_id gnl|my_center|LOCUS_09580 24207 23749 gene locus_tag LOCUS_09590 24207 23749 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_09590 25187 24432 gene locus_tag LOCUS_09600 25187 24432 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389782.1 protein_id gnl|my_center|LOCUS_09600 25516 26157 gene locus_tag LOCUS_09610 25516 26157 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389783.1 protein_id gnl|my_center|LOCUS_09610 27247 26174 gene locus_tag LOCUS_09620 gene anmK 27247 26174 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSR4 protein_id gnl|my_center|LOCUS_09620 >Feature sequence028 <28373 20024 gene locus_tag LOCUS_09630 <28373 20024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005489282.1:type I secretion C-terminal target domain-containing protein >Feature sequence029 1115 291 gene locus_tag LOCUS_09640 gene proC2 1115 291 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFJ1 protein_id gnl|my_center|LOCUS_09640 1552 1151 gene locus_tag LOCUS_09650 1552 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 2211 1708 gene locus_tag LOCUS_09660 2211 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391028.1 protein_id gnl|my_center|LOCUS_09660 3892 2660 gene locus_tag LOCUS_09670 3892 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480779.1 protein_id gnl|my_center|LOCUS_09670 4695 3892 gene locus_tag LOCUS_09680 4695 3892 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_09680 7042 4700 gene locus_tag LOCUS_09690 7042 4700 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_09690 7290 7970 gene locus_tag LOCUS_09700 7290 7970 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338540.1 protein_id gnl|my_center|LOCUS_09700 7995 8963 gene locus_tag LOCUS_09710 7995 8963 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_09710 10871 8973 gene locus_tag LOCUS_09720 10871 8973 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_09720 11616 11041 gene locus_tag LOCUS_09730 11616 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549603.1 protein_id gnl|my_center|LOCUS_09730 11852 14269 gene locus_tag LOCUS_09740 11852 14269 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083405.1 protein_id gnl|my_center|LOCUS_09740 14443 15825 gene locus_tag LOCUS_09750 gene spuC 14443 15825 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084297.1 protein_id gnl|my_center|LOCUS_09750 16060 17112 gene locus_tag LOCUS_09760 16060 17112 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3R5 protein_id gnl|my_center|LOCUS_09760 17195 18124 gene locus_tag LOCUS_09770 17195 18124 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920972.1 protein_id gnl|my_center|LOCUS_09770 18130 18978 gene locus_tag LOCUS_09780 18130 18978 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920971.1 protein_id gnl|my_center|LOCUS_09780 18975 20072 gene locus_tag LOCUS_09790 18975 20072 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CCT0 protein_id gnl|my_center|LOCUS_09790 20082 20645 gene locus_tag LOCUS_09800 gene greB 20082 20645 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ24 protein_id gnl|my_center|LOCUS_09800 21455 20652 gene locus_tag LOCUS_09810 21455 20652 CDS product non-ribosomal peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525107.1 protein_id gnl|my_center|LOCUS_09810 21961 21560 gene locus_tag LOCUS_09820 21961 21560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 22532 22095 gene locus_tag LOCUS_09830 22532 22095 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_09830 23332 22529 gene locus_tag LOCUS_09840 23332 22529 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_09840 24656 23349 gene locus_tag LOCUS_09850 gene cysD 24656 23349 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_09850 25962 25165 gene locus_tag LOCUS_09860 25962 25165 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814011.1 protein_id gnl|my_center|LOCUS_09860 27324 26314 gene locus_tag LOCUS_09870 27324 26314 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289230.1 protein_id gnl|my_center|LOCUS_09870 27526 27344 gene locus_tag LOCUS_09880 27526 27344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence030 39 1115 gene locus_tag LOCUS_09890 39 1115 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_09890 1117 2766 gene locus_tag LOCUS_09900 1117 2766 CDS product microcin C ABC transporter ATP-binding protein YejF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067565.1 protein_id gnl|my_center|LOCUS_09900 3104 2784 gene locus_tag LOCUS_09910 3104 2784 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A295 protein_id gnl|my_center|LOCUS_09910 3168 4421 gene locus_tag LOCUS_09920 3168 4421 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958546.1 protein_id gnl|my_center|LOCUS_09920 5245 4430 gene locus_tag LOCUS_09930 gene dapB 5245 4430 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY36 protein_id gnl|my_center|LOCUS_09930 6163 5321 gene locus_tag LOCUS_09940 6163 5321 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268196.1 protein_id gnl|my_center|LOCUS_09940 6276 6566 gene locus_tag LOCUS_09950 6276 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 6667 7911 gene locus_tag LOCUS_09960 6667 7911 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090688.1 protein_id gnl|my_center|LOCUS_09960 8695 8030 gene locus_tag LOCUS_09970 8695 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 9704 9051 gene locus_tag LOCUS_09980 9704 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 10138 10452 gene locus_tag LOCUS_09990 10138 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 11373 10468 gene locus_tag LOCUS_10000 11373 10468 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976376.1 protein_id gnl|my_center|LOCUS_10000 11522 11731 gene locus_tag LOCUS_10010 11522 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 12668 11784 gene locus_tag LOCUS_10020 gene prmA 12668 11784 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0F3 protein_id gnl|my_center|LOCUS_10020 13646 12771 gene locus_tag LOCUS_10030 13646 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 14148 13759 gene locus_tag LOCUS_10040 14148 13759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975801.1 protein_id gnl|my_center|LOCUS_10040 14989 14153 gene locus_tag LOCUS_10050 14989 14153 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5F4 protein_id gnl|my_center|LOCUS_10050 15468 15028 gene locus_tag LOCUS_10060 15468 15028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 16376 15468 gene locus_tag LOCUS_10070 16376 15468 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_10070 16839 16393 gene locus_tag LOCUS_10080 16839 16393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 17951 16839 gene locus_tag LOCUS_10090 17951 16839 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_10090 18074 19156 gene locus_tag LOCUS_10100 18074 19156 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935884.1 protein_id gnl|my_center|LOCUS_10100 20212 19166 gene locus_tag LOCUS_10110 20212 19166 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530700.1 protein_id gnl|my_center|LOCUS_10110 21525 20236 gene locus_tag LOCUS_10120 21525 20236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 22682 21639 gene locus_tag LOCUS_10130 22682 21639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 23411 22749 gene locus_tag LOCUS_10140 23411 22749 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528903.1 protein_id gnl|my_center|LOCUS_10140 24385 23411 gene locus_tag LOCUS_10150 gene ubiA 24385 23411 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWW9 protein_id gnl|my_center|LOCUS_10150 24436 25185 gene locus_tag LOCUS_10160 24436 25185 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y8G6 protein_id gnl|my_center|LOCUS_10160 25235 26605 gene locus_tag LOCUS_10170 gene gsh1 25235 26605 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 protein_id gnl|my_center|LOCUS_10170 26695 27198 gene locus_tag LOCUS_10180 26695 27198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence031 185 982 gene locus_tag LOCUS_10190 gene sohB 185 982 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222083.1 protein_id gnl|my_center|LOCUS_10190 1029 1298 gene locus_tag LOCUS_10200 1029 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1314 1772 gene locus_tag LOCUS_10210 1314 1772 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338322.1 protein_id gnl|my_center|LOCUS_10210 2411 1812 gene locus_tag LOCUS_10220 2411 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388810.1 protein_id gnl|my_center|LOCUS_10220 4939 2567 gene locus_tag LOCUS_10230 4939 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 5612 5127 gene locus_tag LOCUS_10240 5612 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 6008 6793 gene locus_tag LOCUS_10250 6008 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140602.1 protein_id gnl|my_center|LOCUS_10250 7516 6797 gene locus_tag LOCUS_10260 7516 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389961.1 protein_id gnl|my_center|LOCUS_10260 7721 8881 gene locus_tag LOCUS_10270 7721 8881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 9077 9742 gene locus_tag LOCUS_10280 9077 9742 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204423.1 protein_id gnl|my_center|LOCUS_10280 10548 9853 gene locus_tag LOCUS_10290 10548 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 10741 10571 gene locus_tag LOCUS_10300 10741 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 11101 10808 gene locus_tag LOCUS_10310 11101 10808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 11500 12024 gene locus_tag LOCUS_10320 11500 12024 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089493.1 protein_id gnl|my_center|LOCUS_10320 12090 13541 gene locus_tag LOCUS_10330 12090 13541 CDS product uricase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089494.1 protein_id gnl|my_center|LOCUS_10330 13594 14082 gene locus_tag LOCUS_10340 13594 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089495.1 protein_id gnl|my_center|LOCUS_10340 14116 14670 gene locus_tag LOCUS_10350 14116 14670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 14708 15178 gene locus_tag LOCUS_10360 14708 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 15182 16996 gene locus_tag LOCUS_10370 15182 16996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114518.1 protein_id gnl|my_center|LOCUS_10370 16960 18030 gene locus_tag LOCUS_10380 16960 18030 CDS product type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269329.1 protein_id gnl|my_center|LOCUS_10380 18118 19443 gene locus_tag LOCUS_10390 18118 19443 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089450.1 protein_id gnl|my_center|LOCUS_10390 19514 22183 gene locus_tag LOCUS_10400 gene clpB 19514 22183 CDS product protease associated ATPase ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549921.1 protein_id gnl|my_center|LOCUS_10400 22229 24412 gene locus_tag LOCUS_10410 22229 24412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114515.1 protein_id gnl|my_center|LOCUS_10410 24417 25310 gene locus_tag LOCUS_10420 24417 25310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 25349 27082 gene locus_tag LOCUS_10430 25349 27082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence032 843 652 gene locus_tag LOCUS_10440 843 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1367 840 gene locus_tag LOCUS_10450 1367 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1987 1418 gene locus_tag LOCUS_10460 1987 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2272 1997 gene locus_tag LOCUS_10470 2272 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2662 2285 gene locus_tag LOCUS_10480 2662 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4196 2673 gene locus_tag LOCUS_10490 4196 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4803 4207 gene locus_tag LOCUS_10500 4803 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 5105 4836 gene locus_tag LOCUS_10510 5105 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 5787 5116 gene locus_tag LOCUS_10520 5787 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 8388 5797 gene locus_tag LOCUS_10530 8388 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 8843 8388 gene locus_tag LOCUS_10540 8843 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104841.1 protein_id gnl|my_center|LOCUS_10540 9432 8836 gene locus_tag LOCUS_10550 9432 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 10088 9429 gene locus_tag LOCUS_10560 10088 9429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 12404 10092 gene locus_tag LOCUS_10570 12404 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 12466 12816 gene locus_tag LOCUS_10580 12466 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 13925 13023 gene locus_tag LOCUS_10590 13925 13023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 14089 13925 gene locus_tag LOCUS_10600 14089 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 14415 14104 gene locus_tag LOCUS_10610 14415 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 14489 14722 gene locus_tag LOCUS_10620 14489 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 14972 14724 gene locus_tag LOCUS_10630 14972 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 15367 15005 gene locus_tag LOCUS_10640 15367 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 15848 15369 gene locus_tag LOCUS_10650 15848 15369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339606.1 protein_id gnl|my_center|LOCUS_10650 16288 15875 gene locus_tag LOCUS_10660 16288 15875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 16719 16285 gene locus_tag LOCUS_10670 16719 16285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 17033 16719 gene locus_tag LOCUS_10680 17033 16719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 17721 17062 gene locus_tag LOCUS_10690 17721 17062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 18518 17712 gene locus_tag LOCUS_10700 18518 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 19138 18515 gene locus_tag LOCUS_10710 19138 18515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 19634 19122 gene locus_tag LOCUS_10720 19634 19122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 20407 19631 gene locus_tag LOCUS_10730 20407 19631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 20682 20404 gene locus_tag LOCUS_10740 20682 20404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 22108 21254 gene locus_tag LOCUS_10750 22108 21254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 23636 22188 gene locus_tag LOCUS_10760 23636 22188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 24485 23724 gene locus_tag LOCUS_10770 gene clpP 24485 23724 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0JQM5 protein_id gnl|my_center|LOCUS_10770 26092 24497 gene locus_tag LOCUS_10780 26092 24497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 26234 26094 gene locus_tag LOCUS_10790 26234 26094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 <27299 26249 gene locus_tag LOCUS_10800 <27299 26249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938795.1:terminase >Feature sequence033 780 76 gene locus_tag LOCUS_10810 780 76 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388283.1 protein_id gnl|my_center|LOCUS_10810 957 2315 gene locus_tag LOCUS_10820 gene fliI 957 2315 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388284.1 protein_id gnl|my_center|LOCUS_10820 2315 2737 gene locus_tag LOCUS_10830 2315 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2919 3311 gene locus_tag LOCUS_10840 2919 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3433 5103 gene locus_tag LOCUS_10850 3433 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5541 5104 gene locus_tag LOCUS_10860 5541 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388287.1 protein_id gnl|my_center|LOCUS_10860 7043 5538 gene locus_tag LOCUS_10870 7043 5538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 7898 7146 gene locus_tag LOCUS_10880 7898 7146 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX09 protein_id gnl|my_center|LOCUS_10880 8845 7895 gene locus_tag LOCUS_10890 8845 7895 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388291.1 protein_id gnl|my_center|LOCUS_10890 9006 9659 gene locus_tag LOCUS_10900 9006 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 11798 9672 gene locus_tag LOCUS_10910 gene flhA 11798 9672 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388297.1 protein_id gnl|my_center|LOCUS_10910 13243 11852 gene locus_tag LOCUS_10920 13243 11852 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388298.1 protein_id gnl|my_center|LOCUS_10920 14086 13250 gene locus_tag LOCUS_10930 14086 13250 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388299.1 protein_id gnl|my_center|LOCUS_10930 14499 14104 gene locus_tag LOCUS_10940 14499 14104 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ9 protein_id gnl|my_center|LOCUS_10940 15384 14506 gene locus_tag LOCUS_10950 15384 14506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 16426 15410 gene locus_tag LOCUS_10960 16426 15410 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ7 protein_id gnl|my_center|LOCUS_10960 18233 16581 gene locus_tag LOCUS_10970 18233 16581 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ6 protein_id gnl|my_center|LOCUS_10970 18888 18625 gene locus_tag LOCUS_10980 18888 18625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004430042.1 protein_id gnl|my_center|LOCUS_10980 20529 19072 gene locus_tag LOCUS_10990 20529 19072 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRB3 protein_id gnl|my_center|LOCUS_10990 21289 20594 gene locus_tag LOCUS_11000 21289 20594 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWZ4 protein_id gnl|my_center|LOCUS_11000 22917 21343 gene locus_tag LOCUS_11010 22917 21343 CDS product flagellar hook-length control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388306.1 protein_id gnl|my_center|LOCUS_11010 23607 23182 gene locus_tag LOCUS_11020 23607 23182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 23840 24268 gene locus_tag LOCUS_11030 gene flbT 23840 24268 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385137.1 protein_id gnl|my_center|LOCUS_11030 24949 24284 gene locus_tag LOCUS_11040 24949 24284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 25506 24970 gene locus_tag LOCUS_11050 25506 24970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 26687 25650 gene locus_tag LOCUS_11060 26687 25650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence034 46 2133 gene locus_tag LOCUS_11070 46 2133 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139976.1 protein_id gnl|my_center|LOCUS_11070 2237 3460 gene locus_tag LOCUS_11080 2237 3460 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_11080 4346 3480 gene locus_tag LOCUS_11090 4346 3480 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976283.1 protein_id gnl|my_center|LOCUS_11090 5958 4378 gene locus_tag LOCUS_11100 5958 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 7182 6124 gene locus_tag LOCUS_11110 gene pyrD 7182 6124 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX27 protein_id gnl|my_center|LOCUS_11110 7522 7169 gene locus_tag LOCUS_11120 7522 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706767.1 protein_id gnl|my_center|LOCUS_11120 7962 8786 gene locus_tag LOCUS_11130 7962 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 8805 9074 gene locus_tag LOCUS_11140 8805 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 9144 9713 gene locus_tag LOCUS_11150 9144 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939868.1 protein_id gnl|my_center|LOCUS_11150 9713 11623 gene locus_tag LOCUS_11160 9713 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063626.1 protein_id gnl|my_center|LOCUS_11160 11642 12079 gene locus_tag LOCUS_11170 11642 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 12129 15062 gene locus_tag LOCUS_11180 12129 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 15093 17726 gene locus_tag LOCUS_11190 15093 17726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 17745 18119 gene locus_tag LOCUS_11200 17745 18119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 18264 18572 gene locus_tag LOCUS_11210 18264 18572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 18565 20040 gene locus_tag LOCUS_11220 18565 20040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 20067 20375 gene locus_tag LOCUS_11230 20067 20375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 20372 20881 gene locus_tag LOCUS_11240 20372 20881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 20878 21423 gene locus_tag LOCUS_11250 20878 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 21544 23169 gene locus_tag LOCUS_11260 21544 23169 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389348.1 protein_id gnl|my_center|LOCUS_11260 23180 24124 gene locus_tag LOCUS_11270 23180 24124 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_11270 24509 24144 gene locus_tag LOCUS_11280 24509 24144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 25341 25177 gene locus_tag LOCUS_11290 25341 25177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 25729 26322 gene locus_tag LOCUS_11300 gene ubiX 25729 26322 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89PF2 protein_id gnl|my_center|LOCUS_11300 >Feature sequence035 864 445 gene locus_tag LOCUS_11310 864 445 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 protein_id gnl|my_center|LOCUS_11310 1624 908 gene locus_tag LOCUS_11320 1624 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2245 1655 gene locus_tag LOCUS_11330 gene betI 2245 1655 CDS product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG78 protein_id gnl|my_center|LOCUS_11330 2401 4992 gene locus_tag LOCUS_11340 2401 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5081 5386 gene locus_tag LOCUS_11350 5081 5386 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406609.1 protein_id gnl|my_center|LOCUS_11350 5358 6278 gene locus_tag LOCUS_11360 5358 6278 CDS product fluoroacetate dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_11360 6289 6903 gene locus_tag LOCUS_11370 6289 6903 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384970.1 protein_id gnl|my_center|LOCUS_11370 6980 7354 gene locus_tag LOCUS_11380 6980 7354 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529181.1 protein_id gnl|my_center|LOCUS_11380 8241 7351 gene locus_tag LOCUS_11390 8241 7351 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_11390 8337 9071 gene locus_tag LOCUS_11400 8337 9071 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102071.1 protein_id gnl|my_center|LOCUS_11400 9242 10498 gene locus_tag LOCUS_11410 gene soxB 9242 10498 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821029.1 protein_id gnl|my_center|LOCUS_11410 10512 10799 gene locus_tag LOCUS_11420 10512 10799 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067491.1 protein_id gnl|my_center|LOCUS_11420 10800 13814 gene locus_tag LOCUS_11430 10800 13814 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531141.1 protein_id gnl|my_center|LOCUS_11430 13807 14427 gene locus_tag LOCUS_11440 13807 14427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 14913 14446 gene locus_tag LOCUS_11450 14913 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537431.1 protein_id gnl|my_center|LOCUS_11450 15104 15982 gene locus_tag LOCUS_11460 15104 15982 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820328.1 protein_id gnl|my_center|LOCUS_11460 17393 15987 gene locus_tag LOCUS_11470 17393 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 17912 17397 gene locus_tag LOCUS_11480 17912 17397 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337982.1 protein_id gnl|my_center|LOCUS_11480 18450 18097 gene locus_tag LOCUS_11490 18450 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 18568 18483 gene locus_tag LOCUS_t00130 18568 18483 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18920 18654 gene locus_tag LOCUS_11500 18920 18654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 19103 19264 gene locus_tag LOCUS_11510 19103 19264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 19867 19289 gene locus_tag LOCUS_11520 19867 19289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 20756 19974 gene locus_tag LOCUS_11530 20756 19974 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532015.1 protein_id gnl|my_center|LOCUS_11530 22703 20763 gene locus_tag LOCUS_11540 22703 20763 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_11540 22857 22982 gene locus_tag LOCUS_11550 22857 22982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 23214 24116 gene locus_tag LOCUS_11560 gene folD 23214 24116 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNB2 protein_id gnl|my_center|LOCUS_11560 24121 25368 gene locus_tag LOCUS_11570 24121 25368 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_11570 <26572 25365 gene locus_tag LOCUS_11580 <26572 25365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P58163:putative multidrug resistance protein NorM >Feature sequence036 871 455 gene locus_tag LOCUS_11590 gene atpC 871 455 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV17 protein_id gnl|my_center|LOCUS_11590 2332 914 gene locus_tag LOCUS_11600 gene atpD 2332 914 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV18 protein_id gnl|my_center|LOCUS_11600 3253 2363 gene locus_tag LOCUS_11610 gene atpG 3253 2363 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV19 protein_id gnl|my_center|LOCUS_11610 4838 3309 gene locus_tag LOCUS_11620 gene atpA 4838 3309 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV20 protein_id gnl|my_center|LOCUS_11620 5396 4842 gene locus_tag LOCUS_11630 gene atpH 5396 4842 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV21 protein_id gnl|my_center|LOCUS_11630 5721 6902 gene locus_tag LOCUS_11640 5721 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 7951 6899 gene locus_tag LOCUS_11650 7951 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 8081 9862 gene locus_tag LOCUS_11660 8081 9862 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112499.1 protein_id gnl|my_center|LOCUS_11660 12405 9868 gene locus_tag LOCUS_11670 gene leuS 12405 9868 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S415 protein_id gnl|my_center|LOCUS_11670 13653 12571 gene locus_tag LOCUS_11680 13653 12571 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888398.1 protein_id gnl|my_center|LOCUS_11680 14897 13659 gene locus_tag LOCUS_11690 14897 13659 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709146.1 protein_id gnl|my_center|LOCUS_11690 16847 15330 gene locus_tag LOCUS_11700 16847 15330 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550790.1 protein_id gnl|my_center|LOCUS_11700 17886 16864 gene locus_tag LOCUS_11710 17886 16864 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225688.1 protein_id gnl|my_center|LOCUS_11710 18680 17886 gene locus_tag LOCUS_11720 18680 17886 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389895.1 protein_id gnl|my_center|LOCUS_11720 19104 18682 gene locus_tag LOCUS_11730 19104 18682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 20247 19111 gene locus_tag LOCUS_11740 20247 19111 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198292.1 protein_id gnl|my_center|LOCUS_11740 21446 20250 gene locus_tag LOCUS_11750 21446 20250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936116.1 protein_id gnl|my_center|LOCUS_11750 22635 21460 gene locus_tag LOCUS_11760 22635 21460 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_11760 24738 22639 gene locus_tag LOCUS_11770 24738 22639 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536383.1 protein_id gnl|my_center|LOCUS_11770 25708 24872 gene locus_tag LOCUS_11780 25708 24872 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528139.1 protein_id gnl|my_center|LOCUS_11780 <26308 25718 gene locus_tag LOCUS_11790 <26308 25718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338375.1:C4-dicarboxylate ABC transporter >Feature sequence037 4339 5796 gene locus_tag LOCUS_11800 4339 5796 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 protein_id gnl|my_center|LOCUS_11800 5994 5918 gene locus_tag LOCUS_t00140 5994 5918 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6186 6743 gene locus_tag LOCUS_11810 6186 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919983.1 protein_id gnl|my_center|LOCUS_11810 6936 7370 gene locus_tag LOCUS_11820 6936 7370 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720120.1 protein_id gnl|my_center|LOCUS_11820 8113 7367 gene locus_tag LOCUS_11830 8113 7367 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111362.1 protein_id gnl|my_center|LOCUS_11830 8214 9353 gene locus_tag LOCUS_11840 8214 9353 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082938.1 protein_id gnl|my_center|LOCUS_11840 9350 10927 gene locus_tag LOCUS_11850 9350 10927 CDS product CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082939.1 protein_id gnl|my_center|LOCUS_11850 10956 11990 gene locus_tag LOCUS_11860 10956 11990 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082942.1 protein_id gnl|my_center|LOCUS_11860 12007 12360 gene locus_tag LOCUS_11870 12007 12360 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970786.1 protein_id gnl|my_center|LOCUS_11870 12414 13106 gene locus_tag LOCUS_11880 12414 13106 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812732.1 protein_id gnl|my_center|LOCUS_11880 13434 14627 gene locus_tag LOCUS_11890 13434 14627 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083872.1 protein_id gnl|my_center|LOCUS_11890 14791 15714 gene locus_tag LOCUS_11900 14791 15714 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_11900 15738 16712 gene locus_tag LOCUS_11910 15738 16712 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_11910 16712 17461 gene locus_tag LOCUS_11920 16712 17461 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_11920 17464 18165 gene locus_tag LOCUS_11930 17464 18165 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_11930 18556 18188 gene locus_tag LOCUS_11940 18556 18188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 18744 19367 gene locus_tag LOCUS_11950 18744 19367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 19617 20984 gene locus_tag LOCUS_11960 gene cysS 19617 20984 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK2 protein_id gnl|my_center|LOCUS_11960 21220 22809 gene locus_tag LOCUS_11970 21220 22809 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388453.1 protein_id gnl|my_center|LOCUS_11970 22806 23477 gene locus_tag LOCUS_11980 22806 23477 CDS product fuculose phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088911.1 protein_id gnl|my_center|LOCUS_11980 23481 24566 gene locus_tag LOCUS_11990 gene mtnA 23481 24566 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VT4 protein_id gnl|my_center|LOCUS_11990 >Feature sequence038 3381 1501 gene locus_tag LOCUS_12000 3381 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3947 4723 gene locus_tag LOCUS_12010 3947 4723 CDS product histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456207.1 protein_id gnl|my_center|LOCUS_12010 4858 5634 gene locus_tag LOCUS_12020 4858 5634 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705575.1 protein_id gnl|my_center|LOCUS_12020 5743 6435 gene locus_tag LOCUS_12030 5743 6435 CDS product histidine/lysine/arginine/ornithine ABC transporter permease HisQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369874.1 protein_id gnl|my_center|LOCUS_12030 6445 7206 gene locus_tag LOCUS_12040 6445 7206 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705577.1 protein_id gnl|my_center|LOCUS_12040 7280 7828 gene locus_tag LOCUS_12050 7280 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 9023 7836 gene locus_tag LOCUS_12060 9023 7836 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531199.1 protein_id gnl|my_center|LOCUS_12060 9806 9081 gene locus_tag LOCUS_12070 9806 9081 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969361.1 protein_id gnl|my_center|LOCUS_12070 10441 9908 gene locus_tag LOCUS_12080 10441 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 10550 11368 gene locus_tag LOCUS_12090 10550 11368 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390216.1 protein_id gnl|my_center|LOCUS_12090 11429 12583 gene locus_tag LOCUS_12100 11429 12583 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI3 protein_id gnl|my_center|LOCUS_12100 12586 13176 gene locus_tag LOCUS_12110 12586 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 13236 13559 gene locus_tag LOCUS_12120 13236 13559 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 protein_id gnl|my_center|LOCUS_12120 14890 13571 gene locus_tag LOCUS_12130 14890 13571 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_12130 16484 15039 gene locus_tag LOCUS_12140 16484 15039 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336795.1 protein_id gnl|my_center|LOCUS_12140 17186 16617 gene locus_tag LOCUS_12150 17186 16617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 17908 17327 gene locus_tag LOCUS_12160 17908 17327 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727712.1 protein_id gnl|my_center|LOCUS_12160 18062 20302 gene locus_tag LOCUS_12170 18062 20302 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086745.1 protein_id gnl|my_center|LOCUS_12170 21396 20299 gene locus_tag LOCUS_12180 21396 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 21749 21414 gene locus_tag LOCUS_12190 21749 21414 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530552.1 protein_id gnl|my_center|LOCUS_12190 21902 22147 gene locus_tag LOCUS_12200 21902 22147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 22144 22641 gene locus_tag LOCUS_12210 22144 22641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 22638 23849 gene locus_tag LOCUS_12220 22638 23849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338923.1 protein_id gnl|my_center|LOCUS_12220 24644 23877 gene locus_tag LOCUS_12230 24644 23877 CDS product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8Z4 protein_id gnl|my_center|LOCUS_12230 25573 24671 gene locus_tag LOCUS_12240 25573 24671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence039 2301 1627 gene locus_tag LOCUS_12250 2301 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2442 3107 gene locus_tag LOCUS_12260 2442 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086626.1 protein_id gnl|my_center|LOCUS_12260 3594 3109 gene locus_tag LOCUS_12270 3594 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969419.1 protein_id gnl|my_center|LOCUS_12270 4733 3630 gene locus_tag LOCUS_12280 gene acuC1 4733 3630 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140150.1 protein_id gnl|my_center|LOCUS_12280 4891 5553 gene locus_tag LOCUS_12290 4891 5553 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_12290 5801 7186 gene locus_tag LOCUS_12300 gene trmFO 5801 7186 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTI8 protein_id gnl|my_center|LOCUS_12300 8053 7190 gene locus_tag LOCUS_12310 8053 7190 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389512.1 protein_id gnl|my_center|LOCUS_12310 9009 8050 gene locus_tag LOCUS_12320 9009 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 9127 10677 gene locus_tag LOCUS_12330 9127 10677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 11221 10847 gene locus_tag LOCUS_12340 11221 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_12340 12186 11257 gene locus_tag LOCUS_12350 12186 11257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12350 13803 12190 gene locus_tag LOCUS_12360 13803 12190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12360 14261 13854 gene locus_tag LOCUS_12370 14261 13854 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389518.1 protein_id gnl|my_center|LOCUS_12370 14467 15324 gene locus_tag LOCUS_12380 14467 15324 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389519.1 protein_id gnl|my_center|LOCUS_12380 15411 15707 gene locus_tag LOCUS_12390 15411 15707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 15697 17631 gene locus_tag LOCUS_12400 gene ggt 15697 17631 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065022.1 protein_id gnl|my_center|LOCUS_12400 18476 17628 gene locus_tag LOCUS_12410 18476 17628 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228672.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence040 1381 617 gene locus_tag LOCUS_12420 gene moeB 1381 617 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_12420 2463 1507 gene locus_tag LOCUS_12430 2463 1507 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391541.1 protein_id gnl|my_center|LOCUS_12430 2563 3783 gene locus_tag LOCUS_12440 2563 3783 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_12440 4016 5266 gene locus_tag LOCUS_12450 4016 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 5401 6612 gene locus_tag LOCUS_12460 gene trpB 5401 6612 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS4 protein_id gnl|my_center|LOCUS_12460 6609 7466 gene locus_tag LOCUS_12470 gene trpA 6609 7466 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WE4 protein_id gnl|my_center|LOCUS_12470 7486 8457 gene locus_tag LOCUS_12480 7486 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 8496 9845 gene locus_tag LOCUS_12490 gene folC 8496 9845 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_12490 9948 10436 gene locus_tag LOCUS_12500 9948 10436 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391279.1 protein_id gnl|my_center|LOCUS_12500 10443 11126 gene locus_tag LOCUS_12510 10443 11126 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_12510 11329 12429 gene locus_tag LOCUS_12520 11329 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 13526 12456 gene locus_tag LOCUS_12530 13526 12456 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_12530 13698 14390 gene locus_tag LOCUS_12540 13698 14390 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391510.1 protein_id gnl|my_center|LOCUS_12540 14387 14857 gene locus_tag LOCUS_12550 14387 14857 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974253.1 protein_id gnl|my_center|LOCUS_12550 15100 15525 gene locus_tag LOCUS_12560 15100 15525 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391513.1 protein_id gnl|my_center|LOCUS_12560 15687 16133 gene locus_tag LOCUS_12570 15687 16133 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_12570 16130 16963 gene locus_tag LOCUS_12580 16130 16963 CDS product ornithine-acyl ACP N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391515.1 protein_id gnl|my_center|LOCUS_12580 16950 17873 gene locus_tag LOCUS_12590 16950 17873 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391516.1 protein_id gnl|my_center|LOCUS_12590 17920 18174 gene locus_tag LOCUS_12600 17920 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 18171 19556 gene locus_tag LOCUS_12610 gene miaB 18171 19556 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5U7 protein_id gnl|my_center|LOCUS_12610 19553 20545 gene locus_tag LOCUS_12620 19553 20545 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391518.1 protein_id gnl|my_center|LOCUS_12620 20542 21030 gene locus_tag LOCUS_12630 gene ybeY 20542 21030 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF10 protein_id gnl|my_center|LOCUS_12630 21052 22008 gene locus_tag LOCUS_12640 21052 22008 CDS product hemolysin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391520.1 protein_id gnl|my_center|LOCUS_12640 22048 23640 gene locus_tag LOCUS_12650 gene lnt 22048 23640 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS7 protein_id gnl|my_center|LOCUS_12650 23801 24256 gene locus_tag LOCUS_12660 23801 24256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12660 >Feature sequence041 58 1098 gene locus_tag LOCUS_12670 58 1098 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 protein_id gnl|my_center|LOCUS_12670 1095 1457 gene locus_tag LOCUS_12680 1095 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1998 1492 gene locus_tag LOCUS_12690 1998 1492 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_12690 2332 2550 gene locus_tag LOCUS_12700 gene infA 2332 2550 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A5V4 protein_id gnl|my_center|LOCUS_12700 3309 2626 gene locus_tag LOCUS_12710 3309 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3697 3404 gene locus_tag LOCUS_12720 3697 3404 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969033.1 protein_id gnl|my_center|LOCUS_12720 3763 4047 gene locus_tag LOCUS_12730 3763 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4561 4052 gene locus_tag LOCUS_12740 4561 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525781.1 protein_id gnl|my_center|LOCUS_12740 4652 5086 gene locus_tag LOCUS_12750 4652 5086 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199881.1 protein_id gnl|my_center|LOCUS_12750 6255 5257 gene locus_tag LOCUS_12760 6255 5257 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709507.1 protein_id gnl|my_center|LOCUS_12760 6364 6945 gene locus_tag LOCUS_12770 6364 6945 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709508.1 protein_id gnl|my_center|LOCUS_12770 7078 6989 gene locus_tag LOCUS_t00150 7078 6989 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8736 7153 gene locus_tag LOCUS_12780 8736 7153 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389349.1 protein_id gnl|my_center|LOCUS_12780 8965 10161 gene locus_tag LOCUS_12790 8965 10161 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389396.1 protein_id gnl|my_center|LOCUS_12790 10168 11160 gene locus_tag LOCUS_12800 10168 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389395.1 protein_id gnl|my_center|LOCUS_12800 11261 12415 gene locus_tag LOCUS_12810 11261 12415 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_12810 12415 13056 gene locus_tag LOCUS_12820 gene tmk 12415 13056 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQJ9 protein_id gnl|my_center|LOCUS_12820 13056 14147 gene locus_tag LOCUS_12830 13056 14147 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389392.1 protein_id gnl|my_center|LOCUS_12830 14180 15748 gene locus_tag LOCUS_12840 gene metG 14180 15748 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTP4 protein_id gnl|my_center|LOCUS_12840 15755 16549 gene locus_tag LOCUS_12850 15755 16549 CDS product TatD-related deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_12850 16546 17298 gene locus_tag LOCUS_12860 16546 17298 CDS product phosphoribosyl 1,2-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 protein_id gnl|my_center|LOCUS_12860 17375 18247 gene locus_tag LOCUS_12870 17375 18247 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_12870 18275 19474 gene locus_tag LOCUS_12880 18275 19474 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887328.1 protein_id gnl|my_center|LOCUS_12880 20116 19481 gene locus_tag LOCUS_12890 20116 19481 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705669.1 protein_id gnl|my_center|LOCUS_12890 20864 20118 gene locus_tag LOCUS_12900 20864 20118 CDS product methanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705670.1 protein_id gnl|my_center|LOCUS_12900 21475 20861 gene locus_tag LOCUS_12910 21475 20861 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528992.1 protein_id gnl|my_center|LOCUS_12910 22287 21490 gene locus_tag LOCUS_12920 22287 21490 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_12920 22957 22310 gene locus_tag LOCUS_12930 22957 22310 CDS product threonine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391459.1 protein_id gnl|my_center|LOCUS_12930 24323 22968 gene locus_tag LOCUS_12940 24323 22968 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147522.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence042 <1 576 gene locus_tag LOCUS_12950 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528560.1:glycine cleavage system protein T 576 1979 gene locus_tag LOCUS_12960 576 1979 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339390.1 protein_id gnl|my_center|LOCUS_12960 2035 3102 gene locus_tag LOCUS_12970 2035 3102 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719295.1 protein_id gnl|my_center|LOCUS_12970 3176 3955 gene locus_tag LOCUS_12980 3176 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 5050 3965 gene locus_tag LOCUS_12990 5050 3965 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J201 protein_id gnl|my_center|LOCUS_12990 5847 5047 gene locus_tag LOCUS_13000 5847 5047 CDS product spermidine/putrescine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 protein_id gnl|my_center|LOCUS_13000 6683 5844 gene locus_tag LOCUS_13010 6683 5844 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 protein_id gnl|my_center|LOCUS_13010 8017 6797 gene locus_tag LOCUS_13020 8017 6797 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 protein_id gnl|my_center|LOCUS_13020 8627 8160 gene locus_tag LOCUS_13030 8627 8160 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226527.1 protein_id gnl|my_center|LOCUS_13030 8750 9778 gene locus_tag LOCUS_13040 8750 9778 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525362.1 protein_id gnl|my_center|LOCUS_13040 9907 10509 gene locus_tag LOCUS_13050 gene gst1 9907 10509 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708203.1 protein_id gnl|my_center|LOCUS_13050 11086 10544 gene locus_tag LOCUS_13060 11086 10544 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706109.1 protein_id gnl|my_center|LOCUS_13060 11134 12315 gene locus_tag LOCUS_13070 11134 12315 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532926.1 protein_id gnl|my_center|LOCUS_13070 12972 12325 gene locus_tag LOCUS_13080 12972 12325 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731339.1 protein_id gnl|my_center|LOCUS_13080 13009 13908 gene locus_tag LOCUS_13090 13009 13908 CDS product NmrA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_13090 13905 14387 gene locus_tag LOCUS_13100 13905 14387 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529116.1 protein_id gnl|my_center|LOCUS_13100 14409 14708 gene locus_tag LOCUS_13110 14409 14708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 15496 14783 gene locus_tag LOCUS_13120 15496 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114283.1 protein_id gnl|my_center|LOCUS_13120 15613 16524 gene locus_tag LOCUS_13130 15613 16524 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969857.1 protein_id gnl|my_center|LOCUS_13130 16997 16512 gene locus_tag LOCUS_13140 16997 16512 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528038.1 protein_id gnl|my_center|LOCUS_13140 17687 17031 gene locus_tag LOCUS_13150 17687 17031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709565.1 protein_id gnl|my_center|LOCUS_13150 18192 17674 gene locus_tag LOCUS_13160 18192 17674 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_13160 18676 18224 gene locus_tag LOCUS_13170 18676 18224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 19329 18715 gene locus_tag LOCUS_13180 19329 18715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529457.1 protein_id gnl|my_center|LOCUS_13180 19834 19355 gene locus_tag LOCUS_13190 19834 19355 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 protein_id gnl|my_center|LOCUS_13190 20853 19885 gene locus_tag LOCUS_13200 20853 19885 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975928.1 protein_id gnl|my_center|LOCUS_13200 21472 20858 gene locus_tag LOCUS_13210 21472 20858 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066656.1 protein_id gnl|my_center|LOCUS_13210 22971 21538 gene locus_tag LOCUS_13220 22971 21538 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817451.1 protein_id gnl|my_center|LOCUS_13220 23905 23018 gene locus_tag LOCUS_13230 23905 23018 CDS product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921099.1 protein_id gnl|my_center|LOCUS_13230 24338 23907 gene locus_tag LOCUS_13240 24338 23907 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TE41 protein_id gnl|my_center|LOCUS_13240 >Feature sequence043 1649 1104 gene locus_tag LOCUS_13250 1649 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2754 1765 gene locus_tag LOCUS_13260 2754 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_13260 3078 2863 gene locus_tag LOCUS_13270 3078 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2971 3777 gene locus_tag LOCUS_13280 2971 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3803 4930 gene locus_tag LOCUS_13290 3803 4930 CDS product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 protein_id gnl|my_center|LOCUS_13290 5028 6845 gene locus_tag LOCUS_13300 5028 6845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390692.1 protein_id gnl|my_center|LOCUS_13300 6850 7566 gene locus_tag LOCUS_13310 6850 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392265.1 protein_id gnl|my_center|LOCUS_13310 7563 8852 gene locus_tag LOCUS_13320 7563 8852 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388339.1 protein_id gnl|my_center|LOCUS_13320 8891 9832 gene locus_tag LOCUS_13330 gene lpxK 8891 9832 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6I0 protein_id gnl|my_center|LOCUS_13330 9822 10727 gene locus_tag LOCUS_13340 9822 10727 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598029.1 protein_id gnl|my_center|LOCUS_13340 10742 11515 gene locus_tag LOCUS_13350 10742 11515 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 protein_id gnl|my_center|LOCUS_13350 12345 11500 gene locus_tag LOCUS_13360 12345 11500 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_13360 13826 12345 gene locus_tag LOCUS_13370 gene xseA 13826 12345 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY31 protein_id gnl|my_center|LOCUS_13370 14016 15287 gene locus_tag LOCUS_13380 gene purD 14016 15287 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHE2 protein_id gnl|my_center|LOCUS_13380 15303 15590 gene locus_tag LOCUS_13390 15303 15590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 15618 16967 gene locus_tag LOCUS_13400 15618 16967 CDS product modulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388333.1 protein_id gnl|my_center|LOCUS_13400 18160 16985 gene locus_tag LOCUS_13410 18160 16985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 18660 18157 gene locus_tag LOCUS_13420 18660 18157 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 protein_id gnl|my_center|LOCUS_13420 19777 19016 gene locus_tag LOCUS_13430 19777 19016 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_13430 19921 22290 gene locus_tag LOCUS_13440 19921 22290 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_13440 22301 22888 gene locus_tag LOCUS_13450 gene gmhA1 22301 22888 CDS product phosphoheptose isomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNE6 protein_id gnl|my_center|LOCUS_13450 23734 22889 gene locus_tag LOCUS_13460 gene speE 23734 22889 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRX6 protein_id gnl|my_center|LOCUS_13460 24332 23835 gene locus_tag LOCUS_13470 24332 23835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence044 2806 770 gene locus_tag LOCUS_13480 2806 770 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528563.1 protein_id gnl|my_center|LOCUS_13480 2969 4687 gene locus_tag LOCUS_13490 2969 4687 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084349.1 protein_id gnl|my_center|LOCUS_13490 4727 5290 gene locus_tag LOCUS_13500 4727 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 6373 5312 gene locus_tag LOCUS_13510 gene ctaA 6373 5312 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H551 protein_id gnl|my_center|LOCUS_13510 6531 6989 gene locus_tag LOCUS_13520 6531 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 8279 7035 gene locus_tag LOCUS_13530 8279 7035 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_13530 8435 10240 gene locus_tag LOCUS_13540 gene lepA 8435 10240 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGR1 protein_id gnl|my_center|LOCUS_13540 10682 10350 gene locus_tag LOCUS_13550 10682 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 10890 10979 gene locus_tag LOCUS_t00160 10890 10979 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11400 13205 gene locus_tag LOCUS_13560 11400 13205 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035470.1 protein_id gnl|my_center|LOCUS_13560 13202 15730 gene locus_tag LOCUS_13570 13202 15730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035471.1 protein_id gnl|my_center|LOCUS_13570 18678 15946 gene locus_tag LOCUS_13580 18678 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13580 19739 18675 gene locus_tag LOCUS_13590 19739 18675 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339230.1 protein_id gnl|my_center|LOCUS_13590 21185 19995 gene locus_tag LOCUS_13600 gene cydB 21185 19995 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973557.1 protein_id gnl|my_center|LOCUS_13600 22804 21191 gene locus_tag LOCUS_13610 gene cydA 22804 21191 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973556.1 protein_id gnl|my_center|LOCUS_13610 24551 22929 gene locus_tag LOCUS_13620 24551 22929 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383174.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence045 3166 893 gene locus_tag LOCUS_13630 gene dme 3166 893 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086918.1 protein_id gnl|my_center|LOCUS_13630 3388 3302 gene locus_tag LOCUS_t00170 3388 3302 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3470 4210 gene locus_tag LOCUS_13640 gene lipB 3470 4210 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSU9 protein_id gnl|my_center|LOCUS_13640 4899 4567 gene locus_tag LOCUS_13650 4899 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 6533 4899 gene locus_tag LOCUS_13660 6533 4899 CDS product indolepyruvate/phenylpyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390529.1 protein_id gnl|my_center|LOCUS_13660 6718 7674 gene locus_tag LOCUS_13670 6718 7674 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530045.1 protein_id gnl|my_center|LOCUS_13670 7667 9124 gene locus_tag LOCUS_13680 7667 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 11153 9144 gene locus_tag LOCUS_13690 11153 9144 CDS product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_13690 11888 11163 gene locus_tag LOCUS_13700 11888 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 13431 11899 gene locus_tag LOCUS_13710 13431 11899 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_13710 14214 13516 gene locus_tag LOCUS_13720 14214 13516 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390406.1 protein_id gnl|my_center|LOCUS_13720 17478 14284 gene locus_tag LOCUS_13730 17478 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 18155 17478 gene locus_tag LOCUS_13740 18155 17478 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_13740 19150 18158 gene locus_tag LOCUS_13750 19150 18158 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY9 protein_id gnl|my_center|LOCUS_13750 19527 19147 gene locus_tag LOCUS_13760 gene crcB 19527 19147 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61389 protein_id gnl|my_center|LOCUS_13760 19716 20258 gene locus_tag LOCUS_13770 19716 20258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 21024 20272 gene locus_tag LOCUS_13780 21024 20272 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528859.1 protein_id gnl|my_center|LOCUS_13780 21686 21036 gene locus_tag LOCUS_13790 21686 21036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13790 22364 21690 gene locus_tag LOCUS_13800 22364 21690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13800 23773 22367 gene locus_tag LOCUS_13810 gene degP3 23773 22367 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969200.1 protein_id gnl|my_center|LOCUS_13810 24335 23916 gene locus_tag LOCUS_13820 gene rplQ 24335 23916 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JA8 protein_id gnl|my_center|LOCUS_13820 >Feature sequence046 126 1499 gene locus_tag LOCUS_13830 126 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1486 2604 gene locus_tag LOCUS_13840 1486 2604 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088658.1 protein_id gnl|my_center|LOCUS_13840 2608 3306 gene locus_tag LOCUS_13850 2608 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038679.1 protein_id gnl|my_center|LOCUS_13850 3306 5585 gene locus_tag LOCUS_13860 3306 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5592 7412 gene locus_tag LOCUS_13870 gene asnB 5592 7412 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_13870 7443 8465 gene locus_tag LOCUS_13880 7443 8465 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533118.1 protein_id gnl|my_center|LOCUS_13880 9415 8507 gene locus_tag LOCUS_13890 9415 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 9659 10564 gene locus_tag LOCUS_13900 gene cysD 9659 10564 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNR3 protein_id gnl|my_center|LOCUS_13900 10564 12474 gene locus_tag LOCUS_13910 10564 12474 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919356.1 protein_id gnl|my_center|LOCUS_13910 12568 13236 gene locus_tag LOCUS_13920 12568 13236 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_13920 13233 14126 gene locus_tag LOCUS_13930 13233 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368520.1 protein_id gnl|my_center|LOCUS_13930 14138 14653 gene locus_tag LOCUS_13940 14138 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 14970 14668 gene locus_tag LOCUS_13950 14970 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 15460 15840 gene locus_tag LOCUS_13960 15460 15840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 16444 15824 gene locus_tag LOCUS_13970 gene paiB 16444 15824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036741.1 protein_id gnl|my_center|LOCUS_13970 17376 16594 gene locus_tag LOCUS_13980 gene sdhB 17376 16594 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8V5 protein_id gnl|my_center|LOCUS_13980 19199 17406 gene locus_tag LOCUS_13990 gene sdhA 19199 17406 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6R5 protein_id gnl|my_center|LOCUS_13990 19621 19241 gene locus_tag LOCUS_14000 19621 19241 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067168.1 protein_id gnl|my_center|LOCUS_14000 20019 19633 gene locus_tag LOCUS_14010 gene sdhC 20019 19633 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_14010 21591 21313 gene locus_tag LOCUS_14020 21591 21313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 21553 22263 gene locus_tag LOCUS_14030 21553 22263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 22325 24277 gene locus_tag LOCUS_14040 22325 24277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence047 1420 326 gene locus_tag LOCUS_14050 1420 326 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D0V6 protein_id gnl|my_center|LOCUS_14050 1890 2885 gene locus_tag LOCUS_14060 1890 2885 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_14060 2882 3763 gene locus_tag LOCUS_14070 2882 3763 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RS93 protein_id gnl|my_center|LOCUS_14070 3886 4833 gene locus_tag LOCUS_14080 3886 4833 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382858.1 protein_id gnl|my_center|LOCUS_14080 4848 5159 gene locus_tag LOCUS_14090 4848 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 5876 5172 gene locus_tag LOCUS_14100 5876 5172 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969985.1 protein_id gnl|my_center|LOCUS_14100 6221 5946 gene locus_tag LOCUS_14110 6221 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 6383 7786 gene locus_tag LOCUS_14120 6383 7786 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV29 protein_id gnl|my_center|LOCUS_14120 7787 8671 gene locus_tag LOCUS_14130 7787 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 9537 8668 gene locus_tag LOCUS_14140 9537 8668 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531004.1 protein_id gnl|my_center|LOCUS_14140 9656 10129 gene locus_tag LOCUS_14150 9656 10129 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531005.1 protein_id gnl|my_center|LOCUS_14150 10192 10782 gene locus_tag LOCUS_14160 10192 10782 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_14160 11688 10798 gene locus_tag LOCUS_14170 11688 10798 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390649.1 protein_id gnl|my_center|LOCUS_14170 12786 11776 gene locus_tag LOCUS_14180 12786 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_14180 12929 13426 gene locus_tag LOCUS_14190 12929 13426 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390646.1 protein_id gnl|my_center|LOCUS_14190 14585 13419 gene locus_tag LOCUS_14200 gene phnM 14585 13419 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090672.1 protein_id gnl|my_center|LOCUS_14200 15436 14618 gene locus_tag LOCUS_14210 15436 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 16332 15433 gene locus_tag LOCUS_14220 gene phnC 16332 15433 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7T8 protein_id gnl|my_center|LOCUS_14220 17194 16310 gene locus_tag LOCUS_14230 17194 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 17868 17371 gene locus_tag LOCUS_14240 17868 17371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 18862 17945 gene locus_tag LOCUS_14250 18862 17945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338346.1 protein_id gnl|my_center|LOCUS_14250 20564 18873 gene locus_tag LOCUS_14260 20564 18873 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389458.1 protein_id gnl|my_center|LOCUS_14260 20857 20648 gene locus_tag LOCUS_14270 20857 20648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 21315 20857 gene locus_tag LOCUS_14280 gene greA 21315 20857 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB1 protein_id gnl|my_center|LOCUS_14280 <23940 21496 gene locus_tag LOCUS_14290 <23940 21496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQB2:carbamoyl-phosphate synthase (glutamine-hydrolyzing) >Feature sequence048 <1 1140 gene locus_tag LOCUS_14300 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531743.1:2-aminobenzoate-CoA ligase 2932 1145 gene locus_tag LOCUS_14310 2932 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 3594 3088 gene locus_tag LOCUS_14320 3594 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 4379 3639 gene locus_tag LOCUS_14330 4379 3639 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099978.1 protein_id gnl|my_center|LOCUS_14330 4522 6093 gene locus_tag LOCUS_14340 4522 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 6161 7231 gene locus_tag LOCUS_14350 6161 7231 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887001.1 protein_id gnl|my_center|LOCUS_14350 7237 7791 gene locus_tag LOCUS_14360 7237 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 7804 9144 gene locus_tag LOCUS_14370 7804 9144 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 protein_id gnl|my_center|LOCUS_14370 9155 10258 gene locus_tag LOCUS_14380 gene menC 9155 10258 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ9 protein_id gnl|my_center|LOCUS_14380 10361 10792 gene locus_tag LOCUS_14390 10361 10792 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969576.1 protein_id gnl|my_center|LOCUS_14390 11839 10805 gene locus_tag LOCUS_14400 11839 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391309.1 protein_id gnl|my_center|LOCUS_14400 12738 12037 gene locus_tag LOCUS_14410 12738 12037 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 protein_id gnl|my_center|LOCUS_14410 13122 12742 gene locus_tag LOCUS_14420 13122 12742 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095835.1 protein_id gnl|my_center|LOCUS_14420 14461 13205 gene locus_tag LOCUS_14430 14461 13205 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_14430 15708 14482 gene locus_tag LOCUS_14440 gene bcd 15708 14482 CDS product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_14440 17314 15797 gene locus_tag LOCUS_14450 17314 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 18926 17451 gene locus_tag LOCUS_14460 18926 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_14460 19145 19765 gene locus_tag LOCUS_14470 gene azoR 19145 19765 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVU8 protein_id gnl|my_center|LOCUS_14470 19914 20678 gene locus_tag LOCUS_14480 19914 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947406.1 protein_id gnl|my_center|LOCUS_14480 20796 20721 gene locus_tag LOCUS_t00180 20796 20721 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20990 21289 gene locus_tag LOCUS_14490 20990 21289 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_14490 21297 21632 gene locus_tag LOCUS_14500 21297 21632 CDS product UPF0235 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH5 protein_id gnl|my_center|LOCUS_14500 21659 22552 gene locus_tag LOCUS_14510 gene folD 21659 22552 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J049 protein_id gnl|my_center|LOCUS_14510 23792 22563 gene locus_tag LOCUS_14520 23792 22563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence049 1745 261 gene locus_tag LOCUS_14530 1745 261 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_14530 2897 1854 gene locus_tag LOCUS_14540 2897 1854 CDS product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088424.1 protein_id gnl|my_center|LOCUS_14540 4381 2894 gene locus_tag LOCUS_14550 4381 2894 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6X5 protein_id gnl|my_center|LOCUS_14550 5184 4420 gene locus_tag LOCUS_14560 5184 4420 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391069.1 protein_id gnl|my_center|LOCUS_14560 5413 5859 gene locus_tag LOCUS_14570 5413 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 7405 6044 gene locus_tag LOCUS_14580 7405 6044 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563098.1 protein_id gnl|my_center|LOCUS_14580 7549 7683 gene locus_tag LOCUS_14590 gene rpmH 7549 7683 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP15 protein_id gnl|my_center|LOCUS_14590 7728 8147 gene locus_tag LOCUS_14600 gene rnpA 7728 8147 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYZ0 protein_id gnl|my_center|LOCUS_14600 8186 10228 gene locus_tag LOCUS_14610 gene yidC 8186 10228 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP12 protein_id gnl|my_center|LOCUS_14610 10233 10886 gene locus_tag LOCUS_14620 gene engB 10233 10886 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP11 protein_id gnl|my_center|LOCUS_14620 10939 11871 gene locus_tag LOCUS_14630 gene argB 10939 11871 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP10 protein_id gnl|my_center|LOCUS_14630 12719 11889 gene locus_tag LOCUS_14640 12719 11889 CDS product aspartyl/asparaginyl beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531442.1 protein_id gnl|my_center|LOCUS_14640 15139 12728 gene locus_tag LOCUS_14650 gene pheT 15139 12728 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH7 protein_id gnl|my_center|LOCUS_14650 15559 15239 gene locus_tag LOCUS_14660 15559 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 15794 15549 gene locus_tag LOCUS_14670 15794 15549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 16947 15850 gene locus_tag LOCUS_14680 gene pheS 16947 15850 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH8 protein_id gnl|my_center|LOCUS_14680 17449 17078 gene locus_tag LOCUS_14690 gene rplT 17449 17078 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBC9 protein_id gnl|my_center|LOCUS_14690 17692 17492 gene locus_tag LOCUS_14700 gene rpmI 17692 17492 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNI0 protein_id gnl|my_center|LOCUS_14700 18650 17892 gene locus_tag LOCUS_14710 18650 17892 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974285.1 protein_id gnl|my_center|LOCUS_14710 18803 20479 gene locus_tag LOCUS_14720 18803 20479 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391225.1 protein_id gnl|my_center|LOCUS_14720 20472 21791 gene locus_tag LOCUS_14730 20472 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 <22485 21817 gene locus_tag LOCUS_14740 <22485 21817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584159.1:Crp/Fnr family transcriptional regulator >Feature sequence050 139 1533 gene locus_tag LOCUS_14750 139 1533 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147522.1 protein_id gnl|my_center|LOCUS_14750 1537 2814 gene locus_tag LOCUS_14760 1537 2814 CDS product gamma-glutamylputrescine oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267671.1 protein_id gnl|my_center|LOCUS_14760 2889 3224 gene locus_tag LOCUS_14770 2889 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 3600 3250 gene locus_tag LOCUS_14780 3600 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4070 4387 gene locus_tag LOCUS_14790 4070 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4467 5057 gene locus_tag LOCUS_14800 4467 5057 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L49 protein_id gnl|my_center|LOCUS_14800 5602 5051 gene locus_tag LOCUS_14810 5602 5051 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_14810 5709 6824 gene locus_tag LOCUS_14820 5709 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 6868 8661 gene locus_tag LOCUS_14830 6868 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388308.1 protein_id gnl|my_center|LOCUS_14830 9049 9504 gene locus_tag LOCUS_14840 gene mraZ 9049 9504 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H0A3 protein_id gnl|my_center|LOCUS_14840 9501 10478 gene locus_tag LOCUS_14850 gene rsmH 9501 10478 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT6 protein_id gnl|my_center|LOCUS_14850 10475 10855 gene locus_tag LOCUS_14860 10475 10855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 10915 12636 gene locus_tag LOCUS_14870 10915 12636 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388711.1 protein_id gnl|my_center|LOCUS_14870 12651 14114 gene locus_tag LOCUS_14880 gene murE 12651 14114 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVT9 protein_id gnl|my_center|LOCUS_14880 14111 15547 gene locus_tag LOCUS_14890 gene murF 14111 15547 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU0 protein_id gnl|my_center|LOCUS_14890 15564 16649 gene locus_tag LOCUS_14900 gene mraY 15564 16649 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU1 protein_id gnl|my_center|LOCUS_14900 16654 18021 gene locus_tag LOCUS_14910 gene murD 16654 18021 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU2 protein_id gnl|my_center|LOCUS_14910 18021 19136 gene locus_tag LOCUS_14920 18021 19136 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388706.1 protein_id gnl|my_center|LOCUS_14920 19133 20263 gene locus_tag LOCUS_14930 gene murG 19133 20263 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU4 protein_id gnl|my_center|LOCUS_14930 20263 21669 gene locus_tag LOCUS_14940 gene murC 20263 21669 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU5 protein_id gnl|my_center|LOCUS_14940 >Feature sequence051 384 716 gene locus_tag LOCUS_14950 384 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 722 970 gene locus_tag LOCUS_14960 722 970 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 protein_id gnl|my_center|LOCUS_14960 972 2402 gene locus_tag LOCUS_14970 gene merA-1 972 2402 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DZ63 protein_id gnl|my_center|LOCUS_14970 3249 2875 gene locus_tag LOCUS_14980 3249 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 3572 3243 gene locus_tag LOCUS_14990 3572 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 4399 3569 gene locus_tag LOCUS_15000 4399 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 5797 4937 gene locus_tag LOCUS_15010 5797 4937 CDS product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387735.1 protein_id gnl|my_center|LOCUS_15010 6517 6675 gene locus_tag LOCUS_15020 6517 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 7266 6799 gene locus_tag LOCUS_15030 7266 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 7514 8032 gene locus_tag LOCUS_15040 7514 8032 CDS product DUF4823 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091112.1 protein_id gnl|my_center|LOCUS_15040 8083 8496 gene locus_tag LOCUS_15050 8083 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 8551 8709 gene locus_tag LOCUS_15060 8551 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 8722 8913 gene locus_tag LOCUS_15070 8722 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 9538 9125 gene locus_tag LOCUS_15080 9538 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 9817 9614 gene locus_tag LOCUS_15090 9817 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 10786 9830 gene locus_tag LOCUS_15100 gene xerD 10786 9830 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VY23 protein_id gnl|my_center|LOCUS_15100 10968 10783 gene locus_tag LOCUS_15110 10968 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 11696 10965 gene locus_tag LOCUS_15120 11696 10965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 12082 11693 gene locus_tag LOCUS_15130 12082 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 12349 12095 gene locus_tag LOCUS_15140 12349 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 12674 12372 gene locus_tag LOCUS_15150 12674 12372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 13407 12688 gene locus_tag LOCUS_15160 13407 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 13697 13407 gene locus_tag LOCUS_15170 13697 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 14002 13694 gene locus_tag LOCUS_15180 14002 13694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 14250 13999 gene locus_tag LOCUS_15190 14250 13999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 14501 14256 gene locus_tag LOCUS_15200 14501 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 14852 14610 gene locus_tag LOCUS_15210 14852 14610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 15371 14856 gene locus_tag LOCUS_15220 15371 14856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 15487 15696 gene locus_tag LOCUS_15230 15487 15696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 15924 15718 gene locus_tag LOCUS_15240 15924 15718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 16156 15917 gene locus_tag LOCUS_15250 16156 15917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 16371 16156 gene locus_tag LOCUS_15260 16371 16156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 17275 16364 gene locus_tag LOCUS_15270 17275 16364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 17627 17193 gene locus_tag LOCUS_15280 17627 17193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 17891 18991 gene locus_tag LOCUS_15290 17891 18991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 19304 19981 gene locus_tag LOCUS_15300 19304 19981 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 protein_id gnl|my_center|LOCUS_15300 19985 20296 gene locus_tag LOCUS_15310 19985 20296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 20439 20828 gene locus_tag LOCUS_15320 20439 20828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 20842 21054 gene locus_tag LOCUS_15330 20842 21054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 21035 21892 gene locus_tag LOCUS_15340 21035 21892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence052 <1 930 gene locus_tag LOCUS_15350 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728620.1:MFS transporter 2677 1004 gene locus_tag LOCUS_15360 gene glnS 2677 1004 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KR6 protein_id gnl|my_center|LOCUS_15360 3647 2682 gene locus_tag LOCUS_15370 gene prfB 3647 2682 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAC3 protein_id gnl|my_center|LOCUS_15370 4001 5947 gene locus_tag LOCUS_15380 4001 5947 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707073.1 protein_id gnl|my_center|LOCUS_15380 6844 5954 gene locus_tag LOCUS_15390 6844 5954 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388147.1 protein_id gnl|my_center|LOCUS_15390 7188 6841 gene locus_tag LOCUS_15400 7188 6841 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312612.1 protein_id gnl|my_center|LOCUS_15400 7514 7185 gene locus_tag LOCUS_15410 7514 7185 CDS product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707131.1 protein_id gnl|my_center|LOCUS_15410 7613 8272 gene locus_tag LOCUS_15420 7613 8272 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968921.1 protein_id gnl|my_center|LOCUS_15420 8372 9592 gene locus_tag LOCUS_15430 8372 9592 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083205.1 protein_id gnl|my_center|LOCUS_15430 10806 9598 gene locus_tag LOCUS_15440 10806 9598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 10898 12361 gene locus_tag LOCUS_15450 10898 12361 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_15450 12374 14161 gene locus_tag LOCUS_15460 12374 14161 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388194.1 protein_id gnl|my_center|LOCUS_15460 14434 14829 gene locus_tag LOCUS_15470 14434 14829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 14874 16685 gene locus_tag LOCUS_15480 14874 16685 CDS product putative transcriptional regulatory protein y4pA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55610 protein_id gnl|my_center|LOCUS_15480 17287 16682 gene locus_tag LOCUS_15490 17287 16682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 18113 17430 gene locus_tag LOCUS_15500 18113 17430 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886864.1 protein_id gnl|my_center|LOCUS_15500 18637 19647 gene locus_tag LOCUS_15510 18637 19647 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086169.1 protein_id gnl|my_center|LOCUS_15510 19652 20716 gene locus_tag LOCUS_15520 19652 20716 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086168.1 protein_id gnl|my_center|LOCUS_15520 20743 21990 gene locus_tag LOCUS_15530 20743 21990 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086171.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence053 <1 1712 gene locus_tag LOCUS_15540 <1 1712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123986.1:oxidoreductase 1709 2551 gene locus_tag LOCUS_15550 1709 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2567 4288 gene locus_tag LOCUS_15560 2567 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 5960 4299 gene locus_tag LOCUS_15570 5960 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 7619 6045 gene locus_tag LOCUS_15580 7619 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121319.1 protein_id gnl|my_center|LOCUS_15580 9540 7621 gene locus_tag LOCUS_15590 9540 7621 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121318.1 protein_id gnl|my_center|LOCUS_15590 11032 9701 gene locus_tag LOCUS_15600 11032 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 11275 11925 gene locus_tag LOCUS_15610 11275 11925 CDS product phosphonate metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337861.1 protein_id gnl|my_center|LOCUS_15610 12458 11910 gene locus_tag LOCUS_15620 gene phnN 12458 11910 CDS product ribose 1,5-bisphosphate phosphokinase PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TCF6 protein_id gnl|my_center|LOCUS_15620 13686 12463 gene locus_tag LOCUS_15630 13686 12463 CDS product phosphonate metabolism protein PhnM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113124.1 protein_id gnl|my_center|LOCUS_15630 14405 13704 gene locus_tag LOCUS_15640 14405 13704 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529517.1 protein_id gnl|my_center|LOCUS_15640 15197 14418 gene locus_tag LOCUS_15650 15197 14418 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529518.1 protein_id gnl|my_center|LOCUS_15650 16075 15194 gene locus_tag LOCUS_15660 gene phnJ 16075 15194 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52987 protein_id gnl|my_center|LOCUS_15660 17142 16072 gene locus_tag LOCUS_15670 17142 16072 CDS product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267544.1 protein_id gnl|my_center|LOCUS_15670 17748 17146 gene locus_tag LOCUS_15680 17748 17146 CDS product carbon-phosphorus lyase subunit PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529523.1 protein_id gnl|my_center|LOCUS_15680 18217 17753 gene locus_tag LOCUS_15690 18217 17753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098697.1 protein_id gnl|my_center|LOCUS_15690 18413 19195 gene locus_tag LOCUS_15700 18413 19195 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203732.1 protein_id gnl|my_center|LOCUS_15700 19252 20742 gene locus_tag LOCUS_15710 19252 20742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence054 57 1592 gene locus_tag LOCUS_15720 57 1592 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528104.1 protein_id gnl|my_center|LOCUS_15720 1589 2824 gene locus_tag LOCUS_15730 gene wcaK 1589 2824 CDS product colanic acid biosynthesis glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888198.1 protein_id gnl|my_center|LOCUS_15730 2833 4074 gene locus_tag LOCUS_15740 2833 4074 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142460.1 protein_id gnl|my_center|LOCUS_15740 5316 4081 gene locus_tag LOCUS_15750 5316 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 6581 5313 gene locus_tag LOCUS_15760 6581 5313 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257983.1 protein_id gnl|my_center|LOCUS_15760 7975 6578 gene locus_tag LOCUS_15770 7975 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 9237 7975 gene locus_tag LOCUS_15780 9237 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 10714 9227 gene locus_tag LOCUS_15790 10714 9227 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532222.1 protein_id gnl|my_center|LOCUS_15790 12073 10754 gene locus_tag LOCUS_15800 12073 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 13301 12063 gene locus_tag LOCUS_15810 13301 12063 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403007.1 protein_id gnl|my_center|LOCUS_15810 15638 13314 gene locus_tag LOCUS_15820 15638 13314 CDS product protein-tyrosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389244.1 protein_id gnl|my_center|LOCUS_15820 16228 15638 gene locus_tag LOCUS_15830 16228 15638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918058.1 protein_id gnl|my_center|LOCUS_15830 17248 16244 gene locus_tag LOCUS_15840 gene galE-2 17248 16244 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338033.1 protein_id gnl|my_center|LOCUS_15840 18727 17252 gene locus_tag LOCUS_15850 gene manC 18727 17252 CDS product GDP-mannose pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522157.1 protein_id gnl|my_center|LOCUS_15850 20267 18945 gene locus_tag LOCUS_15860 20267 18945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918052.1 protein_id gnl|my_center|LOCUS_15860 20805 21278 gene locus_tag LOCUS_15870 20805 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence055 59 328 gene locus_tag LOCUS_15880 59 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 355 891 gene locus_tag LOCUS_15890 355 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 888 2144 gene locus_tag LOCUS_15900 888 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2606 2148 gene locus_tag LOCUS_15910 2606 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 4751 2616 gene locus_tag LOCUS_15920 4751 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 4990 4748 gene locus_tag LOCUS_15930 4990 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 7180 5006 gene locus_tag LOCUS_15940 7180 5006 CDS product DNA-repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_603345.2 protein_id gnl|my_center|LOCUS_15940 7380 7201 gene locus_tag LOCUS_15950 7380 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 7806 7585 gene locus_tag LOCUS_15960 7806 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 8984 7860 gene locus_tag LOCUS_15970 8984 7860 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040073.1 protein_id gnl|my_center|LOCUS_15970 9426 10508 gene locus_tag LOCUS_15980 9426 10508 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938039.1 protein_id gnl|my_center|LOCUS_15980 10821 10525 gene locus_tag LOCUS_15990 10821 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 11341 10886 gene locus_tag LOCUS_16000 11341 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 11585 11833 gene locus_tag LOCUS_16010 11585 11833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 12007 13353 gene locus_tag LOCUS_16020 12007 13353 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 protein_id gnl|my_center|LOCUS_16020 14038 13346 gene locus_tag LOCUS_16030 14038 13346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 14238 14507 gene locus_tag LOCUS_16040 gene acpC 14238 14507 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639351.2 protein_id gnl|my_center|LOCUS_16040 14514 15146 gene locus_tag LOCUS_16050 14514 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 15143 16759 gene locus_tag LOCUS_16060 15143 16759 CDS product AMP-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039086.1 protein_id gnl|my_center|LOCUS_16060 16756 17661 gene locus_tag LOCUS_16070 16756 17661 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 protein_id gnl|my_center|LOCUS_16070 17645 18217 gene locus_tag LOCUS_16080 17645 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 18214 20520 gene locus_tag LOCUS_16090 gene actII-3 18214 20520 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence056 3231 1216 gene locus_tag LOCUS_16100 gene accA 3231 1216 CDS product biotin carboxylase subunit of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815954.1 protein_id gnl|my_center|LOCUS_16100 3778 3251 gene locus_tag LOCUS_16110 3778 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4551 3760 gene locus_tag LOCUS_16120 4551 3760 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_16120 6166 4559 gene locus_tag LOCUS_16130 gene mccB 6166 4559 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_16130 8072 6177 gene locus_tag LOCUS_16140 gene wbpQ 8072 6177 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073062.1 protein_id gnl|my_center|LOCUS_16140 8856 8080 gene locus_tag LOCUS_16150 8856 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 9805 8846 gene locus_tag LOCUS_16160 9805 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 10413 9811 gene locus_tag LOCUS_16170 10413 9811 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389697.1 protein_id gnl|my_center|LOCUS_16170 11161 10424 gene locus_tag LOCUS_16180 gene fabG 11161 10424 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_16180 12306 11173 gene locus_tag LOCUS_16190 12306 11173 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_16190 12978 12325 gene locus_tag LOCUS_16200 gene cynT 12978 12325 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KY0 protein_id gnl|my_center|LOCUS_16200 13637 12975 gene locus_tag LOCUS_16210 13637 12975 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_16210 14847 13657 gene locus_tag LOCUS_16220 gene fadA 14847 13657 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_16220 15764 14844 gene locus_tag LOCUS_16230 15764 14844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 16936 15764 gene locus_tag LOCUS_16240 gene liuA 16936 15764 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100385.1 protein_id gnl|my_center|LOCUS_16240 17423 16965 gene locus_tag LOCUS_16250 17423 16965 CDS product thioesterase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_16250 17875 17420 gene locus_tag LOCUS_16260 17875 17420 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084163.1 protein_id gnl|my_center|LOCUS_16260 18282 17872 gene locus_tag LOCUS_16270 18282 17872 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536722.1 protein_id gnl|my_center|LOCUS_16270 19526 18411 gene locus_tag LOCUS_16280 19526 18411 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529403.1 protein_id gnl|my_center|LOCUS_16280 20549 19875 gene locus_tag LOCUS_16290 20549 19875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 <21290 20603 gene locus_tag LOCUS_16300 <21290 20603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RSV0:magnesium transporter MgtE >Feature sequence057 1556 1119 gene locus_tag LOCUS_16310 1556 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2606 1629 gene locus_tag LOCUS_16320 gene thiL 2606 1629 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC5 protein_id gnl|my_center|LOCUS_16320 3103 2612 gene locus_tag LOCUS_16330 gene nusB 3103 2612 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QT9 protein_id gnl|my_center|LOCUS_16330 3565 3116 gene locus_tag LOCUS_16340 gene ribH 3565 3116 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG70 protein_id gnl|my_center|LOCUS_16340 4745 3588 gene locus_tag LOCUS_16350 4745 3588 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_16350 5358 4753 gene locus_tag LOCUS_16360 5358 4753 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389577.1 protein_id gnl|my_center|LOCUS_16360 5713 5480 gene locus_tag LOCUS_16370 5713 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 6682 5804 gene locus_tag LOCUS_16380 6682 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 7782 6652 gene locus_tag LOCUS_16390 7782 6652 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTC0 protein_id gnl|my_center|LOCUS_16390 8259 7792 gene locus_tag LOCUS_16400 gene nrdR 8259 7792 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTB9 protein_id gnl|my_center|LOCUS_16400 9648 8338 gene locus_tag LOCUS_16410 gene glyA 9648 8338 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZN2 protein_id gnl|my_center|LOCUS_16410 10201 9731 gene locus_tag LOCUS_16420 10201 9731 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389581.1 protein_id gnl|my_center|LOCUS_16420 11064 10483 gene locus_tag LOCUS_16430 11064 10483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 11602 12060 gene locus_tag LOCUS_16440 11602 12060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 12382 12086 gene locus_tag LOCUS_16450 12382 12086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 12538 13728 gene locus_tag LOCUS_16460 12538 13728 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705166.1 protein_id gnl|my_center|LOCUS_16460 13960 13721 gene locus_tag LOCUS_16470 13960 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 13857 14693 gene locus_tag LOCUS_16480 13857 14693 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087048.1 protein_id gnl|my_center|LOCUS_16480 14808 15410 gene locus_tag LOCUS_16490 14808 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 15502 16332 gene locus_tag LOCUS_16500 15502 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 17343 16387 gene locus_tag LOCUS_16510 17343 16387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 19021 17447 gene locus_tag LOCUS_16520 gene prfC 19021 17447 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRE8 protein_id gnl|my_center|LOCUS_16520 19133 20050 gene locus_tag LOCUS_16530 19133 20050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390587.1 protein_id gnl|my_center|LOCUS_16530 20106 21119 gene locus_tag LOCUS_16540 gene lhpD 20106 21119 CDS product delta(1)-pyrroline-2-carboxylate/Delta(1)-piperideine-2-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I492 protein_id gnl|my_center|LOCUS_16540 >Feature sequence058 311 748 gene locus_tag LOCUS_16550 311 748 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086163.1 protein_id gnl|my_center|LOCUS_16550 753 2228 gene locus_tag LOCUS_16560 753 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2234 3100 gene locus_tag LOCUS_16570 2234 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_16570 3127 3879 gene locus_tag LOCUS_16580 3127 3879 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015088.1 protein_id gnl|my_center|LOCUS_16580 3910 5253 gene locus_tag LOCUS_16590 3910 5253 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926605.1 protein_id gnl|my_center|LOCUS_16590 5607 5257 gene locus_tag LOCUS_16600 5607 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974541.1 protein_id gnl|my_center|LOCUS_16600 6734 5628 gene locus_tag LOCUS_16610 6734 5628 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339415.1 protein_id gnl|my_center|LOCUS_16610 7753 6731 gene locus_tag LOCUS_16620 7753 6731 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 protein_id gnl|my_center|LOCUS_16620 8715 7786 gene locus_tag LOCUS_16630 8715 7786 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 protein_id gnl|my_center|LOCUS_16630 10076 8715 gene locus_tag LOCUS_16640 10076 8715 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 protein_id gnl|my_center|LOCUS_16640 11181 10090 gene locus_tag LOCUS_16650 11181 10090 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UA71 protein_id gnl|my_center|LOCUS_16650 12403 11249 gene locus_tag LOCUS_16660 12403 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 13307 12516 gene locus_tag LOCUS_16670 13307 12516 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530807.1 protein_id gnl|my_center|LOCUS_16670 14195 13320 gene locus_tag LOCUS_16680 gene potB 14195 13320 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715491.1 protein_id gnl|my_center|LOCUS_16680 14324 15295 gene locus_tag LOCUS_16690 14324 15295 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 protein_id gnl|my_center|LOCUS_16690 15306 16130 gene locus_tag LOCUS_16700 15306 16130 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887728.1 protein_id gnl|my_center|LOCUS_16700 17848 16190 gene locus_tag LOCUS_16710 17848 16190 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974601.1 protein_id gnl|my_center|LOCUS_16710 18914 17853 gene locus_tag LOCUS_16720 18914 17853 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974600.1 protein_id gnl|my_center|LOCUS_16720 19880 18924 gene locus_tag LOCUS_16730 19880 18924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 protein_id gnl|my_center|LOCUS_16730 <21075 20086 gene locus_tag LOCUS_16740 <21075 20086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974597.1:peptide ABC transporter substrate-binding protein >Feature sequence059 1031 1696 gene locus_tag LOCUS_16750 1031 1696 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388973.1 protein_id gnl|my_center|LOCUS_16750 1787 2026 gene locus_tag LOCUS_16760 gene pspB 1787 2026 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388972.1 protein_id gnl|my_center|LOCUS_16760 2110 2598 gene locus_tag LOCUS_16770 gene pspC 2110 2598 CDS product phage-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071930.1 protein_id gnl|my_center|LOCUS_16770 3035 2646 gene locus_tag LOCUS_16780 3035 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3396 4247 gene locus_tag LOCUS_16790 3396 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 4273 6576 gene locus_tag LOCUS_16800 4273 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6677 8230 gene locus_tag LOCUS_16810 6677 8230 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD0 protein_id gnl|my_center|LOCUS_16810 8459 8235 gene locus_tag LOCUS_16820 8459 8235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 9254 8535 gene locus_tag LOCUS_16830 9254 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708718.1 protein_id gnl|my_center|LOCUS_16830 10499 9318 gene locus_tag LOCUS_16840 10499 9318 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114005.1 protein_id gnl|my_center|LOCUS_16840 11236 10496 gene locus_tag LOCUS_16850 11236 10496 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969311.1 protein_id gnl|my_center|LOCUS_16850 11338 11976 gene locus_tag LOCUS_16860 11338 11976 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531693.1 protein_id gnl|my_center|LOCUS_16860 12048 13175 gene locus_tag LOCUS_16870 gene alr 12048 13175 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD1 protein_id gnl|my_center|LOCUS_16870 13172 13945 gene locus_tag LOCUS_16880 13172 13945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_16880 13942 14730 gene locus_tag LOCUS_16890 13942 14730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_16890 14919 15368 gene locus_tag LOCUS_16900 14919 15368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528909.1 protein_id gnl|my_center|LOCUS_16900 16204 15437 gene locus_tag LOCUS_16910 16204 15437 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388807.1 protein_id gnl|my_center|LOCUS_16910 16426 17847 gene locus_tag LOCUS_16920 gene radA 16426 17847 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD4 protein_id gnl|my_center|LOCUS_16920 17931 18596 gene locus_tag LOCUS_16930 17931 18596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 18609 20099 gene locus_tag LOCUS_16940 gene purF 18609 20099 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXD6 protein_id gnl|my_center|LOCUS_16940 20108 20782 gene locus_tag LOCUS_16950 20108 20782 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919529.1 protein_id gnl|my_center|LOCUS_16950 20998 20792 gene locus_tag LOCUS_16960 20998 20792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence060 3548 2028 gene locus_tag LOCUS_16970 3548 2028 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339612.1 protein_id gnl|my_center|LOCUS_16970 3754 3548 gene locus_tag LOCUS_16980 3754 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 5748 3754 gene locus_tag LOCUS_16990 5748 3754 CDS product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_16990 6265 5696 gene locus_tag LOCUS_17000 6265 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 6366 6746 gene locus_tag LOCUS_17010 6366 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 6841 7425 gene locus_tag LOCUS_17020 6841 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 7702 7478 gene locus_tag LOCUS_17030 7702 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 9012 7699 gene locus_tag LOCUS_17040 9012 7699 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A0P6 protein_id gnl|my_center|LOCUS_17040 9833 9369 gene locus_tag LOCUS_17050 9833 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 10453 9830 gene locus_tag LOCUS_17060 10453 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063611.1 protein_id gnl|my_center|LOCUS_17060 12828 10459 gene locus_tag LOCUS_17070 12828 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 13562 12816 gene locus_tag LOCUS_17080 13562 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 13768 13562 gene locus_tag LOCUS_17090 13768 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 14001 15200 gene locus_tag LOCUS_17100 14001 15200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 15166 16272 gene locus_tag LOCUS_17110 15166 16272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 16433 17047 gene locus_tag LOCUS_17120 16433 17047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 17201 17491 gene locus_tag LOCUS_17130 17201 17491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 17488 18387 gene locus_tag LOCUS_17140 17488 18387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 18392 19027 gene locus_tag LOCUS_17150 18392 19027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 19111 20721 gene locus_tag LOCUS_17160 19111 20721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence061 563 12 gene locus_tag LOCUS_17170 563 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1743 598 gene locus_tag LOCUS_17180 1743 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2142 2798 gene locus_tag LOCUS_17190 2142 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 3889 2864 gene locus_tag LOCUS_17200 3889 2864 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_17200 4809 4081 gene locus_tag LOCUS_17210 4809 4081 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_17210 4897 5796 gene locus_tag LOCUS_17220 gene yidZ 4897 5796 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260920.1 protein_id gnl|my_center|LOCUS_17220 6606 5803 gene locus_tag LOCUS_17230 6606 5803 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529916.1 protein_id gnl|my_center|LOCUS_17230 7339 6596 gene locus_tag LOCUS_17240 7339 6596 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531138.1 protein_id gnl|my_center|LOCUS_17240 8079 7336 gene locus_tag LOCUS_17250 8079 7336 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225729.1 protein_id gnl|my_center|LOCUS_17250 9692 8106 gene locus_tag LOCUS_17260 9692 8106 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939525.1 protein_id gnl|my_center|LOCUS_17260 10918 9704 gene locus_tag LOCUS_17270 10918 9704 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_17270 11691 10915 gene locus_tag LOCUS_17280 11691 10915 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228886.1 protein_id gnl|my_center|LOCUS_17280 12881 11688 gene locus_tag LOCUS_17290 12881 11688 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701081.1 protein_id gnl|my_center|LOCUS_17290 13954 12878 gene locus_tag LOCUS_17300 13954 12878 CDS product putative aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701080.1 protein_id gnl|my_center|LOCUS_17300 14788 14162 gene locus_tag LOCUS_17310 14788 14162 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531049.1 protein_id gnl|my_center|LOCUS_17310 15880 14912 gene locus_tag LOCUS_17320 gene dhaA 15880 14912 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T767 protein_id gnl|my_center|LOCUS_17320 18470 16329 gene locus_tag LOCUS_17330 18470 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 19575 18889 gene locus_tag LOCUS_17340 19575 18889 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705438.1 protein_id gnl|my_center|LOCUS_17340 19682 20272 gene locus_tag LOCUS_17350 19682 20272 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064378.1 protein_id gnl|my_center|LOCUS_17350 20460 20384 gene locus_tag LOCUS_t00190 20460 20384 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence062 108 1436 gene locus_tag LOCUS_17360 108 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 1437 2486 gene locus_tag LOCUS_17370 1437 2486 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390688.1 protein_id gnl|my_center|LOCUS_17370 2490 4259 gene locus_tag LOCUS_17380 2490 4259 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_17380 4256 5296 gene locus_tag LOCUS_17390 gene pyrC 4256 5296 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MF80 protein_id gnl|my_center|LOCUS_17390 6148 5303 gene locus_tag LOCUS_17400 6148 5303 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707305.1 protein_id gnl|my_center|LOCUS_17400 6829 6203 gene locus_tag LOCUS_17410 6829 6203 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706748.1 protein_id gnl|my_center|LOCUS_17410 7126 7545 gene locus_tag LOCUS_17420 7126 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 7542 7934 gene locus_tag LOCUS_17430 7542 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 8061 8270 gene locus_tag LOCUS_17440 8061 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 8273 9904 gene locus_tag LOCUS_17450 8273 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939873.1 protein_id gnl|my_center|LOCUS_17450 9897 10160 gene locus_tag LOCUS_17460 9897 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 10175 10900 gene locus_tag LOCUS_17470 10175 10900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 10937 11254 gene locus_tag LOCUS_17480 10937 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 11476 13308 gene locus_tag LOCUS_17490 gene wbmC 11476 13308 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064738.1 protein_id gnl|my_center|LOCUS_17490 13335 14381 gene locus_tag LOCUS_17500 13335 14381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 14811 14305 gene locus_tag LOCUS_17510 14811 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 14944 15747 gene locus_tag LOCUS_17520 14944 15747 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532623.1 protein_id gnl|my_center|LOCUS_17520 16080 15757 gene locus_tag LOCUS_17530 16080 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224148.1 protein_id gnl|my_center|LOCUS_17530 16659 16168 gene locus_tag LOCUS_17540 16659 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 17093 16758 gene locus_tag LOCUS_17550 17093 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387980.1 protein_id gnl|my_center|LOCUS_17550 18265 17096 gene locus_tag LOCUS_17560 18265 17096 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_17560 18437 19849 gene locus_tag LOCUS_17570 18437 19849 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389423.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence063 1558 482 gene locus_tag LOCUS_17580 gene flhB 1558 482 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390448.1 protein_id gnl|my_center|LOCUS_17580 2338 1577 gene locus_tag LOCUS_17590 gene fliR 2338 1577 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I29 protein_id gnl|my_center|LOCUS_17590 2633 2367 gene locus_tag LOCUS_17600 2633 2367 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390450.1 protein_id gnl|my_center|LOCUS_17600 3037 2717 gene locus_tag LOCUS_17610 gene fliE1 3037 2717 CDS product flagellar hook-basal body complex protein FliE 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I27 protein_id gnl|my_center|LOCUS_17610 3561 3151 gene locus_tag LOCUS_17620 3561 3151 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U635 protein_id gnl|my_center|LOCUS_17620 4002 3589 gene locus_tag LOCUS_17630 4002 3589 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH2 protein_id gnl|my_center|LOCUS_17630 4393 4746 gene locus_tag LOCUS_17640 4393 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390454.1 protein_id gnl|my_center|LOCUS_17640 4817 5203 gene locus_tag LOCUS_17650 4817 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 5200 5964 gene locus_tag LOCUS_17660 gene fliP 5200 5964 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQG8 protein_id gnl|my_center|LOCUS_17660 9538 5972 gene locus_tag LOCUS_17670 9538 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390459.1 protein_id gnl|my_center|LOCUS_17670 10350 9535 gene locus_tag LOCUS_17680 10350 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 11153 10347 gene locus_tag LOCUS_17690 11153 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 11374 11994 gene locus_tag LOCUS_17700 11374 11994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390583.1 protein_id gnl|my_center|LOCUS_17700 12020 13705 gene locus_tag LOCUS_17710 12020 13705 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389831.1 protein_id gnl|my_center|LOCUS_17710 14210 13710 gene locus_tag LOCUS_17720 14210 13710 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974971.1 protein_id gnl|my_center|LOCUS_17720 14645 14259 gene locus_tag LOCUS_17730 14645 14259 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 protein_id gnl|my_center|LOCUS_17730 15489 14836 gene locus_tag LOCUS_17740 15489 14836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 16033 15500 gene locus_tag LOCUS_17750 16033 15500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 17180 16128 gene locus_tag LOCUS_17760 17180 16128 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF8 protein_id gnl|my_center|LOCUS_17760 17827 17315 gene locus_tag LOCUS_17770 17827 17315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 18104 18835 gene locus_tag LOCUS_17780 gene flgF 18104 18835 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I12 protein_id gnl|my_center|LOCUS_17780 >Feature sequence064 1205 165 gene locus_tag LOCUS_17790 1205 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929892.1 protein_id gnl|my_center|LOCUS_17790 2048 1227 gene locus_tag LOCUS_17800 2048 1227 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807374.1 protein_id gnl|my_center|LOCUS_17800 2818 2066 gene locus_tag LOCUS_17810 gene maiA 2818 2066 CDS product maleate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TTH1 protein_id gnl|my_center|LOCUS_17810 3787 2834 gene locus_tag LOCUS_17820 3787 2834 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807348.1 protein_id gnl|my_center|LOCUS_17820 4190 5407 gene locus_tag LOCUS_17830 4190 5407 CDS product cobalamin synthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538090.1 protein_id gnl|my_center|LOCUS_17830 5404 6066 gene locus_tag LOCUS_17840 5404 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 6668 6117 gene locus_tag LOCUS_17850 6668 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 9683 6687 gene locus_tag LOCUS_17860 9683 6687 CDS product NHLP family bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_17860 11882 9690 gene locus_tag LOCUS_17870 11882 9690 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_17870 13163 11886 gene locus_tag LOCUS_17880 13163 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 13419 14471 gene locus_tag LOCUS_17890 13419 14471 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085512.1 protein_id gnl|my_center|LOCUS_17890 14525 14875 gene locus_tag LOCUS_17900 14525 14875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 15098 15364 gene locus_tag LOCUS_17910 15098 15364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 15541 15822 gene locus_tag LOCUS_17920 15541 15822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 15918 15712 gene locus_tag LOCUS_17930 15918 15712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 15933 16202 gene locus_tag LOCUS_17940 15933 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 17166 16249 gene locus_tag LOCUS_17950 17166 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 17398 17159 gene locus_tag LOCUS_17960 17398 17159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 <19498 17386 gene locus_tag LOCUS_17970 <19498 17386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027334.1:NHLP family bacteriocin export ABC transporter permease/ATPase subunit >Feature sequence065 2399 1611 gene locus_tag LOCUS_17980 2399 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_17980 2720 3361 gene locus_tag LOCUS_17990 2720 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 3391 5232 gene locus_tag LOCUS_18000 3391 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 5682 5248 gene locus_tag LOCUS_18010 5682 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 6483 5707 gene locus_tag LOCUS_18020 6483 5707 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390265.1 protein_id gnl|my_center|LOCUS_18020 7378 6476 gene locus_tag LOCUS_18030 7378 6476 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_18030 8060 7464 gene locus_tag LOCUS_18040 gene pdxH 8060 7464 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR21 protein_id gnl|my_center|LOCUS_18040 8249 8752 gene locus_tag LOCUS_18050 gene omp 8249 8752 CDS product 17 kDa surface antigen inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16624 protein_id gnl|my_center|LOCUS_18050 8846 9757 gene locus_tag LOCUS_18060 8846 9757 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970033.1 protein_id gnl|my_center|LOCUS_18060 11058 9754 gene locus_tag LOCUS_18070 11058 9754 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I507 protein_id gnl|my_center|LOCUS_18070 11331 12173 gene locus_tag LOCUS_18080 11331 12173 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR24 protein_id gnl|my_center|LOCUS_18080 12173 13255 gene locus_tag LOCUS_18090 gene aroC 12173 13255 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RY1 protein_id gnl|my_center|LOCUS_18090 14188 13262 gene locus_tag LOCUS_18100 14188 13262 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331304.1 protein_id gnl|my_center|LOCUS_18100 14295 15161 gene locus_tag LOCUS_18110 gene tauD 14295 15161 CDS product alpha-ketoglutarate-dependent taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37610 protein_id gnl|my_center|LOCUS_18110 15245 15829 gene locus_tag LOCUS_18120 15245 15829 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL02 protein_id gnl|my_center|LOCUS_18120 15819 17153 gene locus_tag LOCUS_18130 15819 17153 CDS product tetratricopeptide repeat protein 38 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038934.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence066 1290 130 gene locus_tag LOCUS_18140 1290 130 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 protein_id gnl|my_center|LOCUS_18140 2377 1394 gene locus_tag LOCUS_18150 2377 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3229 2444 gene locus_tag LOCUS_18160 gene proC1 3229 2444 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709521.1 protein_id gnl|my_center|LOCUS_18160 5010 3226 gene locus_tag LOCUS_18170 5010 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 5839 5015 gene locus_tag LOCUS_18180 5839 5015 CDS product syringomycin biosynthesis enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_18180 5952 6632 gene locus_tag LOCUS_18190 5952 6632 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089549.1 protein_id gnl|my_center|LOCUS_18190 6747 7343 gene locus_tag LOCUS_18200 6747 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 7546 7920 gene locus_tag LOCUS_18210 7546 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 8523 8074 gene locus_tag LOCUS_18220 8523 8074 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975990.1 protein_id gnl|my_center|LOCUS_18220 9032 8553 gene locus_tag LOCUS_18230 9032 8553 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W2F3 protein_id gnl|my_center|LOCUS_18230 9221 9718 gene locus_tag LOCUS_18240 9221 9718 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555947.1 protein_id gnl|my_center|LOCUS_18240 10828 9731 gene locus_tag LOCUS_18250 10828 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 11348 10920 gene locus_tag LOCUS_18260 11348 10920 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067708.1 protein_id gnl|my_center|LOCUS_18260 11918 11454 gene locus_tag LOCUS_18270 11918 11454 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067709.1 protein_id gnl|my_center|LOCUS_18270 12244 11915 gene locus_tag LOCUS_18280 12244 11915 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067710.1 protein_id gnl|my_center|LOCUS_18280 12389 13267 gene locus_tag LOCUS_18290 12389 13267 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943414.1 protein_id gnl|my_center|LOCUS_18290 14247 13465 gene locus_tag LOCUS_18300 14247 13465 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022136.1 protein_id gnl|my_center|LOCUS_18300 15293 14244 gene locus_tag LOCUS_18310 15293 14244 CDS product iron-siderophore ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215451.1 protein_id gnl|my_center|LOCUS_18310 16422 15286 gene locus_tag LOCUS_18320 16422 15286 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 protein_id gnl|my_center|LOCUS_18320 18680 16425 gene locus_tag LOCUS_18330 18680 16425 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339007.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence067 1799 573 gene locus_tag LOCUS_18340 1799 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 2844 1801 gene locus_tag LOCUS_18350 2844 1801 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707285.1 protein_id gnl|my_center|LOCUS_18350 2952 3527 gene locus_tag LOCUS_18360 2952 3527 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391119.1 protein_id gnl|my_center|LOCUS_18360 3701 4408 gene locus_tag LOCUS_18370 3701 4408 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391169.1 protein_id gnl|my_center|LOCUS_18370 4426 6165 gene locus_tag LOCUS_18380 4426 6165 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391170.1 protein_id gnl|my_center|LOCUS_18380 7071 6349 gene locus_tag LOCUS_18390 7071 6349 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_18390 7867 7262 gene locus_tag LOCUS_18400 7867 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 7912 8112 gene locus_tag LOCUS_18410 7912 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 8365 9927 gene locus_tag LOCUS_18420 8365 9927 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114996.1 protein_id gnl|my_center|LOCUS_18420 10005 10730 gene locus_tag LOCUS_18430 10005 10730 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550326.1 protein_id gnl|my_center|LOCUS_18430 10720 11040 gene locus_tag LOCUS_18440 10720 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 11718 11044 gene locus_tag LOCUS_18450 11718 11044 CDS product thiocyanate hydrolase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731167.1 protein_id gnl|my_center|LOCUS_18450 11996 11715 gene locus_tag LOCUS_18460 11996 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 12351 12001 gene locus_tag LOCUS_18470 12351 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 12682 12356 gene locus_tag LOCUS_18480 12682 12356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 12855 14045 gene locus_tag LOCUS_18490 12855 14045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 14857 14054 gene locus_tag LOCUS_18500 14857 14054 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222580.1 protein_id gnl|my_center|LOCUS_18500 14936 15625 gene locus_tag LOCUS_18510 14936 15625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 15740 17059 gene locus_tag LOCUS_18520 15740 17059 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528073.1 protein_id gnl|my_center|LOCUS_18520 17097 17651 gene locus_tag LOCUS_18530 gene regA 17097 17651 CDS product photosynthetic apparatus regulatory protein RegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53228 protein_id gnl|my_center|LOCUS_18530 17821 18999 gene locus_tag LOCUS_18540 17821 18999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence068 274 1599 gene locus_tag LOCUS_18550 274 1599 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT66 protein_id gnl|my_center|LOCUS_18550 1623 3035 gene locus_tag LOCUS_18560 1623 3035 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT67 protein_id gnl|my_center|LOCUS_18560 3176 3442 gene locus_tag LOCUS_18570 3176 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3540 4502 gene locus_tag LOCUS_18580 gene lipA 3540 4502 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7I8 protein_id gnl|my_center|LOCUS_18580 4575 5024 gene locus_tag LOCUS_18590 4575 5024 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389629.1 protein_id gnl|my_center|LOCUS_18590 5226 5966 gene locus_tag LOCUS_18600 5226 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 6432 5938 gene locus_tag LOCUS_18610 6432 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 6899 6432 gene locus_tag LOCUS_18620 6899 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 7948 6896 gene locus_tag LOCUS_18630 gene ispDF 7948 6896 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNE2 protein_id gnl|my_center|LOCUS_18630 8164 8958 gene locus_tag LOCUS_18640 8164 8958 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389365.1 protein_id gnl|my_center|LOCUS_18640 9056 10081 gene locus_tag LOCUS_18650 gene dus 9056 10081 CDS product putative tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED2 protein_id gnl|my_center|LOCUS_18650 10081 11223 gene locus_tag LOCUS_18660 gene ntrB 10081 11223 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_18660 11226 12683 gene locus_tag LOCUS_18670 11226 12683 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389368.1 protein_id gnl|my_center|LOCUS_18670 12765 15047 gene locus_tag LOCUS_18680 12765 15047 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389369.1 protein_id gnl|my_center|LOCUS_18680 15049 16455 gene locus_tag LOCUS_18690 15049 16455 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389370.1 protein_id gnl|my_center|LOCUS_18690 16490 17866 gene locus_tag LOCUS_18700 gene trkA 16490 17866 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_18700 17871 18545 gene locus_tag LOCUS_18710 17871 18545 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389373.1 protein_id gnl|my_center|LOCUS_18710 18695 18949 gene locus_tag LOCUS_18720 gene hfq 18695 18949 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LQ2 protein_id gnl|my_center|LOCUS_18720 >Feature sequence069 99 881 gene locus_tag LOCUS_18730 99 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 878 1315 gene locus_tag LOCUS_18740 878 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1329 2057 gene locus_tag LOCUS_18750 gene fabG 1329 2057 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 protein_id gnl|my_center|LOCUS_18750 2163 2924 gene locus_tag LOCUS_18760 2163 2924 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957975.1 protein_id gnl|my_center|LOCUS_18760 3018 3404 gene locus_tag LOCUS_18770 3018 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4461 3478 gene locus_tag LOCUS_18780 4461 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 4628 5491 gene locus_tag LOCUS_18790 gene tfdA 4628 5491 CDS product alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084309.1 protein_id gnl|my_center|LOCUS_18790 6523 5504 gene locus_tag LOCUS_18800 gene adhP 6523 5504 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_18800 6619 8211 gene locus_tag LOCUS_18810 6619 8211 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918829.1 protein_id gnl|my_center|LOCUS_18810 8208 8684 gene locus_tag LOCUS_18820 8208 8684 CDS product cys-tRNA(pro)/cys-tRNA(cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929250.1 protein_id gnl|my_center|LOCUS_18820 10810 8681 gene locus_tag LOCUS_18830 10810 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 11530 10841 gene locus_tag LOCUS_18840 11530 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 11654 11917 gene locus_tag LOCUS_18850 11654 11917 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546253.1 protein_id gnl|my_center|LOCUS_18850 11930 13738 gene locus_tag LOCUS_18860 11930 13738 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259231.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18860 13884 14231 gene locus_tag LOCUS_18870 13884 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 16982 14262 gene locus_tag LOCUS_18880 16982 14262 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338040.1 protein_id gnl|my_center|LOCUS_18880 17262 17005 gene locus_tag LOCUS_18890 17262 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 17663 17271 gene locus_tag LOCUS_18900 17663 17271 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720317.1 protein_id gnl|my_center|LOCUS_18900 <18943 17727 gene locus_tag LOCUS_18910 <18943 17727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976248.1:Cro/Cl family transcriptional regulator >Feature sequence070 2270 1485 gene locus_tag LOCUS_18920 2270 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2427 3116 gene locus_tag LOCUS_18930 2427 3116 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089404.1 protein_id gnl|my_center|LOCUS_18930 3215 4087 gene locus_tag LOCUS_18940 3215 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 4084 4527 gene locus_tag LOCUS_18950 4084 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 4643 4915 gene locus_tag LOCUS_18960 4643 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 6025 5117 gene locus_tag LOCUS_18970 6025 5117 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530746.1 protein_id gnl|my_center|LOCUS_18970 6219 6707 gene locus_tag LOCUS_18980 6219 6707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064747.1 protein_id gnl|my_center|LOCUS_18980 6716 7690 gene locus_tag LOCUS_18990 6716 7690 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645267.1 protein_id gnl|my_center|LOCUS_18990 8757 7756 gene locus_tag LOCUS_19000 8757 7756 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268751.1 protein_id gnl|my_center|LOCUS_19000 9023 10351 gene locus_tag LOCUS_19010 9023 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067615.1 protein_id gnl|my_center|LOCUS_19010 10374 11273 gene locus_tag LOCUS_19020 10374 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764781.1 protein_id gnl|my_center|LOCUS_19020 11292 12494 gene locus_tag LOCUS_19030 11292 12494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764787.1 protein_id gnl|my_center|LOCUS_19030 12566 13645 gene locus_tag LOCUS_19040 12566 13645 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887518.1 protein_id gnl|my_center|LOCUS_19040 13721 14644 gene locus_tag LOCUS_19050 13721 14644 CDS product spermidine/putrescine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532864.1 protein_id gnl|my_center|LOCUS_19050 14637 15452 gene locus_tag LOCUS_19060 14637 15452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 15465 16544 gene locus_tag LOCUS_19070 15465 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 16555 17250 gene locus_tag LOCUS_19080 16555 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815631.1 protein_id gnl|my_center|LOCUS_19080 18094 17390 gene locus_tag LOCUS_19090 18094 17390 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969539.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence071 860 402 gene locus_tag LOCUS_19100 gene mucS 860 402 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 protein_id gnl|my_center|LOCUS_19100 1891 1013 gene locus_tag LOCUS_19110 1891 1013 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N85 protein_id gnl|my_center|LOCUS_19110 3004 1931 gene locus_tag LOCUS_19120 3004 1931 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_19120 3199 3861 gene locus_tag LOCUS_19130 gene gst 3199 3861 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 protein_id gnl|my_center|LOCUS_19130 3881 4852 gene locus_tag LOCUS_19140 3881 4852 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529403.1 protein_id gnl|my_center|LOCUS_19140 5339 4863 gene locus_tag LOCUS_19150 5339 4863 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930295.1 protein_id gnl|my_center|LOCUS_19150 6573 5350 gene locus_tag LOCUS_19160 6573 5350 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI4 protein_id gnl|my_center|LOCUS_19160 7281 6751 gene locus_tag LOCUS_19170 7281 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387973.1 protein_id gnl|my_center|LOCUS_19170 7973 7380 gene locus_tag LOCUS_19180 7973 7380 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI3 protein_id gnl|my_center|LOCUS_19180 8197 9462 gene locus_tag LOCUS_19190 8197 9462 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 protein_id gnl|my_center|LOCUS_19190 9578 10282 gene locus_tag LOCUS_19200 gene psd 9578 10282 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZY9 protein_id gnl|my_center|LOCUS_19200 10310 11182 gene locus_tag LOCUS_19210 10310 11182 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_19210 11458 11195 gene locus_tag LOCUS_19220 11458 11195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 12706 11531 gene locus_tag LOCUS_19230 12706 11531 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529103.1 protein_id gnl|my_center|LOCUS_19230 12984 14090 gene locus_tag LOCUS_19240 12984 14090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391111.1 protein_id gnl|my_center|LOCUS_19240 14483 14130 gene locus_tag LOCUS_19250 14483 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 16497 14569 gene locus_tag LOCUS_19260 16497 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 17612 16710 gene locus_tag LOCUS_19270 17612 16710 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence072 361 867 gene locus_tag LOCUS_19280 361 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 993 1412 gene locus_tag LOCUS_19290 993 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 1485 4754 gene locus_tag LOCUS_19300 1485 4754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2744 2649 gene locus_tag LOCUS_t00200 2744 2649 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4767 5690 gene locus_tag LOCUS_19310 gene cas1 4767 5690 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_19310 5687 6025 gene locus_tag LOCUS_19320 5687 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 6098 6330 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agagtagcagctcagaaatcgcggtccagcggcaac 6640 6413 gene locus_tag LOCUS_19330 6640 6413 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266521.1 protein_id gnl|my_center|LOCUS_19330 6721 7659 gene locus_tag LOCUS_19340 6721 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 7907 9250 gene locus_tag LOCUS_19350 7907 9250 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q832V4 protein_id gnl|my_center|LOCUS_19350 9237 9746 gene locus_tag LOCUS_19360 9237 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 9658 10089 gene locus_tag LOCUS_19370 9658 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 10258 10755 gene locus_tag LOCUS_19380 10258 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 10758 11210 gene locus_tag LOCUS_19390 10758 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_19390 11207 12814 gene locus_tag LOCUS_19400 11207 12814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 13088 13013 gene locus_tag LOCUS_t00210 13088 13013 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14365 13211 gene locus_tag LOCUS_19410 gene rodA 14365 13211 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_19410 16341 14365 gene locus_tag LOCUS_19420 16341 14365 CDS product peptidoglycan glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_19420 16827 16357 gene locus_tag LOCUS_19430 16827 16357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 17674 16934 gene locus_tag LOCUS_19440 17674 16934 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX69 protein_id gnl|my_center|LOCUS_19440 >Feature sequence073 566 1231 gene locus_tag LOCUS_19450 566 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1935 1270 gene locus_tag LOCUS_19460 1935 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389778.1 protein_id gnl|my_center|LOCUS_19460 2921 1953 gene locus_tag LOCUS_19470 2921 1953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389332.1 protein_id gnl|my_center|LOCUS_19470 3705 2953 gene locus_tag LOCUS_19480 3705 2953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389333.1 protein_id gnl|my_center|LOCUS_19480 4469 3702 gene locus_tag LOCUS_19490 4469 3702 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705473.1 protein_id gnl|my_center|LOCUS_19490 5577 4477 gene locus_tag LOCUS_19500 5577 4477 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_19500 6395 5574 gene locus_tag LOCUS_19510 gene thiD 6395 5574 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 protein_id gnl|my_center|LOCUS_19510 7066 6392 gene locus_tag LOCUS_19520 gene thiE 7066 6392 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UAS8 protein_id gnl|my_center|LOCUS_19520 7836 7063 gene locus_tag LOCUS_19530 gene thiM 7836 7063 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NPM9 protein_id gnl|my_center|LOCUS_19530 10682 8079 gene locus_tag LOCUS_19540 10682 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 10815 10994 gene locus_tag LOCUS_19550 10815 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 11250 10999 gene locus_tag LOCUS_19560 11250 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 11583 12650 gene locus_tag LOCUS_19570 11583 12650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 12709 13488 gene locus_tag LOCUS_19580 12709 13488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103250.1 protein_id gnl|my_center|LOCUS_19580 13807 13469 gene locus_tag LOCUS_19590 13807 13469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 13724 14128 gene locus_tag LOCUS_19600 13724 14128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 14125 15792 gene locus_tag LOCUS_19610 14125 15792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142002.1 protein_id gnl|my_center|LOCUS_19610 15864 16637 gene locus_tag LOCUS_19620 15864 16637 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968523.1 protein_id gnl|my_center|LOCUS_19620 16961 16671 gene locus_tag LOCUS_19630 16961 16671 CDS product Usg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535108.1 protein_id gnl|my_center|LOCUS_19630 17284 17598 gene locus_tag LOCUS_19640 gene groS5 17284 17598 CDS product 10 kDa chaperonin 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35474 protein_id gnl|my_center|LOCUS_19640 >Feature sequence074 434 808 gene locus_tag LOCUS_19650 434 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1322 3322 gene locus_tag LOCUS_19660 gene uvrC 1322 3322 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DG9 protein_id gnl|my_center|LOCUS_19660 3345 3734 gene locus_tag LOCUS_19670 3345 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 4196 3735 gene locus_tag LOCUS_19680 4196 3735 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389879.1 protein_id gnl|my_center|LOCUS_19680 4413 5408 gene locus_tag LOCUS_19690 4413 5408 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389878.1 protein_id gnl|my_center|LOCUS_19690 5506 6237 gene locus_tag LOCUS_19700 5506 6237 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918357.1 protein_id gnl|my_center|LOCUS_19700 6242 6694 gene locus_tag LOCUS_19710 6242 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 7453 6605 gene locus_tag LOCUS_19720 7453 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 8937 7450 gene locus_tag LOCUS_19730 8937 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918098.1 protein_id gnl|my_center|LOCUS_19730 9078 9767 gene locus_tag LOCUS_19740 9078 9767 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389880.1 protein_id gnl|my_center|LOCUS_19740 9764 11116 gene locus_tag LOCUS_19750 9764 11116 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389881.1 protein_id gnl|my_center|LOCUS_19750 12097 11132 gene locus_tag LOCUS_19760 12097 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 12240 14027 gene locus_tag LOCUS_19770 12240 14027 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR27 protein_id gnl|my_center|LOCUS_19770 14205 14038 gene locus_tag LOCUS_19780 14205 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 14826 14215 gene locus_tag LOCUS_19790 14826 14215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 15250 14912 gene locus_tag LOCUS_19800 15250 14912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 16053 15247 gene locus_tag LOCUS_19810 16053 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 16685 16098 gene locus_tag LOCUS_19820 16685 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 <17838 16825 gene locus_tag LOCUS_19830 <17838 16825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RV30:dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex >Feature sequence075 1891 1226 gene locus_tag LOCUS_19840 gene pyrE 1891 1226 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PY1 protein_id gnl|my_center|LOCUS_19840 3139 1928 gene locus_tag LOCUS_19850 3139 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 4000 3281 gene locus_tag LOCUS_19860 4000 3281 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531778.1 protein_id gnl|my_center|LOCUS_19860 4725 3997 gene locus_tag LOCUS_19870 4725 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087917.1 protein_id gnl|my_center|LOCUS_19870 5555 4770 gene locus_tag LOCUS_19880 5555 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 6515 5610 gene locus_tag LOCUS_19890 6515 5610 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389967.1 protein_id gnl|my_center|LOCUS_19890 6956 7453 gene locus_tag LOCUS_19900 6956 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 7543 8319 gene locus_tag LOCUS_19910 7543 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707284.1 protein_id gnl|my_center|LOCUS_19910 8429 9166 gene locus_tag LOCUS_19920 8429 9166 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_19920 9163 10044 gene locus_tag LOCUS_19930 9163 10044 CDS product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526255.1 protein_id gnl|my_center|LOCUS_19930 10044 10724 gene locus_tag LOCUS_19940 10044 10724 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388715.1 protein_id gnl|my_center|LOCUS_19940 10754 11353 gene locus_tag LOCUS_19950 10754 11353 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_19950 11719 11363 gene locus_tag LOCUS_19960 11719 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 12131 11712 gene locus_tag LOCUS_19970 12131 11712 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073406.1 protein_id gnl|my_center|LOCUS_19970 12241 13164 gene locus_tag LOCUS_19980 12241 13164 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_19980 14087 13161 gene locus_tag LOCUS_19990 14087 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706641.1 protein_id gnl|my_center|LOCUS_19990 14319 15365 gene locus_tag LOCUS_20000 gene ldh 14319 15365 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_20000 15590 17011 gene locus_tag LOCUS_20010 15590 17011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403607.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence076 687 1190 gene locus_tag LOCUS_20020 687 1190 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391185.1 protein_id gnl|my_center|LOCUS_20020 1180 2208 gene locus_tag LOCUS_20030 1180 2208 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391184.1 protein_id gnl|my_center|LOCUS_20030 2205 2933 gene locus_tag LOCUS_20040 2205 2933 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391183.1 protein_id gnl|my_center|LOCUS_20040 2986 6027 gene locus_tag LOCUS_20050 2986 6027 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_20050 6024 9530 gene locus_tag LOCUS_20060 6024 9530 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_20060 9653 9973 gene locus_tag LOCUS_20070 gene trxA 9653 9973 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_20070 10579 10145 gene locus_tag LOCUS_20080 gene rbfA 10579 10145 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMR9 protein_id gnl|my_center|LOCUS_20080 13178 10614 gene locus_tag LOCUS_20090 13178 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 13849 13175 gene locus_tag LOCUS_20100 13849 13175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721612.1 protein_id gnl|my_center|LOCUS_20100 15477 13888 gene locus_tag LOCUS_20110 gene nusA 15477 13888 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS2 protein_id gnl|my_center|LOCUS_20110 16056 15535 gene locus_tag LOCUS_20120 gene rimP 16056 15535 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS3 protein_id gnl|my_center|LOCUS_20120 16882 16193 gene locus_tag LOCUS_20130 gene trmB 16882 16193 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMS4 protein_id gnl|my_center|LOCUS_20130 <17680 16943 gene locus_tag LOCUS_20140 <17680 16943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RMS5:S-adenosylmethionine synthase 2 >Feature sequence077 79 921 gene locus_tag LOCUS_20150 79 921 CDS product endopeptidase DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639887.1 protein_id gnl|my_center|LOCUS_20150 1301 1540 gene locus_tag LOCUS_20160 1301 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 1664 2179 gene locus_tag LOCUS_20170 1664 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 2195 3106 gene locus_tag LOCUS_20180 2195 3106 CDS product fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205080.1 protein_id gnl|my_center|LOCUS_20180 3103 4512 gene locus_tag LOCUS_20190 3103 4512 CDS product fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937576.1 protein_id gnl|my_center|LOCUS_20190 4526 5113 gene locus_tag LOCUS_20200 4526 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 5119 6327 gene locus_tag LOCUS_20210 5119 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 6315 7946 gene locus_tag LOCUS_20220 6315 7946 CDS product fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205079.1 protein_id gnl|my_center|LOCUS_20220 7949 8932 gene locus_tag LOCUS_20230 7949 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 8943 9920 gene locus_tag LOCUS_20240 gene ctpI 8943 9920 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310061.1 protein_id gnl|my_center|LOCUS_20240 10731 9925 gene locus_tag LOCUS_20250 10731 9925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 12006 10834 gene locus_tag LOCUS_20260 12006 10834 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5U6 protein_id gnl|my_center|LOCUS_20260 12560 12129 gene locus_tag LOCUS_20270 12560 12129 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921211.1 protein_id gnl|my_center|LOCUS_20270 12727 14739 gene locus_tag LOCUS_20280 12727 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 14996 15715 gene locus_tag LOCUS_20290 14996 15715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 16163 15717 gene locus_tag LOCUS_20300 16163 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence078 601 1725 gene locus_tag LOCUS_20310 601 1725 CDS product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969989.1 protein_id gnl|my_center|LOCUS_20310 3639 1732 gene locus_tag LOCUS_20320 gene cobT 3639 1732 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709223.1 protein_id gnl|my_center|LOCUS_20320 4655 3654 gene locus_tag LOCUS_20330 4655 3654 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387959.1 protein_id gnl|my_center|LOCUS_20330 5279 4707 gene locus_tag LOCUS_20340 5279 4707 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387958.1 protein_id gnl|my_center|LOCUS_20340 5385 5651 gene locus_tag LOCUS_20350 5385 5651 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920847.1 protein_id gnl|my_center|LOCUS_20350 6110 5679 gene locus_tag LOCUS_20360 6110 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 6753 6175 gene locus_tag LOCUS_20370 6753 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391492.1 protein_id gnl|my_center|LOCUS_20370 8055 6766 gene locus_tag LOCUS_20380 8055 6766 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970119.1 protein_id gnl|my_center|LOCUS_20380 9164 8052 gene locus_tag LOCUS_20390 gene aroB 9164 8052 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW0 protein_id gnl|my_center|LOCUS_20390 9721 9161 gene locus_tag LOCUS_20400 gene aroK 9721 9161 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UCL5 protein_id gnl|my_center|LOCUS_20400 9886 10029 gene locus_tag LOCUS_20410 9886 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 10007 11785 gene locus_tag LOCUS_20420 10007 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391486.1 protein_id gnl|my_center|LOCUS_20420 11803 12714 gene locus_tag LOCUS_20430 gene xerC 11803 12714 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMW3 protein_id gnl|my_center|LOCUS_20430 12850 13827 gene locus_tag LOCUS_20440 12850 13827 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387970.1 protein_id gnl|my_center|LOCUS_20440 14265 13834 gene locus_tag LOCUS_20450 14265 13834 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086610.1 protein_id gnl|my_center|LOCUS_20450 15167 14262 gene locus_tag LOCUS_20460 15167 14262 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064772.1 protein_id gnl|my_center|LOCUS_20460 15503 15183 gene locus_tag LOCUS_20470 15503 15183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 15802 15512 gene locus_tag LOCUS_20480 15802 15512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 15846 16580 gene locus_tag LOCUS_20490 15846 16580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 16689 16961 gene locus_tag LOCUS_20500 16689 16961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence079 1609 1220 gene locus_tag LOCUS_20510 1609 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1732 3459 gene locus_tag LOCUS_20520 1732 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 3892 3470 gene locus_tag LOCUS_20530 3892 3470 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_20530 5662 3896 gene locus_tag LOCUS_20540 5662 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 6066 8939 gene locus_tag LOCUS_20550 6066 8939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 9822 8941 gene locus_tag LOCUS_20560 gene aguB 9822 8941 CDS product N-carbamoylputrescine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_20560 10847 9819 gene locus_tag LOCUS_20570 10847 9819 CDS product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112950.1 protein_id gnl|my_center|LOCUS_20570 10930 11775 gene locus_tag LOCUS_20580 gene dorX 10930 11775 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338992.1 protein_id gnl|my_center|LOCUS_20580 11993 13057 gene locus_tag LOCUS_20590 gene potA 11993 13057 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFY4 protein_id gnl|my_center|LOCUS_20590 13057 14007 gene locus_tag LOCUS_20600 13057 14007 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 protein_id gnl|my_center|LOCUS_20600 14000 14842 gene locus_tag LOCUS_20610 14000 14842 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529816.1 protein_id gnl|my_center|LOCUS_20610 14916 15950 gene locus_tag LOCUS_20620 14916 15950 CDS product putrescine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLE5 protein_id gnl|my_center|LOCUS_20620 >Feature sequence080 273 70 gene locus_tag LOCUS_20630 273 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1057 464 gene locus_tag LOCUS_20640 1057 464 CDS product formate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088224.1 protein_id gnl|my_center|LOCUS_20640 3956 1074 gene locus_tag LOCUS_20650 3956 1074 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453899.1 protein_id gnl|my_center|LOCUS_20650 4312 4118 gene locus_tag LOCUS_20660 4312 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 5004 4369 gene locus_tag LOCUS_20670 5004 4369 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970355.1 protein_id gnl|my_center|LOCUS_20670 5868 5185 gene locus_tag LOCUS_20680 5868 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 6450 5872 gene locus_tag LOCUS_20690 6450 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 6667 7374 gene locus_tag LOCUS_20700 6667 7374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970365.1 protein_id gnl|my_center|LOCUS_20700 7374 8105 gene locus_tag LOCUS_20710 7374 8105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_20710 8099 8929 gene locus_tag LOCUS_20720 8099 8929 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_20720 9204 9557 gene locus_tag LOCUS_20730 9204 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 10460 9561 gene locus_tag LOCUS_20740 10460 9561 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706863.1 protein_id gnl|my_center|LOCUS_20740 10573 11316 gene locus_tag LOCUS_20750 10573 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 11319 12341 gene locus_tag LOCUS_20760 11319 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088230.1 protein_id gnl|my_center|LOCUS_20760 12359 12556 gene locus_tag LOCUS_20770 12359 12556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706319.1 protein_id gnl|my_center|LOCUS_20770 12565 12822 gene locus_tag LOCUS_20780 12565 12822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 14862 12835 gene locus_tag LOCUS_20790 14862 12835 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970361.1 protein_id gnl|my_center|LOCUS_20790 15132 14872 gene locus_tag LOCUS_20800 15132 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 16139 15138 gene locus_tag LOCUS_20810 gene moaA 16139 15138 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8Y5 protein_id gnl|my_center|LOCUS_20810 <17139 16303 gene locus_tag LOCUS_20820 <17139 16303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003119305.1:metallo-oxidoreductase >Feature sequence081 872 1564 gene locus_tag LOCUS_20830 872 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 1564 2973 gene locus_tag LOCUS_20840 1564 2973 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 protein_id gnl|my_center|LOCUS_20840 3692 2985 gene locus_tag LOCUS_20850 3692 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3971 3795 gene locus_tag LOCUS_20860 3971 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 4207 4013 gene locus_tag LOCUS_20870 4207 4013 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813568.1 protein_id gnl|my_center|LOCUS_20870 4362 4222 gene locus_tag LOCUS_20880 4362 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 4550 4972 gene locus_tag LOCUS_20890 4550 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 5032 5205 gene locus_tag LOCUS_20900 5032 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 5441 6403 gene locus_tag LOCUS_20910 5441 6403 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391075.1 protein_id gnl|my_center|LOCUS_20910 7773 6478 gene locus_tag LOCUS_20920 7773 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_20920 8419 7907 gene locus_tag LOCUS_20930 8419 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 8787 8425 gene locus_tag LOCUS_20940 8787 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 9230 8784 gene locus_tag LOCUS_20950 9230 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 9486 11489 gene locus_tag LOCUS_20960 9486 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 11486 12214 gene locus_tag LOCUS_20970 11486 12214 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388914.1 protein_id gnl|my_center|LOCUS_20970 12886 12368 gene locus_tag LOCUS_20980 gene rpoE 12886 12368 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2Z8 protein_id gnl|my_center|LOCUS_20980 13401 14672 gene locus_tag LOCUS_20990 13401 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 16730 14679 gene locus_tag LOCUS_21000 16730 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence082 <1 1039 gene locus_tag LOCUS_21010 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919303.1:cyclopropane-fatty-acyl-phospholipid synthase 1053 2393 gene locus_tag LOCUS_21020 1053 2393 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_21020 2390 2968 gene locus_tag LOCUS_21030 2390 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388485.1 protein_id gnl|my_center|LOCUS_21030 3404 2949 gene locus_tag LOCUS_21040 3404 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_21040 4173 3418 gene locus_tag LOCUS_21050 4173 3418 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_21050 5705 4170 gene locus_tag LOCUS_21060 gene phrB 5705 4170 CDS product (6-4) photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CH39 protein_id gnl|my_center|LOCUS_21060 6372 5707 gene locus_tag LOCUS_21070 6372 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 6546 8501 gene locus_tag LOCUS_21080 6546 8501 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707420.1 protein_id gnl|my_center|LOCUS_21080 10408 8606 gene locus_tag LOCUS_21090 10408 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 12873 10591 gene locus_tag LOCUS_21100 12873 10591 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_21100 14178 12922 gene locus_tag LOCUS_21110 14178 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 15736 14213 gene locus_tag LOCUS_21120 15736 14213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 16760 15933 gene locus_tag LOCUS_21130 16760 15933 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence083 2848 191 gene locus_tag LOCUS_21140 gene valS 2848 191 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE9 protein_id gnl|my_center|LOCUS_21140 3631 2984 gene locus_tag LOCUS_21150 3631 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 5249 3825 gene locus_tag LOCUS_21160 5249 3825 CDS product type I secretion protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389551.1 protein_id gnl|my_center|LOCUS_21160 6017 5364 gene locus_tag LOCUS_21170 gene pcm 6017 5364 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971822.1 protein_id gnl|my_center|LOCUS_21170 6205 6278 gene locus_tag LOCUS_t00220 6205 6278 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6211 7524 gene locus_tag LOCUS_21180 6211 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 8879 7521 gene locus_tag LOCUS_21190 8879 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807858.1 protein_id gnl|my_center|LOCUS_21190 9281 11149 gene locus_tag LOCUS_21200 9281 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 12425 11163 gene locus_tag LOCUS_21210 12425 11163 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969451.1 protein_id gnl|my_center|LOCUS_21210 13001 12429 gene locus_tag LOCUS_21220 13001 12429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 14049 13075 gene locus_tag LOCUS_21230 14049 13075 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087196.1 protein_id gnl|my_center|LOCUS_21230 14629 14075 gene locus_tag LOCUS_21240 gene nbaC 14629 14075 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_21240 14750 15718 gene locus_tag LOCUS_21250 14750 15718 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089050.1 protein_id gnl|my_center|LOCUS_21250 16025 15705 gene locus_tag LOCUS_21260 16025 15705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21260 16502 16077 gene locus_tag LOCUS_21270 16502 16077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21270 >Feature sequence084 <1 1155 gene locus_tag LOCUS_21280 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529293.1:sulfatase 1159 1899 gene locus_tag LOCUS_21290 gene ugpQ 1159 1899 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P10908 protein_id gnl|my_center|LOCUS_21290 1988 2935 gene locus_tag LOCUS_21300 1988 2935 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385088.1 protein_id gnl|my_center|LOCUS_21300 2949 3851 gene locus_tag LOCUS_21310 2949 3851 CDS product fluoroacetate dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_21310 6801 3856 gene locus_tag LOCUS_21320 gene glnE 6801 3856 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSQ7 protein_id gnl|my_center|LOCUS_21320 6897 10538 gene locus_tag LOCUS_21330 6897 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 11097 10570 gene locus_tag LOCUS_21340 11097 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 11260 11982 gene locus_tag LOCUS_21350 11260 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 12052 12471 gene locus_tag LOCUS_21360 12052 12471 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391222.1 protein_id gnl|my_center|LOCUS_21360 12611 14698 gene locus_tag LOCUS_21370 12611 14698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 15391 14756 gene locus_tag LOCUS_21380 15391 14756 CDS product LysE type translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530934.1 protein_id gnl|my_center|LOCUS_21380 15858 15415 gene locus_tag LOCUS_21390 gene rnhA 15858 15415 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UU3 protein_id gnl|my_center|LOCUS_21390 <16629 15855 gene locus_tag LOCUS_21400 <16629 15855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPU7:homoserine kinase >Feature sequence085 <1 864 gene locus_tag LOCUS_21410 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070883.1:sensor histidine kinase 889 1314 gene locus_tag LOCUS_21420 889 1314 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070884.1 protein_id gnl|my_center|LOCUS_21420 1307 3373 gene locus_tag LOCUS_21430 1307 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 3376 4608 gene locus_tag LOCUS_21440 3376 4608 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077104.1 protein_id gnl|my_center|LOCUS_21440 4664 6832 gene locus_tag LOCUS_21450 4664 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 7685 6972 gene locus_tag LOCUS_21460 7685 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 9909 7690 gene locus_tag LOCUS_21470 9909 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 12278 10158 gene locus_tag LOCUS_21480 12278 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 12551 15133 gene locus_tag LOCUS_21490 12551 15133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 <16539 15206 gene locus_tag LOCUS_21500 <16539 15206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086124.1:ABC transporter ATP-binding protein >Feature sequence086 1321 314 gene locus_tag LOCUS_21510 1321 314 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809832.1 protein_id gnl|my_center|LOCUS_21510 2231 1359 gene locus_tag LOCUS_21520 2231 1359 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_21520 2391 3362 gene locus_tag LOCUS_21530 2391 3362 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313134.1 protein_id gnl|my_center|LOCUS_21530 3375 4625 gene locus_tag LOCUS_21540 3375 4625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267305.1 protein_id gnl|my_center|LOCUS_21540 5884 4688 gene locus_tag LOCUS_21550 5884 4688 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188967.1 protein_id gnl|my_center|LOCUS_21550 6449 5895 gene locus_tag LOCUS_21560 6449 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 6646 7812 gene locus_tag LOCUS_21570 6646 7812 CDS product NADH:flavin oxidoreductase / NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038790.1 protein_id gnl|my_center|LOCUS_21570 7914 9050 gene locus_tag LOCUS_21580 7914 9050 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338377.1 protein_id gnl|my_center|LOCUS_21580 9803 9135 gene locus_tag LOCUS_21590 9803 9135 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338381.1 protein_id gnl|my_center|LOCUS_21590 9983 11296 gene locus_tag LOCUS_21600 9983 11296 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338375.1 protein_id gnl|my_center|LOCUS_21600 11350 13362 gene locus_tag LOCUS_21610 11350 13362 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338380.1 protein_id gnl|my_center|LOCUS_21610 13366 15039 gene locus_tag LOCUS_21620 13366 15039 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720819.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence087 416 961 gene locus_tag LOCUS_21630 416 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 1065 1658 gene locus_tag LOCUS_21640 1065 1658 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CAU3 protein_id gnl|my_center|LOCUS_21640 1705 2157 gene locus_tag LOCUS_21650 1705 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2154 2630 gene locus_tag LOCUS_21660 2154 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 3168 2809 gene locus_tag LOCUS_21670 3168 2809 CDS product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708326.1 protein_id gnl|my_center|LOCUS_21670 3934 3314 gene locus_tag LOCUS_21680 gene leuD 3934 3314 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV54 protein_id gnl|my_center|LOCUS_21680 4122 3952 gene locus_tag LOCUS_21690 4122 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 5525 4119 gene locus_tag LOCUS_21700 gene leuC 5525 4119 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV55 protein_id gnl|my_center|LOCUS_21700 6309 5899 gene locus_tag LOCUS_21710 6309 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 7053 6343 gene locus_tag LOCUS_21720 gene trmD 7053 6343 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV57 protein_id gnl|my_center|LOCUS_21720 7603 7058 gene locus_tag LOCUS_21730 gene rimM 7603 7058 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV58 protein_id gnl|my_center|LOCUS_21730 8069 7632 gene locus_tag LOCUS_21740 8069 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 9614 8136 gene locus_tag LOCUS_21750 gene ffh 9614 8136 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV60 protein_id gnl|my_center|LOCUS_21750 10035 10358 gene locus_tag LOCUS_21760 10035 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 10476 11324 gene locus_tag LOCUS_21770 gene dapF 10476 11324 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV61 protein_id gnl|my_center|LOCUS_21770 11321 12577 gene locus_tag LOCUS_21780 11321 12577 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383138.1 protein_id gnl|my_center|LOCUS_21780 12620 13543 gene locus_tag LOCUS_21790 12620 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 14061 13555 gene locus_tag LOCUS_21800 14061 13555 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868975.1 protein_id gnl|my_center|LOCUS_21800 14196 15935 gene locus_tag LOCUS_21810 14196 15935 CDS product chemotaxis sensory transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391310.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence088 52 840 gene locus_tag LOCUS_21820 52 840 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_21820 874 2172 gene locus_tag LOCUS_21830 874 2172 CDS product molecular chaperone Hsp70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919351.1 protein_id gnl|my_center|LOCUS_21830 3138 2179 gene locus_tag LOCUS_21840 3138 2179 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_21840 3274 4155 gene locus_tag LOCUS_21850 3274 4155 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390690.1 protein_id gnl|my_center|LOCUS_21850 5133 4177 gene locus_tag LOCUS_21860 gene mdh 5133 4177 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ83 protein_id gnl|my_center|LOCUS_21860 6754 5324 gene locus_tag LOCUS_21870 6754 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 7132 7539 gene locus_tag LOCUS_21880 7132 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 7626 8213 gene locus_tag LOCUS_21890 7626 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114135.1 protein_id gnl|my_center|LOCUS_21890 8210 8725 gene locus_tag LOCUS_21900 8210 8725 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970090.1 protein_id gnl|my_center|LOCUS_21900 8722 9279 gene locus_tag LOCUS_21910 gene coq7 8722 9279 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNK3 protein_id gnl|my_center|LOCUS_21910 10591 9263 gene locus_tag LOCUS_21920 10591 9263 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063785.1 protein_id gnl|my_center|LOCUS_21920 11200 10640 gene locus_tag LOCUS_21930 11200 10640 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391480.1 protein_id gnl|my_center|LOCUS_21930 12101 11406 gene locus_tag LOCUS_21940 12101 11406 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390534.1 protein_id gnl|my_center|LOCUS_21940 12807 12193 gene locus_tag LOCUS_21950 12807 12193 CDS product DNA-3-methyladenine glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529433.1 protein_id gnl|my_center|LOCUS_21950 12848 13702 gene locus_tag LOCUS_21960 12848 13702 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_21960 14540 13674 gene locus_tag LOCUS_21970 14540 13674 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_21970 14904 14578 gene locus_tag LOCUS_21980 14904 14578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 16005 15070 gene locus_tag LOCUS_21990 gene mdcF 16005 15070 CDS product putative malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56949 protein_id gnl|my_center|LOCUS_21990 16144 16437 gene locus_tag LOCUS_22000 16144 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence089 <1 1232 gene locus_tag LOCUS_22010 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015886748.1:ABC transporter substrate-binding protein 1366 2334 gene locus_tag LOCUS_22020 1366 2334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401718.1 protein_id gnl|my_center|LOCUS_22020 2331 3278 gene locus_tag LOCUS_22030 2331 3278 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970444.1 protein_id gnl|my_center|LOCUS_22030 3282 5105 gene locus_tag LOCUS_22040 3282 5105 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103050.1 protein_id gnl|my_center|LOCUS_22040 5401 6957 gene locus_tag LOCUS_22050 5401 6957 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974597.1 protein_id gnl|my_center|LOCUS_22050 7211 7576 gene locus_tag LOCUS_22060 7211 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_22060 8792 7596 gene locus_tag LOCUS_22070 gene acads 8792 7596 CDS product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 protein_id gnl|my_center|LOCUS_22070 9010 10521 gene locus_tag LOCUS_22080 9010 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 10526 12151 gene locus_tag LOCUS_22090 10526 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 13293 12130 gene locus_tag LOCUS_22100 13293 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 14684 13341 gene locus_tag LOCUS_22110 14684 13341 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223718.1 protein_id gnl|my_center|LOCUS_22110 14763 15299 gene locus_tag LOCUS_22120 14763 15299 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089838.1 protein_id gnl|my_center|LOCUS_22120 15296 16159 gene locus_tag LOCUS_22130 15296 16159 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531708.1 protein_id gnl|my_center|LOCUS_22130 >Feature sequence090 926 246 gene locus_tag LOCUS_22140 926 246 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974790.1 protein_id gnl|my_center|LOCUS_22140 1044 1226 gene locus_tag LOCUS_22150 1044 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 1219 1671 gene locus_tag LOCUS_22160 1219 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531921.1 protein_id gnl|my_center|LOCUS_22160 1664 2254 gene locus_tag LOCUS_22170 1664 2254 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531258.1 protein_id gnl|my_center|LOCUS_22170 2251 3075 gene locus_tag LOCUS_22180 2251 3075 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706107.1 protein_id gnl|my_center|LOCUS_22180 3326 3844 gene locus_tag LOCUS_22190 3326 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 3941 4432 gene locus_tag LOCUS_22200 3941 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 4441 5265 gene locus_tag LOCUS_22210 4441 5265 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_22210 6028 5321 gene locus_tag LOCUS_22220 6028 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 7744 6032 gene locus_tag LOCUS_22230 gene copA 7744 6032 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_22230 8324 7779 gene locus_tag LOCUS_22240 8324 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 8744 8394 gene locus_tag LOCUS_22250 8744 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 9340 8831 gene locus_tag LOCUS_22260 9340 8831 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084296.1 protein_id gnl|my_center|LOCUS_22260 11030 9360 gene locus_tag LOCUS_22270 11030 9360 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529563.1 protein_id gnl|my_center|LOCUS_22270 11354 11034 gene locus_tag LOCUS_22280 11354 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640151.1 protein_id gnl|my_center|LOCUS_22280 12349 11375 gene locus_tag LOCUS_22290 12349 11375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 13504 12512 gene locus_tag LOCUS_22300 13504 12512 CDS product cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886808.1 protein_id gnl|my_center|LOCUS_22300 14539 13520 gene locus_tag LOCUS_22310 14539 13520 CDS product putative threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55664 protein_id gnl|my_center|LOCUS_22310 14648 16057 gene locus_tag LOCUS_22320 14648 16057 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064766.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence091 1373 615 gene locus_tag LOCUS_22330 1373 615 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_22330 2516 1374 gene locus_tag LOCUS_22340 gene yeaW 2516 1374 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067835.1 protein_id gnl|my_center|LOCUS_22340 2823 3794 gene locus_tag LOCUS_22350 2823 3794 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_22350 3892 4989 gene locus_tag LOCUS_22360 3892 4989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_22360 5122 7203 gene locus_tag LOCUS_22370 5122 7203 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_22370 7309 8064 gene locus_tag LOCUS_22380 7309 8064 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531379.1 protein_id gnl|my_center|LOCUS_22380 9108 8083 gene locus_tag LOCUS_22390 9108 8083 CDS product porphyromonas-type peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701340.1 protein_id gnl|my_center|LOCUS_22390 10214 9183 gene locus_tag LOCUS_22400 gene trpS 10214 9183 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5H8 protein_id gnl|my_center|LOCUS_22400 11879 10323 gene locus_tag LOCUS_22410 11879 10323 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG3 protein_id gnl|my_center|LOCUS_22410 13220 11985 gene locus_tag LOCUS_22420 13220 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 <16064 13311 gene locus_tag LOCUS_22430 <16064 13311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNG2:bifunctional uridylyltransferase/uridylyl-removing enzyme >Feature sequence092 3752 2442 gene locus_tag LOCUS_22440 3752 2442 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967861.1 protein_id gnl|my_center|LOCUS_22440 4020 3760 gene locus_tag LOCUS_22450 4020 3760 CDS product metal resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970463.1 protein_id gnl|my_center|LOCUS_22450 4524 5249 gene locus_tag LOCUS_22460 4524 5249 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 protein_id gnl|my_center|LOCUS_22460 5267 5881 gene locus_tag LOCUS_22470 5267 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_22470 6229 7854 gene locus_tag LOCUS_22480 6229 7854 CDS product fatty acid CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039161.1 protein_id gnl|my_center|LOCUS_22480 7858 8580 gene locus_tag LOCUS_22490 7858 8580 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040397.1 protein_id gnl|my_center|LOCUS_22490 8725 9687 gene locus_tag LOCUS_22500 8725 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173979.1 protein_id gnl|my_center|LOCUS_22500 9680 11005 gene locus_tag LOCUS_22510 9680 11005 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026863.1 protein_id gnl|my_center|LOCUS_22510 11767 11012 gene locus_tag LOCUS_22520 11767 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040854.1 protein_id gnl|my_center|LOCUS_22520 13325 11796 gene locus_tag LOCUS_22530 13325 11796 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070148.1 protein_id gnl|my_center|LOCUS_22530 13488 13315 gene locus_tag LOCUS_22540 13488 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 13628 13978 gene locus_tag LOCUS_22550 13628 13978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_22550 13997 14359 gene locus_tag LOCUS_22560 13997 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082795.1 protein_id gnl|my_center|LOCUS_22560 14356 15594 gene locus_tag LOCUS_22570 14356 15594 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082803.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence093 1482 604 gene locus_tag LOCUS_22580 1482 604 CDS product glycerol-3-phosphate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189753.1 protein_id gnl|my_center|LOCUS_22580 2894 1590 gene locus_tag LOCUS_22590 2894 1590 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045558.1 protein_id gnl|my_center|LOCUS_22590 3143 3523 gene locus_tag LOCUS_22600 3143 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 protein_id gnl|my_center|LOCUS_22600 3520 4269 gene locus_tag LOCUS_22610 3520 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 6239 4281 gene locus_tag LOCUS_22620 6239 4281 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085334.1 protein_id gnl|my_center|LOCUS_22620 8135 6351 gene locus_tag LOCUS_22630 8135 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 8590 8515 gene locus_tag LOCUS_t00230 8590 8515 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8922 8680 gene locus_tag LOCUS_22640 8922 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 10302 8926 gene locus_tag LOCUS_22650 10302 8926 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869944.1 protein_id gnl|my_center|LOCUS_22650 10883 10299 gene locus_tag LOCUS_22660 10883 10299 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQN0 protein_id gnl|my_center|LOCUS_22660 11325 10885 gene locus_tag LOCUS_22670 11325 10885 CDS product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 protein_id gnl|my_center|LOCUS_22670 11857 11363 gene locus_tag LOCUS_22680 11857 11363 CDS product UPF0262 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL90 protein_id gnl|my_center|LOCUS_22680 13228 11909 gene locus_tag LOCUS_22690 gene hisD 13228 11909 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM7 protein_id gnl|my_center|LOCUS_22690 13883 13218 gene locus_tag LOCUS_22700 gene hisG 13883 13218 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQM6 protein_id gnl|my_center|LOCUS_22700 14852 13962 gene locus_tag LOCUS_22710 14852 13962 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529602.1 protein_id gnl|my_center|LOCUS_22710 <16040 14945 gene locus_tag LOCUS_22720 <16040 14945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706561.1:membrane protein >Feature sequence094 <1 871 gene locus_tag LOCUS_22730 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082110.1:transcriptional regulator 1099 947 gene locus_tag LOCUS_22740 1099 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 1341 1931 gene locus_tag LOCUS_22750 1341 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 2435 2079 gene locus_tag LOCUS_22760 2435 2079 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_22760 3623 2439 gene locus_tag LOCUS_22770 3623 2439 CDS product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 protein_id gnl|my_center|LOCUS_22770 3761 4264 gene locus_tag LOCUS_22780 3761 4264 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888390.1 protein_id gnl|my_center|LOCUS_22780 4378 5874 gene locus_tag LOCUS_22790 4378 5874 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530323.1 protein_id gnl|my_center|LOCUS_22790 5880 7250 gene locus_tag LOCUS_22800 5880 7250 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975296.1 protein_id gnl|my_center|LOCUS_22800 7296 8285 gene locus_tag LOCUS_22810 7296 8285 CDS product N-alpha-acetyl diaminobutyric acid deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888381.1 protein_id gnl|my_center|LOCUS_22810 9351 8413 gene locus_tag LOCUS_22820 9351 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 9924 9361 gene locus_tag LOCUS_22830 9924 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 11268 9928 gene locus_tag LOCUS_22840 11268 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 11826 11305 gene locus_tag LOCUS_22850 11826 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 12902 11898 gene locus_tag LOCUS_22860 12902 11898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 14071 12977 gene locus_tag LOCUS_22870 14071 12977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 14370 14068 gene locus_tag LOCUS_22880 14370 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 14502 15332 gene locus_tag LOCUS_22890 14502 15332 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence095 3 716 gene locus_tag LOCUS_22900 3 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 718 1926 gene locus_tag LOCUS_22910 718 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 3451 1949 gene locus_tag LOCUS_22920 3451 1949 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390009.1 protein_id gnl|my_center|LOCUS_22920 5808 3535 gene locus_tag LOCUS_22930 gene ppk 5808 3535 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSD4 protein_id gnl|my_center|LOCUS_22930 5998 6522 gene locus_tag LOCUS_22940 5998 6522 CDS product phosphohistidine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390011.1 protein_id gnl|my_center|LOCUS_22940 8049 6538 gene locus_tag LOCUS_22950 8049 6538 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887542.1 protein_id gnl|my_center|LOCUS_22950 8914 8135 gene locus_tag LOCUS_22960 8914 8135 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090612.1 protein_id gnl|my_center|LOCUS_22960 9630 8932 gene locus_tag LOCUS_22970 9630 8932 CDS product regulatory inactivation of DnaA Hda protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390012.1 protein_id gnl|my_center|LOCUS_22970 10811 9627 gene locus_tag LOCUS_22980 10811 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 11125 10847 gene locus_tag LOCUS_22990 11125 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 11024 11941 gene locus_tag LOCUS_23000 gene purM 11024 11941 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKG8 protein_id gnl|my_center|LOCUS_23000 11955 12614 gene locus_tag LOCUS_23010 gene purN 11955 12614 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC7 protein_id gnl|my_center|LOCUS_23010 12721 12855 gene locus_tag LOCUS_23020 12721 12855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 13358 12936 gene locus_tag LOCUS_23030 gene ndk 13358 12936 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSC6 protein_id gnl|my_center|LOCUS_23030 13557 15458 gene locus_tag LOCUS_23040 13557 15458 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390019.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence096 1706 171 gene locus_tag LOCUS_23050 1706 171 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529171.1 protein_id gnl|my_center|LOCUS_23050 2592 2146 gene locus_tag LOCUS_23060 gene tadA 2592 2146 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP1 protein_id gnl|my_center|LOCUS_23060 2703 3800 gene locus_tag LOCUS_23070 2703 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 3781 4338 gene locus_tag LOCUS_23080 3781 4338 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388411.1 protein_id gnl|my_center|LOCUS_23080 4335 4979 gene locus_tag LOCUS_23090 4335 4979 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086038.1 protein_id gnl|my_center|LOCUS_23090 4996 6207 gene locus_tag LOCUS_23100 gene mnmA 4996 6207 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C6U5 protein_id gnl|my_center|LOCUS_23100 6218 7000 gene locus_tag LOCUS_23110 6218 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 7291 7367 gene locus_tag LOCUS_t00240 7291 7367 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7534 8403 gene locus_tag LOCUS_23120 7534 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_23120 9251 8409 gene locus_tag LOCUS_23130 9251 8409 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973013.1 protein_id gnl|my_center|LOCUS_23130 9504 10127 gene locus_tag LOCUS_23140 9504 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 11111 10281 gene locus_tag LOCUS_23150 11111 10281 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973218.1 protein_id gnl|my_center|LOCUS_23150 11259 12263 gene locus_tag LOCUS_23160 gene bacA 11259 12263 CDS product bacteroid development protein BacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08120 protein_id gnl|my_center|LOCUS_23160 12444 12968 gene locus_tag LOCUS_23170 12444 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 14235 13042 gene locus_tag LOCUS_23180 14235 13042 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_23180 <15626 14330 gene locus_tag LOCUS_23190 <15626 14330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337852.1:branched-chain amino acid ABC transporter permease >Feature sequence097 <1 747 gene locus_tag LOCUS_23200 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWE8:aspartokinase 929 3208 gene locus_tag LOCUS_23210 929 3208 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388503.1 protein_id gnl|my_center|LOCUS_23210 3353 4852 gene locus_tag LOCUS_23220 3353 4852 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388504.1 protein_id gnl|my_center|LOCUS_23220 4976 6106 gene locus_tag LOCUS_23230 gene ispG 4976 6106 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE4 protein_id gnl|my_center|LOCUS_23230 6153 7397 gene locus_tag LOCUS_23240 gene hisS 6153 7397 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE3 protein_id gnl|my_center|LOCUS_23240 7401 8705 gene locus_tag LOCUS_23250 gene hemA 7401 8705 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE2 protein_id gnl|my_center|LOCUS_23250 8702 9784 gene locus_tag LOCUS_23260 gene prfA 8702 9784 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE1 protein_id gnl|my_center|LOCUS_23260 9781 10626 gene locus_tag LOCUS_23270 gene hemK1 9781 10626 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MK6 protein_id gnl|my_center|LOCUS_23270 11804 10641 gene locus_tag LOCUS_23280 gene lctB 11804 10641 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338523.1 protein_id gnl|my_center|LOCUS_23280 12635 12228 gene locus_tag LOCUS_23290 12635 12228 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530666.1 protein_id gnl|my_center|LOCUS_23290 13389 12790 gene locus_tag LOCUS_23300 13389 12790 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_23300 14019 13495 gene locus_tag LOCUS_23310 14019 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence098 765 196 gene locus_tag LOCUS_23320 765 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1647 841 gene locus_tag LOCUS_23330 1647 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 3086 1899 gene locus_tag LOCUS_23340 3086 1899 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089141.1 protein_id gnl|my_center|LOCUS_23340 3476 3174 gene locus_tag LOCUS_23350 3476 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708372.1 protein_id gnl|my_center|LOCUS_23350 4146 3496 gene locus_tag LOCUS_23360 4146 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708368.1 protein_id gnl|my_center|LOCUS_23360 4873 4184 gene locus_tag LOCUS_23370 4873 4184 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531175.1 protein_id gnl|my_center|LOCUS_23370 5782 5060 gene locus_tag LOCUS_23380 5782 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 7488 5884 gene locus_tag LOCUS_23390 gene acsA 7488 5884 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203879.1 protein_id gnl|my_center|LOCUS_23390 7926 7507 gene locus_tag LOCUS_23400 7926 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 8006 8575 gene locus_tag LOCUS_23410 8006 8575 CDS product damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973277.1 protein_id gnl|my_center|LOCUS_23410 9506 8586 gene locus_tag LOCUS_23420 9506 8586 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809826.1 protein_id gnl|my_center|LOCUS_23420 9698 11383 gene locus_tag LOCUS_23430 9698 11383 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389280.1 protein_id gnl|my_center|LOCUS_23430 11670 13379 gene locus_tag LOCUS_23440 11670 13379 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088065.1 protein_id gnl|my_center|LOCUS_23440 13589 15100 gene locus_tag LOCUS_23450 13589 15100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence099 <1 681 gene locus_tag LOCUS_23460 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388851.1:tol-pal system protein YbgF 694 2052 gene locus_tag LOCUS_23470 gene tilS 694 2052 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J044 protein_id gnl|my_center|LOCUS_23470 2220 4136 gene locus_tag LOCUS_23480 gene ftsH 2220 4136 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVE6 protein_id gnl|my_center|LOCUS_23480 4293 4847 gene locus_tag LOCUS_23490 4293 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 4905 6152 gene locus_tag LOCUS_23500 4905 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887326.1 protein_id gnl|my_center|LOCUS_23500 6162 6809 gene locus_tag LOCUS_23510 6162 6809 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920499.1 protein_id gnl|my_center|LOCUS_23510 7560 6820 gene locus_tag LOCUS_23520 7560 6820 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_23520 8194 7550 gene locus_tag LOCUS_23530 8194 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 9621 8191 gene locus_tag LOCUS_23540 9621 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 10600 9614 gene locus_tag LOCUS_23550 10600 9614 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205740.1 protein_id gnl|my_center|LOCUS_23550 10721 12070 gene locus_tag LOCUS_23560 gene glmM 10721 12070 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MI20 protein_id gnl|my_center|LOCUS_23560 13007 12081 gene locus_tag LOCUS_23570 13007 12081 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707524.1 protein_id gnl|my_center|LOCUS_23570 13359 14651 gene locus_tag LOCUS_23580 13359 14651 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529436.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence100 200 874 gene locus_tag LOCUS_23590 200 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405134.1 protein_id gnl|my_center|LOCUS_23590 899 2575 gene locus_tag LOCUS_23600 899 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 5370 2587 gene locus_tag LOCUS_23610 5370 2587 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_23610 6294 5557 gene locus_tag LOCUS_23620 gene phoB 6294 5557 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_23620 7066 6287 gene locus_tag LOCUS_23630 7066 6287 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT9 protein_id gnl|my_center|LOCUS_23630 7970 7146 gene locus_tag LOCUS_23640 gene pstB 7970 7146 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Q2 protein_id gnl|my_center|LOCUS_23640 9293 7983 gene locus_tag LOCUS_23650 gene pstA 9293 7983 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SA2 protein_id gnl|my_center|LOCUS_23650 10711 9332 gene locus_tag LOCUS_23660 10711 9332 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFB0 protein_id gnl|my_center|LOCUS_23660 11944 10883 gene locus_tag LOCUS_23670 11944 10883 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968633.1 protein_id gnl|my_center|LOCUS_23670 13552 12197 gene locus_tag LOCUS_23680 13552 12197 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391290.1 protein_id gnl|my_center|LOCUS_23680 <15224 13567 gene locus_tag LOCUS_23690 <15224 13567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528054.1:malic protein NAD-binding protein >Feature sequence101 206 72 gene locus_tag LOCUS_23700 206 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 429 1415 gene locus_tag LOCUS_23710 429 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 2566 1424 gene locus_tag LOCUS_23720 2566 1424 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946904.1 protein_id gnl|my_center|LOCUS_23720 2643 3446 gene locus_tag LOCUS_23730 2643 3446 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX92 protein_id gnl|my_center|LOCUS_23730 3443 4012 gene locus_tag LOCUS_23740 3443 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 4106 6460 gene locus_tag LOCUS_23750 4106 6460 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_23750 6469 7257 gene locus_tag LOCUS_23760 6469 7257 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388204.1 protein_id gnl|my_center|LOCUS_23760 7469 7987 gene locus_tag LOCUS_23770 7469 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112638.1 protein_id gnl|my_center|LOCUS_23770 8770 7988 gene locus_tag LOCUS_23780 8770 7988 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086101.1 protein_id gnl|my_center|LOCUS_23780 9606 8812 gene locus_tag LOCUS_23790 9606 8812 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090538.1 protein_id gnl|my_center|LOCUS_23790 9566 9727 gene locus_tag LOCUS_23800 9566 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 9724 11532 gene locus_tag LOCUS_23810 9724 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 11529 11741 gene locus_tag LOCUS_23820 11529 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707040.1 protein_id gnl|my_center|LOCUS_23820 11738 12487 gene locus_tag LOCUS_23830 11738 12487 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 protein_id gnl|my_center|LOCUS_23830 13071 12862 gene locus_tag LOCUS_23840 13071 12862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 14074 13259 gene locus_tag LOCUS_23850 14074 13259 CDS product SpeB arginase/agmatinase/formimionoglutamate hydrolase SpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706521.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23850 14543 14115 gene locus_tag LOCUS_23860 14543 14115 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530730.1 protein_id gnl|my_center|LOCUS_23860 14637 14915 gene locus_tag LOCUS_23870 14637 14915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence102 55 1458 gene locus_tag LOCUS_23880 55 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1677 2777 gene locus_tag LOCUS_23890 gene recA 1677 2777 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQH9 protein_id gnl|my_center|LOCUS_23890 3794 2943 gene locus_tag LOCUS_23900 gene rsmA 3794 2943 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA9 protein_id gnl|my_center|LOCUS_23900 4795 3791 gene locus_tag LOCUS_23910 gene pdxA1 4795 3791 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92QZ0 protein_id gnl|my_center|LOCUS_23910 6102 4807 gene locus_tag LOCUS_23920 6102 4807 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA7 protein_id gnl|my_center|LOCUS_23920 8318 6105 gene locus_tag LOCUS_23930 gene lptD 8318 6105 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXA6 protein_id gnl|my_center|LOCUS_23930 9418 8318 gene locus_tag LOCUS_23940 9418 8318 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390823.1 protein_id gnl|my_center|LOCUS_23940 10560 9439 gene locus_tag LOCUS_23950 10560 9439 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390693.1 protein_id gnl|my_center|LOCUS_23950 10867 12345 gene locus_tag LOCUS_23960 gene pepA 10867 12345 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX86 protein_id gnl|my_center|LOCUS_23960 12345 12815 gene locus_tag LOCUS_23970 12345 12815 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532504.1 protein_id gnl|my_center|LOCUS_23970 13490 12885 gene locus_tag LOCUS_23980 13490 12885 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_23980 13800 14396 gene locus_tag LOCUS_23990 gene sodB 13800 14396 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD44 protein_id gnl|my_center|LOCUS_23990 14564 15118 gene locus_tag LOCUS_24000 14564 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence103 1166 1681 gene locus_tag LOCUS_24010 gene apt 1166 1681 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT4 protein_id gnl|my_center|LOCUS_24010 2898 1690 gene locus_tag LOCUS_24020 2898 1690 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 protein_id gnl|my_center|LOCUS_24020 4258 2942 gene locus_tag LOCUS_24030 4258 2942 CDS product HlyD family type I secretion membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010239.2 protein_id gnl|my_center|LOCUS_24030 6896 4317 gene locus_tag LOCUS_24040 6896 4317 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938316.1 protein_id gnl|my_center|LOCUS_24040 >Feature sequence104 1906 785 gene locus_tag LOCUS_24050 1906 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 3071 1956 gene locus_tag LOCUS_24060 3071 1956 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 protein_id gnl|my_center|LOCUS_24060 4603 3110 gene locus_tag LOCUS_24070 4603 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 5562 4687 gene locus_tag LOCUS_24080 5562 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 5829 9209 gene locus_tag LOCUS_24090 5829 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 9206 10153 gene locus_tag LOCUS_24100 9206 10153 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_24100 10848 10147 gene locus_tag LOCUS_24110 10848 10147 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083305.1 protein_id gnl|my_center|LOCUS_24110 11056 13065 gene locus_tag LOCUS_24120 11056 13065 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388476.1 protein_id gnl|my_center|LOCUS_24120 13335 13090 gene locus_tag LOCUS_24130 13335 13090 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530645.1 protein_id gnl|my_center|LOCUS_24130 <15057 13337 gene locus_tag LOCUS_24140 <15057 13337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530646.1:oxidoreductase >Feature sequence105 568 320 gene locus_tag LOCUS_24150 568 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 699 1166 gene locus_tag LOCUS_24160 699 1166 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205209.1 protein_id gnl|my_center|LOCUS_24160 1235 1897 gene locus_tag LOCUS_24170 1235 1897 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_24170 1908 2834 gene locus_tag LOCUS_24180 1908 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919459.1 protein_id gnl|my_center|LOCUS_24180 2892 3689 gene locus_tag LOCUS_24190 gene hutG 2892 3689 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193651.1 protein_id gnl|my_center|LOCUS_24190 4897 3716 gene locus_tag LOCUS_24200 4897 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115340.1 protein_id gnl|my_center|LOCUS_24200 9066 4900 gene locus_tag LOCUS_24210 9066 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 10036 9083 gene locus_tag LOCUS_24220 10036 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 11398 10046 gene locus_tag LOCUS_24230 11398 10046 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122697.1 protein_id gnl|my_center|LOCUS_24230 12002 11502 gene locus_tag LOCUS_24240 12002 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104701.1 protein_id gnl|my_center|LOCUS_24240 13171 12008 gene locus_tag LOCUS_24250 13171 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 13780 13490 gene locus_tag LOCUS_24260 13780 13490 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_24260 <14988 13889 gene locus_tag LOCUS_24270 <14988 13889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143421.1:sensor histidine kinase >Feature sequence106 758 2116 gene locus_tag LOCUS_24280 758 2116 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388528.1 protein_id gnl|my_center|LOCUS_24280 2201 2821 gene locus_tag LOCUS_24290 2201 2821 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528638.1 protein_id gnl|my_center|LOCUS_24290 2899 3774 gene locus_tag LOCUS_24300 2899 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103876.1 protein_id gnl|my_center|LOCUS_24300 5562 3787 gene locus_tag LOCUS_24310 5562 3787 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_24310 6703 5576 gene locus_tag LOCUS_24320 6703 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072401.1 protein_id gnl|my_center|LOCUS_24320 7022 6687 gene locus_tag LOCUS_24330 7022 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 6967 8442 gene locus_tag LOCUS_24340 gene ycaD 6967 8442 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038149.1 protein_id gnl|my_center|LOCUS_24340 8458 8808 gene locus_tag LOCUS_24350 8458 8808 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_24350 8813 9325 gene locus_tag LOCUS_24360 8813 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24360 9356 10123 gene locus_tag LOCUS_24370 9356 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 10125 10550 gene locus_tag LOCUS_24380 10125 10550 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391320.1 protein_id gnl|my_center|LOCUS_24380 10604 11557 gene locus_tag LOCUS_24390 gene aes 10604 11557 CDS product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z8T1 protein_id gnl|my_center|LOCUS_24390 11869 11567 gene locus_tag LOCUS_24400 11869 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 11868 12326 gene locus_tag LOCUS_24410 11868 12326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391329.1 protein_id gnl|my_center|LOCUS_24410 12323 13606 gene locus_tag LOCUS_24420 gene sun 12323 13606 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_24420 14062 13616 gene locus_tag LOCUS_24430 14062 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 14158 14592 gene locus_tag LOCUS_24440 14158 14592 CDS product quinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198617.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence107 <1 903 gene locus_tag LOCUS_24450 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035700.1:nucleoside-diphosphate sugar epimerase 1035 1967 gene locus_tag LOCUS_24460 1035 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2911 1994 gene locus_tag LOCUS_24470 2911 1994 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088175.1 protein_id gnl|my_center|LOCUS_24470 3761 2940 gene locus_tag LOCUS_24480 gene tktB 3761 2940 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088174.1 protein_id gnl|my_center|LOCUS_24480 4485 3817 gene locus_tag LOCUS_24490 4485 3817 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088180.1 protein_id gnl|my_center|LOCUS_24490 4972 4511 gene locus_tag LOCUS_24500 4972 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715958.1 protein_id gnl|my_center|LOCUS_24500 5777 4965 gene locus_tag LOCUS_24510 5777 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088178.1 protein_id gnl|my_center|LOCUS_24510 6403 5795 gene locus_tag LOCUS_24520 6403 5795 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088168.1 protein_id gnl|my_center|LOCUS_24520 7973 6435 gene locus_tag LOCUS_24530 7973 6435 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89J62 protein_id gnl|my_center|LOCUS_24530 9016 7976 gene locus_tag LOCUS_24540 9016 7976 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957731.1 protein_id gnl|my_center|LOCUS_24540 10072 9053 gene locus_tag LOCUS_24550 10072 9053 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771860.1 protein_id gnl|my_center|LOCUS_24550 10435 11286 gene locus_tag LOCUS_24560 10435 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 11291 12661 gene locus_tag LOCUS_24570 11291 12661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 13949 12666 gene locus_tag LOCUS_24580 13949 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 14807 13998 gene locus_tag LOCUS_24590 14807 13998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence108 1301 210 gene locus_tag LOCUS_24600 1301 210 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708578.1 protein_id gnl|my_center|LOCUS_24600 1873 1298 gene locus_tag LOCUS_24610 1873 1298 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223539.1 protein_id gnl|my_center|LOCUS_24610 2839 1913 gene locus_tag LOCUS_24620 gene bioC 2839 1913 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 protein_id gnl|my_center|LOCUS_24620 2927 4510 gene locus_tag LOCUS_24630 2927 4510 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807869.1 protein_id gnl|my_center|LOCUS_24630 4489 5280 gene locus_tag LOCUS_24640 4489 5280 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_24640 6943 5285 gene locus_tag LOCUS_24650 6943 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 7705 6992 gene locus_tag LOCUS_24660 7705 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 8715 7702 gene locus_tag LOCUS_24670 8715 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 9167 8730 gene locus_tag LOCUS_24680 9167 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 9707 9177 gene locus_tag LOCUS_24690 9707 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 10099 9707 gene locus_tag LOCUS_24700 10099 9707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 11013 10117 gene locus_tag LOCUS_24710 11013 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 11590 11027 gene locus_tag LOCUS_24720 11590 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 12344 11688 gene locus_tag LOCUS_24730 12344 11688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531177.1 protein_id gnl|my_center|LOCUS_24730 12799 12341 gene locus_tag LOCUS_24740 12799 12341 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639995.1 protein_id gnl|my_center|LOCUS_24740 13417 12809 gene locus_tag LOCUS_24750 13417 12809 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391019.1 protein_id gnl|my_center|LOCUS_24750 14213 13449 gene locus_tag LOCUS_24760 gene gloB 14213 13449 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP80 protein_id gnl|my_center|LOCUS_24760 >Feature sequence109 <1 620 gene locus_tag LOCUS_24770 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015886670.1:DUF2063 domain-containing protein 630 1193 gene locus_tag LOCUS_24780 630 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1950 1201 gene locus_tag LOCUS_24790 gene truA 1950 1201 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNZ9 protein_id gnl|my_center|LOCUS_24790 2511 1999 gene locus_tag LOCUS_24800 2511 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337160.1 protein_id gnl|my_center|LOCUS_24800 2929 2549 gene locus_tag LOCUS_24810 2929 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3874 2954 gene locus_tag LOCUS_24820 gene metA 3874 2954 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CWE8 protein_id gnl|my_center|LOCUS_24820 4082 4939 gene locus_tag LOCUS_24830 4082 4939 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_24830 4936 6033 gene locus_tag LOCUS_24840 gene hisC 4936 6033 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP86 protein_id gnl|my_center|LOCUS_24840 7187 6060 gene locus_tag LOCUS_24850 7187 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 7292 7936 gene locus_tag LOCUS_24860 7292 7936 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J441 protein_id gnl|my_center|LOCUS_24860 7933 8229 gene locus_tag LOCUS_24870 7933 8229 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930852.1 protein_id gnl|my_center|LOCUS_24870 8269 8907 gene locus_tag LOCUS_24880 8269 8907 CDS product riboflavin deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887768.1 protein_id gnl|my_center|LOCUS_24880 11180 8904 gene locus_tag LOCUS_24890 11180 8904 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_24890 12148 11426 gene locus_tag LOCUS_24900 12148 11426 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391005.1 protein_id gnl|my_center|LOCUS_24900 12777 12145 gene locus_tag LOCUS_24910 12777 12145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391004.1 protein_id gnl|my_center|LOCUS_24910 13721 12819 gene locus_tag LOCUS_24920 13721 12819 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391003.1 protein_id gnl|my_center|LOCUS_24920 14394 13714 gene locus_tag LOCUS_24930 14394 13714 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391002.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence110 2707 2288 gene locus_tag LOCUS_24940 2707 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 3350 2790 gene locus_tag LOCUS_24950 3350 2790 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_24950 5560 3398 gene locus_tag LOCUS_24960 5560 3398 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_24960 5805 7013 gene locus_tag LOCUS_24970 gene aatA3 5805 7013 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFH8 protein_id gnl|my_center|LOCUS_24970 7024 7761 gene locus_tag LOCUS_24980 7024 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 7768 8550 gene locus_tag LOCUS_24990 7768 8550 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532642.1 protein_id gnl|my_center|LOCUS_24990 8766 9548 gene locus_tag LOCUS_25000 gene glpR 8766 9548 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035615.1 protein_id gnl|my_center|LOCUS_25000 9545 10678 gene locus_tag LOCUS_25010 9545 10678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940419.1 protein_id gnl|my_center|LOCUS_25010 10767 12047 gene locus_tag LOCUS_25020 10767 12047 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940420.1 protein_id gnl|my_center|LOCUS_25020 12550 13425 gene locus_tag LOCUS_25030 12550 13425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 protein_id gnl|my_center|LOCUS_25030 13616 14428 gene locus_tag LOCUS_25040 13616 14428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940422.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence111 <1 1204 gene locus_tag LOCUS_25050 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388279.1:ATPase 1339 1704 gene locus_tag LOCUS_25060 1339 1704 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388280.1 protein_id gnl|my_center|LOCUS_25060 1705 2865 gene locus_tag LOCUS_25070 gene cheB1 1705 2865 CDS product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX18 protein_id gnl|my_center|LOCUS_25070 2862 3698 gene locus_tag LOCUS_25080 2862 3698 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_25080 4298 3714 gene locus_tag LOCUS_25090 4298 3714 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114828.1 protein_id gnl|my_center|LOCUS_25090 5183 4365 gene locus_tag LOCUS_25100 5183 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 5871 5176 gene locus_tag LOCUS_25110 5871 5176 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531343.1 protein_id gnl|my_center|LOCUS_25110 6355 5876 gene locus_tag LOCUS_25120 6355 5876 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537307.1 protein_id gnl|my_center|LOCUS_25120 8300 6357 gene locus_tag LOCUS_25130 8300 6357 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083710.1 protein_id gnl|my_center|LOCUS_25130 8424 9938 gene locus_tag LOCUS_25140 8424 9938 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 protein_id gnl|my_center|LOCUS_25140 10008 10976 gene locus_tag LOCUS_25150 10008 10976 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338472.1 protein_id gnl|my_center|LOCUS_25150 10994 11677 gene locus_tag LOCUS_25160 10994 11677 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919067.1 protein_id gnl|my_center|LOCUS_25160 12022 11681 gene locus_tag LOCUS_25170 12022 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528825.1 protein_id gnl|my_center|LOCUS_25170 12465 12112 gene locus_tag LOCUS_25180 12465 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 12620 13171 gene locus_tag LOCUS_25190 12620 13171 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_25190 13237 13887 gene locus_tag LOCUS_25200 13237 13887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence112 <1 1326 gene locus_tag LOCUS_25210 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8T7F2:transketolase 1366 2376 gene locus_tag LOCUS_25220 gene gapB 1366 2376 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX57 protein_id gnl|my_center|LOCUS_25220 2527 3468 gene locus_tag LOCUS_25230 2527 3468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972040.1 protein_id gnl|my_center|LOCUS_25230 3646 3509 gene locus_tag LOCUS_25240 3646 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 3636 4688 gene locus_tag LOCUS_25250 3636 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 5174 4722 gene locus_tag LOCUS_25260 5174 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 5337 7052 gene locus_tag LOCUS_25270 5337 7052 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_25270 7255 8175 gene locus_tag LOCUS_25280 gene fbaB 7255 8175 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383967.1 protein_id gnl|my_center|LOCUS_25280 8172 8825 gene locus_tag LOCUS_25290 gene thiE 8172 8825 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVG4 protein_id gnl|my_center|LOCUS_25290 8822 9415 gene locus_tag LOCUS_25300 8822 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 10864 9452 gene locus_tag LOCUS_25310 gene sthA 10864 9452 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971781.1 protein_id gnl|my_center|LOCUS_25310 11040 11534 gene locus_tag LOCUS_25320 11040 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 12588 11545 gene locus_tag LOCUS_25330 12588 11545 CDS product EF-P lysine aminoacylase GenX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388833.1 protein_id gnl|my_center|LOCUS_25330 12712 13278 gene locus_tag LOCUS_25340 gene efp 12712 13278 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89M07 protein_id gnl|my_center|LOCUS_25340 13285 14106 gene locus_tag LOCUS_25350 13285 14106 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence113 1393 152 gene locus_tag LOCUS_25360 1393 152 CDS product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969999.1 protein_id gnl|my_center|LOCUS_25360 2189 1431 gene locus_tag LOCUS_25370 2189 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528408.1 protein_id gnl|my_center|LOCUS_25370 2336 3220 gene locus_tag LOCUS_25380 2336 3220 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_25380 3241 3639 gene locus_tag LOCUS_25390 3241 3639 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706955.1 protein_id gnl|my_center|LOCUS_25390 3747 4778 gene locus_tag LOCUS_25400 3747 4778 CDS product farnesyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390700.1 protein_id gnl|my_center|LOCUS_25400 4888 5883 gene locus_tag LOCUS_25410 4888 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_25410 5886 7463 gene locus_tag LOCUS_25420 5886 7463 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142772.1 protein_id gnl|my_center|LOCUS_25420 7678 8430 gene locus_tag LOCUS_25430 7678 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 8511 9503 gene locus_tag LOCUS_25440 8511 9503 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530699.1 protein_id gnl|my_center|LOCUS_25440 9500 10033 gene locus_tag LOCUS_25450 9500 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 10490 10065 gene locus_tag LOCUS_25460 10490 10065 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083560.1 protein_id gnl|my_center|LOCUS_25460 11577 10561 gene locus_tag LOCUS_25470 11577 10561 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947606.1 protein_id gnl|my_center|LOCUS_25470 11705 12163 gene locus_tag LOCUS_25480 11705 12163 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709023.1 protein_id gnl|my_center|LOCUS_25480 13215 12160 gene locus_tag LOCUS_25490 13215 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 13787 13212 gene locus_tag LOCUS_25500 13787 13212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 14506 13805 gene locus_tag LOCUS_25510 14506 13805 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence114 186 704 gene locus_tag LOCUS_25520 186 704 CDS product invasion-associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337738.1 protein_id gnl|my_center|LOCUS_25520 1684 689 gene locus_tag LOCUS_25530 1684 689 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 protein_id gnl|my_center|LOCUS_25530 1696 2715 gene locus_tag LOCUS_25540 1696 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2802 5465 gene locus_tag LOCUS_25550 2802 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 5488 6351 gene locus_tag LOCUS_25560 5488 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 6348 7130 gene locus_tag LOCUS_25570 6348 7130 CDS product putative O-antigen/lipopolysaccharide transport integral membrane protein ABC transporter RfbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700955.1 protein_id gnl|my_center|LOCUS_25570 7167 7925 gene locus_tag LOCUS_25580 gene rfbA 7167 7925 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086432.1 protein_id gnl|my_center|LOCUS_25580 7909 11394 gene locus_tag LOCUS_25590 7909 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 11476 12447 gene locus_tag LOCUS_25600 11476 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 12506 13573 gene locus_tag LOCUS_25610 12506 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 >Feature sequence115 468 2090 gene locus_tag LOCUS_25620 468 2090 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I43 protein_id gnl|my_center|LOCUS_25620 3188 2166 gene locus_tag LOCUS_25630 3188 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3352 4005 gene locus_tag LOCUS_25640 3352 4005 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969927.1 protein_id gnl|my_center|LOCUS_25640 4105 4383 gene locus_tag LOCUS_25650 4105 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 5661 4384 gene locus_tag LOCUS_25660 5661 4384 CDS product nucleoside:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_25660 5902 6399 gene locus_tag LOCUS_25670 5902 6399 CDS product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391031.1 protein_id gnl|my_center|LOCUS_25670 6530 6871 gene locus_tag LOCUS_25680 gene csaA 6530 6871 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 protein_id gnl|my_center|LOCUS_25680 7779 6880 gene locus_tag LOCUS_25690 7779 6880 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886753.1 protein_id gnl|my_center|LOCUS_25690 7883 8506 gene locus_tag LOCUS_25700 7883 8506 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552112.1 protein_id gnl|my_center|LOCUS_25700 8516 9517 gene locus_tag LOCUS_25710 8516 9517 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930748.1 protein_id gnl|my_center|LOCUS_25710 10134 9514 gene locus_tag LOCUS_25720 10134 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 10505 10134 gene locus_tag LOCUS_25730 10505 10134 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082961.1 protein_id gnl|my_center|LOCUS_25730 10683 10510 gene locus_tag LOCUS_25740 10683 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 10964 10695 gene locus_tag LOCUS_25750 10964 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 12563 10977 gene locus_tag LOCUS_25760 gene lysS 12563 10977 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX38 protein_id gnl|my_center|LOCUS_25760 13192 12785 gene locus_tag LOCUS_25770 13192 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 13262 14218 gene locus_tag LOCUS_25780 13262 14218 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532571.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence116 301 618 gene locus_tag LOCUS_25790 gene rpsJ 301 618 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV9 protein_id gnl|my_center|LOCUS_25790 635 1429 gene locus_tag LOCUS_25800 gene rplC 635 1429 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5S2 protein_id gnl|my_center|LOCUS_25800 1443 2063 gene locus_tag LOCUS_25810 gene rplD 1443 2063 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UE19 protein_id gnl|my_center|LOCUS_25810 2060 2383 gene locus_tag LOCUS_25820 gene rplW 2060 2383 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW2 protein_id gnl|my_center|LOCUS_25820 2426 3256 gene locus_tag LOCUS_25830 gene rplB 2426 3256 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW3 protein_id gnl|my_center|LOCUS_25830 3269 3547 gene locus_tag LOCUS_25840 gene rpsS 3269 3547 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW4 protein_id gnl|my_center|LOCUS_25840 3550 3930 gene locus_tag LOCUS_25850 gene rplV 3550 3930 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW5 protein_id gnl|my_center|LOCUS_25850 3930 4640 gene locus_tag LOCUS_25860 gene rpsC 3930 4640 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW6 protein_id gnl|my_center|LOCUS_25860 4713 5126 gene locus_tag LOCUS_25870 gene rplP 4713 5126 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW7 protein_id gnl|my_center|LOCUS_25870 5139 5351 gene locus_tag LOCUS_25880 gene rpmC 5139 5351 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW8 protein_id gnl|my_center|LOCUS_25880 5380 5619 gene locus_tag LOCUS_25890 gene rpsQ 5380 5619 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQW9 protein_id gnl|my_center|LOCUS_25890 5648 6016 gene locus_tag LOCUS_25900 gene rplN 5648 6016 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX0 protein_id gnl|my_center|LOCUS_25900 6019 6336 gene locus_tag LOCUS_25910 gene rplX 6019 6336 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX1 protein_id gnl|my_center|LOCUS_25910 6374 6931 gene locus_tag LOCUS_25920 gene rplE 6374 6931 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4E6 protein_id gnl|my_center|LOCUS_25920 6951 7256 gene locus_tag LOCUS_25930 gene rpsN 6951 7256 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIG1 protein_id gnl|my_center|LOCUS_25930 7270 7668 gene locus_tag LOCUS_25940 gene rpsH 7270 7668 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX4 protein_id gnl|my_center|LOCUS_25940 7685 8224 gene locus_tag LOCUS_25950 gene rplF 7685 8224 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX5 protein_id gnl|my_center|LOCUS_25950 8237 8599 gene locus_tag LOCUS_25960 gene rplR 8237 8599 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQX6 protein_id gnl|my_center|LOCUS_25960 8616 9230 gene locus_tag LOCUS_25970 gene rpsE 8616 9230 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F1 protein_id gnl|my_center|LOCUS_25970 9223 9417 gene locus_tag LOCUS_25980 gene rpmD 9223 9417 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H4F2 protein_id gnl|my_center|LOCUS_25980 9474 10013 gene locus_tag LOCUS_25990 gene rplO 9474 10013 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Q3 protein_id gnl|my_center|LOCUS_25990 10175 11527 gene locus_tag LOCUS_26000 gene secY 10175 11527 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY0 protein_id gnl|my_center|LOCUS_26000 11524 12168 gene locus_tag LOCUS_26010 gene adk 11524 12168 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0D2 protein_id gnl|my_center|LOCUS_26010 12479 12847 gene locus_tag LOCUS_26020 gene rpsM 12479 12847 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY2 protein_id gnl|my_center|LOCUS_26020 12921 13307 gene locus_tag LOCUS_26030 gene rpsK 12921 13307 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQY3 protein_id gnl|my_center|LOCUS_26030 >Feature sequence117 519 2375 gene locus_tag LOCUS_26040 519 2375 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_26040 2400 3437 gene locus_tag LOCUS_26050 2400 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 3434 4108 gene locus_tag LOCUS_26060 3434 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 4216 5373 gene locus_tag LOCUS_26070 4216 5373 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388859.1 protein_id gnl|my_center|LOCUS_26070 5378 6958 gene locus_tag LOCUS_26080 gene serA 5378 6958 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89DN8 protein_id gnl|my_center|LOCUS_26080 7157 8416 gene locus_tag LOCUS_26090 7157 8416 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391103.1 protein_id gnl|my_center|LOCUS_26090 8418 9251 gene locus_tag LOCUS_26100 8418 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 11408 9252 gene locus_tag LOCUS_26110 11408 9252 CDS product copper-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_26110 11532 11924 gene locus_tag LOCUS_26120 11532 11924 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_26120 11921 12355 gene locus_tag LOCUS_26130 11921 12355 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256868.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence118 770 270 gene locus_tag LOCUS_26140 770 270 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256436.1 protein_id gnl|my_center|LOCUS_26140 870 1646 gene locus_tag LOCUS_26150 870 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 1774 2640 gene locus_tag LOCUS_26160 1774 2640 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_26160 2694 3710 gene locus_tag LOCUS_26170 2694 3710 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389596.1 protein_id gnl|my_center|LOCUS_26170 3720 4595 gene locus_tag LOCUS_26180 3720 4595 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 protein_id gnl|my_center|LOCUS_26180 4677 5168 gene locus_tag LOCUS_26190 4677 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 5335 6789 gene locus_tag LOCUS_26200 5335 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_26200 6815 7792 gene locus_tag LOCUS_26210 6815 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122582.1 protein_id gnl|my_center|LOCUS_26210 7838 8599 gene locus_tag LOCUS_26220 gene ate 7838 8599 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J340 protein_id gnl|my_center|LOCUS_26220 8810 9910 gene locus_tag LOCUS_26230 8810 9910 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_26230 10116 11171 gene locus_tag LOCUS_26240 10116 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 11270 13942 gene locus_tag LOCUS_26250 11270 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence119 1539 721 gene locus_tag LOCUS_26260 1539 721 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_26260 1752 2348 gene locus_tag LOCUS_26270 1752 2348 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 protein_id gnl|my_center|LOCUS_26270 2345 3526 gene locus_tag LOCUS_26280 2345 3526 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530456.1 protein_id gnl|my_center|LOCUS_26280 3737 5101 gene locus_tag LOCUS_26290 3737 5101 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 protein_id gnl|my_center|LOCUS_26290 5192 6277 gene locus_tag LOCUS_26300 5192 6277 CDS product nitrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106411.1 protein_id gnl|my_center|LOCUS_26300 6283 7941 gene locus_tag LOCUS_26310 6283 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 7941 10379 gene locus_tag LOCUS_26320 7941 10379 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061458.1 protein_id gnl|my_center|LOCUS_26320 10376 10717 gene locus_tag LOCUS_26330 10376 10717 CDS product tRNA-(guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530461.1 protein_id gnl|my_center|LOCUS_26330 10720 13353 gene locus_tag LOCUS_26340 gene narB 10720 13353 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975944.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence120 348 275 gene locus_tag LOCUS_t00250 348 275 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 520 436 gene locus_tag LOCUS_t00260 520 436 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 684 1514 gene locus_tag LOCUS_26350 684 1514 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337339.1 protein_id gnl|my_center|LOCUS_26350 2089 1511 gene locus_tag LOCUS_26360 2089 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 3516 2146 gene locus_tag LOCUS_26370 3516 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 4306 3545 gene locus_tag LOCUS_26380 4306 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 4470 4545 gene locus_tag LOCUS_t00270 4470 4545 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5789 4575 gene locus_tag LOCUS_26390 5789 4575 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255925.1 protein_id gnl|my_center|LOCUS_26390 6840 5797 gene locus_tag LOCUS_26400 6840 5797 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAP0 protein_id gnl|my_center|LOCUS_26400 7703 6855 gene locus_tag LOCUS_26410 7703 6855 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331465.1 protein_id gnl|my_center|LOCUS_26410 7956 9041 gene locus_tag LOCUS_26420 7956 9041 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337326.1 protein_id gnl|my_center|LOCUS_26420 9038 12154 gene locus_tag LOCUS_26430 9038 12154 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976163.1 protein_id gnl|my_center|LOCUS_26430 12914 12162 gene locus_tag LOCUS_26440 12914 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 13942 12911 gene locus_tag LOCUS_26450 13942 12911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence121 329 793 gene locus_tag LOCUS_26460 329 793 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_26460 793 1554 gene locus_tag LOCUS_26470 793 1554 CDS product 2-hydroxycyclohexane-1-carbonyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 protein_id gnl|my_center|LOCUS_26470 1573 2487 gene locus_tag LOCUS_26480 1573 2487 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089536.1 protein_id gnl|my_center|LOCUS_26480 3042 2671 gene locus_tag LOCUS_26490 3042 2671 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0M0 protein_id gnl|my_center|LOCUS_26490 3623 3129 gene locus_tag LOCUS_26500 gene rpsI 3623 3129 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6Y4 protein_id gnl|my_center|LOCUS_26500 4093 3626 gene locus_tag LOCUS_26510 gene rplM 4093 3626 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MA33 protein_id gnl|my_center|LOCUS_26510 4864 4349 gene locus_tag LOCUS_26520 4864 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 5349 4927 gene locus_tag LOCUS_26530 5349 4927 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975057.1 protein_id gnl|my_center|LOCUS_26530 5462 6271 gene locus_tag LOCUS_26540 gene fadB 5462 6271 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338959.1 protein_id gnl|my_center|LOCUS_26540 6285 6797 gene locus_tag LOCUS_26550 6285 6797 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532199.1 protein_id gnl|my_center|LOCUS_26550 6991 6794 gene locus_tag LOCUS_26560 6991 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 7029 7949 gene locus_tag LOCUS_26570 7029 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 7981 8406 gene locus_tag LOCUS_26580 gene hisI 7981 8406 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GZS0 protein_id gnl|my_center|LOCUS_26580 8792 8391 gene locus_tag LOCUS_26590 8792 8391 CDS product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889218.1 protein_id gnl|my_center|LOCUS_26590 10008 8797 gene locus_tag LOCUS_26600 10008 8797 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089466.1 protein_id gnl|my_center|LOCUS_26600 11788 10133 gene locus_tag LOCUS_26610 11788 10133 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003341224.1 protein_id gnl|my_center|LOCUS_26610 12567 11800 gene locus_tag LOCUS_26620 12567 11800 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763805.1 protein_id gnl|my_center|LOCUS_26620 13309 12572 gene locus_tag LOCUS_26630 13309 12572 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_26630 14037 13306 gene locus_tag LOCUS_26640 gene ilvE2 14037 13306 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_26640 >Feature sequence122 1527 949 gene locus_tag LOCUS_26650 1527 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 3892 1529 gene locus_tag LOCUS_26660 gene bamA 3892 1529 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU01 protein_id gnl|my_center|LOCUS_26660 5147 4059 gene locus_tag LOCUS_26670 5147 4059 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU02 protein_id gnl|my_center|LOCUS_26670 6335 5169 gene locus_tag LOCUS_26680 gene dxr 6335 5169 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU03 protein_id gnl|my_center|LOCUS_26680 7195 6332 gene locus_tag LOCUS_26690 gene cdsA 7195 6332 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q50 protein_id gnl|my_center|LOCUS_26690 7950 7192 gene locus_tag LOCUS_26700 gene uppS 7950 7192 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFL9 protein_id gnl|my_center|LOCUS_26700 8496 7954 gene locus_tag LOCUS_26710 gene frr 8496 7954 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8K5 protein_id gnl|my_center|LOCUS_26710 9346 8618 gene locus_tag LOCUS_26720 gene pyrH 9346 8618 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU07 protein_id gnl|my_center|LOCUS_26720 10387 9461 gene locus_tag LOCUS_26730 gene tsf 10387 9461 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU08 protein_id gnl|my_center|LOCUS_26730 11423 10584 gene locus_tag LOCUS_26740 gene rpsB 11423 10584 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU09 protein_id gnl|my_center|LOCUS_26740 13386 11596 gene locus_tag LOCUS_26750 13386 11596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810841.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence123 767 1057 gene locus_tag LOCUS_26760 767 1057 CDS product UPF0335 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM19 protein_id gnl|my_center|LOCUS_26760 1831 1058 gene locus_tag LOCUS_26770 1831 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 3159 1915 gene locus_tag LOCUS_26780 3159 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 5293 3161 gene locus_tag LOCUS_26790 gene ligA 5293 3161 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV5 protein_id gnl|my_center|LOCUS_26790 6965 5298 gene locus_tag LOCUS_26800 6965 5298 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV4 protein_id gnl|my_center|LOCUS_26800 7845 6985 gene locus_tag LOCUS_26810 gene bamD 7845 6985 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV3 protein_id gnl|my_center|LOCUS_26810 8889 7954 gene locus_tag LOCUS_26820 gene lpxC 8889 7954 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVV1 protein_id gnl|my_center|LOCUS_26820 10898 9204 gene locus_tag LOCUS_26830 gene ftsZ2 10898 9204 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIB1 protein_id gnl|my_center|LOCUS_26830 12284 11049 gene locus_tag LOCUS_26840 gene ftsA 12284 11049 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVU9 protein_id gnl|my_center|LOCUS_26840 13238 12345 gene locus_tag LOCUS_26850 gene ftsQ 13238 12345 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TF58 protein_id gnl|my_center|LOCUS_26850 <13900 13226 gene locus_tag LOCUS_26860 <13900 13226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RVU7:D-alanine--D-alanine ligase >Feature sequence124 1501 2118 gene locus_tag LOCUS_26870 1501 2118 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808006.1 protein_id gnl|my_center|LOCUS_26870 2105 3283 gene locus_tag LOCUS_26880 2105 3283 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807967.1 protein_id gnl|my_center|LOCUS_26880 4487 3285 gene locus_tag LOCUS_26890 4487 3285 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256967.1 protein_id gnl|my_center|LOCUS_26890 5281 4484 gene locus_tag LOCUS_26900 5281 4484 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_26900 6483 5290 gene locus_tag LOCUS_26910 6483 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 7624 6572 gene locus_tag LOCUS_26920 7624 6572 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227945.1 protein_id gnl|my_center|LOCUS_26920 8527 7628 gene locus_tag LOCUS_26930 8527 7628 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227944.1 protein_id gnl|my_center|LOCUS_26930 10479 8524 gene locus_tag LOCUS_26940 10479 8524 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391256.1 protein_id gnl|my_center|LOCUS_26940 11279 10476 gene locus_tag LOCUS_26950 11279 10476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_26950 12498 11338 gene locus_tag LOCUS_26960 12498 11338 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229659.1 protein_id gnl|my_center|LOCUS_26960 13178 12495 gene locus_tag LOCUS_26970 13178 12495 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064535.1 protein_id gnl|my_center|LOCUS_26970 >Feature sequence125 183 2282 gene locus_tag LOCUS_26980 gene glyS 183 2282 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ43 protein_id gnl|my_center|LOCUS_26980 2333 5002 gene locus_tag LOCUS_26990 2333 5002 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390706.1 protein_id gnl|my_center|LOCUS_26990 6529 5018 gene locus_tag LOCUS_27000 6529 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 7499 6618 gene locus_tag LOCUS_27010 gene mmsB 7499 6618 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972804.1 protein_id gnl|my_center|LOCUS_27010 7925 9487 gene locus_tag LOCUS_27020 7925 9487 CDS product thiamine pyrophosphate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706368.1 protein_id gnl|my_center|LOCUS_27020 9484 10662 gene locus_tag LOCUS_27030 9484 10662 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389823.1 protein_id gnl|my_center|LOCUS_27030 10665 11294 gene locus_tag LOCUS_27040 10665 11294 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529595.1 protein_id gnl|my_center|LOCUS_27040 11390 11677 gene locus_tag LOCUS_27050 11390 11677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 11847 12719 gene locus_tag LOCUS_27060 11847 12719 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529423.1 protein_id gnl|my_center|LOCUS_27060 12738 13646 gene locus_tag LOCUS_27070 12738 13646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_27070 >Feature sequence126 2194 458 gene locus_tag LOCUS_27080 2194 458 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085229.1 protein_id gnl|my_center|LOCUS_27080 2356 3141 gene locus_tag LOCUS_27090 2356 3141 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531814.1 protein_id gnl|my_center|LOCUS_27090 3155 4660 gene locus_tag LOCUS_27100 3155 4660 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAZ4 protein_id gnl|my_center|LOCUS_27100 4811 5827 gene locus_tag LOCUS_27110 4811 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 6950 5832 gene locus_tag LOCUS_27120 6950 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 7363 6947 gene locus_tag LOCUS_27130 7363 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 7785 7360 gene locus_tag LOCUS_27140 7785 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 8435 7782 gene locus_tag LOCUS_27150 8435 7782 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_27150 8773 8432 gene locus_tag LOCUS_27160 8773 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339024.1 protein_id gnl|my_center|LOCUS_27160 9594 8776 gene locus_tag LOCUS_27170 9594 8776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253471.1 protein_id gnl|my_center|LOCUS_27170 10646 9594 gene locus_tag LOCUS_27180 10646 9594 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128344.1 protein_id gnl|my_center|LOCUS_27180 11835 10684 gene locus_tag LOCUS_27190 11835 10684 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 protein_id gnl|my_center|LOCUS_27190 <13784 11835 gene locus_tag LOCUS_27200 <13784 11835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339007.1:TonB-dependent receptor >Feature sequence127 2703 2098 gene locus_tag LOCUS_27210 2703 2098 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532404.1 protein_id gnl|my_center|LOCUS_27210 2811 3509 gene locus_tag LOCUS_27220 2811 3509 CDS product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532405.1 protein_id gnl|my_center|LOCUS_27220 4997 3513 gene locus_tag LOCUS_27230 4997 3513 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389402.1 protein_id gnl|my_center|LOCUS_27230 6742 5195 gene locus_tag LOCUS_27240 6742 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930411.1 protein_id gnl|my_center|LOCUS_27240 6898 7350 gene locus_tag LOCUS_27250 gene nsrR 6898 7350 CDS product HTH-type transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ETF3 protein_id gnl|my_center|LOCUS_27250 8134 7358 gene locus_tag LOCUS_27260 8134 7358 CDS product iron-dicitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 protein_id gnl|my_center|LOCUS_27260 9081 8131 gene locus_tag LOCUS_27270 9081 8131 CDS product enterobactin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776629.1 protein_id gnl|my_center|LOCUS_27270 10070 9093 gene locus_tag LOCUS_27280 gene viuD 10070 9093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537650.1 protein_id gnl|my_center|LOCUS_27280 11056 10067 gene locus_tag LOCUS_27290 11056 10067 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259666.1 protein_id gnl|my_center|LOCUS_27290 11225 12091 gene locus_tag LOCUS_27300 11225 12091 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969781.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence128 1162 620 gene locus_tag LOCUS_27310 1162 620 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384239.1 protein_id gnl|my_center|LOCUS_27310 1330 2652 gene locus_tag LOCUS_27320 1330 2652 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056263.1 protein_id gnl|my_center|LOCUS_27320 3092 2676 gene locus_tag LOCUS_27330 3092 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 3163 4203 gene locus_tag LOCUS_27340 gene gmd 3163 4203 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_27340 4203 5159 gene locus_tag LOCUS_27350 gene fcl 4203 5159 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_27350 5172 6548 gene locus_tag LOCUS_27360 5172 6548 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703817.1 protein_id gnl|my_center|LOCUS_27360 6650 7480 gene locus_tag LOCUS_27370 6650 7480 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551552.1 protein_id gnl|my_center|LOCUS_27370 8575 7508 gene locus_tag LOCUS_27380 8575 7508 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387898.1 protein_id gnl|my_center|LOCUS_27380 9668 8655 gene locus_tag LOCUS_27390 9668 8655 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528521.1 protein_id gnl|my_center|LOCUS_27390 10598 9819 gene locus_tag LOCUS_27400 gene bztD 10598 9819 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722560.1 protein_id gnl|my_center|LOCUS_27400 12002 10623 gene locus_tag LOCUS_27410 gene bztC 12002 10623 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336959.1 protein_id gnl|my_center|LOCUS_27410 13206 12013 gene locus_tag LOCUS_27420 gene bztB 13206 12013 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722555.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence129 1213 695 gene locus_tag LOCUS_27430 1213 695 CDS product transporter DctQ-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707213.1 protein_id gnl|my_center|LOCUS_27430 2360 1323 gene locus_tag LOCUS_27440 2360 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3882 2599 gene locus_tag LOCUS_27450 3882 2599 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811630.1 protein_id gnl|my_center|LOCUS_27450 5695 4064 gene locus_tag LOCUS_27460 5695 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 6509 6213 gene locus_tag LOCUS_27470 6509 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 6534 7061 gene locus_tag LOCUS_27480 6534 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 7297 7779 gene locus_tag LOCUS_27490 7297 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975390.1 protein_id gnl|my_center|LOCUS_27490 8046 8306 gene locus_tag LOCUS_27500 8046 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 8512 10215 gene locus_tag LOCUS_27510 8512 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975387.1 protein_id gnl|my_center|LOCUS_27510 11676 13262 gene locus_tag LOCUS_27520 11676 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence130 471 1616 gene locus_tag LOCUS_27530 471 1616 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926041.1 protein_id gnl|my_center|LOCUS_27530 1613 2689 gene locus_tag LOCUS_27540 1613 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 2686 3579 gene locus_tag LOCUS_27550 2686 3579 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707175.1 protein_id gnl|my_center|LOCUS_27550 3576 4070 gene locus_tag LOCUS_27560 3576 4070 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929961.1 protein_id gnl|my_center|LOCUS_27560 4060 6426 gene locus_tag LOCUS_27570 4060 6426 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257971.1 protein_id gnl|my_center|LOCUS_27570 6458 6913 gene locus_tag LOCUS_27580 6458 6913 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083166.1 protein_id gnl|my_center|LOCUS_27580 6952 7461 gene locus_tag LOCUS_27590 6952 7461 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707919.1 protein_id gnl|my_center|LOCUS_27590 7458 8543 gene locus_tag LOCUS_27600 7458 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 9217 8558 gene locus_tag LOCUS_27610 9217 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 9543 10967 gene locus_tag LOCUS_27620 gene amiE 9543 10967 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229612.1 protein_id gnl|my_center|LOCUS_27620 10978 11736 gene locus_tag LOCUS_27630 gene maiA 10978 11736 CDS product maleate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFK2 protein_id gnl|my_center|LOCUS_27630 11733 13049 gene locus_tag LOCUS_27640 11733 13049 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815911.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence131 432 671 gene locus_tag LOCUS_27650 432 671 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391210.1 protein_id gnl|my_center|LOCUS_27650 684 1229 gene locus_tag LOCUS_27660 684 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 1226 2071 gene locus_tag LOCUS_27670 1226 2071 CDS product peptidase P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_27670 2099 2878 gene locus_tag LOCUS_27680 gene hyi 2099 2878 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QG1 protein_id gnl|my_center|LOCUS_27680 2875 3486 gene locus_tag LOCUS_27690 2875 3486 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919327.1 protein_id gnl|my_center|LOCUS_27690 3776 3513 gene locus_tag LOCUS_27700 3776 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 3700 4791 gene locus_tag LOCUS_27710 3700 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 4924 6189 gene locus_tag LOCUS_27720 4924 6189 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067724.1 protein_id gnl|my_center|LOCUS_27720 6325 7824 gene locus_tag LOCUS_27730 6325 7824 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809974.1 protein_id gnl|my_center|LOCUS_27730 7824 8924 gene locus_tag LOCUS_27740 7824 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710123.1 protein_id gnl|my_center|LOCUS_27740 9016 10017 gene locus_tag LOCUS_27750 9016 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527911.1 protein_id gnl|my_center|LOCUS_27750 10822 10064 gene locus_tag LOCUS_27760 10822 10064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521206.1 protein_id gnl|my_center|LOCUS_27760 11385 10852 gene locus_tag LOCUS_27770 11385 10852 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972012.1 protein_id gnl|my_center|LOCUS_27770 11765 11382 gene locus_tag LOCUS_27780 11765 11382 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972013.1 protein_id gnl|my_center|LOCUS_27780 11895 12833 gene locus_tag LOCUS_27790 gene gcvA 11895 12833 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence132 1098 649 gene locus_tag LOCUS_27800 gene dtd 1098 649 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FT1 protein_id gnl|my_center|LOCUS_27800 1690 1109 gene locus_tag LOCUS_27810 1690 1109 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP91 protein_id gnl|my_center|LOCUS_27810 1833 2198 gene locus_tag LOCUS_27820 1833 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 2667 2203 gene locus_tag LOCUS_27830 gene lrp 2667 2203 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222215.1 protein_id gnl|my_center|LOCUS_27830 2858 3790 gene locus_tag LOCUS_27840 2858 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390819.1 protein_id gnl|my_center|LOCUS_27840 3910 5526 gene locus_tag LOCUS_27850 3910 5526 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG14 protein_id gnl|my_center|LOCUS_27850 5581 7029 gene locus_tag LOCUS_27860 5581 7029 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 protein_id gnl|my_center|LOCUS_27860 7884 7063 gene locus_tag LOCUS_27870 7884 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 9744 7903 gene locus_tag LOCUS_27880 9744 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 10530 9754 gene locus_tag LOCUS_27890 10530 9754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105162.1 protein_id gnl|my_center|LOCUS_27890 11299 10550 gene locus_tag LOCUS_27900 gene yegL 11299 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76396 protein_id gnl|my_center|LOCUS_27900 12356 11466 gene locus_tag LOCUS_27910 12356 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970816.1 protein_id gnl|my_center|LOCUS_27910 >Feature sequence133 369 2750 gene locus_tag LOCUS_27920 369 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 2695 3426 gene locus_tag LOCUS_27930 2695 3426 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TJ02 protein_id gnl|my_center|LOCUS_27930 4227 3439 gene locus_tag LOCUS_27940 4227 3439 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106098.1 protein_id gnl|my_center|LOCUS_27940 4671 6692 gene locus_tag LOCUS_27950 4671 6692 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390492.1 protein_id gnl|my_center|LOCUS_27950 8669 7008 gene locus_tag LOCUS_27960 gene betA 8669 7008 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UH55 protein_id gnl|my_center|LOCUS_27960 9845 8676 gene locus_tag LOCUS_27970 gene yeaW 9845 8676 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067841.1 protein_id gnl|my_center|LOCUS_27970 9960 10937 gene locus_tag LOCUS_27980 9960 10937 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339123.1 protein_id gnl|my_center|LOCUS_27980 11647 10934 gene locus_tag LOCUS_27990 11647 10934 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530139.1 protein_id gnl|my_center|LOCUS_27990 <12952 11864 gene locus_tag LOCUS_28000 <12952 11864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388018.1:electron-transferring-flavoprotein dehydrogenase >Feature sequence134 <1 1079 gene locus_tag LOCUS_28010 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089435.1:choline dehydrogenase 1910 1098 gene locus_tag LOCUS_28020 1910 1098 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_28020 2069 2992 gene locus_tag LOCUS_28030 2069 2992 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_28030 3621 2989 gene locus_tag LOCUS_28040 3621 2989 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085711.1 protein_id gnl|my_center|LOCUS_28040 4868 3618 gene locus_tag LOCUS_28050 4868 3618 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194989.1 protein_id gnl|my_center|LOCUS_28050 5680 4874 gene locus_tag LOCUS_28060 5680 4874 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808825.1 protein_id gnl|my_center|LOCUS_28060 5990 5697 gene locus_tag LOCUS_28070 5990 5697 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113114.1 protein_id gnl|my_center|LOCUS_28070 6234 5992 gene locus_tag LOCUS_28080 6234 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28080 7517 6231 gene locus_tag LOCUS_28090 7517 6231 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368539.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28090 8277 7522 gene locus_tag LOCUS_28100 8277 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 9363 8359 gene locus_tag LOCUS_28110 9363 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368541.1 protein_id gnl|my_center|LOCUS_28110 9496 10593 gene locus_tag LOCUS_28120 9496 10593 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085565.1 protein_id gnl|my_center|LOCUS_28120 10590 11624 gene locus_tag LOCUS_28130 10590 11624 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119543.1 protein_id gnl|my_center|LOCUS_28130 11621 12343 gene locus_tag LOCUS_28140 11621 12343 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707195.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence135 1789 965 gene locus_tag LOCUS_28150 1789 965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_28150 2664 1795 gene locus_tag LOCUS_28160 2664 1795 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339520.1 protein_id gnl|my_center|LOCUS_28160 4111 2753 gene locus_tag LOCUS_28170 4111 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 5252 4146 gene locus_tag LOCUS_28180 5252 4146 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228038.1 protein_id gnl|my_center|LOCUS_28180 6777 5254 gene locus_tag LOCUS_28190 6777 5254 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815982.1 protein_id gnl|my_center|LOCUS_28190 7880 6774 gene locus_tag LOCUS_28200 7880 6774 CDS product 2-oxo-3-deoxygalactonate 6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887520.1 protein_id gnl|my_center|LOCUS_28200 8029 8940 gene locus_tag LOCUS_28210 8029 8940 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 protein_id gnl|my_center|LOCUS_28210 10565 8937 gene locus_tag LOCUS_28220 10565 8937 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 protein_id gnl|my_center|LOCUS_28220 11059 11952 gene locus_tag LOCUS_28230 11059 11952 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940569.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence136 <1 564 gene locus_tag LOCUS_28240 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RS40:uracil phosphoribosyltransferase 727 996 gene locus_tag LOCUS_28250 727 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265875.1 protein_id gnl|my_center|LOCUS_28250 1015 1929 gene locus_tag LOCUS_28260 1015 1929 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_28260 1926 2732 gene locus_tag LOCUS_28270 1926 2732 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947962.1 protein_id gnl|my_center|LOCUS_28270 2824 3606 gene locus_tag LOCUS_28280 2824 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 3700 4191 gene locus_tag LOCUS_28290 3700 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 4318 5532 gene locus_tag LOCUS_28300 4318 5532 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187603.1 protein_id gnl|my_center|LOCUS_28300 5623 6117 gene locus_tag LOCUS_28310 5623 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310724.1 protein_id gnl|my_center|LOCUS_28310 7826 6351 gene locus_tag LOCUS_28320 gene davD 7826 6351 CDS product glutarate-semialdehyde dehydrogenase DavD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6M5 protein_id gnl|my_center|LOCUS_28320 8583 8023 gene locus_tag LOCUS_28330 gene ligT 8583 8023 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89X57 protein_id gnl|my_center|LOCUS_28330 9681 8629 gene locus_tag LOCUS_28340 9681 8629 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930118.1 protein_id gnl|my_center|LOCUS_28340 10934 9786 gene locus_tag LOCUS_28350 10934 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 11580 10951 gene locus_tag LOCUS_28360 11580 10951 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_28360 11630 12361 gene locus_tag LOCUS_28370 11630 12361 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391398.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence137 208 456 gene locus_tag LOCUS_28380 208 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 1116 679 gene locus_tag LOCUS_28390 1116 679 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968167.1 protein_id gnl|my_center|LOCUS_28390 1302 1766 gene locus_tag LOCUS_28400 1302 1766 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316827.1 protein_id gnl|my_center|LOCUS_28400 1936 2553 gene locus_tag LOCUS_28410 1936 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3372 2620 gene locus_tag LOCUS_28420 3372 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3972 3559 gene locus_tag LOCUS_28430 3972 3559 CDS product rifampin ADP-ribosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 protein_id gnl|my_center|LOCUS_28430 4868 4500 gene locus_tag LOCUS_28440 4868 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 4916 5308 gene locus_tag LOCUS_28450 gene hmrR 4916 5308 CDS product HTH-type transcriptional regulator HmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X5X4 protein_id gnl|my_center|LOCUS_28450 6223 5369 gene locus_tag LOCUS_28460 6223 5369 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336969.1 protein_id gnl|my_center|LOCUS_28460 7175 6216 gene locus_tag LOCUS_28470 7175 6216 CDS product N-carbamoyl-D-amino-acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537674.1 protein_id gnl|my_center|LOCUS_28470 8108 7179 gene locus_tag LOCUS_28480 8108 7179 CDS product chitin deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061422.1 protein_id gnl|my_center|LOCUS_28480 8415 8113 gene locus_tag LOCUS_28490 8415 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 9327 8431 gene locus_tag LOCUS_28500 gene tfdA 9327 8431 CDS product alpha-ketoglutarate-dependent 2,4-dichlorophenoxyacetate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930493.1 protein_id gnl|my_center|LOCUS_28500 9434 10339 gene locus_tag LOCUS_28510 9434 10339 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388364.1 protein_id gnl|my_center|LOCUS_28510 11199 10366 gene locus_tag LOCUS_28520 11199 10366 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211684.1 protein_id gnl|my_center|LOCUS_28520 11318 12358 gene locus_tag LOCUS_28530 11318 12358 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030039.1 protein_id gnl|my_center|LOCUS_28530 12577 12359 gene locus_tag LOCUS_28540 12577 12359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence138 200 625 gene locus_tag LOCUS_28550 200 625 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454456.1 protein_id gnl|my_center|LOCUS_28550 642 1532 gene locus_tag LOCUS_28560 642 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 1529 2584 gene locus_tag LOCUS_28570 1529 2584 CDS product hemin ABC transporter membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529789.1 protein_id gnl|my_center|LOCUS_28570 2581 3351 gene locus_tag LOCUS_28580 gene hmuV 2581 3351 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBZ3 protein_id gnl|my_center|LOCUS_28580 3441 4742 gene locus_tag LOCUS_28590 gene fahA 3441 4742 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204081.1 protein_id gnl|my_center|LOCUS_28590 5798 4890 gene locus_tag LOCUS_28600 5798 4890 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186868.1 protein_id gnl|my_center|LOCUS_28600 6049 5804 gene locus_tag LOCUS_28610 6049 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 6498 6097 gene locus_tag LOCUS_28620 6498 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 7729 6503 gene locus_tag LOCUS_28630 7729 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 7856 8866 gene locus_tag LOCUS_28640 7856 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 10006 8876 gene locus_tag LOCUS_28650 10006 8876 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388449.1 protein_id gnl|my_center|LOCUS_28650 10246 10767 gene locus_tag LOCUS_28660 10246 10767 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315770.1 protein_id gnl|my_center|LOCUS_28660 10773 12233 gene locus_tag LOCUS_28670 10773 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence139 <1 656 gene locus_tag LOCUS_28680 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104622.1:phenazine biosynthesis family protein 1656 673 gene locus_tag LOCUS_28690 1656 673 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266140.1 protein_id gnl|my_center|LOCUS_28690 3059 1653 gene locus_tag LOCUS_28700 3059 1653 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331280.1 protein_id gnl|my_center|LOCUS_28700 4554 3046 gene locus_tag LOCUS_28710 gene dhaL 4554 3046 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331281.1 protein_id gnl|my_center|LOCUS_28710 5475 4558 gene locus_tag LOCUS_28720 5475 4558 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331282.1 protein_id gnl|my_center|LOCUS_28720 5732 6166 gene locus_tag LOCUS_28730 5732 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 6333 6190 gene locus_tag LOCUS_28740 6333 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 6560 6330 gene locus_tag LOCUS_28750 6560 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 7799 6714 gene locus_tag LOCUS_28760 7799 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 8305 7781 gene locus_tag LOCUS_28770 8305 7781 CDS product lytic transglycosylase catalytic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393114.1 protein_id gnl|my_center|LOCUS_28770 8654 8298 gene locus_tag LOCUS_28780 8654 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 9127 8651 gene locus_tag LOCUS_28790 9127 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 9717 9127 gene locus_tag LOCUS_28800 9717 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 10037 9714 gene locus_tag LOCUS_28810 10037 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 10213 10040 gene locus_tag LOCUS_28820 10213 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 10662 10225 gene locus_tag LOCUS_28830 10662 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 10892 10662 gene locus_tag LOCUS_28840 10892 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 11885 10908 gene locus_tag LOCUS_28850 11885 10908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 >Feature sequence140 <1 1207 gene locus_tag LOCUS_28860 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530888.1:glycine cleavage system protein T 1276 2004 gene locus_tag LOCUS_28870 1276 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532751.1 protein_id gnl|my_center|LOCUS_28870 2454 2005 gene locus_tag LOCUS_28880 2454 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 3077 2556 gene locus_tag LOCUS_28890 3077 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 3520 3161 gene locus_tag LOCUS_28900 3520 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 4473 3589 gene locus_tag LOCUS_28910 4473 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 5765 4614 gene locus_tag LOCUS_28920 5765 4614 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530004.1 protein_id gnl|my_center|LOCUS_28920 6575 5775 gene locus_tag LOCUS_28930 6575 5775 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWP8 protein_id gnl|my_center|LOCUS_28930 7675 6575 gene locus_tag LOCUS_28940 7675 6575 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_28940 8511 7672 gene locus_tag LOCUS_28950 gene lgt 8511 7672 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UDB4 protein_id gnl|my_center|LOCUS_28950 9534 8551 gene locus_tag LOCUS_28960 gene hldD 9534 8551 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP72 protein_id gnl|my_center|LOCUS_28960 9665 9991 gene locus_tag LOCUS_28970 9665 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 10146 10871 gene locus_tag LOCUS_28980 10146 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 11586 10906 gene locus_tag LOCUS_28990 gene ttdB 11586 10906 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339079.1 protein_id gnl|my_center|LOCUS_28990 <12357 11547 gene locus_tag LOCUS_29000 <12357 11547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339080.1:fumarate hydratase >Feature sequence141 495 1655 gene locus_tag LOCUS_29010 gene hisZ 495 1655 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD9 protein_id gnl|my_center|LOCUS_29010 1667 2959 gene locus_tag LOCUS_29020 gene purA 1667 2959 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD8 protein_id gnl|my_center|LOCUS_29020 3072 5102 gene locus_tag LOCUS_29030 3072 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388862.1 protein_id gnl|my_center|LOCUS_29030 5139 5837 gene locus_tag LOCUS_29040 5139 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 6778 5891 gene locus_tag LOCUS_29050 gene rpoH 6778 5891 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVD4 protein_id gnl|my_center|LOCUS_29050 7056 7556 gene locus_tag LOCUS_29060 7056 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 7673 8161 gene locus_tag LOCUS_29070 gene bfr 7673 8161 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63NC8 protein_id gnl|my_center|LOCUS_29070 8570 8382 gene locus_tag LOCUS_29080 8570 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 9692 8655 gene locus_tag LOCUS_29090 9692 8655 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAY9 protein_id gnl|my_center|LOCUS_29090 9746 10123 gene locus_tag LOCUS_29100 9746 10123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence142 6360 9545 gene locus_tag LOCUS_29110 6360 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 9582 9983 gene locus_tag LOCUS_29120 9582 9983 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530151.1 protein_id gnl|my_center|LOCUS_29120 11017 9980 gene locus_tag LOCUS_29130 11017 9980 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919204.1 protein_id gnl|my_center|LOCUS_29130 >Feature sequence143 894 148 gene locus_tag LOCUS_29140 gene pcaH 894 148 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385629.1 protein_id gnl|my_center|LOCUS_29140 2822 897 gene locus_tag LOCUS_29150 2822 897 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459204.1 protein_id gnl|my_center|LOCUS_29150 3802 2819 gene locus_tag LOCUS_29160 3802 2819 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336881.1 protein_id gnl|my_center|LOCUS_29160 5312 3825 gene locus_tag LOCUS_29170 gene betB 5312 3825 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNN4 protein_id gnl|my_center|LOCUS_29170 6714 5434 gene locus_tag LOCUS_29180 6714 5434 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083890.1 protein_id gnl|my_center|LOCUS_29180 6833 7777 gene locus_tag LOCUS_29190 6833 7777 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225962.1 protein_id gnl|my_center|LOCUS_29190 7818 8933 gene locus_tag LOCUS_29200 7818 8933 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040700.1 protein_id gnl|my_center|LOCUS_29200 8957 9946 gene locus_tag LOCUS_29210 8957 9946 CDS product 4,5-dihydroxyphthalate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038796.1 protein_id gnl|my_center|LOCUS_29210 10490 9951 gene locus_tag LOCUS_29220 10490 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 10904 10662 gene locus_tag LOCUS_29230 10904 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence144 2 1093 gene locus_tag LOCUS_29240 2 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 1113 2648 gene locus_tag LOCUS_29250 1113 2648 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389442.1 protein_id gnl|my_center|LOCUS_29250 2670 4121 gene locus_tag LOCUS_29260 gene nuoN 2670 4121 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU27 protein_id gnl|my_center|LOCUS_29260 4178 4843 gene locus_tag LOCUS_29270 4178 4843 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389444.1 protein_id gnl|my_center|LOCUS_29270 4856 5632 gene locus_tag LOCUS_29280 gene coaX 4856 5632 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU25 protein_id gnl|my_center|LOCUS_29280 5629 7299 gene locus_tag LOCUS_29290 5629 7299 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389446.1 protein_id gnl|my_center|LOCUS_29290 7324 7728 gene locus_tag LOCUS_29300 7324 7728 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531105.1 protein_id gnl|my_center|LOCUS_29300 7734 7970 gene locus_tag LOCUS_29310 7734 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 8071 8628 gene locus_tag LOCUS_29320 gene tag 8071 8628 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037880.1 protein_id gnl|my_center|LOCUS_29320 9851 8640 gene locus_tag LOCUS_29330 9851 8640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 11141 9891 gene locus_tag LOCUS_29340 gene amaB 11141 9891 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811711.1 protein_id gnl|my_center|LOCUS_29340 11206 11799 gene locus_tag LOCUS_29350 11206 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 >Feature sequence145 461 240 gene locus_tag LOCUS_29360 gene rpmE 461 240 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM38 protein_id gnl|my_center|LOCUS_29360 686 958 gene locus_tag LOCUS_29370 686 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 1055 1705 gene locus_tag LOCUS_29380 gene ychE 1055 1705 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_29380 2095 1715 gene locus_tag LOCUS_29390 2095 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 2453 2695 gene locus_tag LOCUS_29400 2453 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 2855 5200 gene locus_tag LOCUS_29410 2855 5200 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389862.1 protein_id gnl|my_center|LOCUS_29410 5368 6795 gene locus_tag LOCUS_29420 5368 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 7383 6829 gene locus_tag LOCUS_29430 7383 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 7627 8028 gene locus_tag LOCUS_29440 7627 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 8069 9481 gene locus_tag LOCUS_29450 8069 9481 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224963.1 protein_id gnl|my_center|LOCUS_29450 10061 9525 gene locus_tag LOCUS_29460 10061 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 11299 10058 gene locus_tag LOCUS_29470 11299 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388809.1 protein_id gnl|my_center|LOCUS_29470 11840 11400 gene locus_tag LOCUS_29480 11840 11400 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970461.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence146 <1 822 gene locus_tag LOCUS_29490 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528635.1:sorbosone dehydrogenase 903 1220 gene locus_tag LOCUS_29500 903 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 1620 1381 gene locus_tag LOCUS_29510 1620 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 1911 2120 gene locus_tag LOCUS_29520 1911 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2757 2095 gene locus_tag LOCUS_29530 gene msrA 2757 2095 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 protein_id gnl|my_center|LOCUS_29530 3805 2840 gene locus_tag LOCUS_29540 3805 2840 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974368.1 protein_id gnl|my_center|LOCUS_29540 5099 3897 gene locus_tag LOCUS_29550 5099 3897 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404011.1 protein_id gnl|my_center|LOCUS_29550 6737 5220 gene locus_tag LOCUS_29560 6737 5220 CDS product 3-polyprenyl-4-hydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388332.1 protein_id gnl|my_center|LOCUS_29560 6844 8001 gene locus_tag LOCUS_29570 6844 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 8028 8351 gene locus_tag LOCUS_29580 8028 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 8449 8829 gene locus_tag LOCUS_29590 8449 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389509.1 protein_id gnl|my_center|LOCUS_29590 8826 9548 gene locus_tag LOCUS_29600 8826 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 10146 9538 gene locus_tag LOCUS_29610 10146 9538 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141420.1 protein_id gnl|my_center|LOCUS_29610 10283 11023 gene locus_tag LOCUS_29620 10283 11023 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728051.1 protein_id gnl|my_center|LOCUS_29620 >Feature sequence147 1523 1789 gene locus_tag LOCUS_29630 1523 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 2343 1921 gene locus_tag LOCUS_29640 2343 1921 CDS product histidine triad protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104815.1 protein_id gnl|my_center|LOCUS_29640 3257 2340 gene locus_tag LOCUS_29650 gene psuG 3257 2340 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNP3 protein_id gnl|my_center|LOCUS_29650 3365 4633 gene locus_tag LOCUS_29660 3365 4633 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 protein_id gnl|my_center|LOCUS_29660 5585 4635 gene locus_tag LOCUS_29670 5585 4635 CDS product DMSO reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 protein_id gnl|my_center|LOCUS_29670 6338 5592 gene locus_tag LOCUS_29680 6338 5592 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 protein_id gnl|my_center|LOCUS_29680 9328 6335 gene locus_tag LOCUS_29690 9328 6335 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533669.1 protein_id gnl|my_center|LOCUS_29690 10110 9352 gene locus_tag LOCUS_29700 10110 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29700 11042 10107 gene locus_tag LOCUS_29710 11042 10107 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSJ5 protein_id gnl|my_center|LOCUS_29710 11259 11483 gene locus_tag LOCUS_29720 11259 11483 CDS product response regulator SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920728.1 protein_id gnl|my_center|LOCUS_29720 11813 11502 gene locus_tag LOCUS_29730 11813 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 >Feature sequence148 446 2368 gene locus_tag LOCUS_29740 gene mnmC 446 2368 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_29740 2463 2387 gene locus_tag LOCUS_t00280 2463 2387 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2811 4115 gene locus_tag LOCUS_29750 2811 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 4241 5410 gene locus_tag LOCUS_29760 4241 5410 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529745.1 protein_id gnl|my_center|LOCUS_29760 7637 5442 gene locus_tag LOCUS_29770 7637 5442 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084021.1 protein_id gnl|my_center|LOCUS_29770 7917 10769 gene locus_tag LOCUS_29780 gene uvrA 7917 10769 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTJ3 protein_id gnl|my_center|LOCUS_29780 10774 11178 gene locus_tag LOCUS_29790 10774 11178 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710162.1 protein_id gnl|my_center|LOCUS_29790 11543 11175 gene locus_tag LOCUS_29800 11543 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 >Feature sequence149 <1 656 gene locus_tag LOCUS_29810 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931320.1:glycosyl transferase 646 1422 gene locus_tag LOCUS_29820 646 1422 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533049.1 protein_id gnl|my_center|LOCUS_29820 1516 1857 gene locus_tag LOCUS_29830 1516 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 1873 2352 gene locus_tag LOCUS_29840 1873 2352 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532155.1 protein_id gnl|my_center|LOCUS_29840 2346 2867 gene locus_tag LOCUS_29850 2346 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 3800 2859 gene locus_tag LOCUS_29860 3800 2859 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_29860 4106 4975 gene locus_tag LOCUS_29870 4106 4975 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSH8 protein_id gnl|my_center|LOCUS_29870 5020 6339 gene locus_tag LOCUS_29880 5020 6339 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920240.1 protein_id gnl|my_center|LOCUS_29880 6361 7761 gene locus_tag LOCUS_29890 6361 7761 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387756.1 protein_id gnl|my_center|LOCUS_29890 7768 8472 gene locus_tag LOCUS_29900 7768 8472 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968837.1 protein_id gnl|my_center|LOCUS_29900 9890 8475 gene locus_tag LOCUS_29910 9890 8475 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_29910 10309 9911 gene locus_tag LOCUS_29920 10309 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314952.1 protein_id gnl|my_center|LOCUS_29920 <11822 10394 gene locus_tag LOCUS_29930 <11822 10394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89RW1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence150 301 2730 gene locus_tag LOCUS_29940 301 2730 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531196.1 protein_id gnl|my_center|LOCUS_29940 2839 4974 gene locus_tag LOCUS_29950 2839 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159898.1 protein_id gnl|my_center|LOCUS_29950 4961 5650 gene locus_tag LOCUS_29960 4961 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112393.1 protein_id gnl|my_center|LOCUS_29960 6384 6614 gene locus_tag LOCUS_29970 6384 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710070.1 protein_id gnl|my_center|LOCUS_29970 6647 6922 gene locus_tag LOCUS_29980 6647 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 7164 7385 gene locus_tag LOCUS_29990 7164 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 7777 7298 gene locus_tag LOCUS_30000 gene aroQ 7777 7298 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89V57 protein_id gnl|my_center|LOCUS_30000 8406 7957 gene locus_tag LOCUS_30010 8406 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968939.1 protein_id gnl|my_center|LOCUS_30010 8784 8416 gene locus_tag LOCUS_30020 8784 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530105.1 protein_id gnl|my_center|LOCUS_30020 9160 8879 gene locus_tag LOCUS_30030 9160 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 9310 9948 gene locus_tag LOCUS_30040 9310 9948 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143585.1 protein_id gnl|my_center|LOCUS_30040 10029 10811 gene locus_tag LOCUS_30050 10029 10811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143584.1 protein_id gnl|my_center|LOCUS_30050 10870 11430 gene locus_tag LOCUS_30060 10870 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083985.1 protein_id gnl|my_center|LOCUS_30060 >Feature sequence151 2392 833 gene locus_tag LOCUS_30070 2392 833 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089326.1 protein_id gnl|my_center|LOCUS_30070 4014 2392 gene locus_tag LOCUS_30080 4014 2392 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_30080 4182 4865 gene locus_tag LOCUS_30090 4182 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 5952 4876 gene locus_tag LOCUS_30100 5952 4876 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532960.1 protein_id gnl|my_center|LOCUS_30100 9099 5962 gene locus_tag LOCUS_30110 9099 5962 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389847.1 protein_id gnl|my_center|LOCUS_30110 10279 9164 gene locus_tag LOCUS_30120 10279 9164 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389848.1 protein_id gnl|my_center|LOCUS_30120 11100 10432 gene locus_tag LOCUS_30130 11100 10432 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970020.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence152 529 104 gene locus_tag LOCUS_30140 529 104 CDS product DUF4864 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085003.1 protein_id gnl|my_center|LOCUS_30140 1796 648 gene locus_tag LOCUS_30150 1796 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391064.1 protein_id gnl|my_center|LOCUS_30150 2339 2415 gene locus_tag LOCUS_t00290 2339 2415 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2753 3265 gene locus_tag LOCUS_30160 2753 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 3335 3796 gene locus_tag LOCUS_30170 gene mmcB 3335 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921296.1 protein_id gnl|my_center|LOCUS_30170 5464 3989 gene locus_tag LOCUS_30180 gene hldE 5464 3989 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RY67 protein_id gnl|my_center|LOCUS_30180 6265 5504 gene locus_tag LOCUS_30190 6265 5504 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390859.1 protein_id gnl|my_center|LOCUS_30190 8474 6321 gene locus_tag LOCUS_30200 8474 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 8723 9355 gene locus_tag LOCUS_30210 8723 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 10424 9639 gene locus_tag LOCUS_30220 10424 9639 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390243.1 protein_id gnl|my_center|LOCUS_30220 >Feature sequence153 77 151 gene locus_tag LOCUS_t00300 77 151 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 765 202 gene locus_tag LOCUS_30230 765 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 1008 2324 gene locus_tag LOCUS_30240 1008 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 2314 3606 gene locus_tag LOCUS_30250 gene mxdB 2314 3606 CDS product glycosyl transferase family 2 MxdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073868.1 protein_id gnl|my_center|LOCUS_30250 3603 4607 gene locus_tag LOCUS_30260 3603 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 5579 4620 gene locus_tag LOCUS_30270 5579 4620 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972330.1 protein_id gnl|my_center|LOCUS_30270 6633 5659 gene locus_tag LOCUS_30280 6633 5659 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404321.1 protein_id gnl|my_center|LOCUS_30280 7177 6686 gene locus_tag LOCUS_30290 7177 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 7521 7183 gene locus_tag LOCUS_30300 7521 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 7666 9714 gene locus_tag LOCUS_30310 7666 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 9716 10087 gene locus_tag LOCUS_30320 9716 10087 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086522.1 protein_id gnl|my_center|LOCUS_30320 10169 10696 gene locus_tag LOCUS_30330 10169 10696 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_30330 >Feature sequence154 <1 1155 gene locus_tag LOCUS_30340 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706481.1:diguanylate cyclase 1281 2477 gene locus_tag LOCUS_30350 1281 2477 CDS product (2Fe-2S) ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_30350 3148 2480 gene locus_tag LOCUS_30360 gene gmk 3148 2480 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXB1 protein_id gnl|my_center|LOCUS_30360 4016 3141 gene locus_tag LOCUS_30370 4016 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_30370 4110 4853 gene locus_tag LOCUS_30380 4110 4853 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_30380 6110 5040 gene locus_tag LOCUS_30390 6110 5040 CDS product peptidase C45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974954.1 protein_id gnl|my_center|LOCUS_30390 7846 6140 gene locus_tag LOCUS_30400 7846 6140 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950580.1 protein_id gnl|my_center|LOCUS_30400 10677 7876 gene locus_tag LOCUS_30410 10677 7876 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086258.1 protein_id gnl|my_center|LOCUS_30410 <11586 10674 gene locus_tag LOCUS_30420 <11586 10674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860835.1:carbon-nitrogen hydrolase >Feature sequence155 <1 1011 gene locus_tag LOCUS_30430 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MHJ2:cytochrome c oxidase subunit 1 1104 2015 gene locus_tag LOCUS_30440 gene ctaB 1104 2015 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJX3 protein_id gnl|my_center|LOCUS_30440 2041 2211 gene locus_tag LOCUS_30450 2041 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 2222 2818 gene locus_tag LOCUS_30460 gene ctaG 2222 2818 CDS product cytochrome c oxidase assembly protein CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5F7 protein_id gnl|my_center|LOCUS_30460 2929 3768 gene locus_tag LOCUS_30470 2929 3768 CDS product cytochrome B562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 protein_id gnl|my_center|LOCUS_30470 3886 4257 gene locus_tag LOCUS_30480 3886 4257 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971138.1 protein_id gnl|my_center|LOCUS_30480 4263 4982 gene locus_tag LOCUS_30490 gene surf1 4263 4982 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJX1 protein_id gnl|my_center|LOCUS_30490 4979 6478 gene locus_tag LOCUS_30500 4979 6478 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_30500 6481 7323 gene locus_tag LOCUS_30510 6481 7323 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809983.1 protein_id gnl|my_center|LOCUS_30510 7333 8736 gene locus_tag LOCUS_30520 gene thrC 7333 8736 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29363 protein_id gnl|my_center|LOCUS_30520 8733 9998 gene locus_tag LOCUS_30530 8733 9998 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_30530 10114 10620 gene locus_tag LOCUS_30540 gene rimJ 10114 10620 CDS product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence156 493 278 gene locus_tag LOCUS_30550 493 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 1406 708 gene locus_tag LOCUS_30560 gene ligE 1406 708 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090161.1 protein_id gnl|my_center|LOCUS_30560 1603 1676 gene locus_tag LOCUS_t00310 1603 1676 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1726 2448 gene locus_tag LOCUS_30570 gene rlmE 1726 2448 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXU5 protein_id gnl|my_center|LOCUS_30570 2510 4252 gene locus_tag LOCUS_30580 2510 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 4448 5911 gene locus_tag LOCUS_30590 gene guaB 4448 5911 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXU6 protein_id gnl|my_center|LOCUS_30590 5922 6170 gene locus_tag LOCUS_30600 5922 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546808.1 protein_id gnl|my_center|LOCUS_30600 6167 7504 gene locus_tag LOCUS_30610 6167 7504 CDS product rRNA cytosine-C5-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_30610 7558 7953 gene locus_tag LOCUS_30620 7558 7953 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087239.1 protein_id gnl|my_center|LOCUS_30620 8024 9592 gene locus_tag LOCUS_30630 gene guaA 8024 9592 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXI5 protein_id gnl|my_center|LOCUS_30630 9642 10994 gene locus_tag LOCUS_30640 9642 10994 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967826.1 protein_id gnl|my_center|LOCUS_30640 >Feature sequence157 1322 402 gene locus_tag LOCUS_30650 1322 402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 protein_id gnl|my_center|LOCUS_30650 2404 1319 gene locus_tag LOCUS_30660 2404 1319 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUT0 protein_id gnl|my_center|LOCUS_30660 3517 2480 gene locus_tag LOCUS_30670 gene potD 3517 2480 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_30670 3648 4517 gene locus_tag LOCUS_30680 3648 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 6360 4525 gene locus_tag LOCUS_30690 gene nolO 6360 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887298.1 protein_id gnl|my_center|LOCUS_30690 6523 6374 gene locus_tag LOCUS_30700 6523 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_30700 6978 6550 gene locus_tag LOCUS_30710 6978 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975330.1 protein_id gnl|my_center|LOCUS_30710 7282 7782 gene locus_tag LOCUS_30720 7282 7782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 7889 8944 gene locus_tag LOCUS_30730 7889 8944 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXY8 protein_id gnl|my_center|LOCUS_30730 8953 9846 gene locus_tag LOCUS_30740 8953 9846 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A953 protein_id gnl|my_center|LOCUS_30740 9843 10394 gene locus_tag LOCUS_30750 gene rmlC 9843 10394 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035866.1 protein_id gnl|my_center|LOCUS_30750 10391 11296 gene locus_tag LOCUS_30760 10391 11296 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061654.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence158 <1 1045 gene locus_tag LOCUS_30770 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533412.1:CoA transferase 1468 1052 gene locus_tag LOCUS_30780 1468 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 3144 1471 gene locus_tag LOCUS_30790 3144 1471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974601.1 protein_id gnl|my_center|LOCUS_30790 4355 3141 gene locus_tag LOCUS_30800 4355 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 5358 4372 gene locus_tag LOCUS_30810 5358 4372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 protein_id gnl|my_center|LOCUS_30810 5657 6754 gene locus_tag LOCUS_30820 5657 6754 CDS product D-amino-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528042.1 protein_id gnl|my_center|LOCUS_30820 6759 8165 gene locus_tag LOCUS_30830 6759 8165 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089472.1 protein_id gnl|my_center|LOCUS_30830 8772 8182 gene locus_tag LOCUS_30840 8772 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 9840 8803 gene locus_tag LOCUS_30850 9840 8803 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020716.1 protein_id gnl|my_center|LOCUS_30850 10253 9837 gene locus_tag LOCUS_30860 gene mgsA 10253 9837 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7N5 protein_id gnl|my_center|LOCUS_30860 10538 10260 gene locus_tag LOCUS_30870 10538 10260 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312913.1 protein_id gnl|my_center|LOCUS_30870 11357 10557 gene locus_tag LOCUS_30880 11357 10557 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709586.1 protein_id gnl|my_center|LOCUS_30880 >Feature sequence159 <1 1493 gene locus_tag LOCUS_30890 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388726.1:4-diphosphocytidyl-2C-methyl-D-erythritol kinase 1565 2869 gene locus_tag LOCUS_30900 1565 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 3126 3245 gene locus_tag LOCUS_30910 3126 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 3928 3320 gene locus_tag LOCUS_30920 3928 3320 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975865.1 protein_id gnl|my_center|LOCUS_30920 4346 4029 gene locus_tag LOCUS_30930 4346 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 4700 4879 gene locus_tag LOCUS_30940 4700 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 4907 5191 gene locus_tag LOCUS_30950 4907 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 8702 5196 gene locus_tag LOCUS_30960 8702 5196 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU13 protein_id gnl|my_center|LOCUS_30960 9687 8794 gene locus_tag LOCUS_30970 9687 8794 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531192.1 protein_id gnl|my_center|LOCUS_30970 9823 10761 gene locus_tag LOCUS_30980 9823 10761 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201242.1 protein_id gnl|my_center|LOCUS_30980 <11296 10784 gene locus_tag LOCUS_30990 <11296 10784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222366.1:ornithine cyclodeaminase >Feature sequence160 77 772 gene locus_tag LOCUS_31000 77 772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888236.1 protein_id gnl|my_center|LOCUS_31000 979 1593 gene locus_tag LOCUS_31010 gene rpsD 979 1593 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWJ0 protein_id gnl|my_center|LOCUS_31010 3243 1675 gene locus_tag LOCUS_31020 3243 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3817 3398 gene locus_tag LOCUS_31030 3817 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461511.1 protein_id gnl|my_center|LOCUS_31030 5113 4040 gene locus_tag LOCUS_31040 gene ttuC 5113 4040 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886777.1 protein_id gnl|my_center|LOCUS_31040 6502 5189 gene locus_tag LOCUS_31050 6502 5189 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532282.1 protein_id gnl|my_center|LOCUS_31050 7384 6599 gene locus_tag LOCUS_31060 7384 6599 CDS product TIGR03084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731630.1 protein_id gnl|my_center|LOCUS_31060 8009 7386 gene locus_tag LOCUS_31070 8009 7386 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_31070 8234 10675 gene locus_tag LOCUS_31080 8234 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 >Feature sequence161 122 568 gene locus_tag LOCUS_31090 122 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 572 1327 gene locus_tag LOCUS_31100 572 1327 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_31100 1339 2298 gene locus_tag LOCUS_31110 1339 2298 CDS product hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064007.1 protein_id gnl|my_center|LOCUS_31110 2302 2649 gene locus_tag LOCUS_31120 2302 2649 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088099.1 protein_id gnl|my_center|LOCUS_31120 2736 3266 gene locus_tag LOCUS_31130 2736 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 3707 4258 gene locus_tag LOCUS_31140 3707 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 4424 7870 gene locus_tag LOCUS_31150 4424 7870 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVC3 protein_id gnl|my_center|LOCUS_31150 9691 7871 gene locus_tag LOCUS_31160 9691 7871 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086742.1 protein_id gnl|my_center|LOCUS_31160 9763 10515 gene locus_tag LOCUS_31170 9763 10515 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089441.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence162 353 1939 gene locus_tag LOCUS_31180 353 1939 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527948.1 protein_id gnl|my_center|LOCUS_31180 2788 2003 gene locus_tag LOCUS_31190 2788 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 6248 2868 gene locus_tag LOCUS_31200 6248 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 7115 6303 gene locus_tag LOCUS_31210 7115 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 8061 7162 gene locus_tag LOCUS_31220 8061 7162 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113260.1 protein_id gnl|my_center|LOCUS_31220 8206 8814 gene locus_tag LOCUS_31230 8206 8814 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920810.1 protein_id gnl|my_center|LOCUS_31230 8818 9198 gene locus_tag LOCUS_31240 8818 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083764.1 protein_id gnl|my_center|LOCUS_31240 9209 9433 gene locus_tag LOCUS_31250 9209 9433 CDS product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSS2 protein_id gnl|my_center|LOCUS_31250 9476 10441 gene locus_tag LOCUS_31260 9476 10441 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087852.1 protein_id gnl|my_center|LOCUS_31260 10461 10787 gene locus_tag LOCUS_31270 10461 10787 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084888.1 protein_id gnl|my_center|LOCUS_31270 >Feature sequence163 <1 721 gene locus_tag LOCUS_31280 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031776.1:amino acid ABC transporter substrate-binding protein 1195 743 gene locus_tag LOCUS_31290 1195 743 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_31290 1474 2673 gene locus_tag LOCUS_31300 gene carA 1474 2673 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB3 protein_id gnl|my_center|LOCUS_31300 2837 3028 gene locus_tag LOCUS_31310 2837 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 2991 3893 gene locus_tag LOCUS_31320 2991 3893 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014665.1 protein_id gnl|my_center|LOCUS_31320 4991 3921 gene locus_tag LOCUS_31330 gene ltaA 4991 3921 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_31330 6146 5025 gene locus_tag LOCUS_31340 6146 5025 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389898.1 protein_id gnl|my_center|LOCUS_31340 6275 7537 gene locus_tag LOCUS_31350 6275 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 10532 7548 gene locus_tag LOCUS_31360 10532 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 >Feature sequence164 4828 6351 gene locus_tag LOCUS_31370 4828 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 6351 7112 gene locus_tag LOCUS_31380 6351 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 7184 8557 gene locus_tag LOCUS_31390 7184 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 8561 10705 gene locus_tag LOCUS_31400 8561 10705 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122785.1 protein_id gnl|my_center|LOCUS_31400 >Feature sequence165 2196 556 gene locus_tag LOCUS_31410 2196 556 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093598.1 protein_id gnl|my_center|LOCUS_31410 2374 3717 gene locus_tag LOCUS_31420 2374 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 3772 4437 gene locus_tag LOCUS_31430 3772 4437 CDS product polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337754.1 protein_id gnl|my_center|LOCUS_31430 7953 4459 gene locus_tag LOCUS_31440 gene mfd 7953 4459 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTL9 protein_id gnl|my_center|LOCUS_31440 8243 7950 gene locus_tag LOCUS_31450 8243 7950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531907.1 protein_id gnl|my_center|LOCUS_31450 8410 10494 gene locus_tag LOCUS_31460 8410 10494 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_31460 >Feature sequence166 738 559 gene locus_tag LOCUS_31470 738 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 957 1199 gene locus_tag LOCUS_31480 957 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2378 1206 gene locus_tag LOCUS_31490 gene metB 2378 1206 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_31490 3769 2387 gene locus_tag LOCUS_31500 gene cysB 3769 2387 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035841.1 protein_id gnl|my_center|LOCUS_31500 3966 4820 gene locus_tag LOCUS_31510 3966 4820 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532884.1 protein_id gnl|my_center|LOCUS_31510 5352 4810 gene locus_tag LOCUS_31520 5352 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 5944 5462 gene locus_tag LOCUS_31530 5944 5462 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931093.1 protein_id gnl|my_center|LOCUS_31530 8202 6094 gene locus_tag LOCUS_31540 8202 6094 CDS product suppressor for copper-sensitivity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390806.1 protein_id gnl|my_center|LOCUS_31540 8381 8968 gene locus_tag LOCUS_31550 8381 8968 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPU1 protein_id gnl|my_center|LOCUS_31550 9101 9577 gene locus_tag LOCUS_31560 9101 9577 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_31560 9751 10740 gene locus_tag LOCUS_31570 gene yedY 9751 10740 CDS product mononuclear molybdenum enzyme YedY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence167 1150 2517 gene locus_tag LOCUS_31580 1150 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 protein_id gnl|my_center|LOCUS_31580 2521 3747 gene locus_tag LOCUS_31590 2521 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 protein_id gnl|my_center|LOCUS_31590 4579 3764 gene locus_tag LOCUS_31600 4579 3764 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708073.1 protein_id gnl|my_center|LOCUS_31600 5058 4594 gene locus_tag LOCUS_31610 5058 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 7899 5185 gene locus_tag LOCUS_31620 7899 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 8282 7896 gene locus_tag LOCUS_31630 8282 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 8777 8460 gene locus_tag LOCUS_31640 8777 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 8715 9845 gene locus_tag LOCUS_31650 8715 9845 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_31650 >Feature sequence168 1333 1659 gene locus_tag LOCUS_31660 1333 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 1666 2046 gene locus_tag LOCUS_31670 1666 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 2286 2897 gene locus_tag LOCUS_31680 2286 2897 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J588 protein_id gnl|my_center|LOCUS_31680 2902 3717 gene locus_tag LOCUS_31690 2902 3717 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 protein_id gnl|my_center|LOCUS_31690 4176 3733 gene locus_tag LOCUS_31700 4176 3733 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390402.1 protein_id gnl|my_center|LOCUS_31700 4934 4422 gene locus_tag LOCUS_31710 4934 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 5488 5006 gene locus_tag LOCUS_31720 5488 5006 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_31720 5815 6567 gene locus_tag LOCUS_31730 5815 6567 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U9K1 protein_id gnl|my_center|LOCUS_31730 6627 7130 gene locus_tag LOCUS_31740 gene ruvC 6627 7130 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF7 protein_id gnl|my_center|LOCUS_31740 7141 7755 gene locus_tag LOCUS_31750 gene ruvA 7141 7755 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF6 protein_id gnl|my_center|LOCUS_31750 7752 8822 gene locus_tag LOCUS_31760 gene ruvB 7752 8822 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF5 protein_id gnl|my_center|LOCUS_31760 8812 9249 gene locus_tag LOCUS_31770 8812 9249 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 protein_id gnl|my_center|LOCUS_31770 9253 10002 gene locus_tag LOCUS_31780 9253 10002 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388846.1 protein_id gnl|my_center|LOCUS_31780 10008 10466 gene locus_tag LOCUS_31790 10008 10466 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388847.1 protein_id gnl|my_center|LOCUS_31790 >Feature sequence169 1160 672 gene locus_tag LOCUS_31800 1160 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 1812 1456 gene locus_tag LOCUS_31810 1812 1456 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140048.1 protein_id gnl|my_center|LOCUS_31810 2710 2003 gene locus_tag LOCUS_31820 2710 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 4602 2986 gene locus_tag LOCUS_31830 4602 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090968.1 protein_id gnl|my_center|LOCUS_31830 5781 4624 gene locus_tag LOCUS_31840 5781 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 6245 5778 gene locus_tag LOCUS_31850 6245 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 6780 6262 gene locus_tag LOCUS_31860 6780 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 7217 6777 gene locus_tag LOCUS_31870 7217 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 8248 7214 gene locus_tag LOCUS_31880 8248 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 8862 8245 gene locus_tag LOCUS_31890 8862 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 9269 8859 gene locus_tag LOCUS_31900 9269 8859 CDS product global cell cycle regulator GcrA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_31900 10200 9361 gene locus_tag LOCUS_31910 10200 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368666.1 protein_id gnl|my_center|LOCUS_31910 >Feature sequence170 517 933 gene locus_tag LOCUS_31920 gene apaG 517 933 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VE6 protein_id gnl|my_center|LOCUS_31920 1038 1679 gene locus_tag LOCUS_31930 gene folE 1038 1679 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR9 protein_id gnl|my_center|LOCUS_31930 3503 1719 gene locus_tag LOCUS_31940 3503 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 3725 5173 gene locus_tag LOCUS_31950 3725 5173 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB0 protein_id gnl|my_center|LOCUS_31950 5211 6362 gene locus_tag LOCUS_31960 5211 6362 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFT4 protein_id gnl|my_center|LOCUS_31960 6582 7112 gene locus_tag LOCUS_31970 6582 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 7273 7770 gene locus_tag LOCUS_31980 7273 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 8177 7797 gene locus_tag LOCUS_31990 8177 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 9241 8240 gene locus_tag LOCUS_32000 9241 8240 CDS product sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970694.1 protein_id gnl|my_center|LOCUS_32000 9975 9268 gene locus_tag LOCUS_32010 9975 9268 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088985.1 protein_id gnl|my_center|LOCUS_32010 >Feature sequence171 207 980 gene locus_tag LOCUS_32020 207 980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720000.1 protein_id gnl|my_center|LOCUS_32020 1001 2380 gene locus_tag LOCUS_32030 1001 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 2377 3078 gene locus_tag LOCUS_32040 2377 3078 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035875.1 protein_id gnl|my_center|LOCUS_32040 3105 4442 gene locus_tag LOCUS_32050 3105 4442 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339635.1 protein_id gnl|my_center|LOCUS_32050 4446 5309 gene locus_tag LOCUS_32060 4446 5309 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812150.1 protein_id gnl|my_center|LOCUS_32060 5319 6332 gene locus_tag LOCUS_32070 5319 6332 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883255.1 protein_id gnl|my_center|LOCUS_32070 6478 7518 gene locus_tag LOCUS_32080 6478 7518 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723317.1 protein_id gnl|my_center|LOCUS_32080 7701 8666 gene locus_tag LOCUS_32090 7701 8666 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_32090 >Feature sequence172 925 2187 gene locus_tag LOCUS_32100 925 2187 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387885.1 protein_id gnl|my_center|LOCUS_32100 2197 3219 gene locus_tag LOCUS_32110 gene cobD 2197 3219 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNW9 protein_id gnl|my_center|LOCUS_32110 5193 3214 gene locus_tag LOCUS_32120 5193 3214 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268975.1 protein_id gnl|my_center|LOCUS_32120 6436 5252 gene locus_tag LOCUS_32130 gene rlmN 6436 5252 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP22 protein_id gnl|my_center|LOCUS_32130 6522 6737 gene locus_tag LOCUS_32140 6522 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 7277 6738 gene locus_tag LOCUS_32150 7277 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721985.1 protein_id gnl|my_center|LOCUS_32150 7410 8075 gene locus_tag LOCUS_32160 7410 8075 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWG9 protein_id gnl|my_center|LOCUS_32160 8072 8767 gene locus_tag LOCUS_32170 gene chrR 8072 8767 CDS product anti-sigma-E factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40685 protein_id gnl|my_center|LOCUS_32170 8835 9206 gene locus_tag LOCUS_32180 8835 9206 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339218.1 protein_id gnl|my_center|LOCUS_32180 9203 9922 gene locus_tag LOCUS_32190 9203 9922 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence173 300 1169 gene locus_tag LOCUS_32200 300 1169 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972258.1 protein_id gnl|my_center|LOCUS_32200 1662 1174 gene locus_tag LOCUS_32210 1662 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531921.1 protein_id gnl|my_center|LOCUS_32210 2319 1693 gene locus_tag LOCUS_32220 2319 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 2592 2894 gene locus_tag LOCUS_32230 2592 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3430 2912 gene locus_tag LOCUS_32240 3430 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 3800 3390 gene locus_tag LOCUS_32250 3800 3390 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_32250 3978 5090 gene locus_tag LOCUS_32260 gene leuB 3978 5090 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZJ3 protein_id gnl|my_center|LOCUS_32260 5230 6105 gene locus_tag LOCUS_32270 5230 6105 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 protein_id gnl|my_center|LOCUS_32270 7001 6357 gene locus_tag LOCUS_32280 gene satA 7001 6357 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 protein_id gnl|my_center|LOCUS_32280 7537 6998 gene locus_tag LOCUS_32290 7537 6998 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090707.1 protein_id gnl|my_center|LOCUS_32290 7789 8454 gene locus_tag LOCUS_32300 7789 8454 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968227.1 protein_id gnl|my_center|LOCUS_32300 8778 9794 gene locus_tag LOCUS_32310 gene asd 8778 9794 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV48 protein_id gnl|my_center|LOCUS_32310 9990 10142 gene locus_tag LOCUS_32320 9990 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 >Feature sequence174 3 638 gene locus_tag LOCUS_32330 3 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 667 1395 gene locus_tag LOCUS_32340 667 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 1395 2225 gene locus_tag LOCUS_32350 1395 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 2222 2920 gene locus_tag LOCUS_32360 2222 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 3618 2917 gene locus_tag LOCUS_32370 3618 2917 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987012.1 protein_id gnl|my_center|LOCUS_32370 4699 3620 gene locus_tag LOCUS_32380 4699 3620 CDS product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_32380 5927 4770 gene locus_tag LOCUS_32390 gene spsC 5927 4770 CDS product spore coat polysaccharide biosynthesis protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39623 protein_id gnl|my_center|LOCUS_32390 6145 7338 gene locus_tag LOCUS_32400 6145 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 8488 7475 gene locus_tag LOCUS_32410 8488 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 <10149 8500 gene locus_tag LOCUS_32420 <10149 8500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088594.1:flagellar hook-associated protein FlgK >Feature sequence175 765 1514 gene locus_tag LOCUS_32430 gene ubiG 765 1514 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWE9 protein_id gnl|my_center|LOCUS_32430 1731 2927 gene locus_tag LOCUS_32440 1731 2927 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971806.1 protein_id gnl|my_center|LOCUS_32440 3246 3043 gene locus_tag LOCUS_32450 3246 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 3142 3396 gene locus_tag LOCUS_32460 3142 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 3407 4009 gene locus_tag LOCUS_32470 gene def 3407 4009 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVK0 protein_id gnl|my_center|LOCUS_32470 3996 4682 gene locus_tag LOCUS_32480 3996 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388800.1 protein_id gnl|my_center|LOCUS_32480 4697 5083 gene locus_tag LOCUS_32490 4697 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 6178 5093 gene locus_tag LOCUS_32500 gene purK 6178 5093 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ3 protein_id gnl|my_center|LOCUS_32500 6662 6171 gene locus_tag LOCUS_32510 gene purE 6662 6171 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIL3 protein_id gnl|my_center|LOCUS_32510 6776 7546 gene locus_tag LOCUS_32520 6776 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 7877 7569 gene locus_tag LOCUS_32530 7877 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 7882 8511 gene locus_tag LOCUS_32540 7882 8511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 9178 8546 gene locus_tag LOCUS_32550 9178 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 <10017 9190 gene locus_tag LOCUS_32560 <10017 9190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387816.1:ABC transporter >Feature sequence176 367 1395 gene locus_tag LOCUS_32570 367 1395 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229212.1 protein_id gnl|my_center|LOCUS_32570 2160 1399 gene locus_tag LOCUS_32580 2160 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 2852 2325 gene locus_tag LOCUS_32590 2852 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 3074 3406 gene locus_tag LOCUS_32600 3074 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 3527 5992 gene locus_tag LOCUS_32610 3527 5992 CDS product sarcosine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887734.1 protein_id gnl|my_center|LOCUS_32610 5996 6508 gene locus_tag LOCUS_32620 5996 6508 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389004.1 protein_id gnl|my_center|LOCUS_32620 6618 6998 gene locus_tag LOCUS_32630 6618 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529135.1 protein_id gnl|my_center|LOCUS_32630 7118 7411 gene locus_tag LOCUS_32640 7118 7411 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_32640 7562 8359 gene locus_tag LOCUS_32650 7562 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 8853 8356 gene locus_tag LOCUS_32660 8853 8356 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 protein_id gnl|my_center|LOCUS_32660 9646 8846 gene locus_tag LOCUS_32670 9646 8846 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_32670 >Feature sequence177 994 3645 gene locus_tag LOCUS_32680 gene mutS 994 3645 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNG0 protein_id gnl|my_center|LOCUS_32680 3638 4702 gene locus_tag LOCUS_32690 3638 4702 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529189.1 protein_id gnl|my_center|LOCUS_32690 4699 4938 gene locus_tag LOCUS_32700 4699 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 5014 5553 gene locus_tag LOCUS_32710 5014 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 6214 5570 gene locus_tag LOCUS_32720 6214 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 7434 6211 gene locus_tag LOCUS_32730 7434 6211 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529971.1 protein_id gnl|my_center|LOCUS_32730 7750 7445 gene locus_tag LOCUS_32740 7750 7445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 8393 7761 gene locus_tag LOCUS_32750 8393 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 8987 8421 gene locus_tag LOCUS_32760 8987 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388121.1 protein_id gnl|my_center|LOCUS_32760 >Feature sequence178 772 179 gene locus_tag LOCUS_32770 772 179 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194572.1 protein_id gnl|my_center|LOCUS_32770 1610 834 gene locus_tag LOCUS_32780 1610 834 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807682.1 protein_id gnl|my_center|LOCUS_32780 3039 1618 gene locus_tag LOCUS_32790 3039 1618 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083889.1 protein_id gnl|my_center|LOCUS_32790 4395 3064 gene locus_tag LOCUS_32800 4395 3064 CDS product ring-hydroxylating oxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083890.1 protein_id gnl|my_center|LOCUS_32800 4441 5745 gene locus_tag LOCUS_32810 4441 5745 CDS product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640486.1 protein_id gnl|my_center|LOCUS_32810 5967 8063 gene locus_tag LOCUS_32820 5967 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 9018 8191 gene locus_tag LOCUS_32830 9018 8191 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088209.1 protein_id gnl|my_center|LOCUS_32830 9656 9066 gene locus_tag LOCUS_32840 gene pcaG 9656 9066 CDS product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524240.1 protein_id gnl|my_center|LOCUS_32840 >Feature sequence179 2542 92 gene locus_tag LOCUS_32850 2542 92 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 protein_id gnl|my_center|LOCUS_32850 3435 2539 gene locus_tag LOCUS_32860 3435 2539 CDS product choline kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 protein_id gnl|my_center|LOCUS_32860 5458 3455 gene locus_tag LOCUS_32870 5458 3455 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 protein_id gnl|my_center|LOCUS_32870 6489 5455 gene locus_tag LOCUS_32880 6489 5455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 protein_id gnl|my_center|LOCUS_32880 7629 6694 gene locus_tag LOCUS_32890 7629 6694 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 protein_id gnl|my_center|LOCUS_32890 7912 8679 gene locus_tag LOCUS_32900 7912 8679 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528029.1 protein_id gnl|my_center|LOCUS_32900 8687 9469 gene locus_tag LOCUS_32910 8687 9469 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336750.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence180 864 1880 gene locus_tag LOCUS_32920 864 1880 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967766.1 protein_id gnl|my_center|LOCUS_32920 1877 2695 gene locus_tag LOCUS_32930 1877 2695 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810133.1 protein_id gnl|my_center|LOCUS_32930 4353 2692 gene locus_tag LOCUS_32940 4353 2692 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066587.1 protein_id gnl|my_center|LOCUS_32940 4945 4439 gene locus_tag LOCUS_32950 4945 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 5399 5848 gene locus_tag LOCUS_32960 5399 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 5832 6221 gene locus_tag LOCUS_32970 5832 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 6221 6418 gene locus_tag LOCUS_32980 6221 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 6418 7233 gene locus_tag LOCUS_32990 6418 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268014.1 protein_id gnl|my_center|LOCUS_32990 7281 8513 gene locus_tag LOCUS_33000 7281 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 8595 8912 gene locus_tag LOCUS_33010 8595 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 8909 9289 gene locus_tag LOCUS_33020 8909 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence181 668 1330 gene locus_tag LOCUS_33030 668 1330 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066656.1 protein_id gnl|my_center|LOCUS_33030 2313 1327 gene locus_tag LOCUS_33040 2313 1327 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_33040 2477 3013 gene locus_tag LOCUS_33050 2477 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 3589 3020 gene locus_tag LOCUS_33060 3589 3020 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090904.1 protein_id gnl|my_center|LOCUS_33060 3769 4242 gene locus_tag LOCUS_33070 3769 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947823.1 protein_id gnl|my_center|LOCUS_33070 5092 4298 gene locus_tag LOCUS_33080 5092 4298 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976335.1 protein_id gnl|my_center|LOCUS_33080 5173 5754 gene locus_tag LOCUS_33090 5173 5754 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534197.1 protein_id gnl|my_center|LOCUS_33090 6411 5818 gene locus_tag LOCUS_33100 6411 5818 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980453.1 protein_id gnl|my_center|LOCUS_33100 7863 6505 gene locus_tag LOCUS_33110 7863 6505 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_33110 8403 7987 gene locus_tag LOCUS_33120 8403 7987 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_33120 9073 8621 gene locus_tag LOCUS_33130 9073 8621 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_33130 >Feature sequence182 817 506 gene locus_tag LOCUS_33140 817 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33140 1666 851 gene locus_tag LOCUS_33150 1666 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33150 2651 1677 gene locus_tag LOCUS_33160 gene lcdH 2651 1677 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH8 protein_id gnl|my_center|LOCUS_33160 3555 2665 gene locus_tag LOCUS_33170 3555 2665 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186835.1 protein_id gnl|my_center|LOCUS_33170 3732 4634 gene locus_tag LOCUS_33180 3732 4634 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268081.1 protein_id gnl|my_center|LOCUS_33180 4723 6150 gene locus_tag LOCUS_33190 gene manC 4723 6150 CDS product GDP-mannose pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522157.1 protein_id gnl|my_center|LOCUS_33190 6381 7109 gene locus_tag LOCUS_33200 6381 7109 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_33200 7892 7113 gene locus_tag LOCUS_33210 7892 7113 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564075.1 protein_id gnl|my_center|LOCUS_33210 8086 9666 gene locus_tag LOCUS_33220 8086 9666 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974597.1 protein_id gnl|my_center|LOCUS_33220 >Feature sequence183 1360 284 gene locus_tag LOCUS_33230 1360 284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098134.1 protein_id gnl|my_center|LOCUS_33230 3280 1400 gene locus_tag LOCUS_33240 3280 1400 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390914.1 protein_id gnl|my_center|LOCUS_33240 4153 3362 gene locus_tag LOCUS_33250 4153 3362 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_33250 4819 4259 gene locus_tag LOCUS_33260 gene cycM 4819 4259 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30323 protein_id gnl|my_center|LOCUS_33260 5075 5830 gene locus_tag LOCUS_33270 gene kdsB 5075 5830 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPI7 protein_id gnl|my_center|LOCUS_33270 5934 6497 gene locus_tag LOCUS_33280 5934 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 6570 7175 gene locus_tag LOCUS_33290 6570 7175 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195674.1 protein_id gnl|my_center|LOCUS_33290 7688 7164 gene locus_tag LOCUS_33300 7688 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 8437 7685 gene locus_tag LOCUS_33310 8437 7685 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257442.1 protein_id gnl|my_center|LOCUS_33310 8895 8452 gene locus_tag LOCUS_33320 8895 8452 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269266.1 protein_id gnl|my_center|LOCUS_33320 >Feature sequence184 911 291 gene locus_tag LOCUS_33330 911 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 1362 3926 gene locus_tag LOCUS_33340 1362 3926 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531153.1 protein_id gnl|my_center|LOCUS_33340 4067 4318 gene locus_tag LOCUS_33350 4067 4318 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390130.1 protein_id gnl|my_center|LOCUS_33350 4315 4620 gene locus_tag LOCUS_33360 4315 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390129.1 protein_id gnl|my_center|LOCUS_33360 5356 4631 gene locus_tag LOCUS_33370 5356 4631 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886889.1 protein_id gnl|my_center|LOCUS_33370 5593 6717 gene locus_tag LOCUS_33380 5593 6717 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086196.1 protein_id gnl|my_center|LOCUS_33380 6849 7763 gene locus_tag LOCUS_33390 6849 7763 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086197.1 protein_id gnl|my_center|LOCUS_33390 7868 8530 gene locus_tag LOCUS_33400 7868 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086182.1 protein_id gnl|my_center|LOCUS_33400 8605 9045 gene locus_tag LOCUS_33410 8605 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920207.1 protein_id gnl|my_center|LOCUS_33410 >Feature sequence185 721 50 gene locus_tag LOCUS_33420 gene exbB1 721 50 CDS product biopolymer transport protein exbB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52043 protein_id gnl|my_center|LOCUS_33420 1791 718 gene locus_tag LOCUS_33430 gene hmuS 1791 718 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204655.1 protein_id gnl|my_center|LOCUS_33430 2755 1814 gene locus_tag LOCUS_33440 2755 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 3027 2863 gene locus_tag LOCUS_33450 3027 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 5005 3056 gene locus_tag LOCUS_33460 5005 3056 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096983.1 protein_id gnl|my_center|LOCUS_33460 6771 5305 gene locus_tag LOCUS_33470 gene hlyD 6771 5305 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089032.1 protein_id gnl|my_center|LOCUS_33470 8953 6758 gene locus_tag LOCUS_33480 8953 6758 CDS product peptidase C39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089033.1 protein_id gnl|my_center|LOCUS_33480 >Feature sequence186 1925 252 gene locus_tag LOCUS_33490 gene leuA 1925 252 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT17 protein_id gnl|my_center|LOCUS_33490 2375 3985 gene locus_tag LOCUS_33500 gene alsS 2375 3985 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989867.1 protein_id gnl|my_center|LOCUS_33500 5380 3989 gene locus_tag LOCUS_33510 5380 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 6469 5420 gene locus_tag LOCUS_33520 gene mutY 6469 5420 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968924.1 protein_id gnl|my_center|LOCUS_33520 6580 7074 gene locus_tag LOCUS_33530 6580 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 7176 7856 gene locus_tag LOCUS_33540 7176 7856 CDS product disulfide bond formation protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309853.1 protein_id gnl|my_center|LOCUS_33540 >Feature sequence187 <1 618 gene locus_tag LOCUS_33550 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FVB9:putrescine-binding periplasmic protein 714 1796 gene locus_tag LOCUS_33560 714 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 1789 2823 gene locus_tag LOCUS_33570 gene potH 1789 2823 CDS product putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521363.1 protein_id gnl|my_center|LOCUS_33570 2836 3708 gene locus_tag LOCUS_33580 2836 3708 CDS product putrescine/spermidine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528944.1 protein_id gnl|my_center|LOCUS_33580 3710 4417 gene locus_tag LOCUS_33590 3710 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967079.1 protein_id gnl|my_center|LOCUS_33590 5641 4745 gene locus_tag LOCUS_33600 5641 4745 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708515.1 protein_id gnl|my_center|LOCUS_33600 5768 6187 gene locus_tag LOCUS_33610 5768 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 6399 7022 gene locus_tag LOCUS_33620 6399 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 7745 7320 gene locus_tag LOCUS_33630 7745 7320 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 protein_id gnl|my_center|LOCUS_33630 7814 8407 gene locus_tag LOCUS_33640 7814 8407 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530165.1 protein_id gnl|my_center|LOCUS_33640 <9711 8415 gene locus_tag LOCUS_33650 <9711 8415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971305.1:histidine kinase >Feature sequence188 <1 1113 gene locus_tag LOCUS_33660 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPE8:DNA topoisomerase 1 1115 3406 gene locus_tag LOCUS_33670 gene rnr 1115 3406 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE7 protein_id gnl|my_center|LOCUS_33670 3543 5045 gene locus_tag LOCUS_33680 3543 5045 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390952.1 protein_id gnl|my_center|LOCUS_33680 5053 5703 gene locus_tag LOCUS_33690 5053 5703 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338219.1 protein_id gnl|my_center|LOCUS_33690 5806 5973 gene locus_tag LOCUS_33700 gene rpmG 5806 5973 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4S1 protein_id gnl|my_center|LOCUS_33700 7264 6077 gene locus_tag LOCUS_33710 7264 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389486.1 protein_id gnl|my_center|LOCUS_33710 <9621 7280 gene locus_tag LOCUS_33720 <9621 7280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073979.1:channel protein TolC >Feature sequence189 412 1698 gene locus_tag LOCUS_33730 412 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 1691 2542 gene locus_tag LOCUS_33740 1691 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 2505 4151 gene locus_tag LOCUS_33750 2505 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 4151 4510 gene locus_tag LOCUS_33760 4151 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 5296 5126 gene locus_tag LOCUS_33770 5296 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 5283 6104 gene locus_tag LOCUS_33780 5283 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 6207 7079 gene locus_tag LOCUS_33790 6207 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 7157 9223 gene locus_tag LOCUS_33800 7157 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 >Feature sequence190 1377 757 gene locus_tag LOCUS_33810 1377 757 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531049.1 protein_id gnl|my_center|LOCUS_33810 1477 2409 gene locus_tag LOCUS_33820 1477 2409 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096166.1 protein_id gnl|my_center|LOCUS_33820 3034 2357 gene locus_tag LOCUS_33830 3034 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 5821 3044 gene locus_tag LOCUS_33840 gene secA 5821 3044 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92MI9 protein_id gnl|my_center|LOCUS_33840 5820 6005 gene locus_tag LOCUS_33850 5820 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 6108 6971 gene locus_tag LOCUS_33860 6108 6971 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TAK1 protein_id gnl|my_center|LOCUS_33860 7002 8234 gene locus_tag LOCUS_33870 gene argJ 7002 8234 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXE6 protein_id gnl|my_center|LOCUS_33870 8215 8787 gene locus_tag LOCUS_33880 8215 8787 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705173.1 protein_id gnl|my_center|LOCUS_33880 8784 9233 gene locus_tag LOCUS_33890 gene mutT 8784 9233 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_33890 >Feature sequence191 3616 863 gene locus_tag LOCUS_33900 3616 863 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_33900 6969 4363 gene locus_tag LOCUS_33910 6969 4363 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920339.1 protein_id gnl|my_center|LOCUS_33910 7958 7047 gene locus_tag LOCUS_33920 7958 7047 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268540.1 protein_id gnl|my_center|LOCUS_33920 8102 9091 gene locus_tag LOCUS_33930 8102 9091 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_33930 >Feature sequence192 3 1031 gene locus_tag LOCUS_33940 3 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 1131 2054 gene locus_tag LOCUS_33950 1131 2054 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337864.1 protein_id gnl|my_center|LOCUS_33950 2058 3071 gene locus_tag LOCUS_33960 2058 3071 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919872.1 protein_id gnl|my_center|LOCUS_33960 3144 4049 gene locus_tag LOCUS_33970 3144 4049 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389528.1 protein_id gnl|my_center|LOCUS_33970 4077 4751 gene locus_tag LOCUS_33980 4077 4751 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KZ6 protein_id gnl|my_center|LOCUS_33980 4829 5902 gene locus_tag LOCUS_33990 4829 5902 CDS product spermidine/putrescine ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020477356.1 protein_id gnl|my_center|LOCUS_33990 5976 6218 gene locus_tag LOCUS_34000 gene tatA 5976 6218 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U8N5 protein_id gnl|my_center|LOCUS_34000 6305 6922 gene locus_tag LOCUS_34010 6305 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 6934 7773 gene locus_tag LOCUS_34020 gene tatC 6934 7773 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKB8 protein_id gnl|my_center|LOCUS_34020 7929 9215 gene locus_tag LOCUS_34030 gene serS 7929 9215 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH5 protein_id gnl|my_center|LOCUS_34030 >Feature sequence193 1242 628 gene locus_tag LOCUS_34040 1242 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 2249 1293 gene locus_tag LOCUS_34050 2249 1293 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP75 protein_id gnl|my_center|LOCUS_34050 3182 2274 gene locus_tag LOCUS_34060 gene argF 3182 2274 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RP74 protein_id gnl|my_center|LOCUS_34060 4371 3172 gene locus_tag LOCUS_34070 gene argD 4371 3172 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U5Q7 protein_id gnl|my_center|LOCUS_34070 6495 4516 gene locus_tag LOCUS_34080 6495 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 7772 6594 gene locus_tag LOCUS_34090 7772 6594 CDS product salicylate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706103.1 protein_id gnl|my_center|LOCUS_34090 8720 7806 gene locus_tag LOCUS_34100 8720 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_34100 >Feature sequence194 156 1829 gene locus_tag LOCUS_34110 gene hutU 156 1829 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92V80 protein_id gnl|my_center|LOCUS_34110 1918 3012 gene locus_tag LOCUS_34120 1918 3012 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_34120 3096 3599 gene locus_tag LOCUS_34130 3096 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808109.1 protein_id gnl|my_center|LOCUS_34130 3604 5178 gene locus_tag LOCUS_34140 3604 5178 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086531.1 protein_id gnl|my_center|LOCUS_34140 6088 5600 gene locus_tag LOCUS_34150 gene atpF1 6088 5600 CDS product ATP synthase subunit b 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA7 protein_id gnl|my_center|LOCUS_34150 6679 6092 gene locus_tag LOCUS_34160 gene atpF2 6679 6092 CDS product ATP synthase subunit b 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZ14 protein_id gnl|my_center|LOCUS_34160 6979 6755 gene locus_tag LOCUS_34170 gene atpE 6979 6755 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA5 protein_id gnl|my_center|LOCUS_34170 7829 7098 gene locus_tag LOCUS_34180 gene atpB 7829 7098 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA4 protein_id gnl|my_center|LOCUS_34180 8282 7899 gene locus_tag LOCUS_34190 8282 7899 CDS product ATP synthase protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPA3 protein_id gnl|my_center|LOCUS_34190 <9303 8455 gene locus_tag LOCUS_34200 <9303 8455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NDN8:proton-gated ion channel >Feature sequence195 2523 322 gene locus_tag LOCUS_34210 gene uvrB 2523 322 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVB1 protein_id gnl|my_center|LOCUS_34210 2764 2564 gene locus_tag LOCUS_34220 2764 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531032.1 protein_id gnl|my_center|LOCUS_34220 3165 2842 gene locus_tag LOCUS_34230 3165 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 3233 4852 gene locus_tag LOCUS_34240 3233 4852 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_34240 4885 5424 gene locus_tag LOCUS_34250 4885 5424 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXS2 protein_id gnl|my_center|LOCUS_34250 6811 5387 gene locus_tag LOCUS_34260 6811 5387 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529649.1 protein_id gnl|my_center|LOCUS_34260 8406 6808 gene locus_tag LOCUS_34270 8406 6808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 8496 9149 gene locus_tag LOCUS_34280 8496 9149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040262.1 protein_id gnl|my_center|LOCUS_34280 >Feature sequence196 >Feature sequence197 <1 520 gene locus_tag LOCUS_34290 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389951.1:membrane protein 528 1586 gene locus_tag LOCUS_34300 gene queA 528 1586 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXQ9 protein_id gnl|my_center|LOCUS_34300 1583 2710 gene locus_tag LOCUS_34310 gene tgt 1583 2710 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR0 protein_id gnl|my_center|LOCUS_34310 2718 3827 gene locus_tag LOCUS_34320 gene queG 2718 3827 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WH3 protein_id gnl|my_center|LOCUS_34320 4175 3882 gene locus_tag LOCUS_34330 gene rpmB 4175 3882 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXY0 protein_id gnl|my_center|LOCUS_34330 4495 5010 gene locus_tag LOCUS_34340 4495 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 5147 6199 gene locus_tag LOCUS_34350 5147 6199 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066633.1 protein_id gnl|my_center|LOCUS_34350 6472 6981 gene locus_tag LOCUS_34360 6472 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 6986 8050 gene locus_tag LOCUS_34370 6986 8050 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_34370 8970 8047 gene locus_tag LOCUS_34380 8970 8047 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143747.1 protein_id gnl|my_center|LOCUS_34380 >Feature sequence198 142 999 gene locus_tag LOCUS_34390 gene pdxY 142 999 CDS product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYX0 protein_id gnl|my_center|LOCUS_34390 1092 2636 gene locus_tag LOCUS_34400 1092 2636 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530987.1 protein_id gnl|my_center|LOCUS_34400 2752 3990 gene locus_tag LOCUS_34410 2752 3990 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391159.1 protein_id gnl|my_center|LOCUS_34410 4219 4722 gene locus_tag LOCUS_34420 4219 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 4860 6293 gene locus_tag LOCUS_34430 4860 6293 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269396.1 protein_id gnl|my_center|LOCUS_34430 7124 6360 gene locus_tag LOCUS_34440 7124 6360 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087476.1 protein_id gnl|my_center|LOCUS_34440 >Feature sequence199 2214 1708 gene locus_tag LOCUS_34450 gene coaD 2214 1708 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK2 protein_id gnl|my_center|LOCUS_34450 5067 2275 gene locus_tag LOCUS_34460 gene gyrA 5067 2275 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK1 protein_id gnl|my_center|LOCUS_34460 5199 5972 gene locus_tag LOCUS_34470 gene guaA 5199 5972 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083382.1 protein_id gnl|my_center|LOCUS_34470 7465 6161 gene locus_tag LOCUS_34480 gene pyrP 7465 6161 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39766 protein_id gnl|my_center|LOCUS_34480 8217 7681 gene locus_tag LOCUS_34490 8217 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 8856 8344 gene locus_tag LOCUS_34500 8856 8344 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088266.1 protein_id gnl|my_center|LOCUS_34500 >Feature sequence200 1304 354 gene locus_tag LOCUS_34510 gene ispH 1304 354 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5X0 protein_id gnl|my_center|LOCUS_34510 1722 2255 gene locus_tag LOCUS_34520 1722 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390800.1 protein_id gnl|my_center|LOCUS_34520 2847 2269 gene locus_tag LOCUS_34530 2847 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 3215 4348 gene locus_tag LOCUS_34540 gene gcvT2 3215 4348 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I140 protein_id gnl|my_center|LOCUS_34540 4390 4761 gene locus_tag LOCUS_34550 gene gcvH 4390 4761 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Q10 protein_id gnl|my_center|LOCUS_34550 4878 7814 gene locus_tag LOCUS_34560 gene gcvP 4878 7814 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZM3 protein_id gnl|my_center|LOCUS_34560 8768 7887 gene locus_tag LOCUS_34570 8768 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 >Feature sequence201 470 1393 gene locus_tag LOCUS_34580 470 1393 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917999.1 protein_id gnl|my_center|LOCUS_34580 1480 2154 gene locus_tag LOCUS_34590 1480 2154 CDS product peptidase S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391457.1 protein_id gnl|my_center|LOCUS_34590 2182 2403 gene locus_tag LOCUS_34600 2182 2403 CDS product UPF0434 protein bsr0601 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WS6 protein_id gnl|my_center|LOCUS_34600 2409 2798 gene locus_tag LOCUS_34610 2409 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531698.1 protein_id gnl|my_center|LOCUS_34610 3443 2802 gene locus_tag LOCUS_34620 gene gst5 3443 2802 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969298.1 protein_id gnl|my_center|LOCUS_34620 4673 3453 gene locus_tag LOCUS_34630 4673 3453 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391454.1 protein_id gnl|my_center|LOCUS_34630 5073 5411 gene locus_tag LOCUS_34640 5073 5411 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528889.1 protein_id gnl|my_center|LOCUS_34640 5428 6762 gene locus_tag LOCUS_34650 gene amt-2 5428 6762 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y7T8 protein_id gnl|my_center|LOCUS_34650 6985 7308 gene locus_tag LOCUS_34660 6985 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 7467 8687 gene locus_tag LOCUS_34670 7467 8687 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385507.1 protein_id gnl|my_center|LOCUS_34670 >Feature sequence202 1278 778 gene locus_tag LOCUS_34680 1278 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 1796 1368 gene locus_tag LOCUS_34690 1796 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089576.1 protein_id gnl|my_center|LOCUS_34690 2313 1801 gene locus_tag LOCUS_34700 2313 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 2420 3190 gene locus_tag LOCUS_34710 gene nadK 2420 3190 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX24 protein_id gnl|my_center|LOCUS_34710 3251 3913 gene locus_tag LOCUS_34720 3251 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 3990 6149 gene locus_tag LOCUS_34730 3990 6149 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085126.1 protein_id gnl|my_center|LOCUS_34730 >Feature sequence203 839 1783 gene locus_tag LOCUS_34740 839 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 1900 3213 gene locus_tag LOCUS_34750 1900 3213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529071.1 protein_id gnl|my_center|LOCUS_34750 4691 3216 gene locus_tag LOCUS_34760 gene gatA 4691 3216 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH4 protein_id gnl|my_center|LOCUS_34760 4992 4705 gene locus_tag LOCUS_34770 gene gatC 4992 4705 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH3 protein_id gnl|my_center|LOCUS_34770 5120 5584 gene locus_tag LOCUS_34780 5120 5584 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH2 protein_id gnl|my_center|LOCUS_34780 6520 5573 gene locus_tag LOCUS_34790 6520 5573 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920941.1 protein_id gnl|my_center|LOCUS_34790 7388 6546 gene locus_tag LOCUS_34800 7388 6546 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 protein_id gnl|my_center|LOCUS_34800 8071 7385 gene locus_tag LOCUS_34810 8071 7385 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532669.1 protein_id gnl|my_center|LOCUS_34810 <8879 8103 gene locus_tag LOCUS_34820 <8879 8103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389619.1:lytic transglycosylase >Feature sequence204 <1 562 gene locus_tag LOCUS_34830 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531195.1:peptidase M24 672 1361 gene locus_tag LOCUS_34840 672 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 1716 1384 gene locus_tag LOCUS_34850 1716 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 2570 1713 gene locus_tag LOCUS_34860 gene ispE 2570 1713 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5K7 protein_id gnl|my_center|LOCUS_34860 4287 2587 gene locus_tag LOCUS_34870 4287 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388017.1 protein_id gnl|my_center|LOCUS_34870 4714 6459 gene locus_tag LOCUS_34880 4714 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 6550 8226 gene locus_tag LOCUS_34890 6550 8226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 >Feature sequence205 2521 683 gene locus_tag LOCUS_34900 2521 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 3542 2529 gene locus_tag LOCUS_34910 3542 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 protein_id gnl|my_center|LOCUS_34910 5584 3560 gene locus_tag LOCUS_34920 5584 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 7548 5581 gene locus_tag LOCUS_34930 7548 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 <8760 7804 gene locus_tag LOCUS_34940 <8760 7804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQE0:flagellin >Feature sequence206 2263 3675 gene locus_tag LOCUS_34950 gene gltX2 2263 3675 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ4 protein_id gnl|my_center|LOCUS_34950 3838 4839 gene locus_tag LOCUS_34960 3838 4839 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ5 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34960 4987 5139 gene locus_tag LOCUS_34970 4987 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34970 6365 5178 gene locus_tag LOCUS_34980 6365 5178 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389474.1 protein_id gnl|my_center|LOCUS_34980 7198 6362 gene locus_tag LOCUS_34990 7198 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389473.1 protein_id gnl|my_center|LOCUS_34990 8023 7220 gene locus_tag LOCUS_35000 gene lpxA 8023 7220 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ8 protein_id gnl|my_center|LOCUS_35000 8491 8024 gene locus_tag LOCUS_35010 gene fabZ 8491 8024 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ9 protein_id gnl|my_center|LOCUS_35010 8708 8505 gene locus_tag LOCUS_35020 8708 8505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 >Feature sequence207 1903 1025 gene locus_tag LOCUS_35030 gene aroE 1903 1025 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUJ7 protein_id gnl|my_center|LOCUS_35030 2035 2721 gene locus_tag LOCUS_35040 2035 2721 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973934.1 protein_id gnl|my_center|LOCUS_35040 3497 2712 gene locus_tag LOCUS_35050 3497 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 3577 5031 gene locus_tag LOCUS_35060 3577 5031 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391431.1 protein_id gnl|my_center|LOCUS_35060 6245 5034 gene locus_tag LOCUS_35070 6245 5034 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085418.1 protein_id gnl|my_center|LOCUS_35070 7426 6329 gene locus_tag LOCUS_35080 gene modC 7426 6329 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3HKL8 protein_id gnl|my_center|LOCUS_35080 8127 7423 gene locus_tag LOCUS_35090 8127 7423 CDS product molybdate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388461.1 protein_id gnl|my_center|LOCUS_35090 >Feature sequence208 291 809 gene locus_tag LOCUS_35100 291 809 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_35100 809 2617 gene locus_tag LOCUS_35110 809 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 3283 2669 gene locus_tag LOCUS_35120 3283 2669 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087070.1 protein_id gnl|my_center|LOCUS_35120 3724 3356 gene locus_tag LOCUS_35130 3724 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 4097 3753 gene locus_tag LOCUS_35140 4097 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 6394 4163 gene locus_tag LOCUS_35150 gene parC 6394 4163 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT97 protein_id gnl|my_center|LOCUS_35150 7738 6473 gene locus_tag LOCUS_35160 7738 6473 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532243.1 protein_id gnl|my_center|LOCUS_35160 <8490 7896 gene locus_tag LOCUS_35170 <8490 7896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706113.1:gamma-glutamyltranspeptidase >Feature sequence209 940 608 gene locus_tag LOCUS_35180 940 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 2109 1063 gene locus_tag LOCUS_35190 2109 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 2330 2106 gene locus_tag LOCUS_35200 2330 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 2524 3864 gene locus_tag LOCUS_35210 2524 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 3941 5242 gene locus_tag LOCUS_35220 3941 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 5407 6105 gene locus_tag LOCUS_35230 5407 6105 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029628.1 protein_id gnl|my_center|LOCUS_35230 7437 6115 gene locus_tag LOCUS_35240 7437 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 >Feature sequence210 <1 688 gene locus_tag LOCUS_35250 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388829.1:flagellar motor protein MotA 729 2045 gene locus_tag LOCUS_35260 729 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 2980 2054 gene locus_tag LOCUS_35270 gene rbsK 2980 2054 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RZ99 protein_id gnl|my_center|LOCUS_35270 3270 3034 gene locus_tag LOCUS_35280 3270 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 3221 4603 gene locus_tag LOCUS_35290 3221 4603 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 protein_id gnl|my_center|LOCUS_35290 4779 5990 gene locus_tag LOCUS_35300 4779 5990 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRD7 protein_id gnl|my_center|LOCUS_35300 6455 7549 gene locus_tag LOCUS_35310 6455 7549 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5A4 protein_id gnl|my_center|LOCUS_35310 >Feature sequence211 642 16 gene locus_tag LOCUS_35320 gene caiE 642 16 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9L6 protein_id gnl|my_center|LOCUS_35320 841 1800 gene locus_tag LOCUS_35330 841 1800 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZD35 protein_id gnl|my_center|LOCUS_35330 2009 2344 gene locus_tag LOCUS_35340 2009 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 2356 3261 gene locus_tag LOCUS_35350 2356 3261 CDS product branched-chain amino acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 protein_id gnl|my_center|LOCUS_35350 3251 3706 gene locus_tag LOCUS_35360 3251 3706 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101319.1 protein_id gnl|my_center|LOCUS_35360 4535 3690 gene locus_tag LOCUS_35370 4535 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 5376 4570 gene locus_tag LOCUS_35380 5376 4570 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084122.1 protein_id gnl|my_center|LOCUS_35380 5838 6170 gene locus_tag LOCUS_35390 5838 6170 CDS product global cell cycle regulator GcrA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389346.1 protein_id gnl|my_center|LOCUS_35390 6224 7315 gene locus_tag LOCUS_35400 6224 7315 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 protein_id gnl|my_center|LOCUS_35400 >Feature sequence212 237 929 gene locus_tag LOCUS_35410 237 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 956 3457 gene locus_tag LOCUS_35420 956 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 4374 3448 gene locus_tag LOCUS_35430 4374 3448 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089553.1 protein_id gnl|my_center|LOCUS_35430 5938 4382 gene locus_tag LOCUS_35440 5938 4382 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970332.1 protein_id gnl|my_center|LOCUS_35440 7853 6063 gene locus_tag LOCUS_35450 gene aspS 7853 6063 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MP9 protein_id gnl|my_center|LOCUS_35450 8204 8022 gene locus_tag LOCUS_35460 8204 8022 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391504.1 protein_id gnl|my_center|LOCUS_35460 >Feature sequence213 <1 961 gene locus_tag LOCUS_35470 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0CAV5:DNA mismatch repair protein MutL 1057 2238 gene locus_tag LOCUS_35480 1057 2238 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_35480 2363 3796 gene locus_tag LOCUS_35490 2363 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532519.1 protein_id gnl|my_center|LOCUS_35490 3793 4338 gene locus_tag LOCUS_35500 3793 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 4338 4889 gene locus_tag LOCUS_35510 4338 4889 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067548.1 protein_id gnl|my_center|LOCUS_35510 6387 5599 gene locus_tag LOCUS_35520 gene pdxJ 6387 5599 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TH49 protein_id gnl|my_center|LOCUS_35520 6545 7441 gene locus_tag LOCUS_35530 6545 7441 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531702.1 protein_id gnl|my_center|LOCUS_35530 >Feature sequence214 1596 88 gene locus_tag LOCUS_35540 1596 88 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_35540 3545 1599 gene locus_tag LOCUS_35550 3545 1599 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T9X7 protein_id gnl|my_center|LOCUS_35550 3686 4438 gene locus_tag LOCUS_35560 gene tpiA 3686 4438 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT56 protein_id gnl|my_center|LOCUS_35560 4575 4904 gene locus_tag LOCUS_35570 4575 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 5027 6667 gene locus_tag LOCUS_35580 gene pyrG 5027 6667 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT58 protein_id gnl|my_center|LOCUS_35580 6773 7606 gene locus_tag LOCUS_35590 gene kdsA 6773 7606 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KV0 protein_id gnl|my_center|LOCUS_35590 >Feature sequence215 1751 498 gene locus_tag LOCUS_35600 1751 498 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709316.1 protein_id gnl|my_center|LOCUS_35600 1936 2382 gene locus_tag LOCUS_35610 1936 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 4212 2383 gene locus_tag LOCUS_35620 gene glmS 4212 2383 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX1 protein_id gnl|my_center|LOCUS_35620 5562 4261 gene locus_tag LOCUS_35630 gene glmU 5562 4261 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPX0 protein_id gnl|my_center|LOCUS_35630 6062 5847 gene locus_tag LOCUS_35640 6062 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 6307 6615 gene locus_tag LOCUS_35650 6307 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 6624 6998 gene locus_tag LOCUS_35660 6624 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 >Feature sequence216 3199 2930 gene locus_tag LOCUS_35670 3199 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 3991 3587 gene locus_tag LOCUS_35680 3991 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 5550 4033 gene locus_tag LOCUS_35690 5550 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 6747 5557 gene locus_tag LOCUS_35700 6747 5557 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704849.1 protein_id gnl|my_center|LOCUS_35700 <7866 6771 gene locus_tag LOCUS_35710 <7866 6771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035732.1:hybrid sensor histidine kinase/response regulator >Feature sequence217 435 1364 gene locus_tag LOCUS_35720 435 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 1446 3740 gene locus_tag LOCUS_35730 1446 3740 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527977.1 protein_id gnl|my_center|LOCUS_35730 3745 4506 gene locus_tag LOCUS_35740 3745 4506 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_35740 4506 4991 gene locus_tag LOCUS_35750 4506 4991 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527979.1 protein_id gnl|my_center|LOCUS_35750 4996 5808 gene locus_tag LOCUS_35760 4996 5808 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527980.1 protein_id gnl|my_center|LOCUS_35760 5812 6972 gene locus_tag LOCUS_35770 5812 6972 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527981.1 protein_id gnl|my_center|LOCUS_35770 >Feature sequence218 1245 490 gene locus_tag LOCUS_35780 1245 490 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888205.1 protein_id gnl|my_center|LOCUS_35780 1364 2071 gene locus_tag LOCUS_35790 gene pcaI 1364 2071 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973949.1 protein_id gnl|my_center|LOCUS_35790 2068 2754 gene locus_tag LOCUS_35800 gene pcaJ 2068 2754 CDS product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973950.1 protein_id gnl|my_center|LOCUS_35800 3304 2834 gene locus_tag LOCUS_35810 3304 2834 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089627.1 protein_id gnl|my_center|LOCUS_35810 3856 4866 gene locus_tag LOCUS_35820 3856 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 5088 6566 gene locus_tag LOCUS_35830 gene pvcC 5088 6566 CDS product pyoverdin chromophore biosynthetic protein PvcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30372 protein_id gnl|my_center|LOCUS_35830 6582 7139 gene locus_tag LOCUS_35840 6582 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 >Feature sequence219 253 672 gene locus_tag LOCUS_35850 253 672 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886859.1 protein_id gnl|my_center|LOCUS_35850 1867 965 gene locus_tag LOCUS_35860 1867 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 1983 3812 gene locus_tag LOCUS_35870 1983 3812 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706454.1 protein_id gnl|my_center|LOCUS_35870 3805 5427 gene locus_tag LOCUS_35880 3805 5427 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090343.1 protein_id gnl|my_center|LOCUS_35880 5444 6466 gene locus_tag LOCUS_35890 5444 6466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083857.1 protein_id gnl|my_center|LOCUS_35890 6481 7326 gene locus_tag LOCUS_35900 6481 7326 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083858.1 protein_id gnl|my_center|LOCUS_35900 >Feature sequence220 1540 764 gene locus_tag LOCUS_35910 1540 764 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083898.1 protein_id gnl|my_center|LOCUS_35910 3093 1537 gene locus_tag LOCUS_35920 3093 1537 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083897.1 protein_id gnl|my_center|LOCUS_35920 3625 3149 gene locus_tag LOCUS_35930 3625 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 4135 3671 gene locus_tag LOCUS_35940 4135 3671 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707919.1 protein_id gnl|my_center|LOCUS_35940 4296 5198 gene locus_tag LOCUS_35950 gene aroK 4296 5198 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VG9 protein_id gnl|my_center|LOCUS_35950 5843 5205 gene locus_tag LOCUS_35960 5843 5205 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528046.1 protein_id gnl|my_center|LOCUS_35960 7516 5840 gene locus_tag LOCUS_35970 gene nadE 7516 5840 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388445.1 protein_id gnl|my_center|LOCUS_35970 >Feature sequence221 416 3658 gene locus_tag LOCUS_35980 416 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 4499 3912 gene locus_tag LOCUS_35990 4499 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530297.1 protein_id gnl|my_center|LOCUS_35990 5411 4548 gene locus_tag LOCUS_36000 5411 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086604.1 protein_id gnl|my_center|LOCUS_36000 6924 5416 gene locus_tag LOCUS_36010 6924 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086603.1 protein_id gnl|my_center|LOCUS_36010 <7655 6921 gene locus_tag LOCUS_36020 <7655 6921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528450.1:aldehyde oxidase >Feature sequence222 973 1368 gene locus_tag LOCUS_36030 973 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 1558 3720 gene locus_tag LOCUS_36040 1558 3720 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389609.1 protein_id gnl|my_center|LOCUS_36040 3792 4304 gene locus_tag LOCUS_36050 3792 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389608.1 protein_id gnl|my_center|LOCUS_36050 4301 4738 gene locus_tag LOCUS_36060 gene acpS 4301 4738 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92R49 protein_id gnl|my_center|LOCUS_36060 4828 5610 gene locus_tag LOCUS_36070 4828 5610 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT92 protein_id gnl|my_center|LOCUS_36070 5597 6292 gene locus_tag LOCUS_36080 gene rnc 5597 6292 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT93 protein_id gnl|my_center|LOCUS_36080 6285 7199 gene locus_tag LOCUS_36090 gene era 6285 7199 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U7A9 protein_id gnl|my_center|LOCUS_36090 >Feature sequence223 500 1627 gene locus_tag LOCUS_36100 500 1627 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974502.1 protein_id gnl|my_center|LOCUS_36100 3060 1624 gene locus_tag LOCUS_36110 3060 1624 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226022.1 protein_id gnl|my_center|LOCUS_36110 3163 3855 gene locus_tag LOCUS_36120 3163 3855 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812170.1 protein_id gnl|my_center|LOCUS_36120 3883 4500 gene locus_tag LOCUS_36130 3883 4500 CDS product threonine efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331424.1 protein_id gnl|my_center|LOCUS_36130 4579 5199 gene locus_tag LOCUS_36140 gene azoR 4579 5199 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UG34 protein_id gnl|my_center|LOCUS_36140 5567 5196 gene locus_tag LOCUS_36150 5567 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 6784 5600 gene locus_tag LOCUS_36160 6784 5600 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224293.1 protein_id gnl|my_center|LOCUS_36160 6873 7382 gene locus_tag LOCUS_36170 6873 7382 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968638.1 protein_id gnl|my_center|LOCUS_36170 >Feature sequence224 422 192 gene locus_tag LOCUS_36180 422 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 2008 479 gene locus_tag LOCUS_36190 2008 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 3765 2005 gene locus_tag LOCUS_36200 3765 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 4483 4115 gene locus_tag LOCUS_36210 4483 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537641.1 protein_id gnl|my_center|LOCUS_36210 5522 4611 gene locus_tag LOCUS_36220 5522 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 6368 5697 gene locus_tag LOCUS_36230 gene pcaJ 6368 5697 CDS product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973950.1 protein_id gnl|my_center|LOCUS_36230 7087 6365 gene locus_tag LOCUS_36240 7087 6365 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969980.1 protein_id gnl|my_center|LOCUS_36240 >Feature sequence225 3 2369 gene locus_tag LOCUS_36250 3 2369 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391400.1 protein_id gnl|my_center|LOCUS_36250 2524 3261 gene locus_tag LOCUS_36260 2524 3261 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709723.1 protein_id gnl|my_center|LOCUS_36260 3752 3342 gene locus_tag LOCUS_36270 3752 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 4495 3749 gene locus_tag LOCUS_36280 4495 3749 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 protein_id gnl|my_center|LOCUS_36280 4639 6030 gene locus_tag LOCUS_36290 4639 6030 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_36290 6797 6027 gene locus_tag LOCUS_36300 6797 6027 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215772.1 protein_id gnl|my_center|LOCUS_36300 <7498 6917 gene locus_tag LOCUS_36310 <7498 6917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531062.1:glutathione S-transferase >Feature sequence226 1648 131 gene locus_tag LOCUS_36320 1648 131 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389658.1 protein_id gnl|my_center|LOCUS_36320 4470 2116 gene locus_tag LOCUS_36330 4470 2116 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RF7 protein_id gnl|my_center|LOCUS_36330 5053 6369 gene locus_tag LOCUS_36340 5053 6369 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389589.1 protein_id gnl|my_center|LOCUS_36340 6401 6985 gene locus_tag LOCUS_36350 6401 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230805.1 protein_id gnl|my_center|LOCUS_36350 >Feature sequence227 128 1045 gene locus_tag LOCUS_36360 128 1045 CDS product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919885.1 protein_id gnl|my_center|LOCUS_36360 1042 1674 gene locus_tag LOCUS_36370 gene cobH 1042 1674 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028884.1 protein_id gnl|my_center|LOCUS_36370 1671 2882 gene locus_tag LOCUS_36380 1671 2882 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390740.1 protein_id gnl|my_center|LOCUS_36380 2879 3616 gene locus_tag LOCUS_36390 gene cobI 2879 3616 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZU3 protein_id gnl|my_center|LOCUS_36390 3613 5454 gene locus_tag LOCUS_36400 gene cobJ 3613 5454 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057147.1 protein_id gnl|my_center|LOCUS_36400 5459 5842 gene locus_tag LOCUS_36410 5459 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_36410 5904 6662 gene locus_tag LOCUS_36420 5904 6662 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391131.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence228 1622 705 gene locus_tag LOCUS_36430 1622 705 CDS product silent information regulator protein Sir2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533453.1 protein_id gnl|my_center|LOCUS_36430 1695 4157 gene locus_tag LOCUS_36440 1695 4157 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_36440 4154 5266 gene locus_tag LOCUS_36450 4154 5266 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331277.1 protein_id gnl|my_center|LOCUS_36450 5279 6556 gene locus_tag LOCUS_36460 5279 6556 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533446.1 protein_id gnl|my_center|LOCUS_36460 <7391 6663 gene locus_tag LOCUS_36470 <7391 6663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I406:gamma-glutamyltranspeptidase >Feature sequence229 404 676 gene locus_tag LOCUS_36480 404 676 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_36480 805 880 gene locus_tag LOCUS_t00320 805 880 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1140 931 gene locus_tag LOCUS_36490 1140 931 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521369.1 protein_id gnl|my_center|LOCUS_36490 1565 1140 gene locus_tag LOCUS_36500 1565 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 2002 2078 gene locus_tag LOCUS_t00330 2002 2078 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2397 2762 gene locus_tag LOCUS_36510 gene nuoA 2397 2762 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU40 protein_id gnl|my_center|LOCUS_36510 2753 3298 gene locus_tag LOCUS_36520 gene nuoB 2753 3298 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU39 protein_id gnl|my_center|LOCUS_36520 3330 3962 gene locus_tag LOCUS_36530 gene nuoC 3330 3962 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU38 protein_id gnl|my_center|LOCUS_36530 3959 5179 gene locus_tag LOCUS_36540 gene nuoD 3959 5179 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KI9 protein_id gnl|my_center|LOCUS_36540 5213 5818 gene locus_tag LOCUS_36550 5213 5818 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087680.1 protein_id gnl|my_center|LOCUS_36550 5837 7150 gene locus_tag LOCUS_36560 gene nuoF 5837 7150 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919813.1 protein_id gnl|my_center|LOCUS_36560 >Feature sequence230 467 1318 gene locus_tag LOCUS_36570 467 1318 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388019.1 protein_id gnl|my_center|LOCUS_36570 2185 1325 gene locus_tag LOCUS_36580 2185 1325 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_36580 3680 2193 gene locus_tag LOCUS_36590 3680 2193 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_36590 5603 3879 gene locus_tag LOCUS_36600 5603 3879 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458059.1 protein_id gnl|my_center|LOCUS_36600 >Feature sequence231 175 831 gene locus_tag LOCUS_36610 175 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 1234 1425 gene locus_tag LOCUS_36620 1234 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 1447 2208 gene locus_tag LOCUS_36630 1447 2208 CDS product cobalt transporter subunit CbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531118.1 protein_id gnl|my_center|LOCUS_36630 3400 2228 gene locus_tag LOCUS_36640 3400 2228 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337231.1 protein_id gnl|my_center|LOCUS_36640 4027 3407 gene locus_tag LOCUS_36650 4027 3407 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_36650 4148 4486 gene locus_tag LOCUS_36660 4148 4486 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082989.1 protein_id gnl|my_center|LOCUS_36660 4903 5406 gene locus_tag LOCUS_36670 4903 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 5594 6400 gene locus_tag LOCUS_36680 5594 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 >Feature sequence232 430 1062 gene locus_tag LOCUS_36690 gene hisH 430 1062 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBG9 protein_id gnl|my_center|LOCUS_36690 1074 1805 gene locus_tag LOCUS_36700 gene hisA 1074 1805 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBG7 protein_id gnl|my_center|LOCUS_36700 1813 2613 gene locus_tag LOCUS_36710 gene hisF 1813 2613 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA7 protein_id gnl|my_center|LOCUS_36710 2610 2942 gene locus_tag LOCUS_36720 gene hisE 2610 2942 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNA8 protein_id gnl|my_center|LOCUS_36720 2959 3615 gene locus_tag LOCUS_36730 gene rhtB 2959 3615 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211486.1 protein_id gnl|my_center|LOCUS_36730 3898 4266 gene locus_tag LOCUS_36740 3898 4266 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391339.1 protein_id gnl|my_center|LOCUS_36740 4524 4339 gene locus_tag LOCUS_36750 4524 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 4648 6657 gene locus_tag LOCUS_36760 4648 6657 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391431.1 protein_id gnl|my_center|LOCUS_36760 <7163 6642 gene locus_tag LOCUS_36770 <7163 6642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462916.1:MFS transporter >Feature sequence233 1004 1435 gene locus_tag LOCUS_36780 1004 1435 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728621.1 protein_id gnl|my_center|LOCUS_36780 1903 1442 gene locus_tag LOCUS_36790 1903 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385513.1 protein_id gnl|my_center|LOCUS_36790 2840 1908 gene locus_tag LOCUS_36800 2840 1908 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887795.1 protein_id gnl|my_center|LOCUS_36800 3861 2926 gene locus_tag LOCUS_36810 3861 2926 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532815.1 protein_id gnl|my_center|LOCUS_36810 3937 4740 gene locus_tag LOCUS_36820 3937 4740 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532814.1 protein_id gnl|my_center|LOCUS_36820 4770 5978 gene locus_tag LOCUS_36830 4770 5978 CDS product creatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_36830 6197 7084 gene locus_tag LOCUS_36840 6197 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 >Feature sequence234 479 970 gene locus_tag LOCUS_36850 gene ribH 479 970 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R6M2 protein_id gnl|my_center|LOCUS_36850 1079 1822 gene locus_tag LOCUS_36860 1079 1822 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706675.1 protein_id gnl|my_center|LOCUS_36860 2433 1837 gene locus_tag LOCUS_36870 2433 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 3931 2498 gene locus_tag LOCUS_36880 gene tldD 3931 2498 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083987.1 protein_id gnl|my_center|LOCUS_36880 4100 5488 gene locus_tag LOCUS_36890 4100 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_36890 5822 6700 gene locus_tag LOCUS_36900 gene ctaC 5822 6700 CDS product putative cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDC6 protein_id gnl|my_center|LOCUS_36900 >Feature sequence235 1777 1004 gene locus_tag LOCUS_36910 1777 1004 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971978.1 protein_id gnl|my_center|LOCUS_36910 3138 1774 gene locus_tag LOCUS_36920 3138 1774 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388481.1 protein_id gnl|my_center|LOCUS_36920 4584 3142 gene locus_tag LOCUS_36930 gene phrA 4584 3142 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CJC9 protein_id gnl|my_center|LOCUS_36930 5544 4855 gene locus_tag LOCUS_36940 5544 4855 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083968.1 protein_id gnl|my_center|LOCUS_36940 7068 5551 gene locus_tag LOCUS_36950 7068 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence236 304 1563 gene locus_tag LOCUS_36960 304 1563 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_36960 1725 2933 gene locus_tag LOCUS_36970 1725 2933 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN4 protein_id gnl|my_center|LOCUS_36970 2953 4242 gene locus_tag LOCUS_36980 2953 4242 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRN5 protein_id gnl|my_center|LOCUS_36980 4310 5281 gene locus_tag LOCUS_36990 4310 5281 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H0 protein_id gnl|my_center|LOCUS_36990 >Feature sequence237 1453 92 gene locus_tag LOCUS_37000 1453 92 CDS product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973234.1 protein_id gnl|my_center|LOCUS_37000 2187 1465 gene locus_tag LOCUS_37010 2187 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 4670 2256 gene locus_tag LOCUS_37020 4670 2256 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066717.1 protein_id gnl|my_center|LOCUS_37020 5797 4826 gene locus_tag LOCUS_37030 gene fecR 5797 4826 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969652.1 protein_id gnl|my_center|LOCUS_37030 6499 5900 gene locus_tag LOCUS_37040 6499 5900 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388638.1 protein_id gnl|my_center|LOCUS_37040 <7022 6501 gene locus_tag LOCUS_37050 <7022 6501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530732.1:prolyl 4-hydroxylase >Feature sequence238 <1 674 gene locus_tag LOCUS_37060 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228821.1:diguanylate phosphodiesterase 682 1650 gene locus_tag LOCUS_37070 682 1650 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173671.1 protein_id gnl|my_center|LOCUS_37070 1647 2543 gene locus_tag LOCUS_37080 1647 2543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089451.1 protein_id gnl|my_center|LOCUS_37080 2724 3209 gene locus_tag LOCUS_37090 2724 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 3330 3710 gene locus_tag LOCUS_37100 3330 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 3796 5019 gene locus_tag LOCUS_37110 3796 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 5457 5029 gene locus_tag LOCUS_37120 5457 5029 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388367.1 protein_id gnl|my_center|LOCUS_37120 <6995 5470 gene locus_tag LOCUS_37130 <6995 5470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704330.1:C4-dicarboxylate ABC transporter >Feature sequence239 2075 1596 gene locus_tag LOCUS_37140 2075 1596 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 protein_id gnl|my_center|LOCUS_37140 2944 2072 gene locus_tag LOCUS_37150 gene cutM 2944 2072 CDS product molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088979.1 protein_id gnl|my_center|LOCUS_37150 3410 2949 gene locus_tag LOCUS_37160 3410 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 4506 3427 gene locus_tag LOCUS_37170 4506 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929892.1 protein_id gnl|my_center|LOCUS_37170 4921 5511 gene locus_tag LOCUS_37180 4921 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 <6877 5600 gene locus_tag LOCUS_37190 <6877 5600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086709.1:N,N-dimethylformamidase >Feature sequence240 877 230 gene locus_tag LOCUS_37200 gene ccmA 877 230 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF0 protein_id gnl|my_center|LOCUS_37200 2084 948 gene locus_tag LOCUS_37210 2084 948 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388196.1 protein_id gnl|my_center|LOCUS_37210 2389 3678 gene locus_tag LOCUS_37220 gene ahcY 2389 3678 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY7 protein_id gnl|my_center|LOCUS_37220 3809 6097 gene locus_tag LOCUS_37230 3809 6097 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391190.1 protein_id gnl|my_center|LOCUS_37230 <6849 6122 gene locus_tag LOCUS_37240 <6849 6122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNR2:ferredoxin--NADP reductase >Feature sequence241 1123 917 gene locus_tag LOCUS_37250 1123 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 1711 1199 gene locus_tag LOCUS_37260 1711 1199 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930138.1 protein_id gnl|my_center|LOCUS_37260 2211 1708 gene locus_tag LOCUS_37270 2211 1708 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921241.1 protein_id gnl|my_center|LOCUS_37270 3182 2220 gene locus_tag LOCUS_37280 gene cmaX 3182 2220 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098062.1 protein_id gnl|my_center|LOCUS_37280 4884 3226 gene locus_tag LOCUS_37290 4884 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 5124 6005 gene locus_tag LOCUS_37300 gene pyrB 5124 6005 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPG0 protein_id gnl|my_center|LOCUS_37300 >Feature sequence242 230 140 gene locus_tag LOCUS_t00340 230 140 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1465 806 gene locus_tag LOCUS_37310 1465 806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338060.1 protein_id gnl|my_center|LOCUS_37310 3190 1472 gene locus_tag LOCUS_37320 3190 1472 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338059.1 protein_id gnl|my_center|LOCUS_37320 4382 3180 gene locus_tag LOCUS_37330 4382 3180 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709896.1 protein_id gnl|my_center|LOCUS_37330 4771 5268 gene locus_tag LOCUS_37340 4771 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 5307 5380 gene locus_tag LOCUS_t00350 5307 5380 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6326 5406 gene locus_tag LOCUS_37350 6326 5406 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389869.1 protein_id gnl|my_center|LOCUS_37350 6453 6665 gene locus_tag LOCUS_37360 6453 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 >Feature sequence243 23 1303 gene locus_tag LOCUS_37370 23 1303 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLS9 protein_id gnl|my_center|LOCUS_37370 1307 1549 gene locus_tag LOCUS_37380 1307 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 1546 1926 gene locus_tag LOCUS_37390 1546 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 1923 2609 gene locus_tag LOCUS_37400 1923 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 2624 3304 gene locus_tag LOCUS_37410 2624 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 3324 3725 gene locus_tag LOCUS_37420 3324 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 3729 4010 gene locus_tag LOCUS_37430 3729 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 4007 4279 gene locus_tag LOCUS_37440 4007 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 4272 4535 gene locus_tag LOCUS_37450 4272 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 4540 5307 gene locus_tag LOCUS_37460 4540 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103974.1 protein_id gnl|my_center|LOCUS_37460 5304 5660 gene locus_tag LOCUS_37470 5304 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 5928 5638 gene locus_tag LOCUS_37480 5928 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 5927 6538 gene locus_tag LOCUS_37490 5927 6538 CDS product N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203018.1 protein_id gnl|my_center|LOCUS_37490 >Feature sequence244 217 666 gene locus_tag LOCUS_37500 217 666 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_37500 1183 692 gene locus_tag LOCUS_37510 1183 692 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 protein_id gnl|my_center|LOCUS_37510 1726 1220 gene locus_tag LOCUS_37520 1726 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 4294 1847 gene locus_tag LOCUS_37530 4294 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 5518 4379 gene locus_tag LOCUS_37540 5518 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 <6783 5865 gene locus_tag LOCUS_37550 <6783 5865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNC6:acetyl-coenzyme A synthetase >Feature sequence245 1525 656 gene locus_tag LOCUS_37560 1525 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 1950 1528 gene locus_tag LOCUS_37570 1950 1528 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530449.1 protein_id gnl|my_center|LOCUS_37570 3275 1980 gene locus_tag LOCUS_37580 3275 1980 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530448.1 protein_id gnl|my_center|LOCUS_37580 3508 3951 gene locus_tag LOCUS_37590 3508 3951 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967550.1 protein_id gnl|my_center|LOCUS_37590 3948 4370 gene locus_tag LOCUS_37600 3948 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807254.1 protein_id gnl|my_center|LOCUS_37600 4327 5088 gene locus_tag LOCUS_37610 4327 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919121.1 protein_id gnl|my_center|LOCUS_37610 6039 5101 gene locus_tag LOCUS_37620 6039 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064119.1 protein_id gnl|my_center|LOCUS_37620 >Feature sequence246 1484 966 gene locus_tag LOCUS_37630 1484 966 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315770.1 protein_id gnl|my_center|LOCUS_37630 2566 1520 gene locus_tag LOCUS_37640 gene mch 2566 1520 CDS product beta-methylmalyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC34 protein_id gnl|my_center|LOCUS_37640 4568 2601 gene locus_tag LOCUS_37650 4568 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 5572 4679 gene locus_tag LOCUS_37660 5572 4679 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_37660 6707 5646 gene locus_tag LOCUS_37670 6707 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 >Feature sequence247 417 1424 gene locus_tag LOCUS_37680 417 1424 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388011.1 protein_id gnl|my_center|LOCUS_37680 1506 2474 gene locus_tag LOCUS_37690 gene argC 1506 2474 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H555 protein_id gnl|my_center|LOCUS_37690 2471 3370 gene locus_tag LOCUS_37700 gene murI 2471 3370 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YAH2 protein_id gnl|my_center|LOCUS_37700 3367 3894 gene locus_tag LOCUS_37710 3367 3894 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_37710 4792 3884 gene locus_tag LOCUS_37720 4792 3884 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919001.1 protein_id gnl|my_center|LOCUS_37720 4927 5733 gene locus_tag LOCUS_37730 4927 5733 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089189.1 protein_id gnl|my_center|LOCUS_37730 5762 6133 gene locus_tag LOCUS_37740 5762 6133 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_37740 >Feature sequence248 3 1619 gene locus_tag LOCUS_37750 3 1619 CDS product N-methylproline demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970334.1 protein_id gnl|my_center|LOCUS_37750 2122 1637 gene locus_tag LOCUS_37760 2122 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 3106 2297 gene locus_tag LOCUS_37770 3106 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 3167 4072 gene locus_tag LOCUS_37780 3167 4072 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389792.1 protein_id gnl|my_center|LOCUS_37780 4532 4056 gene locus_tag LOCUS_37790 4532 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 4719 5651 gene locus_tag LOCUS_37800 4719 5651 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529407.1 protein_id gnl|my_center|LOCUS_37800 >Feature sequence249 1502 543 gene locus_tag LOCUS_37810 gene yrbG 1502 543 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_37810 3094 1787 gene locus_tag LOCUS_37820 3094 1787 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385254.1 protein_id gnl|my_center|LOCUS_37820 2595 2513 gene locus_tag LOCUS_t00360 2595 2513 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3606 3094 gene locus_tag LOCUS_37830 3606 3094 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930617.1 protein_id gnl|my_center|LOCUS_37830 4916 3924 gene locus_tag LOCUS_37840 4916 3924 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537995.1 protein_id gnl|my_center|LOCUS_37840 5202 6065 gene locus_tag LOCUS_37850 5202 6065 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969060.1 protein_id gnl|my_center|LOCUS_37850 6196 6432 gene locus_tag LOCUS_37860 6196 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 >Feature sequence250 <1 594 gene locus_tag LOCUS_37870 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQF5:flagellar basal-body rod protein FlgG 626 1648 gene locus_tag LOCUS_37880 626 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 1681 2454 gene locus_tag LOCUS_37890 gene flgH1 1681 2454 CDS product flagellar L-ring protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I09 protein_id gnl|my_center|LOCUS_37890 3148 2678 gene locus_tag LOCUS_37900 gene dksA 3148 2678 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQF1 protein_id gnl|my_center|LOCUS_37900 3817 3362 gene locus_tag LOCUS_37910 3817 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 4063 5244 gene locus_tag LOCUS_37920 gene flgI 4063 5244 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQE9 protein_id gnl|my_center|LOCUS_37920 5248 5616 gene locus_tag LOCUS_37930 5248 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 5613 6041 gene locus_tag LOCUS_37940 5613 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 >Feature sequence251 1854 676 gene locus_tag LOCUS_37950 gene sucC 1854 676 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MH95 protein_id gnl|my_center|LOCUS_37950 3072 1879 gene locus_tag LOCUS_37960 3072 1879 CDS product serine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709136.1 protein_id gnl|my_center|LOCUS_37960 3274 3107 gene locus_tag LOCUS_37970 3274 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 4601 3975 gene locus_tag LOCUS_37980 4601 3975 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709135.1 protein_id gnl|my_center|LOCUS_37980 5854 4739 gene locus_tag LOCUS_37990 5854 4739 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929856.1 protein_id gnl|my_center|LOCUS_37990 6012 5851 gene locus_tag LOCUS_38000 6012 5851 CDS product Pmp3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705149.1 protein_id gnl|my_center|LOCUS_38000 >Feature sequence252 1749 2390 gene locus_tag LOCUS_38010 1749 2390 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387817.1 protein_id gnl|my_center|LOCUS_38010 2398 3240 gene locus_tag LOCUS_38020 2398 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 4235 3201 gene locus_tag LOCUS_38030 4235 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 4602 4261 gene locus_tag LOCUS_38040 4602 4261 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9M2 protein_id gnl|my_center|LOCUS_38040 5498 4632 gene locus_tag LOCUS_38050 5498 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 6125 5520 gene locus_tag LOCUS_38060 6125 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 >Feature sequence253 883 530 gene locus_tag LOCUS_38070 883 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 2529 925 gene locus_tag LOCUS_38080 gene aruI 2529 925 CDS product putative 2-ketoarginine decarboxylase AruI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUI8 protein_id gnl|my_center|LOCUS_38080 2811 5234 gene locus_tag LOCUS_38090 2811 5234 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_38090 5987 5700 gene locus_tag LOCUS_38100 5987 5700 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958388.1 protein_id gnl|my_center|LOCUS_38100 >Feature sequence254 123 1055 gene locus_tag LOCUS_38110 123 1055 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531702.1 protein_id gnl|my_center|LOCUS_38110 1451 1227 gene locus_tag LOCUS_38120 1451 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 1363 2613 gene locus_tag LOCUS_38130 gene amt-1 1363 2613 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 protein_id gnl|my_center|LOCUS_38130 2643 2981 gene locus_tag LOCUS_38140 2643 2981 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388885.1 protein_id gnl|my_center|LOCUS_38140 >Feature sequence255 876 289 gene locus_tag LOCUS_38150 gene ilvH 876 289 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_38150 2664 898 gene locus_tag LOCUS_38160 2664 898 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX73 protein_id gnl|my_center|LOCUS_38160 3841 2903 gene locus_tag LOCUS_38170 gene miaA 3841 2903 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX74 protein_id gnl|my_center|LOCUS_38170 4494 3838 gene locus_tag LOCUS_38180 4494 3838 CDS product protein 3-oxoalanine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941563.1 protein_id gnl|my_center|LOCUS_38180 >Feature sequence256 277 789 gene locus_tag LOCUS_38190 277 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 786 1622 gene locus_tag LOCUS_38200 786 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140551.1 protein_id gnl|my_center|LOCUS_38200 1635 2498 gene locus_tag LOCUS_38210 1635 2498 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140552.1 protein_id gnl|my_center|LOCUS_38210 3987 2650 gene locus_tag LOCUS_38220 3987 2650 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_38220 4499 5695 gene locus_tag LOCUS_38230 gene sucC 4499 5695 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RV33 protein_id gnl|my_center|LOCUS_38230 >Feature sequence257 932 1837 gene locus_tag LOCUS_38240 gene serB 932 1837 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385585.1 protein_id gnl|my_center|LOCUS_38240 2205 4787 gene locus_tag LOCUS_38250 2205 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 >Feature sequence258 1968 622 gene locus_tag LOCUS_38260 gene mifR 1968 622 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099712.1 protein_id gnl|my_center|LOCUS_38260 3707 1965 gene locus_tag LOCUS_38270 3707 1965 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384288.1 protein_id gnl|my_center|LOCUS_38270 3866 4921 gene locus_tag LOCUS_38280 3866 4921 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970021.1 protein_id gnl|my_center|LOCUS_38280 4954 5451 gene locus_tag LOCUS_38290 4954 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 >Feature sequence259 860 36 gene locus_tag LOCUS_38300 860 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 905 1855 gene locus_tag LOCUS_38310 905 1855 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA6 protein_id gnl|my_center|LOCUS_38310 2867 1869 gene locus_tag LOCUS_38320 2867 1869 CDS product putative GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37895 protein_id gnl|my_center|LOCUS_38320 3315 2881 gene locus_tag LOCUS_38330 3315 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 3887 3339 gene locus_tag LOCUS_38340 3887 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 4121 5269 gene locus_tag LOCUS_38350 4121 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 >Feature sequence260 842 276 gene locus_tag LOCUS_38360 842 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 2265 934 gene locus_tag LOCUS_38370 2265 934 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390721.1 protein_id gnl|my_center|LOCUS_38370 3620 2262 gene locus_tag LOCUS_38380 3620 2262 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390720.1 protein_id gnl|my_center|LOCUS_38380 4361 3762 gene locus_tag LOCUS_38390 4361 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 4910 4437 gene locus_tag LOCUS_38400 gene lspA 4910 4437 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ33 protein_id gnl|my_center|LOCUS_38400 <6193 4910 gene locus_tag LOCUS_38410 <6193 4910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQ34:isoleucine--tRNA ligase >Feature sequence261 659 1294 gene locus_tag LOCUS_38420 659 1294 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_38420 2208 1291 gene locus_tag LOCUS_38430 2208 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 2303 3070 gene locus_tag LOCUS_38440 2303 3070 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529655.1 protein_id gnl|my_center|LOCUS_38440 3200 3874 gene locus_tag LOCUS_38450 3200 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 5434 3935 gene locus_tag LOCUS_38460 5434 3935 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565364.1 protein_id gnl|my_center|LOCUS_38460 <6162 5539 gene locus_tag LOCUS_38470 <6162 5539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969537.1:two-component sensor histidine kinase >Feature sequence262 531 1796 gene locus_tag LOCUS_38480 531 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 2479 1793 gene locus_tag LOCUS_38490 2479 1793 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529672.1 protein_id gnl|my_center|LOCUS_38490 2655 3881 gene locus_tag LOCUS_38500 2655 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 3920 4432 gene locus_tag LOCUS_38510 3920 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391382.1 protein_id gnl|my_center|LOCUS_38510 5107 4436 gene locus_tag LOCUS_38520 5107 4436 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083450.1 protein_id gnl|my_center|LOCUS_38520 >Feature sequence263 3570 1297 gene locus_tag LOCUS_38530 3570 1297 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389593.1 protein_id gnl|my_center|LOCUS_38530 3766 4566 gene locus_tag LOCUS_38540 3766 4566 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203918.1 protein_id gnl|my_center|LOCUS_38540 4581 5093 gene locus_tag LOCUS_38550 4581 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 <6130 5153 gene locus_tag LOCUS_38560 <6130 5153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331290.1:hemolysin >Feature sequence264 535 1188 gene locus_tag LOCUS_38570 gene pcm 535 1188 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTH7 protein_id gnl|my_center|LOCUS_38570 1181 2344 gene locus_tag LOCUS_38580 1181 2344 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389520.1 protein_id gnl|my_center|LOCUS_38580 3199 2351 gene locus_tag LOCUS_38590 3199 2351 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976263.1 protein_id gnl|my_center|LOCUS_38590 3427 4236 gene locus_tag LOCUS_38600 3427 4236 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972092.1 protein_id gnl|my_center|LOCUS_38600 4246 4848 gene locus_tag LOCUS_38610 4246 4848 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_38610 >Feature sequence265 609 2144 gene locus_tag LOCUS_38620 609 2144 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KF8 protein_id gnl|my_center|LOCUS_38620 2304 2549 gene locus_tag LOCUS_38630 2304 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 2851 2935 gene locus_tag LOCUS_t00370 2851 2935 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3034 4461 gene locus_tag LOCUS_38640 gene tig 3034 4461 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU46 protein_id gnl|my_center|LOCUS_38640 4662 5297 gene locus_tag LOCUS_38650 gene clpP 4662 5297 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU45 protein_id gnl|my_center|LOCUS_38650 >Feature sequence266 1567 2604 gene locus_tag LOCUS_38660 gene accA 1567 2604 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXX2 protein_id gnl|my_center|LOCUS_38660 2672 2899 gene locus_tag LOCUS_38670 2672 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 3661 2921 gene locus_tag LOCUS_38680 3661 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090262.1 protein_id gnl|my_center|LOCUS_38680 5529 3760 gene locus_tag LOCUS_38690 5529 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 >Feature sequence267 184 372 gene locus_tag LOCUS_38700 184 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 490 1851 gene locus_tag LOCUS_38710 gene murA 490 1851 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ67 protein_id gnl|my_center|LOCUS_38710 1851 2663 gene locus_tag LOCUS_38720 1851 2663 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816773.1 protein_id gnl|my_center|LOCUS_38720 3195 2665 gene locus_tag LOCUS_38730 3195 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 4052 3258 gene locus_tag LOCUS_38740 4052 3258 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 protein_id gnl|my_center|LOCUS_38740 4153 5232 gene locus_tag LOCUS_38750 gene hppD 4153 5232 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765135.1 protein_id gnl|my_center|LOCUS_38750 >Feature sequence268 528 331 gene locus_tag LOCUS_38760 528 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 451 846 gene locus_tag LOCUS_38770 451 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 1657 851 gene locus_tag LOCUS_38780 1657 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388089.1 protein_id gnl|my_center|LOCUS_38780 3123 1657 gene locus_tag LOCUS_38790 3123 1657 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530835.1 protein_id gnl|my_center|LOCUS_38790 3895 3158 gene locus_tag LOCUS_38800 3895 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 4071 5585 gene locus_tag LOCUS_38810 4071 5585 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IN3 protein_id gnl|my_center|LOCUS_38810 >Feature sequence269 1402 3183 gene locus_tag LOCUS_38820 1402 3183 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390041.1 protein_id gnl|my_center|LOCUS_38820 4011 3196 gene locus_tag LOCUS_38830 4011 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 4150 5028 gene locus_tag LOCUS_38840 4150 5028 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532572.1 protein_id gnl|my_center|LOCUS_38840 <5886 5009 gene locus_tag LOCUS_38850 <5886 5009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971175.1:NAD(P)H quinone oxidoreductase >Feature sequence270 2 139 gene locus_tag LOCUS_38860 2 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 163 957 gene locus_tag LOCUS_38870 163 957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086167.1 protein_id gnl|my_center|LOCUS_38870 947 3217 gene locus_tag LOCUS_38880 947 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086166.1 protein_id gnl|my_center|LOCUS_38880 3204 4037 gene locus_tag LOCUS_38890 3204 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086165.1 protein_id gnl|my_center|LOCUS_38890 >Feature sequence271 518 1390 gene locus_tag LOCUS_38900 518 1390 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_38900 1390 2334 gene locus_tag LOCUS_38910 1390 2334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810748.1 protein_id gnl|my_center|LOCUS_38910 2331 3137 gene locus_tag LOCUS_38920 gene livG 2331 3137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063918.1 protein_id gnl|my_center|LOCUS_38920 3134 3835 gene locus_tag LOCUS_38930 3134 3835 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389501.1 protein_id gnl|my_center|LOCUS_38930 3832 4176 gene locus_tag LOCUS_38940 3832 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 4173 4637 gene locus_tag LOCUS_38950 4173 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 5475 4762 gene locus_tag LOCUS_38960 5475 4762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680283.1 protein_id gnl|my_center|LOCUS_38960 >Feature sequence272 1999 1187 gene locus_tag LOCUS_38970 gene fadB 1999 1187 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089105.1 protein_id gnl|my_center|LOCUS_38970 2322 3560 gene locus_tag LOCUS_38980 2322 3560 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_38980 3690 4595 gene locus_tag LOCUS_38990 3690 4595 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_38990 4621 5700 gene locus_tag LOCUS_39000 4621 5700 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085708.1 protein_id gnl|my_center|LOCUS_39000 >Feature sequence273 <1 1086 gene locus_tag LOCUS_39010 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929897.1:carbon monoxide dehydrogenase 1083 1901 gene locus_tag LOCUS_39020 1083 1901 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925753.1 protein_id gnl|my_center|LOCUS_39020 1898 3058 gene locus_tag LOCUS_39030 1898 3058 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807395.1 protein_id gnl|my_center|LOCUS_39030 4083 3112 gene locus_tag LOCUS_39040 gene znuA 4083 3112 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969557.1 protein_id gnl|my_center|LOCUS_39040 3985 4191 gene locus_tag LOCUS_39050 3985 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 4229 5155 gene locus_tag LOCUS_39060 gene znuC 4229 5155 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UA52 protein_id gnl|my_center|LOCUS_39060 >Feature sequence274 786 1661 gene locus_tag LOCUS_39070 786 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 1973 1746 gene locus_tag LOCUS_39080 1973 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 2380 3486 gene locus_tag LOCUS_39090 2380 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 3606 4760 gene locus_tag LOCUS_39100 gene potA 3606 4760 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXF4 protein_id gnl|my_center|LOCUS_39100 4757 5626 gene locus_tag LOCUS_39110 4757 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 >Feature sequence275 506 1804 gene locus_tag LOCUS_39120 506 1804 CDS product HlyD family type I secretion membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010239.2 protein_id gnl|my_center|LOCUS_39120 >Feature sequence276 83 319 gene locus_tag LOCUS_39130 83 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 330 719 gene locus_tag LOCUS_39140 330 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 1393 1076 gene locus_tag LOCUS_39150 1393 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 1618 2340 gene locus_tag LOCUS_39160 1618 2340 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969061.1 protein_id gnl|my_center|LOCUS_39160 2337 2636 gene locus_tag LOCUS_39170 2337 2636 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974933.1 protein_id gnl|my_center|LOCUS_39170 >Feature sequence277 1641 283 gene locus_tag LOCUS_39180 1641 283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390042.1 protein_id gnl|my_center|LOCUS_39180 2514 1699 gene locus_tag LOCUS_39190 2514 1699 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388317.1 protein_id gnl|my_center|LOCUS_39190 2619 4058 gene locus_tag LOCUS_39200 2619 4058 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814808.1 protein_id gnl|my_center|LOCUS_39200 4686 4066 gene locus_tag LOCUS_39210 4686 4066 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388742.1 protein_id gnl|my_center|LOCUS_39210 <5571 4690 gene locus_tag LOCUS_39220 <5571 4690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390040.1:AMP-dependent synthetase >Feature sequence278 1499 369 gene locus_tag LOCUS_39230 1499 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 2832 1618 gene locus_tag LOCUS_39240 2832 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 4317 2947 gene locus_tag LOCUS_39250 4317 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088233.1 protein_id gnl|my_center|LOCUS_39250 5406 4360 gene locus_tag LOCUS_39260 5406 4360 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088223.1 protein_id gnl|my_center|LOCUS_39260 >Feature sequence279 122 1018 gene locus_tag LOCUS_39270 122 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 1888 1043 gene locus_tag LOCUS_39280 1888 1043 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_39280 3803 2055 gene locus_tag LOCUS_39290 3803 2055 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071586.1 protein_id gnl|my_center|LOCUS_39290 4524 3844 gene locus_tag LOCUS_39300 4524 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071585.1 protein_id gnl|my_center|LOCUS_39300 5217 4534 gene locus_tag LOCUS_39310 5217 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 >Feature sequence280 1092 385 gene locus_tag LOCUS_39320 1092 385 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339095.1 protein_id gnl|my_center|LOCUS_39320 1278 1895 gene locus_tag LOCUS_39330 1278 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 1895 3169 gene locus_tag LOCUS_39340 1895 3169 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969451.1 protein_id gnl|my_center|LOCUS_39340 3166 4110 gene locus_tag LOCUS_39350 3166 4110 CDS product hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064007.1 protein_id gnl|my_center|LOCUS_39350 4123 5100 gene locus_tag LOCUS_39360 4123 5100 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087196.1 protein_id gnl|my_center|LOCUS_39360 >Feature sequence281 696 187 gene locus_tag LOCUS_39370 696 187 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807341.1 protein_id gnl|my_center|LOCUS_39370 1086 1619 gene locus_tag LOCUS_39380 1086 1619 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_39380 1612 2994 gene locus_tag LOCUS_39390 1612 2994 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925918.1 protein_id gnl|my_center|LOCUS_39390 3083 4186 gene locus_tag LOCUS_39400 3083 4186 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808111.1 protein_id gnl|my_center|LOCUS_39400 >Feature sequence282 342 1283 gene locus_tag LOCUS_39410 342 1283 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204261.1 protein_id gnl|my_center|LOCUS_39410 1280 2353 gene locus_tag LOCUS_39420 1280 2353 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706256.1 protein_id gnl|my_center|LOCUS_39420 4347 2350 gene locus_tag LOCUS_39430 4347 2350 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031412.1 protein_id gnl|my_center|LOCUS_39430 4789 4337 gene locus_tag LOCUS_39440 4789 4337 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186182.1 protein_id gnl|my_center|LOCUS_39440 <5508 4786 gene locus_tag LOCUS_39450 <5508 4786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390379.1:MBL fold metallo-hydrolase >Feature sequence283 850 446 gene locus_tag LOCUS_39460 gene pcaC 850 446 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973943.1 protein_id gnl|my_center|LOCUS_39460 1881 1099 gene locus_tag LOCUS_39470 1881 1099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088972.1 protein_id gnl|my_center|LOCUS_39470 2633 1878 gene locus_tag LOCUS_39480 2633 1878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142277.1 protein_id gnl|my_center|LOCUS_39480 3805 2636 gene locus_tag LOCUS_39490 3805 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 4849 3812 gene locus_tag LOCUS_39500 4849 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39500 >Feature sequence284 3119 2244 gene locus_tag LOCUS_39510 3119 2244 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082684.1 protein_id gnl|my_center|LOCUS_39510 3262 4398 gene locus_tag LOCUS_39520 gene phnW 3262 4398 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC81 protein_id gnl|my_center|LOCUS_39520 4462 5292 gene locus_tag LOCUS_39530 gene phnX 4462 5292 CDS product phosphonoacetaldehyde hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKD4 protein_id gnl|my_center|LOCUS_39530 >Feature sequence285 <1 1071 gene locus_tag LOCUS_39540 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529818.1:6-aminohexanoate-dimer hydrolase 2589 1081 gene locus_tag LOCUS_39550 2589 1081 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338678.1 protein_id gnl|my_center|LOCUS_39550 3921 2605 gene locus_tag LOCUS_39560 3921 2605 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970023.1 protein_id gnl|my_center|LOCUS_39560 4487 3921 gene locus_tag LOCUS_39570 4487 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 <5447 4594 gene locus_tag LOCUS_39580 <5447 4594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970021.1:ABC transporter substrate-binding protein >Feature sequence286 1471 560 gene locus_tag LOCUS_39590 1471 560 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_39590 2355 1468 gene locus_tag LOCUS_39600 2355 1468 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931471.1 protein_id gnl|my_center|LOCUS_39600 3603 2437 gene locus_tag LOCUS_39610 3603 2437 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384689.1 protein_id gnl|my_center|LOCUS_39610 4508 3654 gene locus_tag LOCUS_39620 4508 3654 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815017.1 protein_id gnl|my_center|LOCUS_39620 <5420 4498 gene locus_tag LOCUS_39630 <5420 4498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969633.1:dehydrogenase >Feature sequence287 3 1400 gene locus_tag LOCUS_39640 gene hemN 3 1400 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIV7 protein_id gnl|my_center|LOCUS_39640 1647 3650 gene locus_tag LOCUS_39650 1647 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39650 4667 3684 gene locus_tag LOCUS_39660 4667 3684 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 protein_id gnl|my_center|LOCUS_39660 >Feature sequence288 1738 422 gene locus_tag LOCUS_39670 1738 422 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH7 protein_id gnl|my_center|LOCUS_39670 2304 1753 gene locus_tag LOCUS_39680 2304 1753 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH6 protein_id gnl|my_center|LOCUS_39680 2655 3119 gene locus_tag LOCUS_39690 gene trmL 2655 3119 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AAX1 protein_id gnl|my_center|LOCUS_39690 3151 4026 gene locus_tag LOCUS_39700 gene hemF 3151 4026 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SC2 protein_id gnl|my_center|LOCUS_39700 4932 4048 gene locus_tag LOCUS_39710 4932 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 >Feature sequence289 2648 828 gene locus_tag LOCUS_39720 2648 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 3298 2858 gene locus_tag LOCUS_39730 3298 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 3538 3314 gene locus_tag LOCUS_39740 3538 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 3738 4196 gene locus_tag LOCUS_39750 3738 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 4200 4439 gene locus_tag LOCUS_39760 gene rpsR 4200 4439 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MW4 protein_id gnl|my_center|LOCUS_39760 4455 5102 gene locus_tag LOCUS_39770 gene rplI 4455 5102 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLJ0 protein_id gnl|my_center|LOCUS_39770 >Feature sequence290 <1 770 gene locus_tag LOCUS_39780 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720305.1:spermidine/putrescine ABC transporter substrate-binding protein 887 2158 gene locus_tag LOCUS_39790 887 2158 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_39790 2164 3018 gene locus_tag LOCUS_39800 2164 3018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 protein_id gnl|my_center|LOCUS_39800 3181 3726 gene locus_tag LOCUS_39810 3181 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390263.1 protein_id gnl|my_center|LOCUS_39810 4138 3758 gene locus_tag LOCUS_39820 4138 3758 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 protein_id gnl|my_center|LOCUS_39820 4710 4252 gene locus_tag LOCUS_39830 4710 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 <5391 4772 gene locus_tag LOCUS_39840 <5391 4772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388987.1:peptidase S41 >Feature sequence291 797 1306 gene locus_tag LOCUS_39850 797 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 1313 2221 gene locus_tag LOCUS_39860 1313 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038659.1 protein_id gnl|my_center|LOCUS_39860 4451 2250 gene locus_tag LOCUS_39870 4451 2250 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_39870 >Feature sequence292 1124 636 gene locus_tag LOCUS_39880 1124 636 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388720.1 protein_id gnl|my_center|LOCUS_39880 2041 1292 gene locus_tag LOCUS_39890 2041 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 2152 2664 gene locus_tag LOCUS_39900 2152 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 2735 4009 gene locus_tag LOCUS_39910 2735 4009 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529233.1 protein_id gnl|my_center|LOCUS_39910 >Feature sequence293 25 645 gene locus_tag LOCUS_39920 25 645 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929872.1 protein_id gnl|my_center|LOCUS_39920 1811 639 gene locus_tag LOCUS_39930 1811 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389646.1 protein_id gnl|my_center|LOCUS_39930 1995 2570 gene locus_tag LOCUS_39940 1995 2570 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389648.1 protein_id gnl|my_center|LOCUS_39940 2597 3643 gene locus_tag LOCUS_39950 gene trpD 2597 3643 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT49 protein_id gnl|my_center|LOCUS_39950 3640 4443 gene locus_tag LOCUS_39960 gene trpC 3640 4443 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y3T2 protein_id gnl|my_center|LOCUS_39960 4447 4929 gene locus_tag LOCUS_39970 gene moaC 4447 4929 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI5 protein_id gnl|my_center|LOCUS_39970 >Feature sequence294 817 257 gene locus_tag LOCUS_39980 817 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 930 2222 gene locus_tag LOCUS_39990 930 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 3380 2298 gene locus_tag LOCUS_40000 3380 2298 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_40000 4395 3466 gene locus_tag LOCUS_40010 4395 3466 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_40010 <5349 4399 gene locus_tag LOCUS_40020 <5349 4399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389657.1:ABC transporter permease >Feature sequence295 1035 2705 gene locus_tag LOCUS_40030 1035 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 2702 3430 gene locus_tag LOCUS_40040 2702 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038675.1 protein_id gnl|my_center|LOCUS_40040 3528 4589 gene locus_tag LOCUS_40050 3528 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 4592 5158 gene locus_tag LOCUS_40060 4592 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 >Feature sequence296 382 588 gene locus_tag LOCUS_40070 382 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 1526 615 gene locus_tag LOCUS_40080 1526 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 1413 1649 gene locus_tag LOCUS_40090 1413 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 3066 1960 gene locus_tag LOCUS_40100 3066 1960 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390942.1 protein_id gnl|my_center|LOCUS_40100 3230 3655 gene locus_tag LOCUS_40110 3230 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 4313 3687 gene locus_tag LOCUS_40120 gene plsY 4313 3687 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPF8 protein_id gnl|my_center|LOCUS_40120 <5274 4326 gene locus_tag LOCUS_40130 <5274 4326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPF9:dihydroorotase >Feature sequence297 208 2127 gene locus_tag LOCUS_40140 gene dnaX 208 2127 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383690.1 protein_id gnl|my_center|LOCUS_40140 2176 2499 gene locus_tag LOCUS_40150 2176 2499 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNM9 protein_id gnl|my_center|LOCUS_40150 2819 3418 gene locus_tag LOCUS_40160 gene recR 2819 3418 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMS4 protein_id gnl|my_center|LOCUS_40160 3446 4168 gene locus_tag LOCUS_40170 gene guaA 3446 4168 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 protein_id gnl|my_center|LOCUS_40170 >Feature sequence298 1066 311 gene locus_tag LOCUS_40180 1066 311 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971130.1 protein_id gnl|my_center|LOCUS_40180 2062 1088 gene locus_tag LOCUS_40190 gene gpuA 2062 1088 CDS product guanidinopropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6K2 protein_id gnl|my_center|LOCUS_40190 2771 2148 gene locus_tag LOCUS_40200 gene yfcG 2771 2148 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208403.1 protein_id gnl|my_center|LOCUS_40200 3411 2833 gene locus_tag LOCUS_40210 3411 2833 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085008.1 protein_id gnl|my_center|LOCUS_40210 4882 3512 gene locus_tag LOCUS_40220 4882 3512 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_40220 >Feature sequence299 1946 2266 gene locus_tag LOCUS_40230 1946 2266 CDS product septum formation initiator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389635.1 protein_id gnl|my_center|LOCUS_40230 2653 3693 gene locus_tag LOCUS_40240 gene pdhA 2653 3693 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y472 protein_id gnl|my_center|LOCUS_40240 3726 5102 gene locus_tag LOCUS_40250 3726 5102 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389633.1 protein_id gnl|my_center|LOCUS_40250 >Feature sequence300 2541 826 gene locus_tag LOCUS_40260 gene ilvD2 2541 826 CDS product dihydroxy-acid dehydratase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KY5 protein_id gnl|my_center|LOCUS_40260 2904 3242 gene locus_tag LOCUS_40270 gene glnB 2904 3242 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53044 protein_id gnl|my_center|LOCUS_40270 3320 4732 gene locus_tag LOCUS_40280 3320 4732 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSK9 protein_id gnl|my_center|LOCUS_40280 >Feature sequence301 <1 2049 gene locus_tag LOCUS_40290 <1 2049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389996.1:penicillin-binding protein 1A 2060 2890 gene locus_tag LOCUS_40300 gene rlmJ 2060 2890 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT07 protein_id gnl|my_center|LOCUS_40300 2952 3869 gene locus_tag LOCUS_40310 2952 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707077.1 protein_id gnl|my_center|LOCUS_40310 <5055 3847 gene locus_tag LOCUS_40320 <5055 3847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704874.1:phosphodiesterase >Feature sequence302 938 306 gene locus_tag LOCUS_40330 938 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391030.1 protein_id gnl|my_center|LOCUS_40330 2052 970 gene locus_tag LOCUS_40340 2052 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 3368 2049 gene locus_tag LOCUS_40350 3368 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920121.1 protein_id gnl|my_center|LOCUS_40350 <5008 3626 gene locus_tag LOCUS_40360 <5008 3626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P35471:60 kDa chaperonin 5 >Feature sequence303 2401 488 gene locus_tag LOCUS_40370 2401 488 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387983.1 protein_id gnl|my_center|LOCUS_40370 2917 2435 gene locus_tag LOCUS_40380 2917 2435 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228497.1 protein_id gnl|my_center|LOCUS_40380 >Feature sequence304 544 2499 gene locus_tag LOCUS_40390 544 2499 CDS product peptidase S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528247.1 protein_id gnl|my_center|LOCUS_40390 4299 2842 gene locus_tag LOCUS_40400 gene gatB 4299 2842 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPH5 protein_id gnl|my_center|LOCUS_40400 >Feature sequence305 1901 840 gene locus_tag LOCUS_40410 1901 840 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389301.1 protein_id gnl|my_center|LOCUS_40410 2009 3424 gene locus_tag LOCUS_40420 2009 3424 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085698.1 protein_id gnl|my_center|LOCUS_40420 3545 4021 gene locus_tag LOCUS_40430 gene phaJ 3545 4021 CDS product (R)-specific enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQ36 protein_id gnl|my_center|LOCUS_40430 >Feature sequence306 494 9 gene locus_tag LOCUS_40440 494 9 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390191.1 protein_id gnl|my_center|LOCUS_40440 906 544 gene locus_tag LOCUS_40450 906 544 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087052.1 protein_id gnl|my_center|LOCUS_40450 >Feature sequence307 633 1127 gene locus_tag LOCUS_40460 633 1127 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705491.1 protein_id gnl|my_center|LOCUS_40460 1230 1304 gene locus_tag LOCUS_t00380 1230 1304 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2983 1340 gene locus_tag LOCUS_40470 2983 1340 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970328.1 protein_id gnl|my_center|LOCUS_40470 3154 4782 gene locus_tag LOCUS_40480 3154 4782 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974597.1 protein_id gnl|my_center|LOCUS_40480 >Feature sequence308 846 274 gene locus_tag LOCUS_40490 846 274 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072173.1 protein_id gnl|my_center|LOCUS_40490 2573 939 gene locus_tag LOCUS_40500 2573 939 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003614.1 protein_id gnl|my_center|LOCUS_40500 2992 2795 gene locus_tag LOCUS_40510 2992 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 3295 4191 gene locus_tag LOCUS_40520 3295 4191 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 protein_id gnl|my_center|LOCUS_40520 4819 4361 gene locus_tag LOCUS_40530 4819 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 >Feature sequence309 2899 29 gene locus_tag LOCUS_40540 2899 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 3142 4128 gene locus_tag LOCUS_40550 3142 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 <4722 4079 gene locus_tag LOCUS_40560 <4722 4079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807378.1:N-carbamoylsarcosine amidase >Feature sequence310 187 1221 gene locus_tag LOCUS_40570 187 1221 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_40570 1302 2663 gene locus_tag LOCUS_40580 gene glnA2 1302 2663 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708670.1 protein_id gnl|my_center|LOCUS_40580 2698 4083 gene locus_tag LOCUS_40590 2698 4083 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976259.1 protein_id gnl|my_center|LOCUS_40590 >Feature sequence311 327 4319 gene locus_tag LOCUS_40600 327 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 >Feature sequence312 199 2187 gene locus_tag LOCUS_40610 gene parE 199 2187 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQT8 protein_id gnl|my_center|LOCUS_40610 2261 2839 gene locus_tag LOCUS_40620 2261 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 3374 2832 gene locus_tag LOCUS_40630 3374 2832 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_40630 >Feature sequence313 1445 585 gene locus_tag LOCUS_40640 1445 585 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531830.1 protein_id gnl|my_center|LOCUS_40640 1628 1879 gene locus_tag LOCUS_40650 1628 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 2121 1918 gene locus_tag LOCUS_40660 2121 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 2806 2240 gene locus_tag LOCUS_40670 2806 2240 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTK3 protein_id gnl|my_center|LOCUS_40670 2951 3592 gene locus_tag LOCUS_40680 2951 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 >Feature sequence314 1406 555 gene locus_tag LOCUS_40690 1406 555 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978337.1 protein_id gnl|my_center|LOCUS_40690 1497 2387 gene locus_tag LOCUS_40700 1497 2387 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066655.1 protein_id gnl|my_center|LOCUS_40700 3694 2360 gene locus_tag LOCUS_40710 3694 2360 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762837.1 protein_id gnl|my_center|LOCUS_40710 >Feature sequence315 1310 2188 gene locus_tag LOCUS_40720 gene dapA 1310 2188 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT80 protein_id gnl|my_center|LOCUS_40720 2221 2706 gene locus_tag LOCUS_40730 gene smpB 2221 2706 CDS product ssrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RT81 protein_id gnl|my_center|LOCUS_40730 2734 3606 gene locus_tag LOCUS_40740 2734 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392621.1 protein_id gnl|my_center|LOCUS_40740 <4532 3609 gene locus_tag LOCUS_40750 <4532 3609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390978.1:GGDEF domain-containing protein >Feature sequence316 <1 640 gene locus_tag LOCUS_40760 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392277.1:N-acetylneuraminate synthase 630 1355 gene locus_tag LOCUS_40770 630 1355 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975594.1 protein_id gnl|my_center|LOCUS_40770 1352 2344 gene locus_tag LOCUS_40780 1352 2344 CDS product carbamoyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887290.1 protein_id gnl|my_center|LOCUS_40780 2341 3531 gene locus_tag LOCUS_40790 2341 3531 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088732.1 protein_id gnl|my_center|LOCUS_40790 >Feature sequence317 455 727 gene locus_tag LOCUS_40800 455 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 1200 748 gene locus_tag LOCUS_40810 1200 748 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926362.1 protein_id gnl|my_center|LOCUS_40810 1861 1193 gene locus_tag LOCUS_40820 1861 1193 CDS product flavin-nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530752.1 protein_id gnl|my_center|LOCUS_40820 1982 3475 gene locus_tag LOCUS_40830 1982 3475 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204581.1 protein_id gnl|my_center|LOCUS_40830 3472 4125 gene locus_tag LOCUS_40840 3472 4125 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531881.1 protein_id gnl|my_center|LOCUS_40840 4382 4122 gene locus_tag LOCUS_40850 4382 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 >Feature sequence318 1333 404 gene locus_tag LOCUS_40860 1333 404 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969544.1 protein_id gnl|my_center|LOCUS_40860 1424 2002 gene locus_tag LOCUS_40870 1424 2002 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532352.1 protein_id gnl|my_center|LOCUS_40870 2130 2055 gene locus_tag LOCUS_t00390 2130 2055 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2323 3612 gene locus_tag LOCUS_40880 gene flgE 2323 3612 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NY3 protein_id gnl|my_center|LOCUS_40880 <4373 3636 gene locus_tag LOCUS_40890 <4373 3636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390161.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence319 1867 1667 gene locus_tag LOCUS_40900 1867 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388277.1 protein_id gnl|my_center|LOCUS_40900 1957 2634 gene locus_tag LOCUS_40910 1957 2634 CDS product histidine phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529909.1 protein_id gnl|my_center|LOCUS_40910 >Feature sequence320 <1 2145 gene locus_tag LOCUS_40920 <1 2145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RPA2:chromosome partition protein Smc 3062 2142 gene locus_tag LOCUS_40930 3062 2142 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970176.1 protein_id gnl|my_center|LOCUS_40930 3163 3804 gene locus_tag LOCUS_40940 3163 3804 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UK86 protein_id gnl|my_center|LOCUS_40940 >Feature sequence321 2520 847 gene locus_tag LOCUS_40950 2520 847 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_40950 <4328 2514 gene locus_tag LOCUS_40960 <4328 2514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388527.1:iron ABC transporter substrate-binding protein >Feature sequence322 1950 781 gene locus_tag LOCUS_40970 1950 781 CDS product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814041.1 protein_id gnl|my_center|LOCUS_40970 2240 1953 gene locus_tag LOCUS_40980 2240 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_40980 3265 2348 gene locus_tag LOCUS_40990 3265 2348 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723694.1 protein_id gnl|my_center|LOCUS_40990 <4317 3351 gene locus_tag LOCUS_41000 <4317 3351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531197.1:methyltransferase >Feature sequence323 650 1729 gene locus_tag LOCUS_41010 650 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 1829 3448 gene locus_tag LOCUS_41020 1829 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_41020 >Feature sequence324 1225 368 gene locus_tag LOCUS_41030 gene sseA 1225 368 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969352.1 protein_id gnl|my_center|LOCUS_41030 1945 1229 gene locus_tag LOCUS_41040 1945 1229 CDS product Ala-tRNA(Pro) hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337268.1 protein_id gnl|my_center|LOCUS_41040 3036 2035 gene locus_tag LOCUS_41050 gene cysK 3036 2035 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087225.1 protein_id gnl|my_center|LOCUS_41050 3592 3092 gene locus_tag LOCUS_41060 gene aspP 3592 3092 CDS product adenosine diphosphate sugar pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_41060 >Feature sequence325 2200 461 gene locus_tag LOCUS_41070 2200 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 2358 3056 gene locus_tag LOCUS_41080 2358 3056 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392343.1 protein_id gnl|my_center|LOCUS_41080 3113 3277 gene locus_tag LOCUS_41090 3113 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 3387 3462 gene locus_tag LOCUS_t00400 3387 3462 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 <4207 3511 gene locus_tag LOCUS_41100 <4207 3511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388080.1:two-component sensor histidine kinase >Feature sequence326 1487 543 gene locus_tag LOCUS_41110 1487 543 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 protein_id gnl|my_center|LOCUS_41110 3012 1543 gene locus_tag LOCUS_41120 3012 1543 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389995.1 protein_id gnl|my_center|LOCUS_41120 3337 3032 gene locus_tag LOCUS_41130 3337 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 3514 3918 gene locus_tag LOCUS_41140 3514 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530154.1 protein_id gnl|my_center|LOCUS_41140 >Feature sequence327 2801 1752 gene locus_tag LOCUS_41150 2801 1752 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_41150 3602 3120 gene locus_tag LOCUS_41160 3602 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 >Feature sequence328 585 938 gene locus_tag LOCUS_41170 585 938 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224368.1 protein_id gnl|my_center|LOCUS_41170 940 1401 gene locus_tag LOCUS_41180 940 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 1464 2204 gene locus_tag LOCUS_41190 1464 2204 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083731.1 protein_id gnl|my_center|LOCUS_41190 2253 3440 gene locus_tag LOCUS_41200 2253 3440 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039416.1 protein_id gnl|my_center|LOCUS_41200 >Feature sequence329 2139 493 gene locus_tag LOCUS_41210 gene groL2 2139 493 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV4 protein_id gnl|my_center|LOCUS_41210 2493 2155 gene locus_tag LOCUS_41220 gene groS 2493 2155 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWV5 protein_id gnl|my_center|LOCUS_41220 4018 2663 gene locus_tag LOCUS_41230 gene hflX 4018 2663 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTR0 protein_id gnl|my_center|LOCUS_41230 >Feature sequence330 1568 801 gene locus_tag LOCUS_41240 1568 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 2331 1558 gene locus_tag LOCUS_41250 gene pyrF 2331 1558 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNS7 protein_id gnl|my_center|LOCUS_41250 3294 2404 gene locus_tag LOCUS_41260 gene gcvA 3294 2404 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071711.1 protein_id gnl|my_center|LOCUS_41260 3489 3746 gene locus_tag LOCUS_41270 3489 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 >Feature sequence331 1309 2526 gene locus_tag LOCUS_41280 gene hutI 1309 2526 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58079 protein_id gnl|my_center|LOCUS_41280 >Feature sequence332 161 1483 gene locus_tag LOCUS_41290 161 1483 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWH5 protein_id gnl|my_center|LOCUS_41290 1434 3530 gene locus_tag LOCUS_41300 1434 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 >Feature sequence333 <1 924 gene locus_tag LOCUS_41310 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015775991.1:glycine cleavage system protein T 964 1956 gene locus_tag LOCUS_41320 964 1956 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_41320 2032 2280 gene locus_tag LOCUS_41330 2032 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 2415 3482 gene locus_tag LOCUS_41340 2415 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 >Feature sequence334 129 1823 gene locus_tag LOCUS_41350 129 1823 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088065.1 protein_id gnl|my_center|LOCUS_41350 1919 2311 gene locus_tag LOCUS_41360 1919 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923332.1 protein_id gnl|my_center|LOCUS_41360 2342 2869 gene locus_tag LOCUS_41370 2342 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 2891 3553 gene locus_tag LOCUS_41380 2891 3553 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704944.1 protein_id gnl|my_center|LOCUS_41380 >Feature sequence335 <1 535 gene locus_tag LOCUS_41390 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031346.1:precorrin-6A synthase (deacetylating) 2045 555 gene locus_tag LOCUS_41400 2045 555 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813159.1 protein_id gnl|my_center|LOCUS_41400 2158 3261 gene locus_tag LOCUS_41410 2158 3261 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973629.1 protein_id gnl|my_center|LOCUS_41410 3370 3684 gene locus_tag LOCUS_41420 3370 3684 CDS product urease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083173.1 protein_id gnl|my_center|LOCUS_41420 >Feature sequence336 748 1851 gene locus_tag LOCUS_41430 748 1851 CDS product muconate-lactonizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_41430 1848 2231 gene locus_tag LOCUS_41440 1848 2231 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226809.1 protein_id gnl|my_center|LOCUS_41440 2383 2706 gene locus_tag LOCUS_41450 2383 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709919.1 protein_id gnl|my_center|LOCUS_41450 3370 2771 gene locus_tag LOCUS_41460 3370 2771 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 protein_id gnl|my_center|LOCUS_41460 >Feature sequence337 424 3516 gene locus_tag LOCUS_41470 gene sucA 424 3516 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_426301.2 protein_id gnl|my_center|LOCUS_41470 >Feature sequence338 1712 1152 gene locus_tag LOCUS_41480 1712 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 2596 1772 gene locus_tag LOCUS_41490 2596 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 >Feature sequence339 <1 756 gene locus_tag LOCUS_41500 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090884.1:GDP-mannose-dependent alpha-mannosyltransferase 2365 785 gene locus_tag LOCUS_41510 2365 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 2533 3660 gene locus_tag LOCUS_41520 2533 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 >Feature sequence340 613 2076 gene locus_tag LOCUS_41530 613 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 2177 2410 gene locus_tag LOCUS_41540 2177 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 2502 2308 gene locus_tag LOCUS_41550 2502 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 2501 3355 gene locus_tag LOCUS_41560 2501 3355 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336969.1 protein_id gnl|my_center|LOCUS_41560 >Feature sequence341 1095 1298 gene locus_tag LOCUS_41570 1095 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 1267 1662 gene locus_tag LOCUS_41580 1267 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 1831 3789 gene locus_tag LOCUS_41590 1831 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 >Feature sequence342 1788 1144 gene locus_tag LOCUS_41600 gene rnhB 1788 1144 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPE1 protein_id gnl|my_center|LOCUS_41600 3226 1781 gene locus_tag LOCUS_41610 3226 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 >Feature sequence343 1090 68 gene locus_tag LOCUS_41620 1090 68 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921471.1 protein_id gnl|my_center|LOCUS_41620 1194 2297 gene locus_tag LOCUS_41630 1194 2297 CDS product muconate-lactonizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_41630 3349 2399 gene locus_tag LOCUS_41640 3349 2399 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090893.1 protein_id gnl|my_center|LOCUS_41640 >Feature sequence344 1535 1002 gene locus_tag LOCUS_41650 gene ccmE 1535 1002 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYF4 protein_id gnl|my_center|LOCUS_41650 1723 1532 gene locus_tag LOCUS_41660 1723 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 2554 1739 gene locus_tag LOCUS_41670 2554 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 3354 2686 gene locus_tag LOCUS_41680 gene ccmB 3354 2686 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 protein_id gnl|my_center|LOCUS_41680 >Feature sequence345 1198 965 gene locus_tag LOCUS_41690 gene acpP 1198 965 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC3 protein_id gnl|my_center|LOCUS_41690 2120 1383 gene locus_tag LOCUS_41700 gene fabG 2120 1383 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_41700 3107 2166 gene locus_tag LOCUS_41710 3107 2166 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXC5 protein_id gnl|my_center|LOCUS_41710 >Feature sequence346 1256 510 gene locus_tag LOCUS_41720 1256 510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888237.1 protein_id gnl|my_center|LOCUS_41720 2401 1253 gene locus_tag LOCUS_41730 2401 1253 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972306.1 protein_id gnl|my_center|LOCUS_41730 <3502 2403 gene locus_tag LOCUS_41740 <3502 2403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976304.1:branched-chain amino acid ABC transporter permease >Feature sequence347 42 530 gene locus_tag LOCUS_41750 42 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 831 517 gene locus_tag LOCUS_41760 831 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 957 1841 gene locus_tag LOCUS_41770 957 1841 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731218.1 protein_id gnl|my_center|LOCUS_41770 3228 1903 gene locus_tag LOCUS_41780 3228 1903 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708365.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41780 >Feature sequence348 1422 2078 gene locus_tag LOCUS_41790 1422 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067690.1 protein_id gnl|my_center|LOCUS_41790 2189 3331 gene locus_tag LOCUS_41800 2189 3331 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389734.1 protein_id gnl|my_center|LOCUS_41800 >Feature sequence349 1121 429 gene locus_tag LOCUS_41810 1121 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 2543 1296 gene locus_tag LOCUS_41820 2543 1296 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529754.1 protein_id gnl|my_center|LOCUS_41820 >Feature sequence350 300 2465 gene locus_tag LOCUS_41830 gene katG1 300 2465 CDS product catalase-peroxidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSX7 protein_id gnl|my_center|LOCUS_41830 <3389 2695 gene locus_tag LOCUS_41840 <3389 2695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919938.1:glycosyl transferase >Feature sequence351 <1 607 gene locus_tag LOCUS_41850 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388080.1:two-component sensor histidine kinase 1950 676 gene locus_tag LOCUS_41860 gene eno 1950 676 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MBJ9 protein_id gnl|my_center|LOCUS_41860 >Feature sequence352 2 1312 gene locus_tag LOCUS_41870 2 1312 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384484.1 protein_id gnl|my_center|LOCUS_41870 1319 2374 gene locus_tag LOCUS_41880 1319 2374 CDS product binding-protein-dependent permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065034.1 protein_id gnl|my_center|LOCUS_41880 >Feature sequence353 983 219 gene locus_tag LOCUS_41890 983 219 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086141.1 protein_id gnl|my_center|LOCUS_41890 1750 980 gene locus_tag LOCUS_41900 1750 980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809682.1 protein_id gnl|my_center|LOCUS_41900 2797 1754 gene locus_tag LOCUS_41910 2797 1754 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_41910 <3336 2804 gene locus_tag LOCUS_41920 <3336 2804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039248.1:branched-chain amino acid ABC transporter permease >Feature sequence354 2151 352 gene locus_tag LOCUS_41930 2151 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203819.1 protein_id gnl|my_center|LOCUS_41930 2725 2309 gene locus_tag LOCUS_41940 gene msrB 2725 2309 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 protein_id gnl|my_center|LOCUS_41940 <3308 2718 gene locus_tag LOCUS_41950 <3308 2718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RQM2:gamma-glutamylcyclotransferase >Feature sequence355 166 708 gene locus_tag LOCUS_41960 gene fixH 166 708 CDS product nitrogen fixation protein FixH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085553.1 protein_id gnl|my_center|LOCUS_41960 705 3041 gene locus_tag LOCUS_41970 705 3041 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_41970 3038 3205 gene locus_tag LOCUS_41980 3038 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 >Feature sequence356 <1 619 gene locus_tag LOCUS_41990 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RNM1:succinyl-diaminopimelate desuccinylase 616 1194 gene locus_tag LOCUS_42000 616 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 1324 1863 gene locus_tag LOCUS_42010 1324 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 1922 2254 gene locus_tag LOCUS_42020 1922 2254 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975389.1 protein_id gnl|my_center|LOCUS_42020 2323 3210 gene locus_tag LOCUS_42030 2323 3210 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UB8 protein_id gnl|my_center|LOCUS_42030 >Feature sequence357 137 1066 gene locus_tag LOCUS_42040 137 1066 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 protein_id gnl|my_center|LOCUS_42040 2185 1043 gene locus_tag LOCUS_42050 2185 1043 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T8J8 protein_id gnl|my_center|LOCUS_42050 3263 2325 gene locus_tag LOCUS_42060 3263 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 >Feature sequence358 115 636 gene locus_tag LOCUS_42070 115 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 636 1910 gene locus_tag LOCUS_42080 636 1910 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975184.1 protein_id gnl|my_center|LOCUS_42080 >Feature sequence359 <1 2010 gene locus_tag LOCUS_42090 <1 2010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976306.1:acyl-CoA synthetase 2034 2819 gene locus_tag LOCUS_42100 2034 2819 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976307.1 protein_id gnl|my_center|LOCUS_42100 >Feature sequence360 <1 911 gene locus_tag LOCUS_42110 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389307.1:DUF1289 domain-containing protein 1253 918 gene locus_tag LOCUS_42120 1253 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 1412 2530 gene locus_tag LOCUS_42130 1412 2530 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968856.1 protein_id gnl|my_center|LOCUS_42130 2652 3146 gene locus_tag LOCUS_42140 2652 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 >Feature sequence361 1434 946 gene locus_tag LOCUS_42150 1434 946 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_42150 2311 1448 gene locus_tag LOCUS_42160 2311 1448 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530648.1 protein_id gnl|my_center|LOCUS_42160 <3252 2443 gene locus_tag LOCUS_42170 <3252 2443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528147.1:dimethylglycine dehydrogenase >Feature sequence362 507 49 gene locus_tag LOCUS_42180 507 49 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391432.1 protein_id gnl|my_center|LOCUS_42180 675 1802 gene locus_tag LOCUS_42190 675 1802 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQU3 protein_id gnl|my_center|LOCUS_42190 3209 1866 gene locus_tag LOCUS_42200 3209 1866 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389832.1 protein_id gnl|my_center|LOCUS_42200 >Feature sequence363 512 1315 gene locus_tag LOCUS_42210 512 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 1786 1322 gene locus_tag LOCUS_42220 1786 1322 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971767.1 protein_id gnl|my_center|LOCUS_42220 2252 2794 gene locus_tag LOCUS_42230 2252 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42230 >Feature sequence364 1302 514 gene locus_tag LOCUS_42240 1302 514 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388722.1 protein_id gnl|my_center|LOCUS_42240 <3182 1329 gene locus_tag LOCUS_42250 <3182 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388721.1:carbon monoxide dehydrogenase >Feature sequence365 492 1817 gene locus_tag LOCUS_42260 gene tolB 492 1817 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVF0 protein_id gnl|my_center|LOCUS_42260 2036 2563 gene locus_tag LOCUS_42270 2036 2563 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388850.1 protein_id gnl|my_center|LOCUS_42270 >Feature sequence366 438 893 gene locus_tag LOCUS_42280 438 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 886 1317 gene locus_tag LOCUS_42290 886 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 2096 1314 gene locus_tag LOCUS_42300 2096 1314 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 protein_id gnl|my_center|LOCUS_42300 2197 2793 gene locus_tag LOCUS_42310 2197 2793 CDS product protein hupE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066513.1 protein_id gnl|my_center|LOCUS_42310 >Feature sequence367 <1 915 gene locus_tag LOCUS_42320 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A6Z5:proline--tRNA ligase 923 2167 gene locus_tag LOCUS_42330 923 2167 CDS product LolC/E family lipoprotein releasing system, protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389453.1 protein_id gnl|my_center|LOCUS_42330 2160 2855 gene locus_tag LOCUS_42340 gene lolD 2160 2855 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA3 protein_id gnl|my_center|LOCUS_42340 >Feature sequence368 241 1404 gene locus_tag LOCUS_42350 241 1404 CDS product racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_458109.1 protein_id gnl|my_center|LOCUS_42350 2215 1409 gene locus_tag LOCUS_42360 2215 1409 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815895.1 protein_id gnl|my_center|LOCUS_42360 >Feature sequence369 <1 611 gene locus_tag LOCUS_42370 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888330.1:ABC transporter ATP-binding protein 624 1511 gene locus_tag LOCUS_42380 gene livF 624 1511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 protein_id gnl|my_center|LOCUS_42380 >Feature sequence370 2257 437 gene locus_tag LOCUS_42390 2257 437 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_42390 >Feature sequence371 968 657 gene locus_tag LOCUS_42400 968 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 1950 979 gene locus_tag LOCUS_42410 1950 979 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921338.1 protein_id gnl|my_center|LOCUS_42410 <2992 1960 gene locus_tag LOCUS_42420 <2992 1960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RY62:Na(+)/H(+) antiporter NhaA >Feature sequence372 231 1718 gene locus_tag LOCUS_42430 231 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 1823 2179 gene locus_tag LOCUS_42440 1823 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 >Feature sequence373 <1 1151 gene locus_tag LOCUS_42450 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Z2F5:2-amino-3-ketobutyrate coenzyme A ligase 1170 2198 gene locus_tag LOCUS_42460 gene tdh 1170 2198 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJN2 protein_id gnl|my_center|LOCUS_42460 >Feature sequence374 >Feature sequence375 2016 1327 gene locus_tag LOCUS_42470 2016 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 2879 2022 gene locus_tag LOCUS_42480 2879 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 >Feature sequence376 <1 1397 gene locus_tag LOCUS_42490 <1 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UFZ7:histidine kinase 1484 2482 gene locus_tag LOCUS_42500 gene hemB 1484 2482 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45622 protein_id gnl|my_center|LOCUS_42500 >Feature sequence377 1121 96 gene locus_tag LOCUS_42510 1121 96 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_42510 1829 1125 gene locus_tag LOCUS_42520 1829 1125 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_42520 2629 1826 gene locus_tag LOCUS_42530 2629 1826 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720081.1 protein_id gnl|my_center|LOCUS_42530 >Feature sequence378 128 1120 gene locus_tag LOCUS_42540 128 1120 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384486.1 protein_id gnl|my_center|LOCUS_42540 1117 2133 gene locus_tag LOCUS_42550 1117 2133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085658.1 protein_id gnl|my_center|LOCUS_42550 >Feature sequence379 997 1899 gene locus_tag LOCUS_42560 gene liuE 997 1899 CDS product 3-hydroxy-3-isohexenylglutaryl-CoA/hydroxy-methylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2A0 protein_id gnl|my_center|LOCUS_42560 1984 2412 gene locus_tag LOCUS_42570 1984 2412 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339404.1 protein_id gnl|my_center|LOCUS_42570 >Feature sequence380 2511 1237 gene locus_tag LOCUS_42580 gene dadA 2511 1237 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974069.1 protein_id gnl|my_center|LOCUS_42580 >Feature sequence381 50 514 gene locus_tag LOCUS_42590 50 514 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098560.1 protein_id gnl|my_center|LOCUS_42590 954 535 gene locus_tag LOCUS_42600 954 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 1241 1765 gene locus_tag LOCUS_42610 1241 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 2679 1777 gene locus_tag LOCUS_42620 2679 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 >Feature sequence382 921 328 gene locus_tag LOCUS_42630 921 328 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974744.1 protein_id gnl|my_center|LOCUS_42630 1426 956 gene locus_tag LOCUS_42640 1426 956 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389897.1 protein_id gnl|my_center|LOCUS_42640 2624 1497 gene locus_tag LOCUS_42650 2624 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 >Feature sequence383 <1 1259 gene locus_tag LOCUS_42660 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387796.1:cytochrome c biogenesis protein CcmF 1270 1851 gene locus_tag LOCUS_42670 1270 1851 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 protein_id gnl|my_center|LOCUS_42670 1848 2384 gene locus_tag LOCUS_42680 1848 2384 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387794.1 protein_id gnl|my_center|LOCUS_42680 >Feature sequence384 <1 615 gene locus_tag LOCUS_42690 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969773.1:alcohol dehydrogenase 1626 673 gene locus_tag LOCUS_42700 1626 673 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392167.1 protein_id gnl|my_center|LOCUS_42700 <2747 1630 gene locus_tag LOCUS_42710 <2747 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090006.1:carbon monoxide dehydrogenase >Feature sequence385 <2726 908 gene locus_tag LOCUS_42720 <2726 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P476:bifunctional protein PutA >Feature sequence386 300 1274 gene locus_tag LOCUS_42730 300 1274 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114230.1 protein_id gnl|my_center|LOCUS_42730 1261 2694 gene locus_tag LOCUS_42740 1261 2694 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224881.1 protein_id gnl|my_center|LOCUS_42740 >Feature sequence387 124 987 gene locus_tag LOCUS_42750 124 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 995 2608 gene locus_tag LOCUS_42760 995 2608 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 protein_id gnl|my_center|LOCUS_42760 >Feature sequence388 283 1062 gene locus_tag LOCUS_42770 283 1062 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389537.1 protein_id gnl|my_center|LOCUS_42770 1065 1835 gene locus_tag LOCUS_42780 1065 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 >Feature sequence389 814 299 gene locus_tag LOCUS_42790 814 299 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920991.1 protein_id gnl|my_center|LOCUS_42790 1589 993 gene locus_tag LOCUS_42800 1589 993 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531049.1 protein_id gnl|my_center|LOCUS_42800 1913 1839 gene locus_tag LOCUS_t00410 1913 1839 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence390 558 367 gene locus_tag LOCUS_42810 558 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 1301 573 gene locus_tag LOCUS_42820 gene fixO2 1301 573 CDS product cytochrome c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967401.1 protein_id gnl|my_center|LOCUS_42820 <2608 1319 gene locus_tag LOCUS_42830 <2608 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525002.1:cytochrome c oxidase, cbb3-type subunit I >Feature sequence391 621 382 gene locus_tag LOCUS_42840 621 382 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388465.1 protein_id gnl|my_center|LOCUS_42840 <2604 655 gene locus_tag LOCUS_42850 <2604 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWI3:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence392 665 57 gene locus_tag LOCUS_42860 665 57 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084056.1 protein_id gnl|my_center|LOCUS_42860 2217 688 gene locus_tag LOCUS_42870 gene hutH 2217 688 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAA7 protein_id gnl|my_center|LOCUS_42870 >Feature sequence393 <1 1236 gene locus_tag LOCUS_42880 <1 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973161.1:acetyl/propionyl-CoA carboxylase subunit alpha >Feature sequence394 <1 552 gene locus_tag LOCUS_42890 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538213.1:protocatechuate 3,4-dioxygenase subunit alpha 552 1331 gene locus_tag LOCUS_42900 552 1331 CDS product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969980.1 protein_id gnl|my_center|LOCUS_42900 1328 1999 gene locus_tag LOCUS_42910 gene pcaJ 1328 1999 CDS product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973950.1 protein_id gnl|my_center|LOCUS_42910 >Feature sequence395 277 474 gene locus_tag LOCUS_42920 277 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 861 520 gene locus_tag LOCUS_42930 861 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 1601 1945 gene locus_tag LOCUS_42940 1601 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 2153 2341 gene locus_tag LOCUS_42950 2153 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42950 >Feature sequence396 805 1932 gene locus_tag LOCUS_42960 805 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_42960 2090 1926 gene locus_tag LOCUS_42970 2090 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 >Feature sequence397 <1 819 gene locus_tag LOCUS_42980 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973409.1:ABC transporter ATP-binding protein 830 1906 gene locus_tag LOCUS_42990 830 1906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531811.1 protein_id gnl|my_center|LOCUS_42990 >Feature sequence398 <1 859 gene locus_tag LOCUS_43000 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223726.1:Bcr/CflA family drug resistance efflux transporter >Feature sequence399 2073 373 gene locus_tag LOCUS_43010 gene cydD 2073 373 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538124.1 protein_id gnl|my_center|LOCUS_43010 >Feature sequence400 >Feature sequence401 1950 796 gene locus_tag LOCUS_43020 gene gmd 1950 796 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Y5 protein_id gnl|my_center|LOCUS_43020 >Feature sequence402 1001 384 gene locus_tag LOCUS_43030 gene mobA 1001 384 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89SU1 protein_id gnl|my_center|LOCUS_43030 1897 998 gene locus_tag LOCUS_43040 1897 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 2273 1887 gene locus_tag LOCUS_43050 2273 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 >Feature sequence403 1260 58 gene locus_tag LOCUS_43060 gene caiA 1260 58 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348045.1 protein_id gnl|my_center|LOCUS_43060 1587 1273 gene locus_tag LOCUS_43070 1587 1273 CDS product NIPSNAP family containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723669.1 protein_id gnl|my_center|LOCUS_43070 2260 1628 gene locus_tag LOCUS_43080 gene fabG-2 2260 1628 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_43080 >Feature sequence404 365 1789 gene locus_tag LOCUS_43090 gene der 365 1789 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RPR6 protein_id gnl|my_center|LOCUS_43090 1797 2219 gene locus_tag LOCUS_43100 1797 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 >Feature sequence405 690 166 gene locus_tag LOCUS_43110 gene paaJ 690 166 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709130.1 protein_id gnl|my_center|LOCUS_43110 1467 694 gene locus_tag LOCUS_43120 gene paaC 1467 694 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085677.1 protein_id gnl|my_center|LOCUS_43120 1764 1471 gene locus_tag LOCUS_43130 gene paaB 1764 1471 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902768.1 protein_id gnl|my_center|LOCUS_43130 >Feature sequence406 <1 519 gene locus_tag LOCUS_43140 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082924.1:creatininase 1241 522 gene locus_tag LOCUS_43150 1241 522 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085350.1 protein_id gnl|my_center|LOCUS_43150 1773 1249 gene locus_tag LOCUS_43160 1773 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 >Feature sequence407 956 360 gene locus_tag LOCUS_43170 gene folE 956 360 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR9 protein_id gnl|my_center|LOCUS_43170 1104 1562 gene locus_tag LOCUS_43180 1104 1562 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918350.1 protein_id gnl|my_center|LOCUS_43180 >Feature sequence408 207 1640 gene locus_tag LOCUS_43190 207 1640 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRI0 protein_id gnl|my_center|LOCUS_43190 >Feature sequence409 <1 1092 gene locus_tag LOCUS_43200 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976161.1:lactate dehydrogenase <2128 1022 gene locus_tag LOCUS_43210 <2128 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968018.1:MFS transporter >Feature sequence410 1306 434 gene locus_tag LOCUS_43220 gene mtnP 1306 434 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXH9 protein_id gnl|my_center|LOCUS_43220 1990 1331 gene locus_tag LOCUS_43230 1990 1331 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_43230 >Feature sequence411 812 117 gene locus_tag LOCUS_43240 812 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43240 1140 814 gene locus_tag LOCUS_43250 1140 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088407.1 protein_id gnl|my_center|LOCUS_43250 2099 1137 gene locus_tag LOCUS_43260 2099 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 >Feature sequence412 343 1497 gene locus_tag LOCUS_43270 343 1497 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKB0 protein_id gnl|my_center|LOCUS_43270 >Feature sequence413 448 1359 gene locus_tag LOCUS_43280 448 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 <2074 1364 gene locus_tag LOCUS_43290 <2074 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WG20:transport permease protein >Feature sequence414 1364 366 gene locus_tag LOCUS_43300 gene pdhAa 1364 366 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3I9 protein_id gnl|my_center|LOCUS_43300 >Feature sequence415 510 953 gene locus_tag LOCUS_43310 510 953 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 protein_id gnl|my_center|LOCUS_43310 1788 925 gene locus_tag LOCUS_43320 1788 925 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 protein_id gnl|my_center|LOCUS_43320 >Feature sequence416 762 28 gene locus_tag LOCUS_43330 gene cobB 762 28 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RN56 protein_id gnl|my_center|LOCUS_43330 887 1297 gene locus_tag LOCUS_43340 gene ptpA 887 1297 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_43340 >Feature sequence417 1254 220 gene locus_tag LOCUS_43350 1254 220 CDS product trans-3-hydroxy-L-proline dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CH01 protein_id gnl|my_center|LOCUS_43350 1690 1277 gene locus_tag LOCUS_43360 1690 1277 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975836.1 protein_id gnl|my_center|LOCUS_43360 >Feature sequence418 655 1074 gene locus_tag LOCUS_43370 655 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 >Feature sequence419 <1 997 gene locus_tag LOCUS_43380 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869125.1:C4-dicarboxylate ABC transporter permease 997 1746 gene locus_tag LOCUS_43390 gene pcaH 997 1746 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385629.1 protein_id gnl|my_center|LOCUS_43390 >Feature sequence420 734 39 gene locus_tag LOCUS_43400 gene lexA 734 39 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KS7 protein_id gnl|my_center|LOCUS_43400 1902 889 gene locus_tag LOCUS_43410 gene moeA 1902 889 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087593.1 protein_id gnl|my_center|LOCUS_43410 >Feature sequence421 1230 469 gene locus_tag LOCUS_43420 1230 469 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551516.1 protein_id gnl|my_center|LOCUS_43420 1268 1642 gene locus_tag LOCUS_43430 1268 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 >Feature sequence422 843 205 gene locus_tag LOCUS_43440 gene gst 843 205 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038848.1 protein_id gnl|my_center|LOCUS_43440 <1864 998 gene locus_tag LOCUS_43450 <1864 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P51131:cytochrome b/c1 >Feature sequence423 316 50 gene locus_tag LOCUS_43460 316 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 >Feature sequence424 <1 730 gene locus_tag LOCUS_43470 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085126.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence425 1641 334 gene locus_tag LOCUS_43480 1641 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404073.1 protein_id gnl|my_center|LOCUS_43480 >Feature sequence426 1604 1383 gene locus_tag LOCUS_43490 1604 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43490 >Feature sequence427 1677 178 gene locus_tag LOCUS_43500 1677 178 CDS product microcystinase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IN3 protein_id gnl|my_center|LOCUS_43500 >Feature sequence428 154 876 gene locus_tag LOCUS_43510 154 876 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719733.1 protein_id gnl|my_center|LOCUS_43510 1577 873 gene locus_tag LOCUS_43520 gene purQ 1577 873 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IB6 protein_id gnl|my_center|LOCUS_43520 >Feature sequence429 965 291 gene locus_tag LOCUS_43530 965 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973888.1 protein_id gnl|my_center|LOCUS_43530 1142 1633 gene locus_tag LOCUS_43540 1142 1633 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_43540 >Feature sequence430 <1650 732 gene locus_tag LOCUS_43550 <1650 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528562.1:methylhydantoinase >Feature sequence431 387 1253 gene locus_tag LOCUS_43560 387 1253 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226433.1 protein_id gnl|my_center|LOCUS_43560 >Feature sequence432 1443 166 gene locus_tag LOCUS_43570 gene ectB 1443 166 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NZ7 protein_id gnl|my_center|LOCUS_43570 >Feature sequence433 629 1549 gene locus_tag LOCUS_43580 gene sucD 629 1549 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LJ5 protein_id gnl|my_center|LOCUS_43580 >Feature sequence434 <1513 572 gene locus_tag LOCUS_43590 <1513 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074297.1:HD family phosphohydrolase >Feature sequence435