>Feature sequence001 1630 17 gene locus_tag LOCUS_00010 1630 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2590 2189 gene locus_tag LOCUS_00020 2590 2189 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 protein_id gnl|my_center|LOCUS_00020 2645 2944 gene locus_tag LOCUS_00030 2645 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3243 4595 gene locus_tag LOCUS_00040 3243 4595 CDS product putative FAD-dependent pyridine nucleotide-disulphide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700707.1 protein_id gnl|my_center|LOCUS_00040 4900 5391 gene locus_tag LOCUS_00050 4900 5391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6105 5512 gene locus_tag LOCUS_00060 6105 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8677 6275 gene locus_tag LOCUS_00070 8677 6275 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_00070 9777 8731 gene locus_tag LOCUS_00080 9777 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10058 9774 gene locus_tag LOCUS_00090 10058 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10471 10130 gene locus_tag LOCUS_00100 10471 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401147.1 protein_id gnl|my_center|LOCUS_00100 12606 10468 gene locus_tag LOCUS_00110 12606 10468 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 protein_id gnl|my_center|LOCUS_00110 12934 13209 gene locus_tag LOCUS_00120 12934 13209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13206 13496 gene locus_tag LOCUS_00130 13206 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13824 13618 gene locus_tag LOCUS_00140 13824 13618 CDS product heavy metal transport/detoxification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225366.1 protein_id gnl|my_center|LOCUS_00140 14170 13874 gene locus_tag LOCUS_00150 14170 13874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401147.1 protein_id gnl|my_center|LOCUS_00150 14372 14827 gene locus_tag LOCUS_00160 14372 14827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 14902 15504 gene locus_tag LOCUS_00170 14902 15504 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029667.1 protein_id gnl|my_center|LOCUS_00170 16621 15620 gene locus_tag LOCUS_00180 16621 15620 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_00180 18024 16618 gene locus_tag LOCUS_00190 18024 16618 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_00190 19018 18119 gene locus_tag LOCUS_00200 19018 18119 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804603.1 protein_id gnl|my_center|LOCUS_00200 19359 19018 gene locus_tag LOCUS_00210 19359 19018 CDS product putative transcriptional regulator, ArsR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705576.1 protein_id gnl|my_center|LOCUS_00210 19483 20145 gene locus_tag LOCUS_00220 19483 20145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20142 20729 gene locus_tag LOCUS_00230 20142 20729 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 protein_id gnl|my_center|LOCUS_00230 20746 21528 gene locus_tag LOCUS_00240 20746 21528 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029678.1 protein_id gnl|my_center|LOCUS_00240 21525 22145 gene locus_tag LOCUS_00250 21525 22145 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776421.1 protein_id gnl|my_center|LOCUS_00250 23064 22210 gene locus_tag LOCUS_00260 23064 22210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 23531 23166 gene locus_tag LOCUS_00270 23531 23166 CDS product penicillinase repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 protein_id gnl|my_center|LOCUS_00270 25576 23528 gene locus_tag LOCUS_00280 25576 23528 CDS product copper resistance protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228600.1 protein_id gnl|my_center|LOCUS_00280 26175 25615 gene locus_tag LOCUS_00290 26175 25615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27242 26325 gene locus_tag LOCUS_00300 27242 26325 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_00300 28855 27239 gene locus_tag LOCUS_00310 28855 27239 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776419.1 protein_id gnl|my_center|LOCUS_00310 28901 30439 gene locus_tag LOCUS_00320 gene lnt 28901 30439 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAD0 protein_id gnl|my_center|LOCUS_00320 30899 30426 gene locus_tag LOCUS_00330 30899 30426 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706423.1 protein_id gnl|my_center|LOCUS_00330 32989 30896 gene locus_tag LOCUS_00340 32989 30896 CDS product heavy metal-translocating P-type ATPase Cd/Co/Hg/Pb/Zn-transporting inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776290.1 protein_id gnl|my_center|LOCUS_00340 33342 32986 gene locus_tag LOCUS_00350 33342 32986 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 protein_id gnl|my_center|LOCUS_00350 33890 33465 gene locus_tag LOCUS_00360 gene fliL 33890 33465 CDS product flagellar protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67712 protein_id gnl|my_center|LOCUS_00360 34724 34320 gene locus_tag LOCUS_00370 34724 34320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 34686 35042 gene locus_tag LOCUS_00380 34686 35042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 >Feature sequence002 1665 1273 gene locus_tag LOCUS_00390 1665 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 1769 2188 gene locus_tag LOCUS_00400 1769 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 2185 2667 gene locus_tag LOCUS_00410 2185 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 3229 2831 gene locus_tag LOCUS_00420 3229 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 4236 6530 gene locus_tag LOCUS_00430 4236 6530 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224133.1 protein_id gnl|my_center|LOCUS_00430 6530 7063 gene locus_tag LOCUS_00440 6530 7063 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030506.1 protein_id gnl|my_center|LOCUS_00440 7179 7712 gene locus_tag LOCUS_00450 7179 7712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 7773 8366 gene locus_tag LOCUS_00460 7773 8366 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 protein_id gnl|my_center|LOCUS_00460 8578 9174 gene locus_tag LOCUS_00470 8578 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 10801 9221 gene locus_tag LOCUS_00480 10801 9221 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727664.1 protein_id gnl|my_center|LOCUS_00480 10921 11784 gene locus_tag LOCUS_00490 10921 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 12179 11859 gene locus_tag LOCUS_00500 12179 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 12241 12888 gene locus_tag LOCUS_00510 12241 12888 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224757.1 protein_id gnl|my_center|LOCUS_00510 12885 13472 gene locus_tag LOCUS_00520 12885 13472 CDS product TIGR03085 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409689.1 protein_id gnl|my_center|LOCUS_00520 13478 13951 gene locus_tag LOCUS_00530 13478 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 14906 14124 gene locus_tag LOCUS_00540 14906 14124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 14977 15987 gene locus_tag LOCUS_00550 14977 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702817.1 protein_id gnl|my_center|LOCUS_00550 16014 16658 gene locus_tag LOCUS_00560 16014 16658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702814.1 protein_id gnl|my_center|LOCUS_00560 17361 16711 gene locus_tag LOCUS_00570 17361 16711 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973436.1 protein_id gnl|my_center|LOCUS_00570 17242 17571 gene locus_tag LOCUS_00580 17242 17571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 17568 18092 gene locus_tag LOCUS_00590 17568 18092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 18775 18098 gene locus_tag LOCUS_00600 18775 18098 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227083.1 protein_id gnl|my_center|LOCUS_00600 18926 20071 gene locus_tag LOCUS_00610 18926 20071 CDS product putative acyl CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702816.1 protein_id gnl|my_center|LOCUS_00610 20551 20700 gene locus_tag LOCUS_00620 20551 20700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 21707 20904 gene locus_tag LOCUS_00630 21707 20904 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409355.1 protein_id gnl|my_center|LOCUS_00630 23254 21746 gene locus_tag LOCUS_00640 23254 21746 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MII8 protein_id gnl|my_center|LOCUS_00640 24946 23318 gene locus_tag LOCUS_00650 24946 23318 CDS product putative medium chain fatty-acid-CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702815.1 protein_id gnl|my_center|LOCUS_00650 26231 25029 gene locus_tag LOCUS_00660 26231 25029 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_00660 27622 26228 gene locus_tag LOCUS_00670 27622 26228 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702784.1 protein_id gnl|my_center|LOCUS_00670 27963 27643 gene locus_tag LOCUS_00680 27963 27643 CDS product putative ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702785.1 protein_id gnl|my_center|LOCUS_00680 28078 29166 gene locus_tag LOCUS_00690 28078 29166 CDS product putative HTH-type transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702786.1 protein_id gnl|my_center|LOCUS_00690 30159 29566 gene locus_tag LOCUS_00700 30159 29566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 30260 30691 gene locus_tag LOCUS_00710 30260 30691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 30703 31281 gene locus_tag LOCUS_00720 30703 31281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 31416 31712 gene locus_tag LOCUS_00730 31416 31712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 31712 33031 gene locus_tag LOCUS_00740 31712 33031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 33015 33392 gene locus_tag LOCUS_00750 33015 33392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 >Feature sequence003 <1 1173 gene locus_tag LOCUS_00760 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MCU8:Na(+)/H(+) antiporter NhaA 1209 1652 gene locus_tag LOCUS_00770 1209 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230543.1 protein_id gnl|my_center|LOCUS_00770 1663 2613 gene locus_tag LOCUS_00780 1663 2613 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908812.1 protein_id gnl|my_center|LOCUS_00780 3820 2645 gene locus_tag LOCUS_00790 3820 2645 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230547.1 protein_id gnl|my_center|LOCUS_00790 4569 3826 gene locus_tag LOCUS_00800 4569 3826 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029090.1 protein_id gnl|my_center|LOCUS_00800 5168 4566 gene locus_tag LOCUS_00810 5168 4566 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731103.1 protein_id gnl|my_center|LOCUS_00810 5893 5165 gene locus_tag LOCUS_00820 gene nth 5893 5165 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA44 protein_id gnl|my_center|LOCUS_00820 6113 6790 gene locus_tag LOCUS_00830 6113 6790 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_00830 7680 6826 gene locus_tag LOCUS_00840 7680 6826 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029093.1 protein_id gnl|my_center|LOCUS_00840 8607 7690 gene locus_tag LOCUS_00850 8607 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975363.1 protein_id gnl|my_center|LOCUS_00850 9086 8616 gene locus_tag LOCUS_00860 9086 8616 CDS product putative endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701166.1 protein_id gnl|my_center|LOCUS_00860 9238 9083 gene locus_tag LOCUS_00870 9238 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776605.1 protein_id gnl|my_center|LOCUS_00870 9320 10336 gene locus_tag LOCUS_00880 9320 10336 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029095.1 protein_id gnl|my_center|LOCUS_00880 10333 11511 gene locus_tag LOCUS_00890 10333 11511 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_00890 11826 11512 gene locus_tag LOCUS_00900 gene whiB 11826 11512 CDS product transcriptional regulator WhiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2B9 protein_id gnl|my_center|LOCUS_00900 12310 11987 gene locus_tag LOCUS_00910 gene whiB 12310 11987 CDS product transcriptional regulator WhiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2B9 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00910 12567 14870 gene locus_tag LOCUS_00920 12567 14870 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776607.1 protein_id gnl|my_center|LOCUS_00920 15371 14913 gene locus_tag LOCUS_00930 15371 14913 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731125.1 protein_id gnl|my_center|LOCUS_00930 15422 16369 gene locus_tag LOCUS_00940 15422 16369 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230570.1 protein_id gnl|my_center|LOCUS_00940 16424 16500 gene locus_tag LOCUS_t00010 16424 16500 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence004 1561 1124 gene locus_tag LOCUS_00950 1561 1124 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976686.1 protein_id gnl|my_center|LOCUS_00950 1674 3473 gene locus_tag LOCUS_00960 1674 3473 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028155.1 protein_id gnl|my_center|LOCUS_00960 3681 4583 gene locus_tag LOCUS_00970 3681 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 4587 5759 gene locus_tag LOCUS_00980 4587 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 5756 7291 gene locus_tag LOCUS_00990 5756 7291 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_00990 7288 9246 gene locus_tag LOCUS_01000 7288 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 9246 10193 gene locus_tag LOCUS_01010 9246 10193 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_01010 10438 10641 gene locus_tag LOCUS_01020 10438 10641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 11841 10696 gene locus_tag LOCUS_01030 11841 10696 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028156.1 protein_id gnl|my_center|LOCUS_01030 13157 11838 gene locus_tag LOCUS_01040 13157 11838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 13511 13260 gene locus_tag LOCUS_01050 13511 13260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 13651 15453 gene locus_tag LOCUS_01060 gene dnaQ 13651 15453 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224085.1 protein_id gnl|my_center|LOCUS_01060 >Feature sequence005 723 7 gene locus_tag LOCUS_01070 723 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 2345 1029 gene locus_tag LOCUS_01080 2345 1029 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973949.1 protein_id gnl|my_center|LOCUS_01080 3361 2606 gene locus_tag LOCUS_01090 gene uppS 3361 2606 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DI43 protein_id gnl|my_center|LOCUS_01090 3457 4155 gene locus_tag LOCUS_01100 3457 4155 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029984.1 protein_id gnl|my_center|LOCUS_01100 4172 5155 gene locus_tag LOCUS_01110 4172 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 5193 5972 gene locus_tag LOCUS_01120 5193 5972 CDS product SGNH hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226518.1 protein_id gnl|my_center|LOCUS_01120 7182 5974 gene locus_tag LOCUS_01130 7182 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 7281 8423 gene locus_tag LOCUS_01140 gene adh 7281 8423 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222380.1 protein_id gnl|my_center|LOCUS_01140 9685 8486 gene locus_tag LOCUS_01150 9685 8486 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_01150 9792 10583 gene locus_tag LOCUS_01160 9792 10583 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976109.1 protein_id gnl|my_center|LOCUS_01160 10580 10927 gene locus_tag LOCUS_01170 10580 10927 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222088.1 protein_id gnl|my_center|LOCUS_01170 11102 11884 gene locus_tag LOCUS_01180 11102 11884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 14677 11909 gene locus_tag LOCUS_01190 gene ppc 14677 11909 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RNU9 protein_id gnl|my_center|LOCUS_01190 15607 14729 gene locus_tag LOCUS_01200 15607 14729 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 protein_id gnl|my_center|LOCUS_01200 >Feature sequence006 2223 691 gene locus_tag LOCUS_01210 2223 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 4178 2355 gene locus_tag LOCUS_01220 4178 2355 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229763.1 protein_id gnl|my_center|LOCUS_01220 6193 4412 gene locus_tag LOCUS_01230 gene aspS 6193 4412 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805009.1 protein_id gnl|my_center|LOCUS_01230 7488 6190 gene locus_tag LOCUS_01240 gene hisS 7488 6190 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCI0 protein_id gnl|my_center|LOCUS_01240 8248 7526 gene locus_tag LOCUS_01250 8248 7526 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977317.1 protein_id gnl|my_center|LOCUS_01250 8392 9864 gene locus_tag LOCUS_01260 8392 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 12329 10080 gene locus_tag LOCUS_01270 gene relA 12329 10080 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52560 protein_id gnl|my_center|LOCUS_01270 13064 12510 gene locus_tag LOCUS_01280 gene apt 13064 12510 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52561 protein_id gnl|my_center|LOCUS_01280 14346 13054 gene locus_tag LOCUS_01290 gene secF 14346 13054 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53956 protein_id gnl|my_center|LOCUS_01290 <15932 14346 gene locus_tag LOCUS_01300 <15932 14346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q53955:protein translocase subunit SecD >Feature sequence007 <1 2055 gene locus_tag LOCUS_01310 <1 2055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9S291:DNA-directed DNA polymerase 2066 2914 gene locus_tag LOCUS_01320 2066 2914 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028138.1 protein_id gnl|my_center|LOCUS_01320 2942 4222 gene locus_tag LOCUS_01330 gene dinB 2942 4222 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAG1 protein_id gnl|my_center|LOCUS_01330 4369 4872 gene locus_tag LOCUS_01340 4369 4872 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028137.1 protein_id gnl|my_center|LOCUS_01340 7402 5036 gene locus_tag LOCUS_01350 7402 5036 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028136.1 protein_id gnl|my_center|LOCUS_01350 8787 7399 gene locus_tag LOCUS_01360 8787 7399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 9791 8790 gene locus_tag LOCUS_01370 gene moxR 9791 8790 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228052.1 protein_id gnl|my_center|LOCUS_01370 10128 10556 gene locus_tag LOCUS_01380 gene mraZ 10128 10556 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAF5 protein_id gnl|my_center|LOCUS_01380 10789 10959 gene locus_tag LOCUS_01390 10789 10959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 10963 12093 gene locus_tag LOCUS_01400 gene mraW 10963 12093 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DED4 protein_id gnl|my_center|LOCUS_01400 12090 12755 gene locus_tag LOCUS_01410 12090 12755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 12752 14578 gene locus_tag LOCUS_01420 12752 14578 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028132.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence008 1419 217 gene locus_tag LOCUS_01430 1419 217 CDS product McrBC 5-methylcytosine restriction system component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804187.1 protein_id gnl|my_center|LOCUS_01430 3638 1416 gene locus_tag LOCUS_01440 3638 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 4223 3693 gene locus_tag LOCUS_01450 4223 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5445 4228 gene locus_tag LOCUS_01460 gene atoB 5445 4228 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229842.1 protein_id gnl|my_center|LOCUS_01460 5566 6486 gene locus_tag LOCUS_01470 5566 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6875 6483 gene locus_tag LOCUS_01480 6875 6483 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_01480 9382 6908 gene locus_tag LOCUS_01490 9382 6908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 10540 9506 gene locus_tag LOCUS_01500 10540 9506 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978023.1 protein_id gnl|my_center|LOCUS_01500 10809 11084 gene locus_tag LOCUS_01510 10809 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 11078 11461 gene locus_tag LOCUS_01520 11078 11461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 14056 11501 gene locus_tag LOCUS_01530 14056 11501 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028475.1 protein_id gnl|my_center|LOCUS_01530 >Feature sequence009 1616 1122 gene locus_tag LOCUS_01540 1616 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 1697 3316 gene locus_tag LOCUS_01550 1697 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 3358 3648 gene locus_tag LOCUS_01560 gene purS 3358 3648 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEY0 protein_id gnl|my_center|LOCUS_01560 3645 4313 gene locus_tag LOCUS_01570 gene purQ 3645 4313 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKK6 protein_id gnl|my_center|LOCUS_01570 4310 6598 gene locus_tag LOCUS_01580 gene purL 4310 6598 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKK5 protein_id gnl|my_center|LOCUS_01580 7960 6623 gene locus_tag LOCUS_01590 7960 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 8074 8472 gene locus_tag LOCUS_01600 8074 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 8576 10936 gene locus_tag LOCUS_01610 8576 10936 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224857.1 protein_id gnl|my_center|LOCUS_01610 10963 11442 gene locus_tag LOCUS_01620 10963 11442 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224858.1 protein_id gnl|my_center|LOCUS_01620 11485 12840 gene locus_tag LOCUS_01630 11485 12840 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412946.1 protein_id gnl|my_center|LOCUS_01630 12962 13219 gene locus_tag LOCUS_01640 12962 13219 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726655.1 protein_id gnl|my_center|LOCUS_01640 13327 14190 gene locus_tag LOCUS_01650 13327 14190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 >Feature sequence010 >Feature sequence011 331 471 gene locus_tag LOCUS_01660 331 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 1114 482 gene locus_tag LOCUS_01670 1114 482 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027364.1 protein_id gnl|my_center|LOCUS_01670 1166 2803 gene locus_tag LOCUS_01680 1166 2803 CDS product Baeyer-Villiger monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKB5 protein_id gnl|my_center|LOCUS_01680 2800 3639 gene locus_tag LOCUS_01690 2800 3639 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702128.1 protein_id gnl|my_center|LOCUS_01690 4933 3680 gene locus_tag LOCUS_01700 4933 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 5060 6199 gene locus_tag LOCUS_01710 5060 6199 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64694 protein_id gnl|my_center|LOCUS_01710 7291 6239 gene locus_tag LOCUS_01720 7291 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q99340 protein_id gnl|my_center|LOCUS_01720 7500 8909 gene locus_tag LOCUS_01730 7500 8909 CDS product putative diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67211 protein_id gnl|my_center|LOCUS_01730 8958 9752 gene locus_tag LOCUS_01740 8958 9752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 10882 9791 gene locus_tag LOCUS_01750 10882 9791 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777114.1 protein_id gnl|my_center|LOCUS_01750 12329 10875 gene locus_tag LOCUS_01760 12329 10875 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777115.1 protein_id gnl|my_center|LOCUS_01760 13002 12472 gene locus_tag LOCUS_01770 13002 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 >Feature sequence012 728 655 gene locus_tag LOCUS_t00020 728 655 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 881 1462 gene locus_tag LOCUS_01780 gene rpoE 881 1462 CDS product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229256.1 protein_id gnl|my_center|LOCUS_01780 1462 2166 gene locus_tag LOCUS_01790 1462 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229255.1 protein_id gnl|my_center|LOCUS_01790 3819 2176 gene locus_tag LOCUS_01800 3819 2176 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031534.1 protein_id gnl|my_center|LOCUS_01800 3978 3903 gene locus_tag LOCUS_t00030 3978 3903 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4699 4088 gene locus_tag LOCUS_01810 gene orn 4699 4088 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57666 protein_id gnl|my_center|LOCUS_01810 4819 5622 gene locus_tag LOCUS_01820 4819 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 5715 5641 gene locus_tag LOCUS_t00040 5715 5641 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7376 5706 gene locus_tag LOCUS_01830 7376 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 9018 7570 gene locus_tag LOCUS_01840 gene pepPI 9018 7570 CDS product Xaa-Pro aminopeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3Z1 protein_id gnl|my_center|LOCUS_01840 9078 10262 gene locus_tag LOCUS_01850 9078 10262 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230460.1 protein_id gnl|my_center|LOCUS_01850 10244 12004 gene locus_tag LOCUS_01860 10244 12004 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776427.1 protein_id gnl|my_center|LOCUS_01860 12001 13695 gene locus_tag LOCUS_01870 12001 13695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence013 337 1011 gene locus_tag LOCUS_01880 337 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 1170 2102 gene locus_tag LOCUS_01890 1170 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 2197 3345 gene locus_tag LOCUS_01900 2197 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 4257 3352 gene locus_tag LOCUS_01910 gene nfo 4257 3352 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2N2 protein_id gnl|my_center|LOCUS_01910 6317 4284 gene locus_tag LOCUS_01920 6317 4284 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028146.1 protein_id gnl|my_center|LOCUS_01920 6535 7005 gene locus_tag LOCUS_01930 6535 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 8097 7015 gene locus_tag LOCUS_01940 8097 7015 CDS product putative polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702728.1 protein_id gnl|my_center|LOCUS_01940 8181 9044 gene locus_tag LOCUS_01950 8181 9044 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2V3 protein_id gnl|my_center|LOCUS_01950 9140 9301 gene locus_tag LOCUS_01960 9140 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 9330 10646 gene locus_tag LOCUS_01970 9330 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 10816 11250 gene locus_tag LOCUS_01980 10816 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 11268 11717 gene locus_tag LOCUS_01990 11268 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence014 1 921 gene locus_tag LOCUS_02000 1 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 1168 3687 gene locus_tag LOCUS_02010 1168 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 4564 3680 gene locus_tag LOCUS_02020 4564 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230919.1 protein_id gnl|my_center|LOCUS_02020 5487 4564 gene locus_tag LOCUS_02030 5487 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775766.1 protein_id gnl|my_center|LOCUS_02030 7124 5481 gene locus_tag LOCUS_02040 7124 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729931.1 protein_id gnl|my_center|LOCUS_02040 7235 8266 gene locus_tag LOCUS_02050 7235 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 9553 8291 gene locus_tag LOCUS_02060 9553 8291 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230815.1 protein_id gnl|my_center|LOCUS_02060 9658 10767 gene locus_tag LOCUS_02070 gene dxr 9658 10767 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KYS1 protein_id gnl|my_center|LOCUS_02070 10868 11449 gene locus_tag LOCUS_02080 10868 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 11529 12872 gene locus_tag LOCUS_02090 11529 12872 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KYS0 protein_id gnl|my_center|LOCUS_02090 >Feature sequence015 2265 322 gene locus_tag LOCUS_02100 gene nuoL 2265 322 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 protein_id gnl|my_center|LOCUS_02100 2578 2279 gene locus_tag LOCUS_02110 gene nuoK 2578 2279 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWD6 protein_id gnl|my_center|LOCUS_02110 3387 2575 gene locus_tag LOCUS_02120 3387 2575 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029738.1 protein_id gnl|my_center|LOCUS_02120 3986 3384 gene locus_tag LOCUS_02130 gene nuoI 3986 3384 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVN9 protein_id gnl|my_center|LOCUS_02130 5323 3986 gene locus_tag LOCUS_02140 gene nuoH 5323 3986 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MPH1 protein_id gnl|my_center|LOCUS_02140 7779 5320 gene locus_tag LOCUS_02150 gene nuoG 7779 5320 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59962 protein_id gnl|my_center|LOCUS_02150 9122 7776 gene locus_tag LOCUS_02160 gene nuoF 9122 7776 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893427.1 protein_id gnl|my_center|LOCUS_02160 9925 9119 gene locus_tag LOCUS_02170 9925 9119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 11334 9922 gene locus_tag LOCUS_02180 gene nuoD2 11334 9922 CDS product NADH-quinone oxidoreductase subunit D 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAQ7 protein_id gnl|my_center|LOCUS_02180 12107 11334 gene locus_tag LOCUS_02190 gene nuoC 12107 11334 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WJH3 protein_id gnl|my_center|LOCUS_02190 12658 12104 gene locus_tag LOCUS_02200 gene nuoB1 12658 12104 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAQ5 protein_id gnl|my_center|LOCUS_02200 13127 12768 gene locus_tag LOCUS_02210 gene nuoA 13127 12768 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAQ4 protein_id gnl|my_center|LOCUS_02210 >Feature sequence016 <1 726 gene locus_tag LOCUS_02220 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WNE9:NADPH oxidoreductase 755 1966 gene locus_tag LOCUS_02230 755 1966 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 protein_id gnl|my_center|LOCUS_02230 2098 4614 gene locus_tag LOCUS_02240 2098 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 4631 5395 gene locus_tag LOCUS_02250 4631 5395 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_02250 5399 6334 gene locus_tag LOCUS_02260 5399 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 6416 7996 gene locus_tag LOCUS_02270 6416 7996 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727675.1 protein_id gnl|my_center|LOCUS_02270 8136 11486 gene locus_tag LOCUS_02280 8136 11486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 11705 11630 gene locus_tag LOCUS_t00050 11705 11630 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 12527 11781 gene locus_tag LOCUS_02290 12527 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 >Feature sequence017 1871 681 gene locus_tag LOCUS_02300 1871 681 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224456.1 protein_id gnl|my_center|LOCUS_02300 3169 1868 gene locus_tag LOCUS_02310 3169 1868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897419.1 protein_id gnl|my_center|LOCUS_02310 3960 3166 gene locus_tag LOCUS_02320 3960 3166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224454.1 protein_id gnl|my_center|LOCUS_02320 5242 4097 gene locus_tag LOCUS_02330 5242 4097 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897421.1 protein_id gnl|my_center|LOCUS_02330 5396 6556 gene locus_tag LOCUS_02340 gene xylA 5396 6556 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0B8 protein_id gnl|my_center|LOCUS_02340 6560 7972 gene locus_tag LOCUS_02350 gene xylB 6560 7972 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728930.1 protein_id gnl|my_center|LOCUS_02350 8525 7953 gene locus_tag LOCUS_02360 8525 7953 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227148.1 protein_id gnl|my_center|LOCUS_02360 9226 8522 gene locus_tag LOCUS_02370 9226 8522 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703579.1 protein_id gnl|my_center|LOCUS_02370 11020 9293 gene locus_tag LOCUS_02380 gene fprB 11020 9293 CDS product putative ferredoxin/ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33064 protein_id gnl|my_center|LOCUS_02380 12100 11060 gene locus_tag LOCUS_02390 12100 11060 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730709.1 protein_id gnl|my_center|LOCUS_02390 >Feature sequence018 <1 1471 gene locus_tag LOCUS_02400 <1 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222825.1:methylmalonyl-CoA mutase 1468 3651 gene locus_tag LOCUS_02410 1468 3651 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222826.1 protein_id gnl|my_center|LOCUS_02410 3648 4631 gene locus_tag LOCUS_02420 gene argK 3648 4631 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222827.1 protein_id gnl|my_center|LOCUS_02420 4689 5879 gene locus_tag LOCUS_02430 4689 5879 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776145.1 protein_id gnl|my_center|LOCUS_02430 5905 7074 gene locus_tag LOCUS_02440 gene bmpA 5905 7074 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222768.1 protein_id gnl|my_center|LOCUS_02440 7232 8788 gene locus_tag LOCUS_02450 7232 8788 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974086.1 protein_id gnl|my_center|LOCUS_02450 8785 9897 gene locus_tag LOCUS_02460 8785 9897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222770.1 protein_id gnl|my_center|LOCUS_02460 9894 11201 gene locus_tag LOCUS_02470 9894 11201 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029928.1 protein_id gnl|my_center|LOCUS_02470 11198 11596 gene locus_tag LOCUS_02480 11198 11596 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974083.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence019 <1 1440 gene locus_tag LOCUS_02490 <1 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CJR6:transcription termination factor Rho 1556 1945 gene locus_tag LOCUS_02500 1556 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 1942 3006 gene locus_tag LOCUS_02510 1942 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 3011 4531 gene locus_tag LOCUS_02520 3011 4531 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942100.1 protein_id gnl|my_center|LOCUS_02520 4560 4784 gene locus_tag LOCUS_02530 gene rpmE 4560 4784 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4E5 protein_id gnl|my_center|LOCUS_02530 4878 5999 gene locus_tag LOCUS_02540 gene prfA 4878 5999 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4E4 protein_id gnl|my_center|LOCUS_02540 5996 6847 gene locus_tag LOCUS_02550 gene prmC 5996 6847 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4E3 protein_id gnl|my_center|LOCUS_02550 6851 7537 gene locus_tag LOCUS_02560 6851 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 7545 8735 gene locus_tag LOCUS_02570 7545 8735 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775946.1 protein_id gnl|my_center|LOCUS_02570 8732 9202 gene locus_tag LOCUS_02580 8732 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 9233 9523 gene locus_tag LOCUS_02590 9233 9523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 9520 10359 gene locus_tag LOCUS_02600 gene atpB 9520 10359 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DII9 protein_id gnl|my_center|LOCUS_02600 10461 10664 gene locus_tag LOCUS_02610 10461 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 10710 11267 gene locus_tag LOCUS_02620 gene atpF 10710 11267 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DH24 protein_id gnl|my_center|LOCUS_02620 >Feature sequence020 1222 2121 gene locus_tag LOCUS_02630 1222 2121 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029614.1 protein_id gnl|my_center|LOCUS_02630 2304 2636 gene locus_tag LOCUS_02640 2304 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2713 3636 gene locus_tag LOCUS_02650 2713 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3909 4913 gene locus_tag LOCUS_02660 3909 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 5777 4917 gene locus_tag LOCUS_02670 5777 4917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230734.1 protein_id gnl|my_center|LOCUS_02670 7423 5774 gene locus_tag LOCUS_02680 gene cbiO 7423 5774 CDS product cobalt ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230735.1 protein_id gnl|my_center|LOCUS_02680 8649 7420 gene locus_tag LOCUS_02690 8649 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 9733 8651 gene locus_tag LOCUS_02700 9733 8651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence021 235 546 gene locus_tag LOCUS_02710 235 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 973 602 gene locus_tag LOCUS_02720 973 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 2422 1166 gene locus_tag LOCUS_02730 2422 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 3234 2464 gene locus_tag LOCUS_02740 3234 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705284.1 protein_id gnl|my_center|LOCUS_02740 3965 3294 gene locus_tag LOCUS_02750 3965 3294 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977513.1 protein_id gnl|my_center|LOCUS_02750 4005 4961 gene locus_tag LOCUS_02760 4005 4961 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_02760 6281 4977 gene locus_tag LOCUS_02770 gene nhaA 6281 4977 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QW18 protein_id gnl|my_center|LOCUS_02770 6366 7526 gene locus_tag LOCUS_02780 6366 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775829.1 protein_id gnl|my_center|LOCUS_02780 7523 7945 gene locus_tag LOCUS_02790 7523 7945 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027708.1 protein_id gnl|my_center|LOCUS_02790 8046 9062 gene locus_tag LOCUS_02800 8046 9062 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256232.1 protein_id gnl|my_center|LOCUS_02800 9093 10799 gene locus_tag LOCUS_02810 9093 10799 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256231.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence022 422 153 gene locus_tag LOCUS_02820 422 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 864 547 gene locus_tag LOCUS_02830 864 547 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973260.1 protein_id gnl|my_center|LOCUS_02830 1589 861 gene locus_tag LOCUS_02840 1589 861 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973261.1 protein_id gnl|my_center|LOCUS_02840 2235 1573 gene locus_tag LOCUS_02850 2235 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 2686 2261 gene locus_tag LOCUS_02860 2686 2261 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976410.1 protein_id gnl|my_center|LOCUS_02860 2812 3690 gene locus_tag LOCUS_02870 2812 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728818.1 protein_id gnl|my_center|LOCUS_02870 3816 4769 gene locus_tag LOCUS_02880 3816 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730839.1 protein_id gnl|my_center|LOCUS_02880 4891 5100 gene locus_tag LOCUS_02890 4891 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 5104 6309 gene locus_tag LOCUS_02900 5104 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064316.1 protein_id gnl|my_center|LOCUS_02900 7293 6319 gene locus_tag LOCUS_02910 7293 6319 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_02910 7400 8059 gene locus_tag LOCUS_02920 7400 8059 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227434.1 protein_id gnl|my_center|LOCUS_02920 8089 9579 gene locus_tag LOCUS_02930 8089 9579 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730023.1 protein_id gnl|my_center|LOCUS_02930 9589 10719 gene locus_tag LOCUS_02940 9589 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence023 73 318 gene locus_tag LOCUS_02950 73 318 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726655.1 protein_id gnl|my_center|LOCUS_02950 570 400 gene locus_tag LOCUS_02960 570 400 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_02960 1373 702 gene locus_tag LOCUS_02970 1373 702 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814649.1 protein_id gnl|my_center|LOCUS_02970 2109 1396 gene locus_tag LOCUS_02980 2109 1396 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 protein_id gnl|my_center|LOCUS_02980 2100 2504 gene locus_tag LOCUS_02990 2100 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 4197 2494 gene locus_tag LOCUS_03000 4197 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 5676 4303 gene locus_tag LOCUS_03010 5676 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 6401 5724 gene locus_tag LOCUS_03020 6401 5724 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889567.1 protein_id gnl|my_center|LOCUS_03020 6896 6627 gene locus_tag LOCUS_03030 6896 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 6838 8622 gene locus_tag LOCUS_03040 6838 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 8833 9366 gene locus_tag LOCUS_03050 8833 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 9363 10535 gene locus_tag LOCUS_03060 9363 10535 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729667.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence024 16 1545 gene locus_tag LOCUS_03070 16 1545 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974372.1 protein_id gnl|my_center|LOCUS_03070 1542 3179 gene locus_tag LOCUS_03080 gene nuoN 1542 3179 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAR7 protein_id gnl|my_center|LOCUS_03080 3176 4165 gene locus_tag LOCUS_03090 3176 4165 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974364.1 protein_id gnl|my_center|LOCUS_03090 4240 5160 gene locus_tag LOCUS_03100 4240 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03100 7274 5193 gene locus_tag LOCUS_03110 7274 5193 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230984.1 protein_id gnl|my_center|LOCUS_03110 8482 7367 gene locus_tag LOCUS_03120 8482 7367 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029750.1 protein_id gnl|my_center|LOCUS_03120 10353 8479 gene locus_tag LOCUS_03130 10353 8479 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030783.1 protein_id gnl|my_center|LOCUS_03130 >Feature sequence025 632 1351 gene locus_tag LOCUS_03140 632 1351 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027476.1 protein_id gnl|my_center|LOCUS_03140 1389 2204 gene locus_tag LOCUS_03150 1389 2204 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974967.1 protein_id gnl|my_center|LOCUS_03150 2256 2711 gene locus_tag LOCUS_03160 2256 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2733 3689 gene locus_tag LOCUS_03170 2733 3689 CDS product preprotein translocase SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974969.1 protein_id gnl|my_center|LOCUS_03170 5193 3757 gene locus_tag LOCUS_03180 5193 3757 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970232.1 protein_id gnl|my_center|LOCUS_03180 5686 5222 gene locus_tag LOCUS_03190 5686 5222 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804009.1 protein_id gnl|my_center|LOCUS_03190 6606 5683 gene locus_tag LOCUS_03200 6606 5683 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MGP3 protein_id gnl|my_center|LOCUS_03200 6696 7211 gene locus_tag LOCUS_03210 6696 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027611.1 protein_id gnl|my_center|LOCUS_03210 7253 7957 gene locus_tag LOCUS_03220 7253 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 8818 7976 gene locus_tag LOCUS_03230 8818 7976 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730369.1 protein_id gnl|my_center|LOCUS_03230 9723 8815 gene locus_tag LOCUS_03240 9723 8815 CDS product NADH-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227663.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence026 2233 320 gene locus_tag LOCUS_03250 gene dnaG 2233 320 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DE28 protein_id gnl|my_center|LOCUS_03250 3540 2245 gene locus_tag LOCUS_03260 3540 2245 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L2E9 protein_id gnl|my_center|LOCUS_03260 4801 3764 gene locus_tag LOCUS_03270 4801 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 6162 4996 gene locus_tag LOCUS_03280 6162 4996 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKF6 protein_id gnl|my_center|LOCUS_03280 6806 6159 gene locus_tag LOCUS_03290 6806 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 8334 6922 gene locus_tag LOCUS_03300 gene glyQS 8334 6922 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MN75 protein_id gnl|my_center|LOCUS_03300 8451 8768 gene locus_tag LOCUS_03310 8451 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 8814 9851 gene locus_tag LOCUS_03320 8814 9851 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence027 620 234 gene locus_tag LOCUS_03330 620 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 1329 622 gene locus_tag LOCUS_03340 1329 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1817 1377 gene locus_tag LOCUS_03350 gene dut 1817 1377 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2A4 protein_id gnl|my_center|LOCUS_03350 1895 2413 gene locus_tag LOCUS_03360 1895 2413 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413931.1 protein_id gnl|my_center|LOCUS_03360 2471 2752 gene locus_tag LOCUS_03370 2471 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 3110 2823 gene locus_tag LOCUS_03380 3110 2823 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993510.1 protein_id gnl|my_center|LOCUS_03380 4158 3328 gene locus_tag LOCUS_03390 gene suhB 4158 3328 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224474.1 protein_id gnl|my_center|LOCUS_03390 5341 4163 gene locus_tag LOCUS_03400 gene hemH 5341 4163 CDS product putative ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50533 protein_id gnl|my_center|LOCUS_03400 5405 6637 gene locus_tag LOCUS_03410 5405 6637 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113745.1 protein_id gnl|my_center|LOCUS_03410 6696 7793 gene locus_tag LOCUS_03420 6696 7793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805049.1 protein_id gnl|my_center|LOCUS_03420 7878 9875 gene locus_tag LOCUS_03430 7878 9875 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229847.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence028 2117 423 gene locus_tag LOCUS_03440 2117 423 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN4 protein_id gnl|my_center|LOCUS_03440 3162 2137 gene locus_tag LOCUS_03450 3162 2137 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977450.1 protein_id gnl|my_center|LOCUS_03450 3344 4606 gene locus_tag LOCUS_03460 3344 4606 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F3B7 protein_id gnl|my_center|LOCUS_03460 5693 4671 gene locus_tag LOCUS_03470 5693 4671 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_03470 6655 5690 gene locus_tag LOCUS_03480 6655 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8171 6777 gene locus_tag LOCUS_03490 gene aglE 8171 6777 CDS product alpha-glucosides-binding periplasmic protein AglE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z3R5 protein_id gnl|my_center|LOCUS_03490 8429 9517 gene locus_tag LOCUS_03500 8429 9517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029527.1 protein_id gnl|my_center|LOCUS_03500 >Feature sequence029 10 1329 gene locus_tag LOCUS_03510 10 1329 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2G4 protein_id gnl|my_center|LOCUS_03510 1411 2958 gene locus_tag LOCUS_03520 1411 2958 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_03520 3018 3614 gene locus_tag LOCUS_03530 3018 3614 CDS product nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731327.1 protein_id gnl|my_center|LOCUS_03530 4422 3634 gene locus_tag LOCUS_03540 4422 3634 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896587.1 protein_id gnl|my_center|LOCUS_03540 5011 4454 gene locus_tag LOCUS_03550 5011 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 6093 5008 gene locus_tag LOCUS_03560 6093 5008 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029666.1 protein_id gnl|my_center|LOCUS_03560 6141 6857 gene locus_tag LOCUS_03570 6141 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 7788 6847 gene locus_tag LOCUS_03580 7788 6847 CDS product putative hydrolase, alpha/beta fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703343.1 protein_id gnl|my_center|LOCUS_03580 7912 9702 gene locus_tag LOCUS_03590 7912 9702 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230478.1 protein_id gnl|my_center|LOCUS_03590 >Feature sequence030 1126 119 gene locus_tag LOCUS_03600 1126 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403477.1 protein_id gnl|my_center|LOCUS_03600 2324 1131 gene locus_tag LOCUS_03610 2324 1131 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030944.1 protein_id gnl|my_center|LOCUS_03610 3786 2410 gene locus_tag LOCUS_03620 3786 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 4886 3783 gene locus_tag LOCUS_03630 4886 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5025 6347 gene locus_tag LOCUS_03640 5025 6347 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030088.1 protein_id gnl|my_center|LOCUS_03640 6340 6906 gene locus_tag LOCUS_03650 6340 6906 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030087.1 protein_id gnl|my_center|LOCUS_03650 6924 8078 gene locus_tag LOCUS_03660 6924 8078 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBK6 protein_id gnl|my_center|LOCUS_03660 8129 8461 gene locus_tag LOCUS_03670 8129 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 9101 8508 gene locus_tag LOCUS_03680 9101 8508 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973830.1 protein_id gnl|my_center|LOCUS_03680 9331 9912 gene locus_tag LOCUS_03690 9331 9912 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222974.1 protein_id gnl|my_center|LOCUS_03690 >Feature sequence031 830 78 gene locus_tag LOCUS_03700 830 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 905 1441 gene locus_tag LOCUS_03710 905 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224874.1 protein_id gnl|my_center|LOCUS_03710 2847 1504 gene locus_tag LOCUS_03720 2847 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 3050 4423 gene locus_tag LOCUS_03730 gene hemL 3050 4423 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2S0 protein_id gnl|my_center|LOCUS_03730 4423 5112 gene locus_tag LOCUS_03740 4423 5112 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974480.1 protein_id gnl|my_center|LOCUS_03740 5223 5720 gene locus_tag LOCUS_03750 5223 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03750 5737 6489 gene locus_tag LOCUS_03760 5737 6489 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029678.1 protein_id gnl|my_center|LOCUS_03760 6513 8228 gene locus_tag LOCUS_03770 6513 8228 CDS product cytochrome c biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029679.1 protein_id gnl|my_center|LOCUS_03770 8225 9229 gene locus_tag LOCUS_03780 8225 9229 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029680.1 protein_id gnl|my_center|LOCUS_03780 9556 9293 gene locus_tag LOCUS_03790 9556 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 9667 9960 gene locus_tag LOCUS_03800 9667 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence032 1435 449 gene locus_tag LOCUS_03810 1435 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03810 2165 1557 gene locus_tag LOCUS_03820 gene leuD 2165 1557 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZM0 protein_id gnl|my_center|LOCUS_03820 3586 2186 gene locus_tag LOCUS_03830 gene leuC 3586 2186 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86534 protein_id gnl|my_center|LOCUS_03830 3654 4373 gene locus_tag LOCUS_03840 3654 4373 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030305.1 protein_id gnl|my_center|LOCUS_03840 4999 4391 gene locus_tag LOCUS_03850 4999 4391 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970020.1 protein_id gnl|my_center|LOCUS_03850 5216 6385 gene locus_tag LOCUS_03860 5216 6385 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970024.1 protein_id gnl|my_center|LOCUS_03860 6382 7974 gene locus_tag LOCUS_03870 6382 7974 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 protein_id gnl|my_center|LOCUS_03870 7976 8476 gene locus_tag LOCUS_03880 7976 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 8473 9234 gene locus_tag LOCUS_03890 8473 9234 CDS product malonate transporter MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084016.1 protein_id gnl|my_center|LOCUS_03890 9743 9240 gene locus_tag LOCUS_03900 9743 9240 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R1Z5 protein_id gnl|my_center|LOCUS_03900 >Feature sequence033 980 1459 gene locus_tag LOCUS_03910 980 1459 CDS product hypothetical transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701519.1 protein_id gnl|my_center|LOCUS_03910 1581 2009 gene locus_tag LOCUS_03920 gene aroQ 1581 2009 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2T6 protein_id gnl|my_center|LOCUS_03920 2063 2737 gene locus_tag LOCUS_03930 2063 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2753 3655 gene locus_tag LOCUS_03940 2753 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705002.1 protein_id gnl|my_center|LOCUS_03940 3701 4318 gene locus_tag LOCUS_03950 gene efp 3701 4318 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXQ9 protein_id gnl|my_center|LOCUS_03950 4332 4745 gene locus_tag LOCUS_03960 gene nusB 4332 4745 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWR5 protein_id gnl|my_center|LOCUS_03960 4758 5369 gene locus_tag LOCUS_03970 4758 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 5671 7047 gene locus_tag LOCUS_03980 5671 7047 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028984.1 protein_id gnl|my_center|LOCUS_03980 7044 7562 gene locus_tag LOCUS_03990 7044 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 8744 7566 gene locus_tag LOCUS_04000 8744 7566 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013383.1 protein_id gnl|my_center|LOCUS_04000 8977 9555 gene locus_tag LOCUS_04010 gene pyrR 8977 9555 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXR1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence034 9 1433 gene locus_tag LOCUS_04020 gene glnA 9 1433 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15106 protein_id gnl|my_center|LOCUS_04020 1758 2375 gene locus_tag LOCUS_04030 1758 2375 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803956.1 protein_id gnl|my_center|LOCUS_04030 2372 3229 gene locus_tag LOCUS_04040 2372 3229 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803957.1 protein_id gnl|my_center|LOCUS_04040 3226 4569 gene locus_tag LOCUS_04050 3226 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 5583 4681 gene locus_tag LOCUS_04060 5583 4681 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731198.1 protein_id gnl|my_center|LOCUS_04060 6123 5662 gene locus_tag LOCUS_04070 6123 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 6326 7201 gene locus_tag LOCUS_04080 6326 7201 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228716.1 protein_id gnl|my_center|LOCUS_04080 7509 7243 gene locus_tag LOCUS_04090 7509 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 7599 8489 gene locus_tag LOCUS_04100 7599 8489 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228493.1 protein_id gnl|my_center|LOCUS_04100 8930 8490 gene locus_tag LOCUS_04110 gene arsC 8930 8490 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 protein_id gnl|my_center|LOCUS_04110 >Feature sequence035 2641 1757 gene locus_tag LOCUS_04120 2641 1757 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971490.1 protein_id gnl|my_center|LOCUS_04120 2750 4129 gene locus_tag LOCUS_04130 2750 4129 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975860.1 protein_id gnl|my_center|LOCUS_04130 4327 5472 gene locus_tag LOCUS_04140 4327 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 5469 6617 gene locus_tag LOCUS_04150 5469 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6671 8851 gene locus_tag LOCUS_04160 6671 8851 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726743.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence036 1157 60 gene locus_tag LOCUS_04170 1157 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 1213 2721 gene locus_tag LOCUS_04180 1213 2721 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_04180 2986 2732 gene locus_tag LOCUS_04190 gene whiB 2986 2732 CDS product transcriptional regulator WhiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKG4 protein_id gnl|my_center|LOCUS_04190 3211 3618 gene locus_tag LOCUS_04200 3211 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4440 3655 gene locus_tag LOCUS_04210 4440 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4847 4449 gene locus_tag LOCUS_04220 4847 4449 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973726.1 protein_id gnl|my_center|LOCUS_04220 5377 4976 gene locus_tag LOCUS_04230 gene sodN 5377 4976 CDS product superoxide dismutase [Ni] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80735 protein_id gnl|my_center|LOCUS_04230 5616 5903 gene locus_tag LOCUS_04240 5616 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 5971 7161 gene locus_tag LOCUS_04250 5971 7161 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973709.1 protein_id gnl|my_center|LOCUS_04250 7207 8175 gene locus_tag LOCUS_04260 7207 8175 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228445.1 protein_id gnl|my_center|LOCUS_04260 8172 8876 gene locus_tag LOCUS_04270 8172 8876 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973506.1 protein_id gnl|my_center|LOCUS_04270 9074 8892 gene locus_tag LOCUS_04280 9074 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030139.1 protein_id gnl|my_center|LOCUS_04280 <9745 9091 gene locus_tag LOCUS_04290 <9745 9091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030150.1:alpha-ketoglutarate decarboxylase >Feature sequence037 1292 264 gene locus_tag LOCUS_04300 1292 264 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027562.1 protein_id gnl|my_center|LOCUS_04300 1464 2570 gene locus_tag LOCUS_04310 1464 2570 CDS product sugar ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706698.1 protein_id gnl|my_center|LOCUS_04310 2697 3743 gene locus_tag LOCUS_04320 2697 3743 CDS product monosaccharide-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974316.1 protein_id gnl|my_center|LOCUS_04320 3740 4558 gene locus_tag LOCUS_04330 3740 4558 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532702.1 protein_id gnl|my_center|LOCUS_04330 5587 4634 gene locus_tag LOCUS_04340 5587 4634 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_04340 6387 5599 gene locus_tag LOCUS_04350 6387 5599 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027565.1 protein_id gnl|my_center|LOCUS_04350 6878 6525 gene locus_tag LOCUS_04360 6878 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 7719 6940 gene locus_tag LOCUS_04370 7719 6940 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence038 1 153 gene locus_tag LOCUS_04380 1 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 342 848 gene locus_tag LOCUS_04390 342 848 CDS product UPF0678 fatty acid-binding protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DLX6 protein_id gnl|my_center|LOCUS_04390 845 1333 gene locus_tag LOCUS_04400 845 1333 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_04400 2038 1340 gene locus_tag LOCUS_04410 2038 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2911 2081 gene locus_tag LOCUS_04420 2911 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 3053 4075 gene locus_tag LOCUS_04430 3053 4075 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974786.1 protein_id gnl|my_center|LOCUS_04430 4094 5797 gene locus_tag LOCUS_04440 4094 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 5974 6432 gene locus_tag LOCUS_04450 5974 6432 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727288.1 protein_id gnl|my_center|LOCUS_04450 6528 7211 gene locus_tag LOCUS_04460 6528 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 7371 7685 gene locus_tag LOCUS_04470 7371 7685 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974771.1 protein_id gnl|my_center|LOCUS_04470 7757 9295 gene locus_tag LOCUS_04480 7757 9295 CDS product polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803920.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence039 39 1025 gene locus_tag LOCUS_04490 39 1025 CDS product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z514 protein_id gnl|my_center|LOCUS_04490 1102 2088 gene locus_tag LOCUS_04500 gene whiA 1102 2088 CDS product sporulation transcription regulator WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z515 protein_id gnl|my_center|LOCUS_04500 2202 3197 gene locus_tag LOCUS_04510 gene gapA 2202 3197 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4Z2 protein_id gnl|my_center|LOCUS_04510 3202 4419 gene locus_tag LOCUS_04520 gene pgk 3202 4419 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z519 protein_id gnl|my_center|LOCUS_04520 4449 5219 gene locus_tag LOCUS_04530 gene tpiA 4449 5219 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z520 protein_id gnl|my_center|LOCUS_04530 5287 5514 gene locus_tag LOCUS_04540 5287 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 5728 6087 gene locus_tag LOCUS_04550 gene rbpA 5728 6087 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z522 protein_id gnl|my_center|LOCUS_04550 6986 6186 gene locus_tag LOCUS_04560 gene pgl 6986 6186 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAB7 protein_id gnl|my_center|LOCUS_04560 8668 6983 gene locus_tag LOCUS_04570 gene pgi 8668 6983 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBH9 protein_id gnl|my_center|LOCUS_04570 <9468 8665 gene locus_tag LOCUS_04580 <9468 8665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D4Z8:transaldolase >Feature sequence040 <1 955 gene locus_tag LOCUS_04590 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031126.1:LacI family transcriptional regulator 1706 1065 gene locus_tag LOCUS_04600 1706 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2478 1711 gene locus_tag LOCUS_04610 2478 1711 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_04610 3717 2485 gene locus_tag LOCUS_04620 gene acd 3717 2485 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_04620 4592 3783 gene locus_tag LOCUS_04630 4592 3783 CDS product putative short chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703834.1 protein_id gnl|my_center|LOCUS_04630 5248 4667 gene locus_tag LOCUS_04640 5248 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 5705 5241 gene locus_tag LOCUS_04650 5705 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 8039 5901 gene locus_tag LOCUS_04660 8039 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 8473 8400 gene locus_tag LOCUS_t00060 8473 8400 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8589 8517 gene locus_tag LOCUS_t00070 8589 8517 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 <9399 8635 gene locus_tag LOCUS_04670 <9399 8635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803896.1:CAAX amino protease >Feature sequence041 960 49 gene locus_tag LOCUS_04680 gene htpX1 960 49 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKN3 protein_id gnl|my_center|LOCUS_04680 1714 968 gene locus_tag LOCUS_04690 1714 968 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028172.1 protein_id gnl|my_center|LOCUS_04690 1861 2484 gene locus_tag LOCUS_04700 1861 2484 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028173.1 protein_id gnl|my_center|LOCUS_04700 2566 3573 gene locus_tag LOCUS_04710 2566 3573 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_04710 3836 3588 gene locus_tag LOCUS_04720 3836 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 4994 3882 gene locus_tag LOCUS_04730 gene gcvT 4994 3882 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R067 protein_id gnl|my_center|LOCUS_04730 5061 6590 gene locus_tag LOCUS_04740 gene pepA 5061 6590 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2Q7 protein_id gnl|my_center|LOCUS_04740 7012 6644 gene locus_tag LOCUS_04750 7012 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729701.1 protein_id gnl|my_center|LOCUS_04750 7203 9041 gene locus_tag LOCUS_04760 7203 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence042 2277 1000 gene locus_tag LOCUS_04770 2277 1000 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 protein_id gnl|my_center|LOCUS_04770 3277 2405 gene locus_tag LOCUS_04780 3277 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 4157 3354 gene locus_tag LOCUS_04790 4157 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974645.1 protein_id gnl|my_center|LOCUS_04790 4196 5833 gene locus_tag LOCUS_04800 4196 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 6251 5868 gene locus_tag LOCUS_04810 6251 5868 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974650.1 protein_id gnl|my_center|LOCUS_04810 6500 8788 gene locus_tag LOCUS_04820 6500 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence043 <1 787 gene locus_tag LOCUS_04830 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227558.1:peptidase 1988 801 gene locus_tag LOCUS_04840 gene serA 1988 801 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054393.1 protein_id gnl|my_center|LOCUS_04840 4337 2040 gene locus_tag LOCUS_04850 4337 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 4548 4877 gene locus_tag LOCUS_04860 4548 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 5397 4954 gene locus_tag LOCUS_04870 5397 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 5434 6117 gene locus_tag LOCUS_04880 gene ho1 5434 6117 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140413.1 protein_id gnl|my_center|LOCUS_04880 7100 6132 gene locus_tag LOCUS_04890 gene dhmA1 7100 6132 CDS product haloalkane dehalogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMS3 protein_id gnl|my_center|LOCUS_04890 8569 7097 gene locus_tag LOCUS_04900 8569 7097 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence044 <1 517 gene locus_tag LOCUS_04910 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O86810:DNA translocase FtsK 514 2928 gene locus_tag LOCUS_04920 514 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 2961 4520 gene locus_tag LOCUS_04930 gene rimO 2961 4520 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86812 protein_id gnl|my_center|LOCUS_04930 4517 5176 gene locus_tag LOCUS_04940 gene pgsA 4517 5176 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894077.1 protein_id gnl|my_center|LOCUS_04940 5791 5219 gene locus_tag LOCUS_04950 5791 5219 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228754.1 protein_id gnl|my_center|LOCUS_04950 6066 6404 gene locus_tag LOCUS_04960 6066 6404 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973269.1 protein_id gnl|my_center|LOCUS_04960 7229 6417 gene locus_tag LOCUS_04970 7229 6417 CDS product putative DNA glycosylase Nei inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705450.1 protein_id gnl|my_center|LOCUS_04970 <9205 7222 gene locus_tag LOCUS_04980 <9205 7222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224210.1:DEAD/DEAH box helicase >Feature sequence045 4642 1412 gene locus_tag LOCUS_04990 4642 1412 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX88 protein_id gnl|my_center|LOCUS_04990 4983 4639 gene locus_tag LOCUS_05000 4983 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5842 4994 gene locus_tag LOCUS_05010 5842 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 6795 5926 gene locus_tag LOCUS_05020 6795 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 8157 6946 gene locus_tag LOCUS_05030 8157 6946 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973798.1 protein_id gnl|my_center|LOCUS_05030 8381 8941 gene locus_tag LOCUS_05040 8381 8941 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973808.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence046 356 102 gene locus_tag LOCUS_05050 356 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 1233 445 gene locus_tag LOCUS_05060 1233 445 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKC6 protein_id gnl|my_center|LOCUS_05060 1910 1230 gene locus_tag LOCUS_05070 1910 1230 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_05070 2267 1911 gene locus_tag LOCUS_05080 2267 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 2995 2264 gene locus_tag LOCUS_05090 2995 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05090 3114 3599 gene locus_tag LOCUS_05100 3114 3599 CDS product alkyl hydroperoxide reductase/ Thiol specific antioxidant/ Mal allergen inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702255.1 protein_id gnl|my_center|LOCUS_05100 3830 3630 gene locus_tag LOCUS_05110 3830 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 4005 4078 gene locus_tag LOCUS_t00080 4005 4078 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5426 4128 gene locus_tag LOCUS_05120 5426 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 7077 5779 gene locus_tag LOCUS_05130 gene deoA 7077 5779 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029929.1 protein_id gnl|my_center|LOCUS_05130 7593 7159 gene locus_tag LOCUS_05140 7593 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 7791 8159 gene locus_tag LOCUS_05150 7791 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030597.1 protein_id gnl|my_center|LOCUS_05150 <8974 8187 gene locus_tag LOCUS_05160 <8974 8187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222093.1:cytochrome P450 >Feature sequence047 420 1061 gene locus_tag LOCUS_05170 420 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1058 1705 gene locus_tag LOCUS_05180 1058 1705 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777112.1 protein_id gnl|my_center|LOCUS_05180 1710 2390 gene locus_tag LOCUS_05190 gene cobB 1710 2390 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX94 protein_id gnl|my_center|LOCUS_05190 2412 3032 gene locus_tag LOCUS_05200 2412 3032 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028545.1 protein_id gnl|my_center|LOCUS_05200 3102 3278 gene locus_tag LOCUS_05210 3102 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3950 3312 gene locus_tag LOCUS_05220 gene upp 3950 3312 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AK76 protein_id gnl|my_center|LOCUS_05220 4046 4549 gene locus_tag LOCUS_05230 4046 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 4572 5066 gene locus_tag LOCUS_05240 gene tadA 4572 5066 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AK79 protein_id gnl|my_center|LOCUS_05240 5187 5274 gene locus_tag LOCUS_t00090 5187 5274 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5333 5893 gene locus_tag LOCUS_05250 5333 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 5904 6101 gene locus_tag LOCUS_05260 5904 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 6113 6478 gene locus_tag LOCUS_05270 6113 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 6662 7108 gene locus_tag LOCUS_05280 6662 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 7105 7785 gene locus_tag LOCUS_05290 7105 7785 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273859.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence048 1972 164 gene locus_tag LOCUS_05300 1972 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703340.1 protein_id gnl|my_center|LOCUS_05300 2008 2568 gene locus_tag LOCUS_05310 2008 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 5599 2717 gene locus_tag LOCUS_05320 gene nrdA 5599 2717 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224267.1 protein_id gnl|my_center|LOCUS_05320 6219 5737 gene locus_tag LOCUS_05330 gene nrdR 6219 5737 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCZ3 protein_id gnl|my_center|LOCUS_05330 7261 6680 gene locus_tag LOCUS_05340 7261 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 7422 8105 gene locus_tag LOCUS_05350 7422 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 8467 8114 gene locus_tag LOCUS_05360 8467 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence049 <1 1089 gene locus_tag LOCUS_05370 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8T8F2:histidine kinase 1271 1588 gene locus_tag LOCUS_05380 gene kaiB2 1271 1588 CDS product KaiB 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725098.1 protein_id gnl|my_center|LOCUS_05380 1581 2687 gene locus_tag LOCUS_05390 1581 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 6088 2702 gene locus_tag LOCUS_05400 6088 2702 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776321.1 protein_id gnl|my_center|LOCUS_05400 6226 6624 gene locus_tag LOCUS_05410 6226 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 7504 6641 gene locus_tag LOCUS_05420 7504 6641 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803897.1 protein_id gnl|my_center|LOCUS_05420 7745 7509 gene locus_tag LOCUS_05430 7745 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803898.1 protein_id gnl|my_center|LOCUS_05430 7832 8776 gene locus_tag LOCUS_05440 gene menB 7832 8776 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHD8 protein_id gnl|my_center|LOCUS_05440 >Feature sequence050 2719 86 gene locus_tag LOCUS_05450 gene valS 2719 86 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1M5 protein_id gnl|my_center|LOCUS_05450 2796 4355 gene locus_tag LOCUS_05460 2796 4355 CDS product dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028454.1 protein_id gnl|my_center|LOCUS_05460 4348 4689 gene locus_tag LOCUS_05470 4348 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 4740 5147 gene locus_tag LOCUS_05480 gene ndk 4740 5147 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMX9 protein_id gnl|my_center|LOCUS_05480 5307 6329 gene locus_tag LOCUS_05490 5307 6329 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976188.1 protein_id gnl|my_center|LOCUS_05490 6326 7291 gene locus_tag LOCUS_05500 6326 7291 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976189.1 protein_id gnl|my_center|LOCUS_05500 7288 7854 gene locus_tag LOCUS_05510 7288 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 >Feature sequence051 1880 1107 gene locus_tag LOCUS_05520 1880 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2443 1877 gene locus_tag LOCUS_05530 2443 1877 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029683.1 protein_id gnl|my_center|LOCUS_05530 2518 3603 gene locus_tag LOCUS_05540 gene leuB 2518 3603 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKK9 protein_id gnl|my_center|LOCUS_05540 3632 4717 gene locus_tag LOCUS_05550 gene ilvE 3632 4717 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC84 protein_id gnl|my_center|LOCUS_05550 4803 6575 gene locus_tag LOCUS_05560 4803 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 6651 8348 gene locus_tag LOCUS_05570 gene cimA 6651 8348 CDS product (R)-citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86511 protein_id gnl|my_center|LOCUS_05570 >Feature sequence052 1174 1596 gene locus_tag LOCUS_05580 1174 1596 CDS product molybdopterin biosynthesis protein MoeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_05580 1699 1965 gene locus_tag LOCUS_05590 1699 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2014 3066 gene locus_tag LOCUS_05600 2014 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804763.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05600 3093 3641 gene locus_tag LOCUS_05610 3093 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 3820 6990 gene locus_tag LOCUS_05620 3820 6990 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FCI4 protein_id gnl|my_center|LOCUS_05620 7102 7410 gene locus_tag LOCUS_05630 7102 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 7421 7915 gene locus_tag LOCUS_05640 gene smpB 7421 7915 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1S9 protein_id gnl|my_center|LOCUS_05640 >Feature sequence053 533 282 gene locus_tag LOCUS_05650 gene acpP 533 282 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKN8 protein_id gnl|my_center|LOCUS_05650 1602 628 gene locus_tag LOCUS_05660 1602 628 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028322.1 protein_id gnl|my_center|LOCUS_05660 1964 2959 gene locus_tag LOCUS_05670 1964 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNH3 protein_id gnl|my_center|LOCUS_05670 4511 3189 gene locus_tag LOCUS_05680 gene livK 4511 3189 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223283.1 protein_id gnl|my_center|LOCUS_05680 5775 4597 gene locus_tag LOCUS_05690 gene livM 5775 4597 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223282.1 protein_id gnl|my_center|LOCUS_05690 6656 5775 gene locus_tag LOCUS_05700 gene livH 6656 5775 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223281.1 protein_id gnl|my_center|LOCUS_05700 7427 6669 gene locus_tag LOCUS_05710 gene livF 7427 6669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223280.1 protein_id gnl|my_center|LOCUS_05710 8188 7424 gene locus_tag LOCUS_05720 gene livG 8188 7424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223279.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence054 2788 1523 gene locus_tag LOCUS_05730 2788 1523 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533371.1 protein_id gnl|my_center|LOCUS_05730 3093 2785 gene locus_tag LOCUS_05740 3093 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3972 3367 gene locus_tag LOCUS_05750 3972 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 5079 4177 gene locus_tag LOCUS_05760 5079 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 5660 5076 gene locus_tag LOCUS_05770 5660 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 5978 6334 gene locus_tag LOCUS_05780 5978 6334 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546974.1 protein_id gnl|my_center|LOCUS_05780 6797 6345 gene locus_tag LOCUS_05790 6797 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 7367 6894 gene locus_tag LOCUS_05800 7367 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 >Feature sequence055 741 118 gene locus_tag LOCUS_05810 741 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 1337 714 gene locus_tag LOCUS_05820 1337 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1672 4902 gene locus_tag LOCUS_05830 gene ileS 1672 4902 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2X5 protein_id gnl|my_center|LOCUS_05830 5786 4992 gene locus_tag LOCUS_05840 5786 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 6190 5897 gene locus_tag LOCUS_05850 6190 5897 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804708.1 protein_id gnl|my_center|LOCUS_05850 6805 6275 gene locus_tag LOCUS_05860 gene sepF2 6805 6275 CDS product cell division protein SepF 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2X2 protein_id gnl|my_center|LOCUS_05860 7605 6874 gene locus_tag LOCUS_05870 7605 6874 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028129.1 protein_id gnl|my_center|LOCUS_05870 8399 7602 gene locus_tag LOCUS_05880 8399 7602 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45497 protein_id gnl|my_center|LOCUS_05880 >Feature sequence056 1480 212 gene locus_tag LOCUS_05890 1480 212 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224306.1 protein_id gnl|my_center|LOCUS_05890 3102 1477 gene locus_tag LOCUS_05900 3102 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 4286 3102 gene locus_tag LOCUS_05910 4286 3102 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976390.1 protein_id gnl|my_center|LOCUS_05910 5287 4283 gene locus_tag LOCUS_05920 5287 4283 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229369.1 protein_id gnl|my_center|LOCUS_05920 6315 5287 gene locus_tag LOCUS_05930 6315 5287 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222535.1 protein_id gnl|my_center|LOCUS_05930 7580 6321 gene locus_tag LOCUS_05940 7580 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 <8366 7577 gene locus_tag LOCUS_05950 <8366 7577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223673.1:ABC transporter substrate-binding protein >Feature sequence057 1257 88 gene locus_tag LOCUS_05960 1257 88 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804511.1 protein_id gnl|my_center|LOCUS_05960 1998 1330 gene locus_tag LOCUS_05970 1998 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 2738 2112 gene locus_tag LOCUS_05980 2738 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3345 2773 gene locus_tag LOCUS_05990 3345 2773 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975432.1 protein_id gnl|my_center|LOCUS_05990 3721 3338 gene locus_tag LOCUS_06000 gene folB 3721 3338 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8I0 protein_id gnl|my_center|LOCUS_06000 4616 3714 gene locus_tag LOCUS_06010 gene folP 4616 3714 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DL49 protein_id gnl|my_center|LOCUS_06010 5238 4624 gene locus_tag LOCUS_06020 gene folE 5238 4624 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8I3 protein_id gnl|my_center|LOCUS_06020 7455 5248 gene locus_tag LOCUS_06030 gene ftsH 7455 5248 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8I4 protein_id gnl|my_center|LOCUS_06030 7554 8177 gene locus_tag LOCUS_06040 7554 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence058 113 1873 gene locus_tag LOCUS_06050 gene leuA 113 1873 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31046 protein_id gnl|my_center|LOCUS_06050 4385 1890 gene locus_tag LOCUS_06060 4385 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 4544 5395 gene locus_tag LOCUS_06070 4544 5395 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226826.1 protein_id gnl|my_center|LOCUS_06070 5512 7047 gene locus_tag LOCUS_06080 5512 7047 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776726.1 protein_id gnl|my_center|LOCUS_06080 7067 7798 gene locus_tag LOCUS_06090 gene recO 7067 7798 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L2H3 protein_id gnl|my_center|LOCUS_06090 >Feature sequence059 <1 561 gene locus_tag LOCUS_06100 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776734.1:acyltransferase 558 1622 gene locus_tag LOCUS_06110 558 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 1777 2811 gene locus_tag LOCUS_06120 1777 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 2808 3818 gene locus_tag LOCUS_06130 2808 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 4081 3821 gene locus_tag LOCUS_06140 4081 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 5908 4169 gene locus_tag LOCUS_06150 5908 4169 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143814.1 protein_id gnl|my_center|LOCUS_06150 6034 7557 gene locus_tag LOCUS_06160 6034 7557 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence060 521 1141 gene locus_tag LOCUS_06170 521 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_06170 1714 1280 gene locus_tag LOCUS_06180 1714 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06180 3230 1707 gene locus_tag LOCUS_06190 3230 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06190 3458 4516 gene locus_tag LOCUS_06200 3458 4516 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_06200 6319 4610 gene locus_tag LOCUS_06210 gene ptsI 6319 4610 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNL6 protein_id gnl|my_center|LOCUS_06210 6435 7202 gene locus_tag LOCUS_06220 6435 7202 CDS product D-beta-D-heptose 1-phosphate adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 protein_id gnl|my_center|LOCUS_06220 7204 8172 gene locus_tag LOCUS_06230 7204 8172 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence061 <1 975 gene locus_tag LOCUS_06240 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063731.1:flagellar biosynthesis protein FlhB 1108 3162 gene locus_tag LOCUS_06250 1108 3162 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460749.1 protein_id gnl|my_center|LOCUS_06250 3159 3599 gene locus_tag LOCUS_06260 3159 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 4602 3769 gene locus_tag LOCUS_06270 gene nei 4602 3769 CDS product putative endonuclease 8 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86820 protein_id gnl|my_center|LOCUS_06270 6623 4626 gene locus_tag LOCUS_06280 6623 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226763.1 protein_id gnl|my_center|LOCUS_06280 8015 6633 gene locus_tag LOCUS_06290 gene chlI 8015 6633 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226764.1 protein_id gnl|my_center|LOCUS_06290 >Feature sequence062 475 618 gene locus_tag LOCUS_06300 475 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 706 1260 gene locus_tag LOCUS_06310 706 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 1792 1271 gene locus_tag LOCUS_06320 1792 1271 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_06320 1821 2543 gene locus_tag LOCUS_06330 1821 2543 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_06330 2566 4158 gene locus_tag LOCUS_06340 2566 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4212 5696 gene locus_tag LOCUS_06350 4212 5696 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029001.1 protein_id gnl|my_center|LOCUS_06350 6404 5751 gene locus_tag LOCUS_06360 6404 5751 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028998.1 protein_id gnl|my_center|LOCUS_06360 6472 7767 gene locus_tag LOCUS_06370 6472 7767 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028997.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence063 1216 509 gene locus_tag LOCUS_06380 1216 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804383.1 protein_id gnl|my_center|LOCUS_06380 3050 1242 gene locus_tag LOCUS_06390 gene sppA 3050 1242 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727691.1 protein_id gnl|my_center|LOCUS_06390 3575 3093 gene locus_tag LOCUS_06400 3575 3093 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 protein_id gnl|my_center|LOCUS_06400 5148 3685 gene locus_tag LOCUS_06410 5148 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206056.1 protein_id gnl|my_center|LOCUS_06410 6733 5210 gene locus_tag LOCUS_06420 6733 5210 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence064 196 753 gene locus_tag LOCUS_06430 gene frr 196 753 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86770 protein_id gnl|my_center|LOCUS_06430 766 1644 gene locus_tag LOCUS_06440 766 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2822 1656 gene locus_tag LOCUS_06450 2822 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2954 4018 gene locus_tag LOCUS_06460 2954 4018 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226173.1 protein_id gnl|my_center|LOCUS_06460 4015 4803 gene locus_tag LOCUS_06470 4015 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226174.1 protein_id gnl|my_center|LOCUS_06470 4800 5831 gene locus_tag LOCUS_06480 gene adh 4800 5831 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226175.1 protein_id gnl|my_center|LOCUS_06480 6364 5837 gene locus_tag LOCUS_06490 6364 5837 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837135.1 protein_id gnl|my_center|LOCUS_06490 6429 7610 gene locus_tag LOCUS_06500 gene rlmN 6429 7610 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86754 protein_id gnl|my_center|LOCUS_06500 >Feature sequence065 565 2016 gene locus_tag LOCUS_06510 565 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2033 3940 gene locus_tag LOCUS_06520 2033 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 3961 5133 gene locus_tag LOCUS_06530 3961 5133 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776101.1 protein_id gnl|my_center|LOCUS_06530 5130 7256 gene locus_tag LOCUS_06540 5130 7256 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776100.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence066 2582 3352 gene locus_tag LOCUS_06550 2582 3352 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R539 protein_id gnl|my_center|LOCUS_06550 3366 3995 gene locus_tag LOCUS_06560 3366 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06560 3992 4891 gene locus_tag LOCUS_06570 3992 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705119.1 protein_id gnl|my_center|LOCUS_06570 4960 5895 gene locus_tag LOCUS_06580 4960 5895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223406.1 protein_id gnl|my_center|LOCUS_06580 5892 6656 gene locus_tag LOCUS_06590 5892 6656 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223407.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence067 395 1648 gene locus_tag LOCUS_06600 395 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_06600 1645 2286 gene locus_tag LOCUS_06610 1645 2286 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027667.1 protein_id gnl|my_center|LOCUS_06610 2348 3637 gene locus_tag LOCUS_06620 2348 3637 CDS product UPF0256 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKV6 protein_id gnl|my_center|LOCUS_06620 3695 4315 gene locus_tag LOCUS_06630 3695 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 4396 7221 gene locus_tag LOCUS_06640 gene secA 4396 7221 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4G6 protein_id gnl|my_center|LOCUS_06640 >Feature sequence068 927 2786 gene locus_tag LOCUS_06650 927 2786 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230903.1 protein_id gnl|my_center|LOCUS_06650 3003 3221 gene locus_tag LOCUS_06660 3003 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 3244 4056 gene locus_tag LOCUS_06670 3244 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701453.1 protein_id gnl|my_center|LOCUS_06670 4071 4601 gene locus_tag LOCUS_06680 4071 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4656 5144 gene locus_tag LOCUS_06690 4656 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5137 6624 gene locus_tag LOCUS_06700 gene accD 5137 6624 CDS product acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728196.1 protein_id gnl|my_center|LOCUS_06700 7694 6621 gene locus_tag LOCUS_06710 7694 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 >Feature sequence069 722 1819 gene locus_tag LOCUS_06720 722 1819 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803669.1 protein_id gnl|my_center|LOCUS_06720 1819 2448 gene locus_tag LOCUS_06730 1819 2448 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_06730 2445 3707 gene locus_tag LOCUS_06740 gene ribBA 2445 3707 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EWJ8 protein_id gnl|my_center|LOCUS_06740 3704 4246 gene locus_tag LOCUS_06750 gene ribH 3704 4246 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EWJ9 protein_id gnl|my_center|LOCUS_06750 4258 4521 gene locus_tag LOCUS_06760 gene hisE 4258 4521 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MPG1 protein_id gnl|my_center|LOCUS_06760 4533 5387 gene locus_tag LOCUS_06770 gene hisG 4533 5387 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CK28 protein_id gnl|my_center|LOCUS_06770 5387 5845 gene locus_tag LOCUS_06780 5387 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 6547 5963 gene locus_tag LOCUS_06790 6547 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703922.1 protein_id gnl|my_center|LOCUS_06790 <7692 6582 gene locus_tag LOCUS_06800 <7692 6582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005464000.1:peptidase S8 >Feature sequence070 1725 370 gene locus_tag LOCUS_06810 gene mshA 1725 370 CDS product D-inositol 3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FCG5 protein_id gnl|my_center|LOCUS_06810 2275 1850 gene locus_tag LOCUS_06820 2275 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4216 2342 gene locus_tag LOCUS_06830 4216 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 4821 4216 gene locus_tag LOCUS_06840 4821 4216 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013585.1 protein_id gnl|my_center|LOCUS_06840 4998 6893 gene locus_tag LOCUS_06850 4998 6893 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973866.1 protein_id gnl|my_center|LOCUS_06850 7624 6941 gene locus_tag LOCUS_06860 7624 6941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence071 <1 1374 gene locus_tag LOCUS_06870 <1 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KXP9:alanine--tRNA ligase 1402 1866 gene locus_tag LOCUS_06880 1402 1866 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXQ0 protein_id gnl|my_center|LOCUS_06880 1926 3038 gene locus_tag LOCUS_06890 1926 3038 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775669.1 protein_id gnl|my_center|LOCUS_06890 3050 3886 gene locus_tag LOCUS_06900 gene aroE 3050 3886 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_625778.2 protein_id gnl|my_center|LOCUS_06900 3896 4654 gene locus_tag LOCUS_06910 3896 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4722 5897 gene locus_tag LOCUS_06920 gene aroC 4722 5897 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXQ4 protein_id gnl|my_center|LOCUS_06920 5917 6468 gene locus_tag LOCUS_06930 gene aroK 5917 6468 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0T2 protein_id gnl|my_center|LOCUS_06930 >Feature sequence072 777 370 gene locus_tag LOCUS_06940 777 370 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027943.1 protein_id gnl|my_center|LOCUS_06940 776 1948 gene locus_tag LOCUS_06950 gene iscS 776 1948 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223557.1 protein_id gnl|my_center|LOCUS_06950 1949 3064 gene locus_tag LOCUS_06960 gene mnmA 1949 3064 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86583 protein_id gnl|my_center|LOCUS_06960 3061 4101 gene locus_tag LOCUS_06970 3061 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030277.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence073 3047 4525 gene locus_tag LOCUS_06980 3047 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4667 4978 gene locus_tag LOCUS_06990 4667 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4992 5282 gene locus_tag LOCUS_07000 4992 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 5392 5916 gene locus_tag LOCUS_07010 5392 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 5927 7324 gene locus_tag LOCUS_07020 5927 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence074 <1 629 gene locus_tag LOCUS_07030 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KY67:DNA helicase 1847 1041 gene locus_tag LOCUS_07040 1847 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2017 2430 gene locus_tag LOCUS_07050 2017 2430 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869042.1 protein_id gnl|my_center|LOCUS_07050 4220 2433 gene locus_tag LOCUS_07060 4220 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 5200 4361 gene locus_tag LOCUS_07070 5200 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 5397 6563 gene locus_tag LOCUS_07080 gene sucC 5397 6563 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R3M4 protein_id gnl|my_center|LOCUS_07080 6577 7464 gene locus_tag LOCUS_07090 6577 7464 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MAK6 protein_id gnl|my_center|LOCUS_07090 >Feature sequence075 1391 1993 gene locus_tag LOCUS_07100 gene coaE 1391 1993 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2K7 protein_id gnl|my_center|LOCUS_07100 3051 2029 gene locus_tag LOCUS_07110 gene hrdD 3051 2029 CDS product RNA polymerase principal sigma factor HrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18249 protein_id gnl|my_center|LOCUS_07110 4753 3305 gene locus_tag LOCUS_07120 gene dinB 4753 3305 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AK82 protein_id gnl|my_center|LOCUS_07120 4945 6012 gene locus_tag LOCUS_07130 4945 6012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence076 1337 246 gene locus_tag LOCUS_07140 gene murG 1337 246 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBA5 protein_id gnl|my_center|LOCUS_07140 2743 1337 gene locus_tag LOCUS_07150 2743 1337 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976730.1 protein_id gnl|my_center|LOCUS_07150 4225 2747 gene locus_tag LOCUS_07160 gene murD 4225 2747 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2W9 protein_id gnl|my_center|LOCUS_07160 5292 4222 gene locus_tag LOCUS_07170 gene mraY 5292 4222 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56833 protein_id gnl|my_center|LOCUS_07170 6782 5289 gene locus_tag LOCUS_07180 gene murF 6782 5289 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2W8 protein_id gnl|my_center|LOCUS_07180 <7412 6779 gene locus_tag LOCUS_07190 <7412 6779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DBG9:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence077 943 56 gene locus_tag LOCUS_07200 943 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2378 1074 gene locus_tag LOCUS_07210 gene proA 2378 1074 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDK1 protein_id gnl|my_center|LOCUS_07210 2829 2407 gene locus_tag LOCUS_07220 2829 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 4105 2939 gene locus_tag LOCUS_07230 gene proB 4105 2939 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDJ9 protein_id gnl|my_center|LOCUS_07230 5700 4105 gene locus_tag LOCUS_07240 gene obg 5700 4105 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95722 protein_id gnl|my_center|LOCUS_07240 6078 5824 gene locus_tag LOCUS_07250 gene rpmA 6078 5824 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1I1 protein_id gnl|my_center|LOCUS_07250 6447 6142 gene locus_tag LOCUS_07260 gene rplU 6447 6142 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WHC3 protein_id gnl|my_center|LOCUS_07260 >Feature sequence078 <1 1357 gene locus_tag LOCUS_07270 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225215.1:peptidase M14 1539 2072 gene locus_tag LOCUS_07280 1539 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2193 2119 gene locus_tag LOCUS_t00100 2193 2119 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2364 2288 gene locus_tag LOCUS_t00110 2364 2288 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2522 2449 gene locus_tag LOCUS_t00120 2522 2449 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2571 2948 gene locus_tag LOCUS_07290 2571 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029427.1 protein_id gnl|my_center|LOCUS_07290 3331 2969 gene locus_tag LOCUS_07300 3331 2969 CDS product chromosome condensation protein CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944501.1 protein_id gnl|my_center|LOCUS_07300 3738 3328 gene locus_tag LOCUS_07310 3738 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4807 3764 gene locus_tag LOCUS_07320 4807 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 6332 4914 gene locus_tag LOCUS_07330 gene gor 6332 4914 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223941.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence079 572 6 gene locus_tag LOCUS_07340 572 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973424.1 protein_id gnl|my_center|LOCUS_07340 1272 730 gene locus_tag LOCUS_07350 gene coaD 1272 730 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV16 protein_id gnl|my_center|LOCUS_07350 1841 1257 gene locus_tag LOCUS_07360 1841 1257 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030310.1 protein_id gnl|my_center|LOCUS_07360 4060 1838 gene locus_tag LOCUS_07370 gene recG 4060 1838 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBR3 protein_id gnl|my_center|LOCUS_07370 5753 4062 gene locus_tag LOCUS_07380 5753 4062 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030309.1 protein_id gnl|my_center|LOCUS_07380 6001 6186 gene locus_tag LOCUS_07390 gene rpmB1 6001 6186 CDS product 50S ribosomal protein L28-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBR5 protein_id gnl|my_center|LOCUS_07390 7302 6274 gene locus_tag LOCUS_07400 gene thiL 7302 6274 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBR7 protein_id gnl|my_center|LOCUS_07400 >Feature sequence080 <1 634 gene locus_tag LOCUS_07410 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705061.1:putative short-chain dehydrogenase/reductase 687 1610 gene locus_tag LOCUS_07420 687 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 2353 1616 gene locus_tag LOCUS_07430 2353 1616 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_07430 3125 2460 gene locus_tag LOCUS_07440 3125 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 4295 3285 gene locus_tag LOCUS_07450 4295 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 6530 4335 gene locus_tag LOCUS_07460 6530 4335 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_07460 <7378 6572 gene locus_tag LOCUS_07470 <7378 6572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257118.1:sulfate transporter >Feature sequence081 464 1024 gene locus_tag LOCUS_07480 464 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2973 970 gene locus_tag LOCUS_07490 2973 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3343 4080 gene locus_tag LOCUS_07500 gene infC 3343 4080 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O88060 protein_id gnl|my_center|LOCUS_07500 4151 4345 gene locus_tag LOCUS_07510 gene rpmI 4151 4345 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O88059 protein_id gnl|my_center|LOCUS_07510 4429 4830 gene locus_tag LOCUS_07520 gene rplT 4429 4830 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O88058 protein_id gnl|my_center|LOCUS_07520 4876 5781 gene locus_tag LOCUS_07530 4876 5781 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027873.1 protein_id gnl|my_center|LOCUS_07530 5818 6897 gene locus_tag LOCUS_07540 5818 6897 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027872.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence082 1144 2535 gene locus_tag LOCUS_07550 1144 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 2545 3156 gene locus_tag LOCUS_07560 gene purN 2545 3156 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KY51 protein_id gnl|my_center|LOCUS_07560 3304 4941 gene locus_tag LOCUS_07570 gene purH 3304 4941 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KY50 protein_id gnl|my_center|LOCUS_07570 5025 5888 gene locus_tag LOCUS_07580 gene folD 5025 5888 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3J6 protein_id gnl|my_center|LOCUS_07580 5919 6221 gene locus_tag LOCUS_07590 5919 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence083 <1 1365 gene locus_tag LOCUS_07600 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401001.1:trehalose synthase 2086 1373 gene locus_tag LOCUS_07610 gene ribD 2086 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413854.1 protein_id gnl|my_center|LOCUS_07610 2243 3379 gene locus_tag LOCUS_07620 gene pslG 2243 3379 CDS product biofilm formation protein PslG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089230.1 protein_id gnl|my_center|LOCUS_07620 4291 3452 gene locus_tag LOCUS_07630 4291 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 5544 4351 gene locus_tag LOCUS_07640 5544 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529437.1 protein_id gnl|my_center|LOCUS_07640 5793 5710 gene locus_tag LOCUS_t00130 5793 5710 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5884 6375 gene locus_tag LOCUS_07650 5884 6375 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2U7 protein_id gnl|my_center|LOCUS_07650 >Feature sequence084 104 886 gene locus_tag LOCUS_07660 104 886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_07660 923 1165 gene locus_tag LOCUS_07670 923 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2816 1440 gene locus_tag LOCUS_07680 2816 1440 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_07680 3679 2945 gene locus_tag LOCUS_07690 3679 2945 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_07690 4130 3684 gene locus_tag LOCUS_07700 4130 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 4179 6890 gene locus_tag LOCUS_07710 gene polA 4179 6890 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DA45 protein_id gnl|my_center|LOCUS_07710 >Feature sequence085 956 345 gene locus_tag LOCUS_07720 956 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 1681 956 gene locus_tag LOCUS_07730 1681 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 1829 2335 gene locus_tag LOCUS_07740 gene rimP 1829 2335 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DAN3 protein_id gnl|my_center|LOCUS_07740 2337 3311 gene locus_tag LOCUS_07750 gene nusA 2337 3311 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KYR1 protein_id gnl|my_center|LOCUS_07750 3889 6831 gene locus_tag LOCUS_07760 3889 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07760 >Feature sequence086 838 179 gene locus_tag LOCUS_07770 838 179 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S231 protein_id gnl|my_center|LOCUS_07770 1773 835 gene locus_tag LOCUS_07780 1773 835 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027965.1 protein_id gnl|my_center|LOCUS_07780 2167 1784 gene locus_tag LOCUS_07790 2167 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3087 2152 gene locus_tag LOCUS_07800 3087 2152 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977053.1 protein_id gnl|my_center|LOCUS_07800 4396 3407 gene locus_tag LOCUS_07810 gene xerD 4396 3407 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DC22 protein_id gnl|my_center|LOCUS_07810 5052 4393 gene locus_tag LOCUS_07820 5052 4393 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977050.1 protein_id gnl|my_center|LOCUS_07820 6776 5049 gene locus_tag LOCUS_07830 gene pyrG 6776 5049 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S224 protein_id gnl|my_center|LOCUS_07830 >Feature sequence087 2443 857 gene locus_tag LOCUS_07840 gene gabD2 2443 857 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_07840 3389 2667 gene locus_tag LOCUS_07850 3389 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 4511 3408 gene locus_tag LOCUS_07860 4511 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920925.1 protein_id gnl|my_center|LOCUS_07860 5614 4508 gene locus_tag LOCUS_07870 5614 4508 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_07870 5716 6291 gene locus_tag LOCUS_07880 5716 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 6328 7041 gene locus_tag LOCUS_07890 6328 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence088 899 2065 gene locus_tag LOCUS_07900 899 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 2058 4088 gene locus_tag LOCUS_07910 2058 4088 CDS product cellulose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257823.1 protein_id gnl|my_center|LOCUS_07910 4081 4416 gene locus_tag LOCUS_07920 4081 4416 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE11 protein_id gnl|my_center|LOCUS_07920 4406 4852 gene locus_tag LOCUS_07930 4406 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5904 4816 gene locus_tag LOCUS_07940 5904 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 <7207 6067 gene locus_tag LOCUS_07950 <7207 6067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P18183:RNA polymerase principal sigma factor HrdB >Feature sequence089 2389 1976 gene locus_tag LOCUS_07960 2389 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 3461 2409 gene locus_tag LOCUS_07970 gene hemE 3461 2409 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69861 protein_id gnl|my_center|LOCUS_07970 3572 4147 gene locus_tag LOCUS_07980 3572 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030605.1 protein_id gnl|my_center|LOCUS_07980 4147 5505 gene locus_tag LOCUS_07990 4147 5505 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030604.1 protein_id gnl|my_center|LOCUS_07990 5541 6437 gene locus_tag LOCUS_08000 5541 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 6430 7086 gene locus_tag LOCUS_08010 6430 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804371.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence090 3431 2091 gene locus_tag LOCUS_08020 gene aroH 3431 2091 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80574 protein_id gnl|my_center|LOCUS_08020 5624 3462 gene locus_tag LOCUS_08030 5624 3462 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030473.1 protein_id gnl|my_center|LOCUS_08030 6760 5690 gene locus_tag LOCUS_08040 6760 5690 CDS product tellurium resistance protein TerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027421.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence091 825 328 gene locus_tag LOCUS_08050 825 328 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E286 protein_id gnl|my_center|LOCUS_08050 2640 856 gene locus_tag LOCUS_08060 2640 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 3352 2654 gene locus_tag LOCUS_08070 3352 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 5891 3369 gene locus_tag LOCUS_08080 5891 3369 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50510 protein_id gnl|my_center|LOCUS_08080 >Feature sequence092 1179 103 gene locus_tag LOCUS_08090 1179 103 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027356.1 protein_id gnl|my_center|LOCUS_08090 2175 1372 gene locus_tag LOCUS_08100 2175 1372 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730436.1 protein_id gnl|my_center|LOCUS_08100 2311 2469 gene locus_tag LOCUS_08110 2311 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010551122.1 protein_id gnl|my_center|LOCUS_08110 2599 3552 gene locus_tag LOCUS_08120 2599 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 3621 4940 gene locus_tag LOCUS_08130 3621 4940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030108.1 protein_id gnl|my_center|LOCUS_08130 5240 5013 gene locus_tag LOCUS_08140 5240 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 5585 5271 gene locus_tag LOCUS_08150 5585 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 5989 5735 gene locus_tag LOCUS_08160 5989 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 <7119 6051 gene locus_tag LOCUS_08170 <7119 6051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9FCK0:DNA helicase >Feature sequence093 1781 741 gene locus_tag LOCUS_08180 1781 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1791 2552 gene locus_tag LOCUS_08190 gene echA6 1791 2552 CDS product putative enoyl-CoA hydratase echA6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64015 protein_id gnl|my_center|LOCUS_08190 2636 3928 gene locus_tag LOCUS_08200 2636 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 4089 4244 gene locus_tag LOCUS_08210 4089 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 6586 4430 gene locus_tag LOCUS_08220 6586 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence094 1565 2320 gene locus_tag LOCUS_08230 1565 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256348.1 protein_id gnl|my_center|LOCUS_08230 2332 3111 gene locus_tag LOCUS_08240 2332 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 3204 3785 gene locus_tag LOCUS_08250 3204 3785 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 protein_id gnl|my_center|LOCUS_08250 4625 3873 gene locus_tag LOCUS_08260 4625 3873 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976167.1 protein_id gnl|my_center|LOCUS_08260 6182 4674 gene locus_tag LOCUS_08270 6182 4674 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029117.1 protein_id gnl|my_center|LOCUS_08270 6741 6226 gene locus_tag LOCUS_08280 6741 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence095 1235 4216 gene locus_tag LOCUS_08290 1235 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence096 1669 14 gene locus_tag LOCUS_08300 1669 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1741 2517 gene locus_tag LOCUS_08310 1741 2517 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 protein_id gnl|my_center|LOCUS_08310 4385 2550 gene locus_tag LOCUS_08320 4385 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5277 4465 gene locus_tag LOCUS_08330 5277 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 5390 6148 gene locus_tag LOCUS_08340 5390 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6517 6858 gene locus_tag LOCUS_08350 6517 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence097 1022 2239 gene locus_tag LOCUS_08360 1022 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229362.1 protein_id gnl|my_center|LOCUS_08360 2453 3715 gene locus_tag LOCUS_08370 2453 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 3931 3857 gene locus_tag LOCUS_t00140 3931 3857 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4030 4485 gene locus_tag LOCUS_08380 4030 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 4501 4797 gene locus_tag LOCUS_08390 4501 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 4877 5842 gene locus_tag LOCUS_08400 4877 5842 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891984.1 protein_id gnl|my_center|LOCUS_08400 5839 6288 gene locus_tag LOCUS_08410 5839 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 <7028 6311 gene locus_tag LOCUS_08420 <7028 6311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975664.1:inositol monophosphatase >Feature sequence098 454 14 gene locus_tag LOCUS_08430 454 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2412 508 gene locus_tag LOCUS_08440 2412 508 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224732.1 protein_id gnl|my_center|LOCUS_08440 3329 2469 gene locus_tag LOCUS_08450 3329 2469 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028003.1 protein_id gnl|my_center|LOCUS_08450 3363 4127 gene locus_tag LOCUS_08460 gene map 3363 4127 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MED0 protein_id gnl|my_center|LOCUS_08460 4140 4514 gene locus_tag LOCUS_08470 4140 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 4663 5421 gene locus_tag LOCUS_08480 4663 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 7021 5423 gene locus_tag LOCUS_08490 7021 5423 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976982.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence099 <1 807 gene locus_tag LOCUS_08500 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228585.1:aminopeptidase N 1251 817 gene locus_tag LOCUS_08510 1251 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2004 1270 gene locus_tag LOCUS_08520 2004 1270 CDS product phosphatidic acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776273.1 protein_id gnl|my_center|LOCUS_08520 2257 3036 gene locus_tag LOCUS_08530 gene fdhD 2257 3036 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBW0 protein_id gnl|my_center|LOCUS_08530 3454 4659 gene locus_tag LOCUS_08540 gene sbcD 3454 4659 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93IW9 protein_id gnl|my_center|LOCUS_08540 >Feature sequence100 <1 984 gene locus_tag LOCUS_08550 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000030646.1:cell envelope integrity protein TolA 2137 1061 gene locus_tag LOCUS_08560 2137 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2961 2134 gene locus_tag LOCUS_08570 2961 2134 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730758.1 protein_id gnl|my_center|LOCUS_08570 3397 2975 gene locus_tag LOCUS_08580 3397 2975 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973585.1 protein_id gnl|my_center|LOCUS_08580 4159 3407 gene locus_tag LOCUS_08590 4159 3407 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ39 protein_id gnl|my_center|LOCUS_08590 4236 5087 gene locus_tag LOCUS_08600 4236 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637618.2 protein_id gnl|my_center|LOCUS_08600 5149 5388 gene locus_tag LOCUS_08610 5149 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 5521 6747 gene locus_tag LOCUS_08620 5521 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 6859 6785 gene locus_tag LOCUS_t00150 6859 6785 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence101 1815 340 gene locus_tag LOCUS_08630 1815 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1908 3338 gene locus_tag LOCUS_08640 gene cysS 1908 3338 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0Q6 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08640 3407 4411 gene locus_tag LOCUS_08650 gene yjfH 3407 4411 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230407.1 protein_id gnl|my_center|LOCUS_08650 4603 6816 gene locus_tag LOCUS_08660 4603 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence102 102 686 gene locus_tag LOCUS_08670 102 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 683 1834 gene locus_tag LOCUS_08680 gene argJ 683 1834 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CK24 protein_id gnl|my_center|LOCUS_08680 1845 2777 gene locus_tag LOCUS_08690 gene argB 1845 2777 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCM3 protein_id gnl|my_center|LOCUS_08690 2774 4024 gene locus_tag LOCUS_08700 gene argD 2774 4024 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEG5 protein_id gnl|my_center|LOCUS_08700 4021 4971 gene locus_tag LOCUS_08710 gene argF 4021 4971 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59778 protein_id gnl|my_center|LOCUS_08710 4968 5528 gene locus_tag LOCUS_08720 gene argR 4968 5528 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1A5 protein_id gnl|my_center|LOCUS_08720 >Feature sequence103 46 999 gene locus_tag LOCUS_08730 gene putA 46 999 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224531.1 protein_id gnl|my_center|LOCUS_08730 1039 1884 gene locus_tag LOCUS_08740 gene proC 1039 1884 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8G1 protein_id gnl|my_center|LOCUS_08740 1890 3104 gene locus_tag LOCUS_08750 1890 3104 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028913.1 protein_id gnl|my_center|LOCUS_08750 3304 3546 gene locus_tag LOCUS_08760 3304 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3858 4901 gene locus_tag LOCUS_08770 3858 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975510.1 protein_id gnl|my_center|LOCUS_08770 4901 6097 gene locus_tag LOCUS_08780 4901 6097 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975511.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence104 832 1410 gene locus_tag LOCUS_08790 gene ctaE 832 1410 CDS product putative cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X809 protein_id gnl|my_center|LOCUS_08790 1462 2346 gene locus_tag LOCUS_08800 1462 2346 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976665.1 protein_id gnl|my_center|LOCUS_08800 2343 3392 gene locus_tag LOCUS_08810 gene qcrA 2343 3392 CDS product cytochrome bc1 complex Rieske iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X807 protein_id gnl|my_center|LOCUS_08810 3399 5144 gene locus_tag LOCUS_08820 gene qcrB 3399 5144 CDS product cytochrome bc1 complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X806 protein_id gnl|my_center|LOCUS_08820 >Feature sequence105 691 1050 gene locus_tag LOCUS_08830 691 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974665.1 protein_id gnl|my_center|LOCUS_08830 1907 1053 gene locus_tag LOCUS_08840 1907 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2753 1971 gene locus_tag LOCUS_08850 2753 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3616 2765 gene locus_tag LOCUS_08860 gene cutM 3616 2765 CDS product carbon-monoxide dehydrogenase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_08860 6123 3613 gene locus_tag LOCUS_08870 6123 3613 CDS product carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223764.1 protein_id gnl|my_center|LOCUS_08870 6602 6120 gene locus_tag LOCUS_08880 gene coxS 6602 6120 CDS product carbon-monoxide dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223763.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence106 <1 2956 gene locus_tag LOCUS_08890 <1 2956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ZBQ2:chromosome partition protein Smc 2953 3414 gene locus_tag LOCUS_08900 2953 3414 CDS product putative acyl-CoA hydrolase/thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701728.1 protein_id gnl|my_center|LOCUS_08900 3523 3675 gene locus_tag LOCUS_08910 3523 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 3733 4914 gene locus_tag LOCUS_08920 gene ftsY 3733 4914 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBP9 protein_id gnl|my_center|LOCUS_08920 5199 6521 gene locus_tag LOCUS_08930 gene amt 5199 6521 CDS product putative ammonia channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQ65 protein_id gnl|my_center|LOCUS_08930 >Feature sequence107 1829 1134 gene locus_tag LOCUS_08940 1829 1134 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529450.1 protein_id gnl|my_center|LOCUS_08940 2966 1875 gene locus_tag LOCUS_08950 2966 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920925.1 protein_id gnl|my_center|LOCUS_08950 4066 2963 gene locus_tag LOCUS_08960 4066 2963 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974202.1 protein_id gnl|my_center|LOCUS_08960 4279 4695 gene locus_tag LOCUS_08970 4279 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4720 5427 gene locus_tag LOCUS_08980 4720 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 5537 5905 gene locus_tag LOCUS_08990 gene yolI 5537 5905 CDS product putative tautomerase YolI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34882 protein_id gnl|my_center|LOCUS_08990 6731 5976 gene locus_tag LOCUS_09000 6731 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence108 1144 1410 gene locus_tag LOCUS_09010 1144 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1788 1462 gene locus_tag LOCUS_09020 1788 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1861 2133 gene locus_tag LOCUS_09030 gene rpmE2 1861 2133 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MGV4 protein_id gnl|my_center|LOCUS_09030 2148 3215 gene locus_tag LOCUS_09040 2148 3215 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028970.1 protein_id gnl|my_center|LOCUS_09040 3262 3453 gene locus_tag LOCUS_09050 gene rpmF2 3262 3453 CDS product 50S ribosomal protein L32-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RL50 protein_id gnl|my_center|LOCUS_09050 3450 3740 gene locus_tag LOCUS_09060 3450 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 3865 4101 gene locus_tag LOCUS_09070 gene rpmB2 3865 4101 CDS product 50S ribosomal protein L28-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8K8 protein_id gnl|my_center|LOCUS_09070 4101 4277 gene locus_tag LOCUS_09080 gene rpmG1 4101 4277 CDS product 50S ribosomal protein L33 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A5W1 protein_id gnl|my_center|LOCUS_09080 4279 4581 gene locus_tag LOCUS_09090 gene rpsN 4279 4581 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8K9 protein_id gnl|my_center|LOCUS_09090 5279 4908 gene locus_tag LOCUS_09100 5279 4908 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225086.1 protein_id gnl|my_center|LOCUS_09100 5683 5276 gene locus_tag LOCUS_09110 5683 5276 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225922.1 protein_id gnl|my_center|LOCUS_09110 <6728 5676 gene locus_tag LOCUS_09120 <6728 5676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WKK5:isopentenyl-diphosphate Delta-isomerase >Feature sequence109 1302 442 gene locus_tag LOCUS_09130 1302 442 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728693.1 protein_id gnl|my_center|LOCUS_09130 2507 1299 gene locus_tag LOCUS_09140 2507 1299 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975879.1 protein_id gnl|my_center|LOCUS_09140 3163 2504 gene locus_tag LOCUS_09150 3163 2504 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975880.1 protein_id gnl|my_center|LOCUS_09150 3978 3292 gene locus_tag LOCUS_09160 3978 3292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 protein_id gnl|my_center|LOCUS_09160 4131 5720 gene locus_tag LOCUS_09170 gene betA 4131 5720 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence110 <1 571 gene locus_tag LOCUS_09180 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVB2:putative phosphoenolpyruvate synthase regulatory protein 586 2994 gene locus_tag LOCUS_09190 gene ppsA 586 2994 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLP8 protein_id gnl|my_center|LOCUS_09190 3100 4002 gene locus_tag LOCUS_09200 3100 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 4885 3986 gene locus_tag LOCUS_09210 4885 3986 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031688.1 protein_id gnl|my_center|LOCUS_09210 5504 4968 gene locus_tag LOCUS_09220 gene tspO 5504 4968 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222428.1 protein_id gnl|my_center|LOCUS_09220 5639 6067 gene locus_tag LOCUS_09230 5639 6067 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_09230 6505 6098 gene locus_tag LOCUS_09240 6505 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence111 2947 1442 gene locus_tag LOCUS_09250 2947 1442 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223445.1 protein_id gnl|my_center|LOCUS_09250 4239 3097 gene locus_tag LOCUS_09260 4239 3097 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031223.1 protein_id gnl|my_center|LOCUS_09260 4300 4920 gene locus_tag LOCUS_09270 4300 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5850 4951 gene locus_tag LOCUS_09280 5850 4951 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223360.1 protein_id gnl|my_center|LOCUS_09280 5954 6436 gene locus_tag LOCUS_09290 5954 6436 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028826.1 protein_id gnl|my_center|LOCUS_09290 6681 6445 gene locus_tag LOCUS_09300 6681 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence112 <1 527 gene locus_tag LOCUS_09310 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229314.1:betaine-aldehyde dehydrogenase 524 2254 gene locus_tag LOCUS_09320 gene betA 524 2254 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGN2 protein_id gnl|my_center|LOCUS_09320 2280 4352 gene locus_tag LOCUS_09330 2280 4352 CDS product high-affinity choline transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704693.1 protein_id gnl|my_center|LOCUS_09330 4443 4721 gene locus_tag LOCUS_09340 4443 4721 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976675.1 protein_id gnl|my_center|LOCUS_09340 5786 4737 gene locus_tag LOCUS_09350 gene trpD1 5786 4737 CDS product anthranilate phosphoribosyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68608 protein_id gnl|my_center|LOCUS_09350 6184 5789 gene locus_tag LOCUS_09360 6184 5789 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416410.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence113 90 163 gene locus_tag LOCUS_t00160 90 163 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 201 1481 gene locus_tag LOCUS_09370 201 1481 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939271.1 protein_id gnl|my_center|LOCUS_09370 2211 1552 gene locus_tag LOCUS_09380 2211 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 2795 2244 gene locus_tag LOCUS_09390 2795 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 3677 2799 gene locus_tag LOCUS_09400 3677 2799 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918831.1 protein_id gnl|my_center|LOCUS_09400 5145 3751 gene locus_tag LOCUS_09410 5145 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 5910 5185 gene locus_tag LOCUS_09420 5910 5185 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085673.1 protein_id gnl|my_center|LOCUS_09420 6443 5943 gene locus_tag LOCUS_09430 6443 5943 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975762.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence114 1250 108 gene locus_tag LOCUS_09440 1250 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2355 1240 gene locus_tag LOCUS_09450 2355 1240 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029836.1 protein_id gnl|my_center|LOCUS_09450 3536 2352 gene locus_tag LOCUS_09460 gene alr 3536 2352 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZ49 protein_id gnl|my_center|LOCUS_09460 5062 3611 gene locus_tag LOCUS_09470 5062 3611 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86783 protein_id gnl|my_center|LOCUS_09470 5214 6158 gene locus_tag LOCUS_09480 5214 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 6525 6172 gene locus_tag LOCUS_09490 gene acpS 6525 6172 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86785 protein_id gnl|my_center|LOCUS_09490 >Feature sequence115 1626 2633 gene locus_tag LOCUS_09500 gene qor 1626 2633 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229986.1 protein_id gnl|my_center|LOCUS_09500 2672 3061 gene locus_tag LOCUS_09510 2672 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_09510 3106 4299 gene locus_tag LOCUS_09520 3106 4299 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117973.1 protein_id gnl|my_center|LOCUS_09520 4408 5253 gene locus_tag LOCUS_09530 4408 5253 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDX6 protein_id gnl|my_center|LOCUS_09530 5320 6459 gene locus_tag LOCUS_09540 5320 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030976.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence116 <1 1899 gene locus_tag LOCUS_09550 <1 1899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229508.1:methylmalonyl-CoA mutase 1998 4190 gene locus_tag LOCUS_09560 1998 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 4231 4884 gene locus_tag LOCUS_09570 4231 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5618 4836 gene locus_tag LOCUS_09580 gene nucS 5618 4836 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDR8 protein_id gnl|my_center|LOCUS_09580 >Feature sequence117 2300 1548 gene locus_tag LOCUS_09590 2300 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2514 3710 gene locus_tag LOCUS_09600 2514 3710 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028169.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09600 3713 3991 gene locus_tag LOCUS_09610 3713 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09610 4820 4008 gene locus_tag LOCUS_09620 gene nei 4820 4008 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_09620 5817 4834 gene locus_tag LOCUS_09630 5817 4834 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976657.1 protein_id gnl|my_center|LOCUS_09630 5966 6196 gene locus_tag LOCUS_09640 5966 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence118 2487 3650 gene locus_tag LOCUS_09650 2487 3650 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226510.1 protein_id gnl|my_center|LOCUS_09650 4195 3653 gene locus_tag LOCUS_09660 4195 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4812 4231 gene locus_tag LOCUS_09670 4812 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 5507 4866 gene locus_tag LOCUS_09680 5507 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 <6471 5557 gene locus_tag LOCUS_09690 <6471 5557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031182.1:acyl-CoA dehydrogenase >Feature sequence119 95 1459 gene locus_tag LOCUS_09700 95 1459 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014906.1 protein_id gnl|my_center|LOCUS_09700 1808 1479 gene locus_tag LOCUS_09710 1808 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1896 2561 gene locus_tag LOCUS_09720 1896 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4813 2564 gene locus_tag LOCUS_09730 4813 2564 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030282.1 protein_id gnl|my_center|LOCUS_09730 4941 5555 gene locus_tag LOCUS_09740 4941 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 6049 5621 gene locus_tag LOCUS_09750 gene cadI 6049 5621 CDS product cadmium-induced protein CadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A5N7 protein_id gnl|my_center|LOCUS_09750 >Feature sequence120 1241 375 gene locus_tag LOCUS_09760 1241 375 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225283.1 protein_id gnl|my_center|LOCUS_09760 1865 1473 gene locus_tag LOCUS_09770 1865 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 2506 1928 gene locus_tag LOCUS_09780 2506 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 4280 2496 gene locus_tag LOCUS_09790 4280 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLK7 protein_id gnl|my_center|LOCUS_09790 4597 4286 gene locus_tag LOCUS_09800 4597 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 5153 4590 gene locus_tag LOCUS_09810 5153 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence121 352 2859 gene locus_tag LOCUS_09820 gene leuS 352 2859 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AZ0 protein_id gnl|my_center|LOCUS_09820 3203 2892 gene locus_tag LOCUS_09830 3203 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3449 4336 gene locus_tag LOCUS_09840 3449 4336 CDS product DegV domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDL7 protein_id gnl|my_center|LOCUS_09840 4559 5446 gene locus_tag LOCUS_09850 4559 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence122 138 1745 gene locus_tag LOCUS_09860 138 1745 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_09860 1905 2156 gene locus_tag LOCUS_09870 1905 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2129 2785 gene locus_tag LOCUS_09880 2129 2785 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EWV6 protein_id gnl|my_center|LOCUS_09880 2793 4025 gene locus_tag LOCUS_09890 2793 4025 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704179.1 protein_id gnl|my_center|LOCUS_09890 4432 4037 gene locus_tag LOCUS_09900 4432 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 5702 4485 gene locus_tag LOCUS_09910 gene fadE19 5702 4485 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412771.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence123 1555 1160 gene locus_tag LOCUS_09920 1555 1160 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69890 protein_id gnl|my_center|LOCUS_09920 3040 1706 gene locus_tag LOCUS_09930 3040 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3788 3135 gene locus_tag LOCUS_09940 gene rnhB 3788 3135 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV44 protein_id gnl|my_center|LOCUS_09940 4474 3785 gene locus_tag LOCUS_09950 4474 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 4821 4471 gene locus_tag LOCUS_09960 gene rplS 4821 4471 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A477 protein_id gnl|my_center|LOCUS_09960 6234 4996 gene locus_tag LOCUS_09970 6234 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 >Feature sequence124 992 3133 gene locus_tag LOCUS_09980 992 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 4652 3147 gene locus_tag LOCUS_09990 gene dld 4652 3147 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230833.1 protein_id gnl|my_center|LOCUS_09990 4980 4654 gene locus_tag LOCUS_10000 4980 4654 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978605.1 protein_id gnl|my_center|LOCUS_10000 5711 5034 gene locus_tag LOCUS_10010 5711 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 <6329 5750 gene locus_tag LOCUS_10020 <6329 5750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776724.1:esterase >Feature sequence125 852 385 gene locus_tag LOCUS_10030 852 385 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728853.1 protein_id gnl|my_center|LOCUS_10030 1690 899 gene locus_tag LOCUS_10040 1690 899 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223511.1 protein_id gnl|my_center|LOCUS_10040 1779 2549 gene locus_tag LOCUS_10050 1779 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2560 3771 gene locus_tag LOCUS_10060 2560 3771 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S281 protein_id gnl|my_center|LOCUS_10060 4296 3790 gene locus_tag LOCUS_10070 4296 3790 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_10070 4560 4348 gene locus_tag LOCUS_10080 4560 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027443.1 protein_id gnl|my_center|LOCUS_10080 4723 5064 gene locus_tag LOCUS_10090 4723 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5126 5347 gene locus_tag LOCUS_10100 5126 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 <6323 5355 gene locus_tag LOCUS_10110 <6323 5355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RJ47:GTP 3',8-cyclase >Feature sequence126 532 5 gene locus_tag LOCUS_10120 532 5 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DDT0 protein_id gnl|my_center|LOCUS_10120 2070 637 gene locus_tag LOCUS_10130 gene argH 2070 637 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYS5 protein_id gnl|my_center|LOCUS_10130 3824 2103 gene locus_tag LOCUS_10140 gene glpA 3824 2103 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZR9 protein_id gnl|my_center|LOCUS_10140 3947 4657 gene locus_tag LOCUS_10150 3947 4657 CDS product glycerol transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776957.1 protein_id gnl|my_center|LOCUS_10150 4698 6215 gene locus_tag LOCUS_10160 gene glpK 4698 6215 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MA83 protein_id gnl|my_center|LOCUS_10160 >Feature sequence127 310 1470 gene locus_tag LOCUS_10170 gene dnaN 310 1470 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27903 protein_id gnl|my_center|LOCUS_10170 1553 2437 gene locus_tag LOCUS_10180 1553 2437 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029286.1 protein_id gnl|my_center|LOCUS_10180 2474 3670 gene locus_tag LOCUS_10190 gene recF 2474 3670 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36176 protein_id gnl|my_center|LOCUS_10190 3642 4265 gene locus_tag LOCUS_10200 3642 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence128 1870 992 gene locus_tag LOCUS_10210 1870 992 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0Z5 protein_id gnl|my_center|LOCUS_10210 2862 1867 gene locus_tag LOCUS_10220 2862 1867 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 protein_id gnl|my_center|LOCUS_10220 3707 3003 gene locus_tag LOCUS_10230 3707 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 5098 3707 gene locus_tag LOCUS_10240 5098 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 6023 5271 gene locus_tag LOCUS_10250 6023 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 6265 6041 gene locus_tag LOCUS_10260 6265 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence129 16 486 gene locus_tag LOCUS_10270 16 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 629 1663 gene locus_tag LOCUS_10280 629 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1657 2298 gene locus_tag LOCUS_10290 1657 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3791 2283 gene locus_tag LOCUS_10300 gene recQ 3791 2283 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226038.1 protein_id gnl|my_center|LOCUS_10300 3906 5447 gene locus_tag LOCUS_10310 3906 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence130 2309 369 gene locus_tag LOCUS_10320 2309 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 4197 2455 gene locus_tag LOCUS_10330 4197 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10330 >Feature sequence131 538 1944 gene locus_tag LOCUS_10340 538 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 1979 3187 gene locus_tag LOCUS_10350 1979 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 4517 3192 gene locus_tag LOCUS_10360 4517 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence132 1300 275 gene locus_tag LOCUS_10370 1300 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2279 1293 gene locus_tag LOCUS_10380 2279 1293 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532984.1 protein_id gnl|my_center|LOCUS_10380 3635 2289 gene locus_tag LOCUS_10390 3635 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 4407 3679 gene locus_tag LOCUS_10400 4407 3679 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976804.1 protein_id gnl|my_center|LOCUS_10400 4368 4442 gene locus_tag LOCUS_t00170 4368 4442 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5901 4456 gene locus_tag LOCUS_10410 5901 4456 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MCL7 protein_id gnl|my_center|LOCUS_10410 >Feature sequence133 850 2577 gene locus_tag LOCUS_10420 gene cstA 850 2577 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67304 protein_id gnl|my_center|LOCUS_10420 2585 3013 gene locus_tag LOCUS_10430 2585 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3032 3532 gene locus_tag LOCUS_10440 3032 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4586 3555 gene locus_tag LOCUS_10450 gene pfkA 4586 3555 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBH7 protein_id gnl|my_center|LOCUS_10450 4909 5157 gene locus_tag LOCUS_10460 4909 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 5615 5190 gene locus_tag LOCUS_10470 5615 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 <6202 5700 gene locus_tag LOCUS_10480 <6202 5700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836703.1:UDP-N-acetylenolpyruvoylglucosamine reductase >Feature sequence134 1584 727 gene locus_tag LOCUS_10490 gene fliA 1584 727 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR18 protein_id gnl|my_center|LOCUS_10490 1766 2245 gene locus_tag LOCUS_10500 1766 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2247 3638 gene locus_tag LOCUS_10510 2247 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3638 4531 gene locus_tag LOCUS_10520 gene flgL 3638 4531 CDS product flagellar hook-filament junction protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168813.1 protein_id gnl|my_center|LOCUS_10520 4531 5004 gene locus_tag LOCUS_10530 4531 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5054 5371 gene locus_tag LOCUS_10540 5054 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence135 993 61 gene locus_tag LOCUS_10550 993 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1105 1980 gene locus_tag LOCUS_10560 1105 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030273.1 protein_id gnl|my_center|LOCUS_10560 2050 2895 gene locus_tag LOCUS_10570 gene mmsB 2050 2895 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224579.1 protein_id gnl|my_center|LOCUS_10570 2900 3274 gene locus_tag LOCUS_10580 2900 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223515.1 protein_id gnl|my_center|LOCUS_10580 3271 3522 gene locus_tag LOCUS_10590 3271 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 3841 3530 gene locus_tag LOCUS_10600 3841 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 4175 3882 gene locus_tag LOCUS_10610 4175 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4978 4337 gene locus_tag LOCUS_10620 4978 4337 CDS product UPF0126 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86576 protein_id gnl|my_center|LOCUS_10620 >Feature sequence136 795 133 gene locus_tag LOCUS_10630 795 133 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205691.1 protein_id gnl|my_center|LOCUS_10630 1943 795 gene locus_tag LOCUS_10640 1943 795 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228741.1 protein_id gnl|my_center|LOCUS_10640 2781 1960 gene locus_tag LOCUS_10650 2781 1960 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268628.1 protein_id gnl|my_center|LOCUS_10650 4515 2890 gene locus_tag LOCUS_10660 4515 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 5230 4490 gene locus_tag LOCUS_10670 5230 4490 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118316.1 protein_id gnl|my_center|LOCUS_10670 <6186 5385 gene locus_tag LOCUS_10680 <6186 5385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229635.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence137 <1 1173 gene locus_tag LOCUS_10690 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q93IX0:nuclease SbcCD subunit C 1197 2711 gene locus_tag LOCUS_10700 1197 2711 CDS product modulator of DNA gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 protein_id gnl|my_center|LOCUS_10700 2708 4132 gene locus_tag LOCUS_10710 2708 4132 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027992.1 protein_id gnl|my_center|LOCUS_10710 4129 4674 gene locus_tag LOCUS_10720 4129 4674 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204933.1 protein_id gnl|my_center|LOCUS_10720 5122 4640 gene locus_tag LOCUS_10730 5122 4640 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859290.1 protein_id gnl|my_center|LOCUS_10730 <6128 5132 gene locus_tag LOCUS_10740 <6128 5132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230185.1:serine hydrolase >Feature sequence138 856 1494 gene locus_tag LOCUS_10750 856 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1572 2249 gene locus_tag LOCUS_10760 1572 2249 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223868.1 protein_id gnl|my_center|LOCUS_10760 3374 2250 gene locus_tag LOCUS_10770 3374 2250 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257892.1 protein_id gnl|my_center|LOCUS_10770 3504 4988 gene locus_tag LOCUS_10780 gene radA 3504 4988 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8L5 protein_id gnl|my_center|LOCUS_10780 5023 6087 gene locus_tag LOCUS_10790 gene disA 5023 6087 CDS product DNA integrity scanning protein DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8L6 protein_id gnl|my_center|LOCUS_10790 >Feature sequence139 2353 1553 gene locus_tag LOCUS_10800 2353 1553 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229732.1 protein_id gnl|my_center|LOCUS_10800 2464 4143 gene locus_tag LOCUS_10810 gene fhs 2464 4143 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N42 protein_id gnl|my_center|LOCUS_10810 4628 4140 gene locus_tag LOCUS_10820 4628 4140 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AD88 protein_id gnl|my_center|LOCUS_10820 4740 5471 gene locus_tag LOCUS_10830 4740 5471 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385801.1 protein_id gnl|my_center|LOCUS_10830 6109 5474 gene locus_tag LOCUS_10840 6109 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence140 <1 1330 gene locus_tag LOCUS_10850 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MFU8:RecBCD enzyme subunit RecB 1327 3207 gene locus_tag LOCUS_10860 gene recD 1327 3207 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MFU7 protein_id gnl|my_center|LOCUS_10860 3315 4268 gene locus_tag LOCUS_10870 3315 4268 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027198.1 protein_id gnl|my_center|LOCUS_10870 4265 4561 gene locus_tag LOCUS_10880 gene kaiB 4265 4561 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VAN4 protein_id gnl|my_center|LOCUS_10880 4558 6099 gene locus_tag LOCUS_10890 4558 6099 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259117.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence141 <1 546 gene locus_tag LOCUS_10900 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_599478.1:di- and tricarboxylate transporter 666 1043 gene locus_tag LOCUS_10910 666 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225939.1 protein_id gnl|my_center|LOCUS_10910 1141 1425 gene locus_tag LOCUS_10920 1141 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2079 1708 gene locus_tag LOCUS_10930 2079 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2191 2706 gene locus_tag LOCUS_10940 2191 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228440.1 protein_id gnl|my_center|LOCUS_10940 3262 2738 gene locus_tag LOCUS_10950 3262 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039519.1 protein_id gnl|my_center|LOCUS_10950 3324 4421 gene locus_tag LOCUS_10960 3324 4421 CDS product putative ribonuclease BN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703757.1 protein_id gnl|my_center|LOCUS_10960 4418 5323 gene locus_tag LOCUS_10970 4418 5323 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972246.1 protein_id gnl|my_center|LOCUS_10970 5375 5992 gene locus_tag LOCUS_10980 5375 5992 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222352.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence142 2994 460 gene locus_tag LOCUS_10990 2994 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3215 3352 gene locus_tag LOCUS_11000 3215 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3380 3853 gene locus_tag LOCUS_11010 3380 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 3924 4011 gene locus_tag LOCUS_t00180 3924 4011 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4446 4075 gene locus_tag LOCUS_11020 4446 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 4859 4443 gene locus_tag LOCUS_11030 4859 4443 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888560.1 protein_id gnl|my_center|LOCUS_11030 4971 5876 gene locus_tag LOCUS_11040 4971 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence143 547 368 gene locus_tag LOCUS_11050 547 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1007 576 gene locus_tag LOCUS_11060 1007 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3103 1007 gene locus_tag LOCUS_11070 3103 1007 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69998 protein_id gnl|my_center|LOCUS_11070 3435 3638 gene locus_tag LOCUS_11080 3435 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805039.1 protein_id gnl|my_center|LOCUS_11080 3806 4294 gene locus_tag LOCUS_11090 3806 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4294 5172 gene locus_tag LOCUS_11100 4294 5172 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729048.1 protein_id gnl|my_center|LOCUS_11100 5565 5200 gene locus_tag LOCUS_11110 5565 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 <6077 5575 gene locus_tag LOCUS_11120 <6077 5575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CK43:histidine N-alpha-methyltransferase >Feature sequence144 1108 2094 gene locus_tag LOCUS_11130 1108 2094 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776549.1 protein_id gnl|my_center|LOCUS_11130 2267 3406 gene locus_tag LOCUS_11140 2267 3406 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MGB0 protein_id gnl|my_center|LOCUS_11140 3534 4487 gene locus_tag LOCUS_11150 3534 4487 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MGA9 protein_id gnl|my_center|LOCUS_11150 4487 5602 gene locus_tag LOCUS_11160 4487 5602 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZW1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence145 391 1107 gene locus_tag LOCUS_11170 391 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1628 1110 gene locus_tag LOCUS_11180 1628 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2751 1621 gene locus_tag LOCUS_11190 gene ald 2751 1621 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DIY9 protein_id gnl|my_center|LOCUS_11190 4130 2844 gene locus_tag LOCUS_11200 4130 2844 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102247.1 protein_id gnl|my_center|LOCUS_11200 4317 5654 gene locus_tag LOCUS_11210 gene fabG 4317 5654 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230940.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence146 <1 781 gene locus_tag LOCUS_11220 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391110.1:PAS domain-containing sensor histidine kinase 894 1832 gene locus_tag LOCUS_11230 894 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2792 1833 gene locus_tag LOCUS_11240 2792 1833 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_11240 3854 2832 gene locus_tag LOCUS_11250 3854 2832 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533364.1 protein_id gnl|my_center|LOCUS_11250 5612 3876 gene locus_tag LOCUS_11260 5612 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence147 1309 503 gene locus_tag LOCUS_11270 1309 503 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729629.1 protein_id gnl|my_center|LOCUS_11270 1951 1310 gene locus_tag LOCUS_11280 1951 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977160.1 protein_id gnl|my_center|LOCUS_11280 2757 1951 gene locus_tag LOCUS_11290 2757 1951 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226474.1 protein_id gnl|my_center|LOCUS_11290 2836 3813 gene locus_tag LOCUS_11300 gene corA 2836 3813 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADA0 protein_id gnl|my_center|LOCUS_11300 3936 4391 gene locus_tag LOCUS_11310 3936 4391 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634175.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence148 1399 572 gene locus_tag LOCUS_11320 1399 572 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223674.1 protein_id gnl|my_center|LOCUS_11320 2186 1404 gene locus_tag LOCUS_11330 2186 1404 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976385.1 protein_id gnl|my_center|LOCUS_11330 3135 2188 gene locus_tag LOCUS_11340 3135 2188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222531.1 protein_id gnl|my_center|LOCUS_11340 3854 3465 gene locus_tag LOCUS_11350 gene rplL 3854 3465 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QS63 protein_id gnl|my_center|LOCUS_11350 4532 3969 gene locus_tag LOCUS_11360 gene rplJ 4532 3969 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P41103 protein_id gnl|my_center|LOCUS_11360 <5996 4812 gene locus_tag LOCUS_11370 <5996 4812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013994.1:MFS transporter >Feature sequence149 <1 1298 gene locus_tag LOCUS_11380 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027328.1:serine/threonine protein kinase 1804 1304 gene locus_tag LOCUS_11390 1804 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3014 1815 gene locus_tag LOCUS_11400 3014 1815 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKQ2 protein_id gnl|my_center|LOCUS_11400 3106 4623 gene locus_tag LOCUS_11410 3106 4623 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975632.1 protein_id gnl|my_center|LOCUS_11410 5188 4673 gene locus_tag LOCUS_11420 5188 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5536 5336 gene locus_tag LOCUS_11430 5536 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 5688 5960 gene locus_tag LOCUS_11440 5688 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703236.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence150 1530 334 gene locus_tag LOCUS_11450 1530 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2741 1524 gene locus_tag LOCUS_11460 2741 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2925 3734 gene locus_tag LOCUS_11470 2925 3734 CDS product morphological differentiation-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975378.1 protein_id gnl|my_center|LOCUS_11470 4792 4034 gene locus_tag LOCUS_11480 4792 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230534.1 protein_id gnl|my_center|LOCUS_11480 4826 5860 gene locus_tag LOCUS_11490 4826 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence151 242 487 gene locus_tag LOCUS_11500 242 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 503 1954 gene locus_tag LOCUS_11510 gene glmU 503 1954 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MC72 protein_id gnl|my_center|LOCUS_11510 2041 3021 gene locus_tag LOCUS_11520 gene prs 2041 3021 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MC73 protein_id gnl|my_center|LOCUS_11520 3293 3985 gene locus_tag LOCUS_11530 3293 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3982 4572 gene locus_tag LOCUS_11540 gene pth 3982 4572 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3T8 protein_id gnl|my_center|LOCUS_11540 4750 5730 gene locus_tag LOCUS_11550 4750 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence152 231 159 gene locus_tag LOCUS_t00190 231 159 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 320 898 gene locus_tag LOCUS_11560 gene dcd 320 898 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8W0 protein_id gnl|my_center|LOCUS_11560 2193 970 gene locus_tag LOCUS_11570 2193 970 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977076.1 protein_id gnl|my_center|LOCUS_11570 3602 2232 gene locus_tag LOCUS_11580 3602 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144202.1 protein_id gnl|my_center|LOCUS_11580 5062 3599 gene locus_tag LOCUS_11590 5062 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence153 80 901 gene locus_tag LOCUS_11600 80 901 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 protein_id gnl|my_center|LOCUS_11600 979 2334 gene locus_tag LOCUS_11610 979 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2321 2848 gene locus_tag LOCUS_11620 2321 2848 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230223.1 protein_id gnl|my_center|LOCUS_11620 2876 3808 gene locus_tag LOCUS_11630 2876 3808 CDS product strictosidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228739.1 protein_id gnl|my_center|LOCUS_11630 3886 5859 gene locus_tag LOCUS_11640 gene dxs2 3886 5859 CDS product 1-deoxy-D-xylulose-5-phosphate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJP7 protein_id gnl|my_center|LOCUS_11640 >Feature sequence154 1848 247 gene locus_tag LOCUS_11650 1848 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3502 1961 gene locus_tag LOCUS_11660 3502 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 3819 5123 gene locus_tag LOCUS_11670 3819 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence155 2487 1342 gene locus_tag LOCUS_11680 2487 1342 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028527.1 protein_id gnl|my_center|LOCUS_11680 3643 2492 gene locus_tag LOCUS_11690 3643 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4005 5381 gene locus_tag LOCUS_11700 gene wcaJ 4005 5381 CDS product UDP-phosphate galactose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229159.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence156 1402 20 gene locus_tag LOCUS_11710 gene manB 1402 20 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_11710 1781 1431 gene locus_tag LOCUS_11720 1781 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2224 1967 gene locus_tag LOCUS_11730 gene whiB 2224 1967 CDS product transcriptional regulator WhiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKN0 protein_id gnl|my_center|LOCUS_11730 2306 3445 gene locus_tag LOCUS_11740 gene cofD 2306 3445 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZK9 protein_id gnl|my_center|LOCUS_11740 3442 4524 gene locus_tag LOCUS_11750 3442 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 4536 5243 gene locus_tag LOCUS_11760 4536 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5795 5325 gene locus_tag LOCUS_11770 5795 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence157 562 635 gene locus_tag LOCUS_t00200 562 635 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2725 731 gene locus_tag LOCUS_11780 2725 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 4830 2722 gene locus_tag LOCUS_11790 4830 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence158 <1 1062 gene locus_tag LOCUS_11800 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P16245:histidinol dehydrogenase 1059 2153 gene locus_tag LOCUS_11810 gene hisC 1059 2153 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G4S8 protein_id gnl|my_center|LOCUS_11810 2150 2776 gene locus_tag LOCUS_11820 gene hisB 2150 2776 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZH5 protein_id gnl|my_center|LOCUS_11820 2815 3456 gene locus_tag LOCUS_11830 gene hisH 2815 3456 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEJ1 protein_id gnl|my_center|LOCUS_11830 4374 3496 gene locus_tag LOCUS_11840 4374 3496 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727008.1 protein_id gnl|my_center|LOCUS_11840 4475 5230 gene locus_tag LOCUS_11850 4475 5230 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027173.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence159 252 1037 gene locus_tag LOCUS_11860 252 1037 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976789.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence160 <1 978 gene locus_tag LOCUS_11870 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804631.1:DNA processing protein DprA 975 2003 gene locus_tag LOCUS_11880 gene xerC 975 2003 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZL6 protein_id gnl|my_center|LOCUS_11880 2551 2015 gene locus_tag LOCUS_11890 2551 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11890 2926 3903 gene locus_tag LOCUS_11900 gene rpsB 2926 3903 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31212 protein_id gnl|my_center|LOCUS_11900 4042 4854 gene locus_tag LOCUS_11910 gene tsf 4042 4854 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYT7 protein_id gnl|my_center|LOCUS_11910 5034 5753 gene locus_tag LOCUS_11920 gene pyrH 5034 5753 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MB89 protein_id gnl|my_center|LOCUS_11920 >Feature sequence161 <1 1168 gene locus_tag LOCUS_11930 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225999.1:MFS transporter 1243 2364 gene locus_tag LOCUS_11940 1243 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2382 3170 gene locus_tag LOCUS_11950 2382 3170 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382989.1 protein_id gnl|my_center|LOCUS_11950 3167 3970 gene locus_tag LOCUS_11960 3167 3970 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972912.1 protein_id gnl|my_center|LOCUS_11960 3970 4863 gene locus_tag LOCUS_11970 3970 4863 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482930.1 protein_id gnl|my_center|LOCUS_11970 5445 4969 gene locus_tag LOCUS_11980 5445 4969 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974003.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence162 354 707 gene locus_tag LOCUS_11990 354 707 CDS product flagellar basal-body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_11990 707 1096 gene locus_tag LOCUS_12000 707 1096 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6C9 protein_id gnl|my_center|LOCUS_12000 1099 1461 gene locus_tag LOCUS_12010 1099 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1470 3065 gene locus_tag LOCUS_12020 gene fliF 1470 3065 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR09 protein_id gnl|my_center|LOCUS_12020 3062 4078 gene locus_tag LOCUS_12030 3062 4078 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460758.1 protein_id gnl|my_center|LOCUS_12030 4062 4793 gene locus_tag LOCUS_12040 4062 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence163 136 1380 gene locus_tag LOCUS_12050 136 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1448 2479 gene locus_tag LOCUS_12060 1448 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229588.1 protein_id gnl|my_center|LOCUS_12060 2479 3339 gene locus_tag LOCUS_12070 gene tesB 2479 3339 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224343.1 protein_id gnl|my_center|LOCUS_12070 3555 5024 gene locus_tag LOCUS_12080 3555 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence164 1651 395 gene locus_tag LOCUS_12090 1651 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_12090 2357 1683 gene locus_tag LOCUS_12100 2357 1683 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_12100 3053 2415 gene locus_tag LOCUS_12110 3053 2415 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975803.1 protein_id gnl|my_center|LOCUS_12110 3908 3192 gene locus_tag LOCUS_12120 3908 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 <5633 3970 gene locus_tag LOCUS_12130 <5633 3970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7TWW9:lipoprotein LpqB >Feature sequence165 2059 566 gene locus_tag LOCUS_12140 gene mprB 2059 566 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230060.1 protein_id gnl|my_center|LOCUS_12140 2793 2056 gene locus_tag LOCUS_12150 gene mprA 2793 2056 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230061.1 protein_id gnl|my_center|LOCUS_12150 3749 2871 gene locus_tag LOCUS_12160 3749 2871 CDS product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226372.1 protein_id gnl|my_center|LOCUS_12160 4375 3797 gene locus_tag LOCUS_12170 4375 3797 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223074.1 protein_id gnl|my_center|LOCUS_12170 4755 4372 gene locus_tag LOCUS_12180 4755 4372 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013480.1 protein_id gnl|my_center|LOCUS_12180 5266 4838 gene locus_tag LOCUS_12190 5266 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence166 1753 2805 gene locus_tag LOCUS_12200 1753 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 4476 2836 gene locus_tag LOCUS_12210 gene pgm 4476 2836 CDS product phosphoglucomutase, alpha-D-glucose phosphate-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728182.1 protein_id gnl|my_center|LOCUS_12210 4579 5481 gene locus_tag LOCUS_12220 gene galE2 4579 5481 CDS product nucleoside-diphosphate-sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119394.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence167 1028 2380 gene locus_tag LOCUS_12230 gene der 1028 2380 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EWW8 protein_id gnl|my_center|LOCUS_12230 2851 2516 gene locus_tag LOCUS_12240 2851 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 3042 3118 gene locus_tag LOCUS_t00210 3042 3118 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3579 3914 gene locus_tag LOCUS_12250 3579 3914 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727853.1 protein_id gnl|my_center|LOCUS_12250 4112 4891 gene locus_tag LOCUS_12260 4112 4891 CDS product putative transposase for insertion sequence element IS986/IS6110 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59800 protein_id gnl|my_center|LOCUS_12260 5398 4904 gene locus_tag LOCUS_12270 5398 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence168 1535 4348 gene locus_tag LOCUS_12280 gene acnA 1535 4348 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226785.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence169 1199 432 gene locus_tag LOCUS_12290 gene fliR 1199 432 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYF6 protein_id gnl|my_center|LOCUS_12290 1494 1225 gene locus_tag LOCUS_12300 gene fliQ 1494 1225 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35535 protein_id gnl|my_center|LOCUS_12300 2340 1504 gene locus_tag LOCUS_12310 2340 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2813 2337 gene locus_tag LOCUS_12320 2813 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3683 2817 gene locus_tag LOCUS_12330 3683 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4636 3680 gene locus_tag LOCUS_12340 4636 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 5224 4787 gene locus_tag LOCUS_12350 5224 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence170 4743 5222 gene locus_tag LOCUS_12360 4743 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892352.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence171 3 716 gene locus_tag LOCUS_12370 3 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 718 1170 gene locus_tag LOCUS_12380 718 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1160 1834 gene locus_tag LOCUS_12390 1160 1834 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028232.1 protein_id gnl|my_center|LOCUS_12390 1992 2249 gene locus_tag LOCUS_12400 1992 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 3140 2331 gene locus_tag LOCUS_12410 3140 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3438 3959 gene locus_tag LOCUS_12420 3438 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 5025 4156 gene locus_tag LOCUS_12430 5025 4156 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228550.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence172 253 1464 gene locus_tag LOCUS_12440 253 1464 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028814.1 protein_id gnl|my_center|LOCUS_12440 1464 1949 gene locus_tag LOCUS_12450 gene moaC 1464 1949 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKA8 protein_id gnl|my_center|LOCUS_12450 1942 2463 gene locus_tag LOCUS_12460 1942 2463 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028812.1 protein_id gnl|my_center|LOCUS_12460 2460 3086 gene locus_tag LOCUS_12470 2460 3086 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804925.1 protein_id gnl|my_center|LOCUS_12470 3185 4036 gene locus_tag LOCUS_12480 3185 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 5276 4056 gene locus_tag LOCUS_12490 5276 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 5365 5440 gene locus_tag LOCUS_t00220 5365 5440 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence173 3230 2298 gene locus_tag LOCUS_12500 3230 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 4984 3293 gene locus_tag LOCUS_12510 gene rnj 4984 3293 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86842 protein_id gnl|my_center|LOCUS_12510 >Feature sequence174 399 1808 gene locus_tag LOCUS_12520 gene eutB 399 1808 CDS product ethanolamine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892941.1 protein_id gnl|my_center|LOCUS_12520 1805 2632 gene locus_tag LOCUS_12530 gene eutC 1805 2632 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QSP7 protein_id gnl|my_center|LOCUS_12530 3575 2664 gene locus_tag LOCUS_12540 gene purC 3575 2664 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKL1 protein_id gnl|my_center|LOCUS_12540 4990 3572 gene locus_tag LOCUS_12550 gene purB 4990 3572 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJA2 protein_id gnl|my_center|LOCUS_12550 >Feature sequence175 190 1368 gene locus_tag LOCUS_12560 gene gcd 190 1368 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_12560 1486 3087 gene locus_tag LOCUS_12570 1486 3087 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 protein_id gnl|my_center|LOCUS_12570 3084 3275 gene locus_tag LOCUS_12580 3084 3275 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403890.1 protein_id gnl|my_center|LOCUS_12580 3338 3931 gene locus_tag LOCUS_12590 3338 3931 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228181.1 protein_id gnl|my_center|LOCUS_12590 4038 4682 gene locus_tag LOCUS_12600 gene mpt83 4038 4682 CDS product cell surface glycolipoprotein MPT83 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNF3 protein_id gnl|my_center|LOCUS_12600 4743 4925 gene locus_tag LOCUS_12610 4743 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence176 1741 803 gene locus_tag LOCUS_12620 1741 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1709 2044 gene locus_tag LOCUS_12630 1709 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3302 2148 gene locus_tag LOCUS_12640 3302 2148 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731331.1 protein_id gnl|my_center|LOCUS_12640 4495 3317 gene locus_tag LOCUS_12650 4495 3317 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731330.1 protein_id gnl|my_center|LOCUS_12650 <5389 4578 gene locus_tag LOCUS_12660 <5389 4578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227663.1:NADH-binding protein >Feature sequence177 705 295 gene locus_tag LOCUS_12670 705 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_12670 1609 761 gene locus_tag LOCUS_12680 1609 761 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030789.1 protein_id gnl|my_center|LOCUS_12680 2862 1606 gene locus_tag LOCUS_12690 2862 1606 CDS product putative NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705358.1 protein_id gnl|my_center|LOCUS_12690 2963 3787 gene locus_tag LOCUS_12700 2963 3787 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039345.1 protein_id gnl|my_center|LOCUS_12700 4877 3798 gene locus_tag LOCUS_12710 4877 3798 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941964.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence178 721 380 gene locus_tag LOCUS_12720 721 380 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707594.1 protein_id gnl|my_center|LOCUS_12720 761 2830 gene locus_tag LOCUS_12730 gene nadE 761 2830 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729965.1 protein_id gnl|my_center|LOCUS_12730 3504 3094 gene locus_tag LOCUS_12740 3504 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3620 4957 gene locus_tag LOCUS_12750 3620 4957 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976572.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence179 1195 341 gene locus_tag LOCUS_12760 1195 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1323 2063 gene locus_tag LOCUS_12770 1323 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223323.1 protein_id gnl|my_center|LOCUS_12770 2277 2663 gene locus_tag LOCUS_12780 2277 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2864 4345 gene locus_tag LOCUS_12790 2864 4345 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803913.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence180 2235 58 gene locus_tag LOCUS_12800 2235 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2489 3607 gene locus_tag LOCUS_12810 gene rumB 2489 3607 CDS product 23S rRNA (uracil(747)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804013.1 protein_id gnl|my_center|LOCUS_12810 <5355 3595 gene locus_tag LOCUS_12820 <5355 3595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000755373.1:PAS domain-containing sensor histidine kinase >Feature sequence181 2511 1378 gene locus_tag LOCUS_12830 gene ddl 2511 1378 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDP3 protein_id gnl|my_center|LOCUS_12830 2588 3688 gene locus_tag LOCUS_12840 gene metB 2588 3688 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222013.1 protein_id gnl|my_center|LOCUS_12840 4762 3761 gene locus_tag LOCUS_12850 gene gpsA 4762 3761 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CY20 protein_id gnl|my_center|LOCUS_12850 >Feature sequence182 682 248 gene locus_tag LOCUS_12860 682 248 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227655.1 protein_id gnl|my_center|LOCUS_12860 854 2002 gene locus_tag LOCUS_12870 854 2002 CDS product pyruvate dehydrogenase E1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776525.1 protein_id gnl|my_center|LOCUS_12870 1999 2985 gene locus_tag LOCUS_12880 1999 2985 CDS product pyruvate dehydrogenase E1 component beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705639.1 protein_id gnl|my_center|LOCUS_12880 2996 4342 gene locus_tag LOCUS_12890 gene pdhC 2996 4342 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DL08 protein_id gnl|my_center|LOCUS_12890 >Feature sequence183 1270 1527 gene locus_tag LOCUS_12900 1270 1527 CDS product putative glutaredoxin Rv3198.1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN17 protein_id gnl|my_center|LOCUS_12900 2546 1563 gene locus_tag LOCUS_12910 2546 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 4576 2531 gene locus_tag LOCUS_12920 gene thoP1 4576 2531 CDS product Zn-dependent oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_12920 <5315 4587 gene locus_tag LOCUS_12930 <5315 4587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030104.1:ATP-dependent DNA helicase >Feature sequence184 2313 775 gene locus_tag LOCUS_12940 2313 775 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3V1 protein_id gnl|my_center|LOCUS_12940 3172 2360 gene locus_tag LOCUS_12950 3172 2360 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893318.1 protein_id gnl|my_center|LOCUS_12950 3336 4409 gene locus_tag LOCUS_12960 3336 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence185 2277 1186 gene locus_tag LOCUS_12970 gene ino1 2277 1186 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R7G6 protein_id gnl|my_center|LOCUS_12970 2918 2340 gene locus_tag LOCUS_12980 2918 2340 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975031.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence186 <1 2535 gene locus_tag LOCUS_12990 <1 2535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III 3656 2550 gene locus_tag LOCUS_13000 3656 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13000 3655 5040 gene locus_tag LOCUS_13010 3655 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704376.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence187 494 1264 gene locus_tag LOCUS_13020 494 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977652.1 protein_id gnl|my_center|LOCUS_13020 1964 1296 gene locus_tag LOCUS_13030 1964 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 2694 2065 gene locus_tag LOCUS_13040 2694 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2905 5205 gene locus_tag LOCUS_13050 2905 5205 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZ13 protein_id gnl|my_center|LOCUS_13050 >Feature sequence188 <1 1429 gene locus_tag LOCUS_13060 <1 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028431.1:membrane protein 1549 2505 gene locus_tag LOCUS_13070 1549 2505 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976240.1 protein_id gnl|my_center|LOCUS_13070 2667 3905 gene locus_tag LOCUS_13080 gene xenA 2667 3905 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103986.1 protein_id gnl|my_center|LOCUS_13080 4279 4019 gene locus_tag LOCUS_13090 gene rpsT 4279 4019 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDM3 protein_id gnl|my_center|LOCUS_13090 4682 4431 gene locus_tag LOCUS_13100 4682 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence189 2954 2235 gene locus_tag LOCUS_13110 2954 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 2996 3748 gene locus_tag LOCUS_13120 2996 3748 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029387.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence190 1804 866 gene locus_tag LOCUS_13130 gene dapD 1804 866 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2G5 protein_id gnl|my_center|LOCUS_13130 1957 2682 gene locus_tag LOCUS_13140 1957 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2679 3743 gene locus_tag LOCUS_13150 2679 3743 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030079.1 protein_id gnl|my_center|LOCUS_13150 3782 4570 gene locus_tag LOCUS_13160 3782 4570 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBL8 protein_id gnl|my_center|LOCUS_13160 >Feature sequence191 313 951 gene locus_tag LOCUS_13170 gene bioY 313 951 CDS product BioY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707085.1 protein_id gnl|my_center|LOCUS_13170 968 1996 gene locus_tag LOCUS_13180 968 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2009 3190 gene locus_tag LOCUS_13190 2009 3190 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968893.1 protein_id gnl|my_center|LOCUS_13190 3187 3888 gene locus_tag LOCUS_13200 3187 3888 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRL9 protein_id gnl|my_center|LOCUS_13200 3896 4558 gene locus_tag LOCUS_13210 3896 4558 CDS product cobalt ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889093.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence192 <1 807 gene locus_tag LOCUS_13220 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087752.1:esterase 977 2122 gene locus_tag LOCUS_13230 gene tbpA 977 2122 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229776.1 protein_id gnl|my_center|LOCUS_13230 2119 3831 gene locus_tag LOCUS_13240 2119 3831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229775.1 protein_id gnl|my_center|LOCUS_13240 3846 4931 gene locus_tag LOCUS_13250 3846 4931 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229774.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence193 688 128 gene locus_tag LOCUS_13260 688 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 765 691 gene locus_tag LOCUS_t00230 765 691 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1330 767 gene locus_tag LOCUS_13270 1330 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2036 1491 gene locus_tag LOCUS_13280 2036 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3847 2090 gene locus_tag LOCUS_13290 3847 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053633.1 protein_id gnl|my_center|LOCUS_13290 5130 3871 gene locus_tag LOCUS_13300 5130 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence194 2100 55 gene locus_tag LOCUS_13310 2100 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 2352 2279 gene locus_tag LOCUS_t00240 2352 2279 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2514 3782 gene locus_tag LOCUS_13320 2514 3782 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028731.1 protein_id gnl|my_center|LOCUS_13320 4123 3842 gene locus_tag LOCUS_13330 4123 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 4010 4774 gene locus_tag LOCUS_13340 4010 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 4767 4982 gene locus_tag LOCUS_13350 4767 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5127 4996 gene locus_tag LOCUS_13360 5127 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence195 2761 1250 gene locus_tag LOCUS_13370 gene gabD 2761 1250 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229619.1 protein_id gnl|my_center|LOCUS_13370 3194 2856 gene locus_tag LOCUS_13380 gene rsbV 3194 2856 CDS product anti-sigma-B factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WVX8 protein_id gnl|my_center|LOCUS_13380 3341 3997 gene locus_tag LOCUS_13390 3341 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 4460 4056 gene locus_tag LOCUS_13400 4460 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 4927 4457 gene locus_tag LOCUS_13410 4927 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence196 591 58 gene locus_tag LOCUS_13420 gene purE 591 58 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93J44 protein_id gnl|my_center|LOCUS_13420 1808 588 gene locus_tag LOCUS_13430 gene purK 1808 588 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CJX8 protein_id gnl|my_center|LOCUS_13430 2354 1950 gene locus_tag LOCUS_13440 2354 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3586 2501 gene locus_tag LOCUS_13450 gene cya 3586 2501 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40135 protein_id gnl|my_center|LOCUS_13450 4125 3583 gene locus_tag LOCUS_13460 4125 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 5017 4154 gene locus_tag LOCUS_13470 gene birA 5017 4154 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222884.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence197 1984 662 gene locus_tag LOCUS_13480 1984 662 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224816.1 protein_id gnl|my_center|LOCUS_13480 2130 3056 gene locus_tag LOCUS_13490 2130 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 3801 3085 gene locus_tag LOCUS_13500 3801 3085 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976619.1 protein_id gnl|my_center|LOCUS_13500 4777 3836 gene locus_tag LOCUS_13510 gene lipA 4777 3836 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2P2 protein_id gnl|my_center|LOCUS_13510 >Feature sequence198 1283 207 gene locus_tag LOCUS_13520 1283 207 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976959.1 protein_id gnl|my_center|LOCUS_13520 1522 1361 gene locus_tag LOCUS_13530 1522 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1642 2241 gene locus_tag LOCUS_13540 1642 2241 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226000.1 protein_id gnl|my_center|LOCUS_13540 3816 2245 gene locus_tag LOCUS_13550 gene ffh 3816 2245 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69874 protein_id gnl|my_center|LOCUS_13550 5026 3875 gene locus_tag LOCUS_13560 5026 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence199 2183 513 gene locus_tag LOCUS_13570 2183 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2540 2881 gene locus_tag LOCUS_13580 gene ndhC 2540 2881 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDP3 protein_id gnl|my_center|LOCUS_13580 2872 3873 gene locus_tag LOCUS_13590 2872 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 3866 4795 gene locus_tag LOCUS_13600 3866 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence200 1579 809 gene locus_tag LOCUS_13610 1579 809 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_13610 1875 1582 gene locus_tag LOCUS_13620 1875 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2897 2106 gene locus_tag LOCUS_13630 gene flgG 2897 2106 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23446 protein_id gnl|my_center|LOCUS_13630 3637 2975 gene locus_tag LOCUS_13640 3637 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4986 3646 gene locus_tag LOCUS_13650 4986 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence201 >Feature sequence202 1967 627 gene locus_tag LOCUS_13660 1967 627 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977272.1 protein_id gnl|my_center|LOCUS_13660 1989 2516 gene locus_tag LOCUS_13670 1989 2516 CDS product UPF0098 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X9Z8 protein_id gnl|my_center|LOCUS_13670 2559 2996 gene locus_tag LOCUS_13680 2559 2996 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_13680 3786 3010 gene locus_tag LOCUS_13690 3786 3010 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVY7 protein_id gnl|my_center|LOCUS_13690 <4994 3813 gene locus_tag LOCUS_13700 <4994 3813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027982.1:paraslipin >Feature sequence203 613 1431 gene locus_tag LOCUS_13710 613 1431 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_13710 2450 1776 gene locus_tag LOCUS_13720 2450 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973817.1 protein_id gnl|my_center|LOCUS_13720 3067 2465 gene locus_tag LOCUS_13730 gene gpm 3067 2465 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229706.1 protein_id gnl|my_center|LOCUS_13730 3674 3078 gene locus_tag LOCUS_13740 3674 3078 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030945.1 protein_id gnl|my_center|LOCUS_13740 4834 3752 gene locus_tag LOCUS_13750 4834 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence204 583 143 gene locus_tag LOCUS_13760 583 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1675 593 gene locus_tag LOCUS_13770 1675 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2278 1805 gene locus_tag LOCUS_13780 2278 1805 CDS product putative MutT/NUDIX-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702254.1 protein_id gnl|my_center|LOCUS_13780 3740 2298 gene locus_tag LOCUS_13790 3740 2298 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226681.1 protein_id gnl|my_center|LOCUS_13790 4146 3784 gene locus_tag LOCUS_13800 4146 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 <4964 4143 gene locus_tag LOCUS_13810 <4964 4143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814501.1:extradiol dioxygenase >Feature sequence205 1515 391 gene locus_tag LOCUS_13820 1515 391 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZW1 protein_id gnl|my_center|LOCUS_13820 2465 1515 gene locus_tag LOCUS_13830 2465 1515 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MGA9 protein_id gnl|my_center|LOCUS_13830 3720 2593 gene locus_tag LOCUS_13840 3720 2593 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MGB0 protein_id gnl|my_center|LOCUS_13840 <4959 3921 gene locus_tag LOCUS_13850 <4959 3921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776549.1:ADP-ribose pyrophosphatase >Feature sequence206 1054 596 gene locus_tag LOCUS_13860 1054 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1140 2696 gene locus_tag LOCUS_13870 1140 2696 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014192.1 protein_id gnl|my_center|LOCUS_13870 2696 3727 gene locus_tag LOCUS_13880 2696 3727 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014191.1 protein_id gnl|my_center|LOCUS_13880 4430 3771 gene locus_tag LOCUS_13890 4430 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 4952 4455 gene locus_tag LOCUS_13900 4952 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence207 1275 751 gene locus_tag LOCUS_13910 1275 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1343 2548 gene locus_tag LOCUS_13920 gene rimK 1343 2548 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_13920 2762 3433 gene locus_tag LOCUS_13930 2762 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence208 364 1500 gene locus_tag LOCUS_13940 364 1500 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229184.1 protein_id gnl|my_center|LOCUS_13940 1916 1515 gene locus_tag LOCUS_13950 1916 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_13950 1972 2472 gene locus_tag LOCUS_13960 1972 2472 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886775.1 protein_id gnl|my_center|LOCUS_13960 3038 2475 gene locus_tag LOCUS_13970 3038 2475 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029667.1 protein_id gnl|my_center|LOCUS_13970 4024 3107 gene locus_tag LOCUS_13980 4024 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 <4916 4130 gene locus_tag LOCUS_13990 <4916 4130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089997.1:CoA transferase >Feature sequence209 826 278 gene locus_tag LOCUS_14000 826 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2437 863 gene locus_tag LOCUS_14010 2437 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2674 2501 gene locus_tag LOCUS_14020 2674 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3519 2740 gene locus_tag LOCUS_14030 3519 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4670 3516 gene locus_tag LOCUS_14040 4670 3516 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856473.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence210 <1 927 gene locus_tag LOCUS_14050 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223258.1:multidrug ABC transporter ATP-binding protein 924 1937 gene locus_tag LOCUS_14060 924 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1992 2747 gene locus_tag LOCUS_14070 gene lipB 1992 2747 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D030 protein_id gnl|my_center|LOCUS_14070 2744 3460 gene locus_tag LOCUS_14080 2744 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4286 3477 gene locus_tag LOCUS_14090 4286 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225768.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence211 1658 1230 gene locus_tag LOCUS_14100 1658 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1833 2717 gene locus_tag LOCUS_14110 gene carH 1833 2717 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W62 protein_id gnl|my_center|LOCUS_14110 2785 4299 gene locus_tag LOCUS_14120 2785 4299 CDS product cyclohexanone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence212 38 910 gene locus_tag LOCUS_14130 gene phaD 38 910 CDS product poly(3-hydroxyalkanoic acid) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095866.1 protein_id gnl|my_center|LOCUS_14130 997 2181 gene locus_tag LOCUS_14140 gene gcdH 997 2181 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228249.1 protein_id gnl|my_center|LOCUS_14140 2579 2202 gene locus_tag LOCUS_14150 2579 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2834 4330 gene locus_tag LOCUS_14160 2834 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence213 460 1071 gene locus_tag LOCUS_14170 460 1071 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727052.1 protein_id gnl|my_center|LOCUS_14170 1369 1076 gene locus_tag LOCUS_14180 1369 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2297 1449 gene locus_tag LOCUS_14190 2297 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2369 3748 gene locus_tag LOCUS_14200 2369 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence214 815 306 gene locus_tag LOCUS_14210 815 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1307 903 gene locus_tag LOCUS_14220 1307 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2285 1323 gene locus_tag LOCUS_14230 2285 1323 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974981.1 protein_id gnl|my_center|LOCUS_14230 2338 3588 gene locus_tag LOCUS_14240 gene arcA 2338 3588 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKB7 protein_id gnl|my_center|LOCUS_14240 3597 4010 gene locus_tag LOCUS_14250 3597 4010 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268644.1 protein_id gnl|my_center|LOCUS_14250 4358 4041 gene locus_tag LOCUS_14260 4358 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence215 516 1298 gene locus_tag LOCUS_14270 516 1298 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_14270 1453 3024 gene locus_tag LOCUS_14280 1453 3024 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223405.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence216 2095 1073 gene locus_tag LOCUS_14290 gene hrcA 2095 1073 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDD6 protein_id gnl|my_center|LOCUS_14290 2236 3147 gene locus_tag LOCUS_14300 2236 3147 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409574.1 protein_id gnl|my_center|LOCUS_14300 3208 4074 gene locus_tag LOCUS_14310 3208 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728763.1 protein_id gnl|my_center|LOCUS_14310 <4829 4140 gene locus_tag LOCUS_14320 <4829 4140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O31788:serine protease AprX >Feature sequence217 92 898 gene locus_tag LOCUS_14330 92 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 926 1462 gene locus_tag LOCUS_14340 926 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2245 1616 gene locus_tag LOCUS_14350 2245 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083060.1 protein_id gnl|my_center|LOCUS_14350 3002 2271 gene locus_tag LOCUS_14360 3002 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 3164 3090 gene locus_tag LOCUS_t00250 3164 3090 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3236 3165 gene locus_tag LOCUS_t00260 3236 3165 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3340 3267 gene locus_tag LOCUS_t00270 3340 3267 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3497 4345 gene locus_tag LOCUS_14370 3497 4345 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977279.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence218 1332 724 gene locus_tag LOCUS_14380 1332 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1641 1336 gene locus_tag LOCUS_14390 1641 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402188.1 protein_id gnl|my_center|LOCUS_14390 1798 3291 gene locus_tag LOCUS_14400 gene otsA 1798 3291 CDS product trehalose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R4M9 protein_id gnl|my_center|LOCUS_14400 3334 4581 gene locus_tag LOCUS_14410 3334 4581 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229652.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence219 <1 1864 gene locus_tag LOCUS_14420 <1 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CJV9:chaperone protein ClpB 1920 2954 gene locus_tag LOCUS_14430 1920 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3041 3715 gene locus_tag LOCUS_14440 3041 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 3712 4305 gene locus_tag LOCUS_14450 3712 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence220 1584 829 gene locus_tag LOCUS_14460 1584 829 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027734.1 protein_id gnl|my_center|LOCUS_14460 3078 1666 gene locus_tag LOCUS_14470 3078 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 3695 3288 gene locus_tag LOCUS_14480 3695 3288 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence221 1581 253 gene locus_tag LOCUS_14490 gene avtA 1581 253 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_14490 2044 1718 gene locus_tag LOCUS_14500 gene trxA 2044 1718 CDS product thioredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52230 protein_id gnl|my_center|LOCUS_14500 3046 2093 gene locus_tag LOCUS_14510 gene trxB 3046 2093 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52215 protein_id gnl|my_center|LOCUS_14510 4007 3192 gene locus_tag LOCUS_14520 4007 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 <4783 3997 gene locus_tag LOCUS_14530 <4783 3997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029295.1:RNA polymerase sigma factor SigM >Feature sequence222 732 403 gene locus_tag LOCUS_14540 732 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1133 729 gene locus_tag LOCUS_14550 gene fliS 1133 729 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39739 protein_id gnl|my_center|LOCUS_14550 2561 1227 gene locus_tag LOCUS_14560 gene fliD 2561 1227 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G5 protein_id gnl|my_center|LOCUS_14560 3900 2785 gene locus_tag LOCUS_14570 3900 2785 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKG1 protein_id gnl|my_center|LOCUS_14570 <4744 4089 gene locus_tag LOCUS_14580 <4744 4089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748G4:flagellin >Feature sequence223 2299 1346 gene locus_tag LOCUS_14590 2299 1346 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHU2 protein_id gnl|my_center|LOCUS_14590 3254 2421 gene locus_tag LOCUS_14600 3254 2421 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MCM3 protein_id gnl|my_center|LOCUS_14600 3317 3724 gene locus_tag LOCUS_14610 3317 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 4126 3728 gene locus_tag LOCUS_14620 4126 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4204 4635 gene locus_tag LOCUS_14630 4204 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence224 <1 558 gene locus_tag LOCUS_14640 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226294.1:pilus assembly protein PilB 561 1766 gene locus_tag LOCUS_14650 gene pilC 561 1766 CDS product pilus assembly protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226293.1 protein_id gnl|my_center|LOCUS_14650 1766 2236 gene locus_tag LOCUS_14660 1766 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 2233 2880 gene locus_tag LOCUS_14670 2233 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence225 1153 656 gene locus_tag LOCUS_14680 1153 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1249 1905 gene locus_tag LOCUS_14690 1249 1905 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224757.1 protein_id gnl|my_center|LOCUS_14690 1902 2735 gene locus_tag LOCUS_14700 1902 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705652.1 protein_id gnl|my_center|LOCUS_14700 2728 4641 gene locus_tag LOCUS_14710 2728 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404960.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence226 1895 51 gene locus_tag LOCUS_14720 gene glmS 1895 51 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86781 protein_id gnl|my_center|LOCUS_14720 2000 2959 gene locus_tag LOCUS_14730 gene coaA 2000 2959 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEW3 protein_id gnl|my_center|LOCUS_14730 3008 3997 gene locus_tag LOCUS_14740 3008 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703597.1 protein_id gnl|my_center|LOCUS_14740 <4695 4026 gene locus_tag LOCUS_14750 <4695 4026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WE89:glucose-6-phosphate 1-dehydrogenase >Feature sequence227 679 1077 gene locus_tag LOCUS_14760 679 1077 CDS product putative mutator protein MutT2/NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702050.1 protein_id gnl|my_center|LOCUS_14760 1074 1358 gene locus_tag LOCUS_14770 1074 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1423 2361 gene locus_tag LOCUS_14780 gene mshB 1423 2361 CDS product 1D-myo-inositol 2-acetamido-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F344 protein_id gnl|my_center|LOCUS_14780 2405 2794 gene locus_tag LOCUS_14790 2405 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 2791 4671 gene locus_tag LOCUS_14800 2791 4671 CDS product vanomycin resistance protein VanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228760.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence228 2666 2151 gene locus_tag LOCUS_14810 2666 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976415.1 protein_id gnl|my_center|LOCUS_14810 <4663 2851 gene locus_tag LOCUS_14820 <4663 2851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MLR2:ATP-dependent RNA helicase DeaD >Feature sequence229 417 1184 gene locus_tag LOCUS_14830 417 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1188 2714 gene locus_tag LOCUS_14840 1188 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence230 153 875 gene locus_tag LOCUS_14850 153 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804265.1 protein_id gnl|my_center|LOCUS_14850 1179 886 gene locus_tag LOCUS_14860 1179 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1525 1184 gene locus_tag LOCUS_14870 1525 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_14870 2667 1522 gene locus_tag LOCUS_14880 2667 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 3795 2743 gene locus_tag LOCUS_14890 3795 2743 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976087.1 protein_id gnl|my_center|LOCUS_14890 3881 4384 gene locus_tag LOCUS_14900 3881 4384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 4612 4460 gene locus_tag LOCUS_14910 4612 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence231 694 3315 gene locus_tag LOCUS_14920 gene gyrA 694 3315 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35885 protein_id gnl|my_center|LOCUS_14920 3315 4046 gene locus_tag LOCUS_14930 3315 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 4138 4213 gene locus_tag LOCUS_t00280 4138 4213 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4397 4471 gene locus_tag LOCUS_t00290 4397 4471 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence232 <1 966 gene locus_tag LOCUS_14940 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013801.1:siderophore-interacting protein 1881 994 gene locus_tag LOCUS_14950 gene ars 1881 994 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020668.1 protein_id gnl|my_center|LOCUS_14950 3889 1913 gene locus_tag LOCUS_14960 3889 1913 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119431.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence233 <1 556 gene locus_tag LOCUS_14970 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229771.1:membrane protein 553 1494 gene locus_tag LOCUS_14980 553 1494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974362.1 protein_id gnl|my_center|LOCUS_14980 1481 2344 gene locus_tag LOCUS_14990 1481 2344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029744.1 protein_id gnl|my_center|LOCUS_14990 3276 2365 gene locus_tag LOCUS_15000 gene glsA 3276 2365 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D5U5 protein_id gnl|my_center|LOCUS_15000 4092 3301 gene locus_tag LOCUS_15010 4092 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4073 4258 gene locus_tag LOCUS_15020 4073 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence234 302 1366 gene locus_tag LOCUS_15030 302 1366 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975295.1 protein_id gnl|my_center|LOCUS_15030 1483 3054 gene locus_tag LOCUS_15040 1483 3054 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228504.1 protein_id gnl|my_center|LOCUS_15040 3121 4428 gene locus_tag LOCUS_15050 gene tyrS 3121 4428 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ50 protein_id gnl|my_center|LOCUS_15050 >Feature sequence235 2065 1103 gene locus_tag LOCUS_15060 gene menC 2065 1103 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DHU7 protein_id gnl|my_center|LOCUS_15060 3192 2065 gene locus_tag LOCUS_15070 3192 2065 CDS product putative O-succinylbenzoic acid--CoA ligase MenE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704680.1 protein_id gnl|my_center|LOCUS_15070 3259 4167 gene locus_tag LOCUS_15080 gene menA 3259 4167 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65651 protein_id gnl|my_center|LOCUS_15080 >Feature sequence236 973 362 gene locus_tag LOCUS_15090 973 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 <4518 978 gene locus_tag LOCUS_15100 <4518 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MDR4:1,4-alpha-glucan branching enzyme GlgB >Feature sequence237 189 1178 gene locus_tag LOCUS_15110 189 1178 CDS product protein pafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226714.1 protein_id gnl|my_center|LOCUS_15110 1224 1508 gene locus_tag LOCUS_15120 1224 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1523 2365 gene locus_tag LOCUS_15130 gene tatC 1523 2365 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ69 protein_id gnl|my_center|LOCUS_15130 2362 2805 gene locus_tag LOCUS_15140 2362 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence238 262 1053 gene locus_tag LOCUS_15150 262 1053 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941604.1 protein_id gnl|my_center|LOCUS_15150 1050 4103 gene locus_tag LOCUS_15160 gene glnE 1050 4103 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CK02 protein_id gnl|my_center|LOCUS_15160 4122 4421 gene locus_tag LOCUS_15170 4122 4421 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence239 <1 831 gene locus_tag LOCUS_15180 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975111.1:NAD(P)H quinone oxidoreductase 883 1488 gene locus_tag LOCUS_15190 883 1488 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975113.1 protein_id gnl|my_center|LOCUS_15190 1672 2850 gene locus_tag LOCUS_15200 1672 2850 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730701.1 protein_id gnl|my_center|LOCUS_15200 2948 4219 gene locus_tag LOCUS_15210 2948 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4492 4295 gene locus_tag LOCUS_15220 4492 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence240 18 1100 gene locus_tag LOCUS_15230 gene pat 18 1100 CDS product putative phenylalanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBY8 protein_id gnl|my_center|LOCUS_15230 1138 2103 gene locus_tag LOCUS_15240 1138 2103 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226183.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence241 <1 1069 gene locus_tag LOCUS_15250 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222700.1:histidine kinase 1066 1749 gene locus_tag LOCUS_15260 1066 1749 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222701.1 protein_id gnl|my_center|LOCUS_15260 1815 2159 gene locus_tag LOCUS_15270 1815 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence242 1966 1274 gene locus_tag LOCUS_15280 1966 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3214 2027 gene locus_tag LOCUS_15290 gene mshC 3214 2027 CDS product L-cysteine:1D-myo-inositol 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67018 protein_id gnl|my_center|LOCUS_15290 3881 3303 gene locus_tag LOCUS_15300 3881 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 <4428 3927 gene locus_tag LOCUS_15310 <4428 3927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027320.1:cystathionine beta-lyase >Feature sequence243 2775 3203 gene locus_tag LOCUS_15320 2775 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908452.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence244 342 1142 gene locus_tag LOCUS_15330 342 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3243 1207 gene locus_tag LOCUS_15340 3243 1207 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727176.1 protein_id gnl|my_center|LOCUS_15340 3311 4213 gene locus_tag LOCUS_15350 3311 4213 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705496.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence245 13 335 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtctcgtggctcgccccagggggctcgca 1559 456 gene locus_tag LOCUS_15360 1559 456 CDS product GDP-mannose pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028729.1 protein_id gnl|my_center|LOCUS_15360 1578 2321 gene locus_tag LOCUS_15370 1578 2321 CDS product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727932.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence246 <1 1252 gene locus_tag LOCUS_15380 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918481.1:chemotaxis protein CheA 1249 1731 gene locus_tag LOCUS_15390 1249 1731 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390315.1 protein_id gnl|my_center|LOCUS_15390 1728 4088 gene locus_tag LOCUS_15400 1728 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence247 2152 1034 gene locus_tag LOCUS_15410 gene ydjI 2152 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537911.1 protein_id gnl|my_center|LOCUS_15410 2185 2628 gene locus_tag LOCUS_15420 2185 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3711 2662 gene locus_tag LOCUS_15430 3711 2662 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229198.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence248 46 121 gene locus_tag LOCUS_t00300 46 121 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 856 212 gene locus_tag LOCUS_15440 856 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1251 853 gene locus_tag LOCUS_15450 1251 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1783 1289 gene locus_tag LOCUS_15460 1783 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3368 1794 gene locus_tag LOCUS_15470 3368 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3725 3408 gene locus_tag LOCUS_15480 3725 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence249 3178 1370 gene locus_tag LOCUS_15490 3178 1370 CDS product putative oligopeptide ABC transporter, ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701182.1 protein_id gnl|my_center|LOCUS_15490 3280 3765 gene locus_tag LOCUS_15500 3280 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 4358 3774 gene locus_tag LOCUS_15510 4358 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence250 1079 327 gene locus_tag LOCUS_15520 gene gpmA 1079 327 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33158 protein_id gnl|my_center|LOCUS_15520 1686 1084 gene locus_tag LOCUS_15530 1686 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2507 1758 gene locus_tag LOCUS_15540 2507 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2883 3368 gene locus_tag LOCUS_15550 2883 3368 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003953493.1 protein_id gnl|my_center|LOCUS_15550 3443 3739 gene locus_tag LOCUS_15560 3443 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 <4356 3764 gene locus_tag LOCUS_15570 <4356 3764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804551.1:2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase >Feature sequence251 310 2397 gene locus_tag LOCUS_15580 310 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3355 2402 gene locus_tag LOCUS_15590 3355 2402 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805026.1 protein_id gnl|my_center|LOCUS_15590 4059 3352 gene locus_tag LOCUS_15600 4059 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence252 <1 1388 gene locus_tag LOCUS_15610 <1 1388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729556.1:NAD(P) transhydrogenase subunit alpha 1392 2816 gene locus_tag LOCUS_15620 gene pntB 1392 2816 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNN7 protein_id gnl|my_center|LOCUS_15620 2813 3478 gene locus_tag LOCUS_15630 2813 3478 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 protein_id gnl|my_center|LOCUS_15630 <4331 3507 gene locus_tag LOCUS_15640 <4331 3507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001701102.1:putative hydrolase, alpha/beta fold protein >Feature sequence253 855 538 gene locus_tag LOCUS_15650 855 538 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7M9Y6 protein_id gnl|my_center|LOCUS_15650 1379 852 gene locus_tag LOCUS_15660 1379 852 CDS product OHCU decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097235.1 protein_id gnl|my_center|LOCUS_15660 3114 1606 gene locus_tag LOCUS_15670 3114 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4205 3111 gene locus_tag LOCUS_15680 4205 3111 CDS product acetamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730485.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence254 2057 807 gene locus_tag LOCUS_15690 2057 807 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0L5 protein_id gnl|my_center|LOCUS_15690 2182 2255 gene locus_tag LOCUS_t00310 2182 2255 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2371 2595 gene locus_tag LOCUS_15700 2371 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2672 3472 gene locus_tag LOCUS_15710 gene nusG 2672 3472 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P36266 protein_id gnl|my_center|LOCUS_15710 3553 3987 gene locus_tag LOCUS_15720 gene rplK 3553 3987 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A463 protein_id gnl|my_center|LOCUS_15720 >Feature sequence255 1685 333 gene locus_tag LOCUS_15730 1685 333 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 protein_id gnl|my_center|LOCUS_15730 2331 1831 gene locus_tag LOCUS_15740 2331 1831 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027260.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence256 267 1091 gene locus_tag LOCUS_15750 267 1091 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223943.1 protein_id gnl|my_center|LOCUS_15750 1127 1951 gene locus_tag LOCUS_15760 gene thyA 1127 1951 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG32 protein_id gnl|my_center|LOCUS_15760 1971 2468 gene locus_tag LOCUS_15770 gene folA 1971 2468 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_15770 3216 2545 gene locus_tag LOCUS_15780 3216 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 3527 3204 gene locus_tag LOCUS_15790 3527 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 <4315 3666 gene locus_tag LOCUS_15800 <4315 3666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816358.1:murein peptide amidase A >Feature sequence257 620 192 gene locus_tag LOCUS_15810 620 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 951 649 gene locus_tag LOCUS_15820 951 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2215 941 gene locus_tag LOCUS_15830 2215 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15830 2838 2212 gene locus_tag LOCUS_15840 2838 2212 CDS product ferric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227735.1 protein_id gnl|my_center|LOCUS_15840 3932 2835 gene locus_tag LOCUS_15850 gene apbE 3932 2835 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DC90 protein_id gnl|my_center|LOCUS_15850 >Feature sequence258 <1 1065 gene locus_tag LOCUS_15860 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228398.1:membrane protein 1071 1433 gene locus_tag LOCUS_15870 1071 1433 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028414.1 protein_id gnl|my_center|LOCUS_15870 1441 2232 gene locus_tag LOCUS_15880 1441 2232 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974569.1 protein_id gnl|my_center|LOCUS_15880 2229 3158 gene locus_tag LOCUS_15890 gene era 2229 3158 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDF2 protein_id gnl|my_center|LOCUS_15890 3844 3182 gene locus_tag LOCUS_15900 3844 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence259 1243 284 gene locus_tag LOCUS_15910 1243 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1437 2729 gene locus_tag LOCUS_15920 gene purA 1437 2729 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8P6 protein_id gnl|my_center|LOCUS_15920 2737 3987 gene locus_tag LOCUS_15930 gene purD 2737 3987 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKL4 protein_id gnl|my_center|LOCUS_15930 >Feature sequence260 3602 1137 gene locus_tag LOCUS_15940 3602 1137 CDS product kojibiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804565.1 protein_id gnl|my_center|LOCUS_15940 <4252 3599 gene locus_tag LOCUS_15950 <4252 3599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804566.1:haloacid dehalogenase >Feature sequence261 225 1154 gene locus_tag LOCUS_15960 225 1154 CDS product MoxR-like ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223759.1 protein_id gnl|my_center|LOCUS_15960 1151 2305 gene locus_tag LOCUS_15970 1151 2305 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223761.1 protein_id gnl|my_center|LOCUS_15970 2298 3446 gene locus_tag LOCUS_15980 2298 3446 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727161.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence262 2187 217 gene locus_tag LOCUS_15990 2187 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2476 2643 gene locus_tag LOCUS_16000 2476 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence263 <1 912 gene locus_tag LOCUS_16010 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:nuclease note possible pseudo, internal stop codon 1087 1287 gene locus_tag LOCUS_16020 1087 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2830 1322 gene locus_tag LOCUS_16030 2830 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 <4245 2864 gene locus_tag LOCUS_16040 <4245 2864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027760.1:acetoacetate-CoA ligase >Feature sequence264 158 745 gene locus_tag LOCUS_16050 158 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 906 1667 gene locus_tag LOCUS_16060 906 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1695 2750 gene locus_tag LOCUS_16070 1695 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_16070 2747 2998 gene locus_tag LOCUS_16080 2747 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 <4237 3005 gene locus_tag LOCUS_16090 <4237 3005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206873.1:acyl-CoA dehydrogenase >Feature sequence265 1532 684 gene locus_tag LOCUS_16100 1532 684 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DCK1 protein_id gnl|my_center|LOCUS_16100 2467 1532 gene locus_tag LOCUS_16110 2467 1532 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228484.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence266 1778 42 gene locus_tag LOCUS_16120 gene phaC1 1778 42 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 protein_id gnl|my_center|LOCUS_16120 3286 1775 gene locus_tag LOCUS_16130 gene fadD 3286 1775 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_16130 3788 3399 gene locus_tag LOCUS_16140 3788 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence267 1242 175 gene locus_tag LOCUS_16150 1242 175 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 protein_id gnl|my_center|LOCUS_16150 1371 2213 gene locus_tag LOCUS_16160 gene cheR1 1371 2213 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XC4 protein_id gnl|my_center|LOCUS_16160 2213 2605 gene locus_tag LOCUS_16170 gene cheY 2213 2605 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71403 protein_id gnl|my_center|LOCUS_16170 2602 3132 gene locus_tag LOCUS_16180 2602 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 3142 3507 gene locus_tag LOCUS_16190 gene cheY-3 3142 3507 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_16190 3520 4035 gene locus_tag LOCUS_16200 3520 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence268 709 281 gene locus_tag LOCUS_16210 709 281 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_16210 1745 867 gene locus_tag LOCUS_16220 gene hisN 1745 867 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4B1 protein_id gnl|my_center|LOCUS_16220 2787 1771 gene locus_tag LOCUS_16230 gene rsgA 2787 1771 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDV6 protein_id gnl|my_center|LOCUS_16230 4088 2784 gene locus_tag LOCUS_16240 gene aroA1 4088 2784 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4A7 protein_id gnl|my_center|LOCUS_16240 >Feature sequence269 554 1546 gene locus_tag LOCUS_16250 554 1546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976891.1 protein_id gnl|my_center|LOCUS_16250 1543 2307 gene locus_tag LOCUS_16260 1543 2307 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAC7 protein_id gnl|my_center|LOCUS_16260 2312 3241 gene locus_tag LOCUS_16270 2312 3241 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028049.1 protein_id gnl|my_center|LOCUS_16270 3252 3719 gene locus_tag LOCUS_16280 3252 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889092.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence270 1308 139 gene locus_tag LOCUS_16290 1308 139 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031139.1 protein_id gnl|my_center|LOCUS_16290 1389 1685 gene locus_tag LOCUS_16300 1389 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2515 1694 gene locus_tag LOCUS_16310 2515 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2642 3229 gene locus_tag LOCUS_16320 2642 3229 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222261.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence271 2025 913 gene locus_tag LOCUS_16330 2025 913 CDS product stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727980.1 protein_id gnl|my_center|LOCUS_16330 2108 2527 gene locus_tag LOCUS_16340 2108 2527 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972860.1 protein_id gnl|my_center|LOCUS_16340 3343 2552 gene locus_tag LOCUS_16350 3343 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972879.1 protein_id gnl|my_center|LOCUS_16350 <4135 3331 gene locus_tag LOCUS_16360 <4135 3331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224513.1:protoporphyrinogen oxidase >Feature sequence272 208 2223 gene locus_tag LOCUS_16370 208 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 3265 2237 gene locus_tag LOCUS_16380 gene pfk 3265 2237 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D256 protein_id gnl|my_center|LOCUS_16380 3907 3398 gene locus_tag LOCUS_16390 3907 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence273 386 799 gene locus_tag LOCUS_16400 386 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1537 812 gene locus_tag LOCUS_16410 1537 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 2388 1537 gene locus_tag LOCUS_16420 2388 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2732 2385 gene locus_tag LOCUS_16430 2732 2385 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596149.1 protein_id gnl|my_center|LOCUS_16430 2839 3909 gene locus_tag LOCUS_16440 2839 3909 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972287.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence274 1774 134 gene locus_tag LOCUS_16450 1774 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2399 1863 gene locus_tag LOCUS_16460 2399 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2603 2403 gene locus_tag LOCUS_16470 2603 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3715 2765 gene locus_tag LOCUS_16480 3715 2765 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030222.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence275 1420 152 gene locus_tag LOCUS_16490 1420 152 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229287.1 protein_id gnl|my_center|LOCUS_16490 1507 2241 gene locus_tag LOCUS_16500 1507 2241 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229286.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence276 1571 150 gene locus_tag LOCUS_16510 1571 150 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8U7 protein_id gnl|my_center|LOCUS_16510 2179 2784 gene locus_tag LOCUS_16520 2179 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2927 3970 gene locus_tag LOCUS_16530 2927 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence277 1985 630 gene locus_tag LOCUS_16540 1985 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 2809 2210 gene locus_tag LOCUS_16550 gene wrbA 2809 2210 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728300.1 protein_id gnl|my_center|LOCUS_16550 3911 2940 gene locus_tag LOCUS_16560 3911 2940 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026842.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence278 <1 919 gene locus_tag LOCUS_16570 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028213.1:alpha-glucosidase 1450 983 gene locus_tag LOCUS_16580 1450 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2228 1515 gene locus_tag LOCUS_16590 2228 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3083 2382 gene locus_tag LOCUS_16600 gene pdxH 3083 2382 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M91 protein_id gnl|my_center|LOCUS_16600 >Feature sequence279 1393 827 gene locus_tag LOCUS_16610 1393 827 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229904.1 protein_id gnl|my_center|LOCUS_16610 1533 1895 gene locus_tag LOCUS_16620 1533 1895 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_16620 1880 3115 gene locus_tag LOCUS_16630 1880 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence280 894 589 gene locus_tag LOCUS_16640 894 589 CDS product putative molybdenum cofactor biosynthesis protein D2 / thiamineS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701618.1 protein_id gnl|my_center|LOCUS_16640 960 1670 gene locus_tag LOCUS_16650 gene glnR 960 1670 CDS product transcriptional regulatory protein GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q05943 protein_id gnl|my_center|LOCUS_16650 1672 2622 gene locus_tag LOCUS_16660 gene mshD 1672 2622 CDS product mycothiol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MI19 protein_id gnl|my_center|LOCUS_16660 2782 3003 gene locus_tag LOCUS_16670 2782 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3162 3407 gene locus_tag LOCUS_16680 3162 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3498 3707 gene locus_tag LOCUS_16690 3498 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence281 1299 607 gene locus_tag LOCUS_16700 1299 607 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229457.1 protein_id gnl|my_center|LOCUS_16700 2495 1314 gene locus_tag LOCUS_16710 2495 1314 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_16710 <4004 2540 gene locus_tag LOCUS_16720 <4004 2540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028453.1:penicillin-binding protein 2 note possible pseudo, frameshifted >Feature sequence282 >Feature sequence283 989 372 gene locus_tag LOCUS_16730 989 372 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903560.1 protein_id gnl|my_center|LOCUS_16730 1199 1372 gene locus_tag LOCUS_16740 1199 1372 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 protein_id gnl|my_center|LOCUS_16740 2851 1463 gene locus_tag LOCUS_16750 2851 1463 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225213.1 protein_id gnl|my_center|LOCUS_16750 2886 3389 gene locus_tag LOCUS_16760 2886 3389 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888981.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence284 395 1288 gene locus_tag LOCUS_16770 395 1288 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_16770 1412 2491 gene locus_tag LOCUS_16780 1412 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3469 2600 gene locus_tag LOCUS_16790 3469 2600 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_16790 3978 3814 gene locus_tag LOCUS_16800 3978 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence285 1142 471 gene locus_tag LOCUS_16810 gene tdk 1142 471 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50519 protein_id gnl|my_center|LOCUS_16810 2291 1143 gene locus_tag LOCUS_16820 2291 1143 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_16820 2893 2294 gene locus_tag LOCUS_16830 2893 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030492.1 protein_id gnl|my_center|LOCUS_16830 <3971 2963 gene locus_tag LOCUS_16840 <3971 2963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224292.1:GNAT family N-acetyltransferase >Feature sequence286 1624 353 gene locus_tag LOCUS_16850 1624 353 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029975.1 protein_id gnl|my_center|LOCUS_16850 3021 1624 gene locus_tag LOCUS_16860 3021 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 3091 3738 gene locus_tag LOCUS_16870 gene msrA 3091 3738 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_16870 >Feature sequence287 1280 519 gene locus_tag LOCUS_16880 1280 519 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975843.1 protein_id gnl|my_center|LOCUS_16880 1375 2073 gene locus_tag LOCUS_16890 1375 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3181 2075 gene locus_tag LOCUS_16900 gene prfB 3181 2075 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QU58 protein_id gnl|my_center|LOCUS_16900 >Feature sequence288 372 1094 gene locus_tag LOCUS_16910 372 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1088 2119 gene locus_tag LOCUS_16920 1088 2119 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920837.1 protein_id gnl|my_center|LOCUS_16920 2188 3051 gene locus_tag LOCUS_16930 2188 3051 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971787.1 protein_id gnl|my_center|LOCUS_16930 <3937 3080 gene locus_tag LOCUS_16940 <3937 3080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224038.1:MFS transporter >Feature sequence289 <1 2061 gene locus_tag LOCUS_16950 <1 2061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NDM3:histidine kinase 3166 2096 gene locus_tag LOCUS_16960 3166 2096 CDS product putative hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703649.1 protein_id gnl|my_center|LOCUS_16960 3183 3617 gene locus_tag LOCUS_16970 3183 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence290 788 321 gene locus_tag LOCUS_16980 788 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 931 1125 gene locus_tag LOCUS_16990 931 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1125 2576 gene locus_tag LOCUS_17000 1125 2576 CDS product tetracycline resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902466.1 protein_id gnl|my_center|LOCUS_17000 2815 3855 gene locus_tag LOCUS_17010 gene recA 2815 3855 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9REV6 protein_id gnl|my_center|LOCUS_17010 >Feature sequence291 1785 1144 gene locus_tag LOCUS_17020 1785 1144 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403648.1 protein_id gnl|my_center|LOCUS_17020 1861 2877 gene locus_tag LOCUS_17030 1861 2877 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731571.1 protein_id gnl|my_center|LOCUS_17030 2969 3412 gene locus_tag LOCUS_17040 gene osmC 2969 3412 CDS product osmotically inducible protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224811.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence292 2208 970 gene locus_tag LOCUS_17050 2208 970 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228019.1 protein_id gnl|my_center|LOCUS_17050 3259 2288 gene locus_tag LOCUS_17060 3259 2288 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258943.1 protein_id gnl|my_center|LOCUS_17060 3495 3304 gene locus_tag LOCUS_17070 3495 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence293 994 2448 gene locus_tag LOCUS_17080 gene glyA 994 2448 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R2V7 protein_id gnl|my_center|LOCUS_17080 3767 2472 gene locus_tag LOCUS_17090 3767 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence294 328 1077 gene locus_tag LOCUS_17100 gene lexA 328 1077 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVY5 protein_id gnl|my_center|LOCUS_17100 1215 2927 gene locus_tag LOCUS_17110 1215 2927 CDS product phosphodiesterase/alkaline phosphatase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601465.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence295 2207 1515 gene locus_tag LOCUS_17120 2207 1515 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976201.1 protein_id gnl|my_center|LOCUS_17120 2295 3563 gene locus_tag LOCUS_17130 2295 3563 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977011.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence296 87 410 gene locus_tag LOCUS_17140 87 410 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MER2 protein_id gnl|my_center|LOCUS_17140 627 2390 gene locus_tag LOCUS_17150 gene ilvB 627 2390 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D1V7 protein_id gnl|my_center|LOCUS_17150 2431 3060 gene locus_tag LOCUS_17160 gene ilvH 2431 3060 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973483.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence297 1082 684 gene locus_tag LOCUS_17170 1082 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17170 2547 1243 gene locus_tag LOCUS_17180 gene gltA 2547 1243 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBF3 protein_id gnl|my_center|LOCUS_17180 2963 3406 gene locus_tag LOCUS_17190 gene rplM 2963 3406 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZ33 protein_id gnl|my_center|LOCUS_17190 >Feature sequence298 2055 526 gene locus_tag LOCUS_17200 2055 526 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229396.1 protein_id gnl|my_center|LOCUS_17200 2249 2536 gene locus_tag LOCUS_17210 2249 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 2614 2540 gene locus_tag LOCUS_t00320 2614 2540 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3091 2630 gene locus_tag LOCUS_17220 3091 2630 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_17220 <3859 3124 gene locus_tag LOCUS_17230 <3859 3124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899884.1:acyl-CoA synthetase >Feature sequence299 987 1661 gene locus_tag LOCUS_17240 987 1661 CDS product dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028987.1 protein_id gnl|my_center|LOCUS_17240 1679 2962 gene locus_tag LOCUS_17250 1679 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601707.1 protein_id gnl|my_center|LOCUS_17250 2959 3255 gene locus_tag LOCUS_17260 2959 3255 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888479.1 protein_id gnl|my_center|LOCUS_17260 3765 3262 gene locus_tag LOCUS_17270 3765 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence300 <1 529 gene locus_tag LOCUS_17280 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703092.1:HAD-superfamily hydrolase 638 934 gene locus_tag LOCUS_17290 638 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 938 1795 gene locus_tag LOCUS_17300 938 1795 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027974.1 protein_id gnl|my_center|LOCUS_17300 1792 2781 gene locus_tag LOCUS_17310 gene nadK2 1792 2781 CDS product NAD kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S219 protein_id gnl|my_center|LOCUS_17310 >Feature sequence301 726 319 gene locus_tag LOCUS_17320 726 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1762 818 gene locus_tag LOCUS_17330 1762 818 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775931.1 protein_id gnl|my_center|LOCUS_17330 1820 2704 gene locus_tag LOCUS_17340 1820 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3302 2712 gene locus_tag LOCUS_17350 3302 2712 CDS product deaminase reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031391.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence302 1253 2767 gene locus_tag LOCUS_17360 gene zwf 1253 2767 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QP90 protein_id gnl|my_center|LOCUS_17360 >Feature sequence303 <1 2418 gene locus_tag LOCUS_17370 <1 2418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702252.1:putative fatty acid synthase Fas 2415 2885 gene locus_tag LOCUS_17380 gene acpS 2415 2885 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4W9 protein_id gnl|my_center|LOCUS_17380 >Feature sequence304 1222 266 gene locus_tag LOCUS_17390 1222 266 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230883.1 protein_id gnl|my_center|LOCUS_17390 2757 1219 gene locus_tag LOCUS_17400 2757 1219 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972517.1 protein_id gnl|my_center|LOCUS_17400 2866 3738 gene locus_tag LOCUS_17410 2866 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence305 2025 3317 gene locus_tag LOCUS_17420 2025 3317 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227759.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence306 2986 3690 gene locus_tag LOCUS_17430 2986 3690 CDS product transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1L0 protein_id gnl|my_center|LOCUS_17430 >Feature sequence307 1368 742 gene locus_tag LOCUS_17440 1368 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224727.1 protein_id gnl|my_center|LOCUS_17440 1790 1377 gene locus_tag LOCUS_17450 1790 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2300 1854 gene locus_tag LOCUS_17460 2300 1854 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407491.1 protein_id gnl|my_center|LOCUS_17460 3607 2306 gene locus_tag LOCUS_17470 gene csd 3607 2306 CDS product putative cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAD5 protein_id gnl|my_center|LOCUS_17470 >Feature sequence308 <1 562 gene locus_tag LOCUS_17480 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030230.1:methylmalonyl-CoA mutase 1433 591 gene locus_tag LOCUS_17490 1433 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728926.1 protein_id gnl|my_center|LOCUS_17490 1646 3274 gene locus_tag LOCUS_17500 1646 3274 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence309 2582 129 gene locus_tag LOCUS_17510 gene uvrA 2582 129 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731547.1 protein_id gnl|my_center|LOCUS_17510 3400 2711 gene locus_tag LOCUS_17520 3400 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence310 571 912 gene locus_tag LOCUS_17530 571 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1240 1037 gene locus_tag LOCUS_17540 1240 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1239 2534 gene locus_tag LOCUS_17550 gene hemA 1239 2534 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYF0 protein_id gnl|my_center|LOCUS_17550 2531 3517 gene locus_tag LOCUS_17560 gene hemC 2531 3517 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QR18 protein_id gnl|my_center|LOCUS_17560 >Feature sequence311 830 2068 gene locus_tag LOCUS_17570 gene xyoA 830 2068 CDS product putative xylitol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBU1 protein_id gnl|my_center|LOCUS_17570 3122 2076 gene locus_tag LOCUS_17580 3122 2076 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDP4 protein_id gnl|my_center|LOCUS_17580 <3739 3167 gene locus_tag LOCUS_17590 <3739 3167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027107.1:TetR family transcriptional regulator >Feature sequence312 1057 209 gene locus_tag LOCUS_17600 gene rsmA 1057 209 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K3R5 protein_id gnl|my_center|LOCUS_17600 2350 1142 gene locus_tag LOCUS_17610 2350 1142 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229978.1 protein_id gnl|my_center|LOCUS_17610 3584 2703 gene locus_tag LOCUS_17620 3584 2703 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028796.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence313 378 983 gene locus_tag LOCUS_17630 378 983 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226000.1 protein_id gnl|my_center|LOCUS_17630 1008 3524 gene locus_tag LOCUS_17640 gene hrpB 1008 3524 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223186.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence314 919 3033 gene locus_tag LOCUS_17650 919 3033 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAC1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence315 591 2114 gene locus_tag LOCUS_17660 591 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2125 2769 gene locus_tag LOCUS_17670 gene pdxT 2125 2769 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L287 protein_id gnl|my_center|LOCUS_17670 2842 3606 gene locus_tag LOCUS_17680 2842 3606 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L288 protein_id gnl|my_center|LOCUS_17680 >Feature sequence316 232 645 gene locus_tag LOCUS_17690 232 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 688 2205 gene locus_tag LOCUS_17700 688 2205 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028162.1 protein_id gnl|my_center|LOCUS_17700 2322 2876 gene locus_tag LOCUS_17710 2322 2876 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140026.1 protein_id gnl|my_center|LOCUS_17710 3334 2951 gene locus_tag LOCUS_17720 3334 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence317 2013 364 gene locus_tag LOCUS_17730 2013 364 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028715.1 protein_id gnl|my_center|LOCUS_17730 2730 2017 gene locus_tag LOCUS_17740 2730 2017 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975799.1 protein_id gnl|my_center|LOCUS_17740 <3677 2886 gene locus_tag LOCUS_17750 <3677 2886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KZM1:adenosylhomocysteinase >Feature sequence318 1215 457 gene locus_tag LOCUS_17760 gene rph 1215 457 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2H7 protein_id gnl|my_center|LOCUS_17760 1772 1263 gene locus_tag LOCUS_17770 1772 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702153.1 protein_id gnl|my_center|LOCUS_17770 1818 3518 gene locus_tag LOCUS_17780 1818 3518 CDS product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971843.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence319 <1 903 gene locus_tag LOCUS_17790 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QS18:peptide chain release factor 3 905 1519 gene locus_tag LOCUS_17800 905 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1626 2297 gene locus_tag LOCUS_17810 1626 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3207 2332 gene locus_tag LOCUS_17820 3207 2332 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819430.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence320 468 1004 gene locus_tag LOCUS_17830 468 1004 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973553.1 protein_id gnl|my_center|LOCUS_17830 2148 1009 gene locus_tag LOCUS_17840 2148 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 3152 2166 gene locus_tag LOCUS_17850 3152 2166 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z530 protein_id gnl|my_center|LOCUS_17850 >Feature sequence321 198 2024 gene locus_tag LOCUS_17860 gene metG 198 2024 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDC0 protein_id gnl|my_center|LOCUS_17860 2021 2599 gene locus_tag LOCUS_17870 2021 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2634 3524 gene locus_tag LOCUS_17880 2634 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence322 853 305 gene locus_tag LOCUS_17890 853 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331451.1 protein_id gnl|my_center|LOCUS_17890 1818 1021 gene locus_tag LOCUS_17900 1818 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_17900 3248 1872 gene locus_tag LOCUS_17910 3248 1872 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706123.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence323 929 54 gene locus_tag LOCUS_17920 gene omt 929 54 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_17920 2212 926 gene locus_tag LOCUS_17930 2212 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2895 2209 gene locus_tag LOCUS_17940 gene cbbY 2895 2209 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089577.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence324 478 1392 gene locus_tag LOCUS_17950 478 1392 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030775.1 protein_id gnl|my_center|LOCUS_17950 1931 1407 gene locus_tag LOCUS_17960 1931 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976691.1 protein_id gnl|my_center|LOCUS_17960 2743 1928 gene locus_tag LOCUS_17970 2743 1928 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_17970 2851 3585 gene locus_tag LOCUS_17980 2851 3585 CDS product putative 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702720.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence325 64 1146 gene locus_tag LOCUS_17990 64 1146 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599899.1 protein_id gnl|my_center|LOCUS_17990 1143 2015 gene locus_tag LOCUS_18000 1143 2015 CDS product iron-dicitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 protein_id gnl|my_center|LOCUS_18000 2188 1994 gene locus_tag LOCUS_18010 2188 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 2526 2245 gene locus_tag LOCUS_18020 2526 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2717 3262 gene locus_tag LOCUS_18030 2717 3262 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015486.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence326 <1 1447 gene locus_tag LOCUS_18040 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027655.1:cation acetate symporter 1860 1423 gene locus_tag LOCUS_18050 1860 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 2214 2519 gene locus_tag LOCUS_18060 2214 2519 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence327 1245 2432 gene locus_tag LOCUS_18070 1245 2432 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 protein_id gnl|my_center|LOCUS_18070 1941 1861 gene locus_tag LOCUS_t00330 1941 1861 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence328 244 711 gene locus_tag LOCUS_18080 244 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1381 734 gene locus_tag LOCUS_18090 1381 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3097 1499 gene locus_tag LOCUS_18100 3097 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence329 143 436 gene locus_tag LOCUS_18110 143 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225328.1 protein_id gnl|my_center|LOCUS_18110 1200 532 gene locus_tag LOCUS_18120 1200 532 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222823.1 protein_id gnl|my_center|LOCUS_18120 1242 1880 gene locus_tag LOCUS_18130 1242 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1942 3372 gene locus_tag LOCUS_18140 1942 3372 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407382.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence330 <1 573 gene locus_tag LOCUS_18150 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MDN8:ketol-acid reductoisomerase (NADP(+)) 647 1468 gene locus_tag LOCUS_18160 647 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404373.1 protein_id gnl|my_center|LOCUS_18160 1563 1946 gene locus_tag LOCUS_18170 1563 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1933 2871 gene locus_tag LOCUS_18180 gene serA 1933 2871 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223578.1 protein_id gnl|my_center|LOCUS_18180 <3483 2945 gene locus_tag LOCUS_18190 <3483 2945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DKK9:aldehyde dehydrogenase >Feature sequence331 1098 820 gene locus_tag LOCUS_18200 1098 820 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004559268.1 protein_id gnl|my_center|LOCUS_18200 1581 1162 gene locus_tag LOCUS_18210 1581 1162 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229460.1 protein_id gnl|my_center|LOCUS_18210 1669 2109 gene locus_tag LOCUS_18220 gene elaA 1669 2109 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223944.1 protein_id gnl|my_center|LOCUS_18220 2859 2269 gene locus_tag LOCUS_18230 2859 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975896.1 protein_id gnl|my_center|LOCUS_18230 3185 2856 gene locus_tag LOCUS_18240 3185 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence332 377 658 gene locus_tag LOCUS_18250 377 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1321 671 gene locus_tag LOCUS_18260 1321 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1474 2280 gene locus_tag LOCUS_18270 1474 2280 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228778.1 protein_id gnl|my_center|LOCUS_18270 2285 2656 gene locus_tag LOCUS_18280 2285 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230234.1 protein_id gnl|my_center|LOCUS_18280 <3467 2643 gene locus_tag LOCUS_18290 <3467 2643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117973.1:RNA polymerase subunit sigma-24 >Feature sequence333 <1 2349 gene locus_tag LOCUS_18300 <1 2349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001703592.1:transglutaminase family protein >Feature sequence334 185 2902 gene locus_tag LOCUS_18310 185 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2991 3440 gene locus_tag LOCUS_18320 2991 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence335 116 409 gene locus_tag LOCUS_18330 116 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 460 822 gene locus_tag LOCUS_18340 gene rnpA 460 822 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48206 protein_id gnl|my_center|LOCUS_18340 819 1130 gene locus_tag LOCUS_18350 819 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1146 2213 gene locus_tag LOCUS_18360 1146 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2210 2716 gene locus_tag LOCUS_18370 2210 2716 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029290.1 protein_id gnl|my_center|LOCUS_18370 2777 3379 gene locus_tag LOCUS_18380 gene rsmG 2777 3379 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBJ9 protein_id gnl|my_center|LOCUS_18380 >Feature sequence336 453 2150 gene locus_tag LOCUS_18390 453 2150 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728275.1 protein_id gnl|my_center|LOCUS_18390 3336 2179 gene locus_tag LOCUS_18400 3336 2179 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230139.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence337 1930 1439 gene locus_tag LOCUS_18410 1930 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2048 2845 gene locus_tag LOCUS_18420 2048 2845 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776089.1 protein_id gnl|my_center|LOCUS_18420 3316 2879 gene locus_tag LOCUS_18430 3316 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence338 1576 242 gene locus_tag LOCUS_18440 1576 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3227 1677 gene locus_tag LOCUS_18450 gene mviN 3227 1677 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183L8 protein_id gnl|my_center|LOCUS_18450 >Feature sequence339 369 2360 gene locus_tag LOCUS_18460 369 2360 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705259.1 protein_id gnl|my_center|LOCUS_18460 2456 3148 gene locus_tag LOCUS_18470 2456 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence340 <1 502 gene locus_tag LOCUS_18480 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QV27:ammonium transporter 499 837 gene locus_tag LOCUS_18490 gene glnB 499 837 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814240.1 protein_id gnl|my_center|LOCUS_18490 1024 2376 gene locus_tag LOCUS_18500 1024 2376 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDJ7 protein_id gnl|my_center|LOCUS_18500 2486 2824 gene locus_tag LOCUS_18510 2486 2824 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence341 1472 399 gene locus_tag LOCUS_18520 1472 399 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085669.1 protein_id gnl|my_center|LOCUS_18520 1792 1472 gene locus_tag LOCUS_18530 1792 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1915 2700 gene locus_tag LOCUS_18540 gene adc 1915 2700 CDS product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228151.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence342 1384 2295 gene locus_tag LOCUS_18550 1384 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence343 715 566 gene locus_tag LOCUS_18560 715 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 662 1201 gene locus_tag LOCUS_18570 662 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 1866 1357 gene locus_tag LOCUS_18580 1866 1357 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_18580 2065 2661 gene locus_tag LOCUS_18590 2065 2661 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730499.1 protein_id gnl|my_center|LOCUS_18590 <3415 2684 gene locus_tag LOCUS_18600 <3415 2684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121958.1:oxidoreductase >Feature sequence344 856 164 gene locus_tag LOCUS_18610 856 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2516 903 gene locus_tag LOCUS_18620 2516 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3206 2535 gene locus_tag LOCUS_18630 3206 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence345 <1 781 gene locus_tag LOCUS_18640 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011976080.1:ABC transporter permease 778 1572 gene locus_tag LOCUS_18650 778 1572 CDS product ABC transporter membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028995.1 protein_id gnl|my_center|LOCUS_18650 1569 2642 gene locus_tag LOCUS_18660 1569 2642 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028994.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence346 166 1122 gene locus_tag LOCUS_18670 166 1122 CDS product uricase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D076 protein_id gnl|my_center|LOCUS_18670 1124 2542 gene locus_tag LOCUS_18680 gene allB 1124 2542 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKU5 protein_id gnl|my_center|LOCUS_18680 >Feature sequence347 485 392 gene locus_tag LOCUS_t00340 485 392 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 980 513 gene locus_tag LOCUS_18690 980 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1136 1050 gene locus_tag LOCUS_t00350 1136 1050 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2004 1204 gene locus_tag LOCUS_18700 2004 1204 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_18700 2047 2697 gene locus_tag LOCUS_18710 2047 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2743 2949 gene locus_tag LOCUS_18720 2743 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence348 845 465 gene locus_tag LOCUS_18730 gene trxC 845 465 CDS product putative thioredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RD25 protein_id gnl|my_center|LOCUS_18730 2257 1091 gene locus_tag LOCUS_18740 2257 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2354 3190 gene locus_tag LOCUS_18750 2354 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence349 <1 850 gene locus_tag LOCUS_18760 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R145:NAD-dependent protein deacetylase 1558 866 gene locus_tag LOCUS_18770 1558 866 CDS product DtxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974588.1 protein_id gnl|my_center|LOCUS_18770 1536 2930 gene locus_tag LOCUS_18780 gene phrB 1536 2930 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230152.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence350 764 15 gene locus_tag LOCUS_18790 764 15 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029272.1 protein_id gnl|my_center|LOCUS_18790 929 1372 gene locus_tag LOCUS_18800 929 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2460 1501 gene locus_tag LOCUS_18810 2460 1501 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975079.1 protein_id gnl|my_center|LOCUS_18810 3007 2480 gene locus_tag LOCUS_18820 gene ppiA 3007 2480 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNF6 protein_id gnl|my_center|LOCUS_18820 >Feature sequence351 1013 1462 gene locus_tag LOCUS_18830 1013 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2568 1492 gene locus_tag LOCUS_18840 2568 1492 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_18840 <3349 2834 gene locus_tag LOCUS_18850 <3349 2834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899864.1:enoyl-CoA hydratase >Feature sequence352 1237 197 gene locus_tag LOCUS_18860 gene asd 1237 197 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DK59 protein_id gnl|my_center|LOCUS_18860 2511 1234 gene locus_tag LOCUS_18870 2511 1234 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI7 protein_id gnl|my_center|LOCUS_18870 3227 2631 gene locus_tag LOCUS_18880 gene recR 3227 2631 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAI4 protein_id gnl|my_center|LOCUS_18880 >Feature sequence353 1703 654 gene locus_tag LOCUS_18890 1703 654 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973600.1 protein_id gnl|my_center|LOCUS_18890 3215 1878 gene locus_tag LOCUS_18900 3215 1878 CDS product crotonyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972505.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence354 <1 586 gene locus_tag LOCUS_18910 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MFR8:glutamate--cysteine ligase EgtA 579 1919 gene locus_tag LOCUS_18920 gene egtB 579 1919 CDS product hercynine oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5N0 protein_id gnl|my_center|LOCUS_18920 1912 2649 gene locus_tag LOCUS_18930 gene egtC 1912 2649 CDS product gamma-glutamyl-hercynylcysteine sulfoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5M9 protein_id gnl|my_center|LOCUS_18930 >Feature sequence355 2140 740 gene locus_tag LOCUS_18940 2140 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227755.1 protein_id gnl|my_center|LOCUS_18940 2212 2763 gene locus_tag LOCUS_18950 2212 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 <3336 2717 gene locus_tag LOCUS_18960 <3336 2717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730070.1:MFS transporter >Feature sequence356 3 1490 gene locus_tag LOCUS_18970 3 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2767 1541 gene locus_tag LOCUS_18980 2767 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence357 1008 115 gene locus_tag LOCUS_18990 1008 115 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229183.1 protein_id gnl|my_center|LOCUS_18990 1036 1410 gene locus_tag LOCUS_19000 1036 1410 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223630.1 protein_id gnl|my_center|LOCUS_19000 1546 3207 gene locus_tag LOCUS_19010 1546 3207 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726949.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence358 <3294 2554 gene locus_tag LOCUS_19020 <3294 2554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223027.1:FAD/NAD(P)-binding oxidoreductase >Feature sequence359 2049 535 gene locus_tag LOCUS_19030 gene purF 2049 535 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7AKK3 protein_id gnl|my_center|LOCUS_19030 >Feature sequence360 >Feature sequence361 1128 466 gene locus_tag LOCUS_19040 1128 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 1816 1148 gene locus_tag LOCUS_19050 1816 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 <3258 1822 gene locus_tag LOCUS_19060 <3258 1822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9F2P1:transcription-repair-coupling factor >Feature sequence362 1270 761 gene locus_tag LOCUS_19070 1270 761 CDS product mini-circle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228370.1 protein_id gnl|my_center|LOCUS_19070 2037 1267 gene locus_tag LOCUS_19080 2037 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2697 2065 gene locus_tag LOCUS_19090 2697 2065 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228798.1 protein_id gnl|my_center|LOCUS_19090 <3245 2702 gene locus_tag LOCUS_19100 <3245 2702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MCT3:UPF0721 transmembrane protein >Feature sequence363 322 161 gene locus_tag LOCUS_19110 322 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2276 417 gene locus_tag LOCUS_19120 2276 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence364 1543 2301 gene locus_tag LOCUS_19130 1543 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973811.1 protein_id gnl|my_center|LOCUS_19130 2629 2357 gene locus_tag LOCUS_19140 2629 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2884 2672 gene locus_tag LOCUS_19150 2884 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence365 >Feature sequence366 704 261 gene locus_tag LOCUS_19160 gene rplI 704 261 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8U5 protein_id gnl|my_center|LOCUS_19160 958 722 gene locus_tag LOCUS_19170 gene rpsR1 958 722 CDS product 30S ribosomal protein S18 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66470 protein_id gnl|my_center|LOCUS_19170 1641 1039 gene locus_tag LOCUS_19180 1641 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2025 1735 gene locus_tag LOCUS_19190 gene rpsF 2025 1735 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WH31 protein_id gnl|my_center|LOCUS_19190 2588 2130 gene locus_tag LOCUS_19200 2588 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 <3209 2585 gene locus_tag LOCUS_19210 <3209 2585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224587.1:TetR family transcriptional regulator >Feature sequence367 >Feature sequence368 1073 369 gene locus_tag LOCUS_19220 1073 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2270 1113 gene locus_tag LOCUS_19230 2270 1113 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704250.1 protein_id gnl|my_center|LOCUS_19230 2711 2274 gene locus_tag LOCUS_19240 2711 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence369 860 366 gene locus_tag LOCUS_19250 860 366 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_19250 2075 927 gene locus_tag LOCUS_19260 2075 927 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence370 1367 534 gene locus_tag LOCUS_19270 1367 534 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027753.1 protein_id gnl|my_center|LOCUS_19270 2017 1364 gene locus_tag LOCUS_19280 gene dddL 2017 1364 CDS product putative dimethlysulfonioproprionate lyase DddL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6L0 protein_id gnl|my_center|LOCUS_19280 3057 2014 gene locus_tag LOCUS_19290 3057 2014 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028671.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence371 2 1114 gene locus_tag LOCUS_19300 2 1114 CDS product GDP-mannose-dependent alpha-(1-2)-phosphatidylinositol mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_19300 1111 1662 gene locus_tag LOCUS_19310 1111 1662 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027827.1 protein_id gnl|my_center|LOCUS_19310 1753 2637 gene locus_tag LOCUS_19320 gene pdxS 1753 2637 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCK0 protein_id gnl|my_center|LOCUS_19320 3166 2657 gene locus_tag LOCUS_19330 3166 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393553.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence372 <1 622 gene locus_tag LOCUS_19340 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P63776:CinA-like protein 653 1294 gene locus_tag LOCUS_19350 653 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703998.1 protein_id gnl|my_center|LOCUS_19350 1449 2246 gene locus_tag LOCUS_19360 1449 2246 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770966.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence373 <1 904 gene locus_tag LOCUS_19370 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9F2Y1:phosphoserine aminotransferase 1443 901 gene locus_tag LOCUS_19380 1443 901 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776976.1 protein_id gnl|my_center|LOCUS_19380 2483 1443 gene locus_tag LOCUS_19390 gene topA 2483 1443 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226137.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence374 1776 604 gene locus_tag LOCUS_19400 1776 604 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777043.1 protein_id gnl|my_center|LOCUS_19400 2677 1880 gene locus_tag LOCUS_19410 2677 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence375 148 630 gene locus_tag LOCUS_19420 gene recX 148 630 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O50488 protein_id gnl|my_center|LOCUS_19420 715 1155 gene locus_tag LOCUS_19430 715 1155 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229705.1 protein_id gnl|my_center|LOCUS_19430 1219 1995 gene locus_tag LOCUS_19440 1219 1995 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726748.1 protein_id gnl|my_center|LOCUS_19440 1992 2945 gene locus_tag LOCUS_19450 1992 2945 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230821.1 protein_id gnl|my_center|LOCUS_19450 >Feature sequence376 780 226 gene locus_tag LOCUS_19460 gene pyrE 780 226 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8R7 protein_id gnl|my_center|LOCUS_19460 1678 878 gene locus_tag LOCUS_19470 1678 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1721 2920 gene locus_tag LOCUS_19480 1721 2920 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029150.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence377 832 341 gene locus_tag LOCUS_19490 gene ppa 832 341 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8I9 protein_id gnl|my_center|LOCUS_19490 962 2527 gene locus_tag LOCUS_19500 962 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence378 1607 831 gene locus_tag LOCUS_19510 1607 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2386 1607 gene locus_tag LOCUS_19520 2386 1607 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528424.1 protein_id gnl|my_center|LOCUS_19520 2956 2420 gene locus_tag LOCUS_19530 2956 2420 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014064.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence379 1022 15 gene locus_tag LOCUS_19540 gene ybjU 1022 15 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404173.1 protein_id gnl|my_center|LOCUS_19540 1820 1062 gene locus_tag LOCUS_19550 1820 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2863 1892 gene locus_tag LOCUS_19560 2863 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence380 88 393 gene locus_tag LOCUS_19570 88 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 1509 406 gene locus_tag LOCUS_19580 1509 406 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730062.1 protein_id gnl|my_center|LOCUS_19580 <3133 1544 gene locus_tag LOCUS_19590 <3133 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CK11:UvrABC system protein B >Feature sequence381 1030 350 gene locus_tag LOCUS_19600 1030 350 CDS product sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029851.1 protein_id gnl|my_center|LOCUS_19600 1085 1564 gene locus_tag LOCUS_19610 1085 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 1554 1868 gene locus_tag LOCUS_19620 1554 1868 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 protein_id gnl|my_center|LOCUS_19620 2787 1876 gene locus_tag LOCUS_19630 2787 1876 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence382 1354 1791 gene locus_tag LOCUS_19640 1354 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 1802 2041 gene locus_tag LOCUS_19650 1802 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2127 2831 gene locus_tag LOCUS_19660 2127 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence383 44 718 gene locus_tag LOCUS_19670 44 718 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029839.1 protein_id gnl|my_center|LOCUS_19670 715 1179 gene locus_tag LOCUS_19680 gene rimI 715 1179 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BF8 protein_id gnl|my_center|LOCUS_19680 1176 2222 gene locus_tag LOCUS_19690 gene tsaD 1176 2222 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86793 protein_id gnl|my_center|LOCUS_19690 2259 2507 gene locus_tag LOCUS_19700 2259 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2649 2846 gene locus_tag LOCUS_19710 2649 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence384 617 21 gene locus_tag LOCUS_19720 617 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1685 645 gene locus_tag LOCUS_19730 1685 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2021 2224 gene locus_tag LOCUS_19740 2021 2224 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974443.1 protein_id gnl|my_center|LOCUS_19740 2407 2652 gene locus_tag LOCUS_19750 2407 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence385 <1 668 gene locus_tag LOCUS_19760 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CYL5:3-methyl-2-oxobutanoate hydroxymethyltransferase 685 1104 gene locus_tag LOCUS_19770 685 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1345 1121 gene locus_tag LOCUS_19780 1345 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1414 2283 gene locus_tag LOCUS_19790 gene map 1414 2283 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKR2 protein_id gnl|my_center|LOCUS_19790 >Feature sequence386 769 122 gene locus_tag LOCUS_19800 gene trkA 769 122 CDS product Trk system potassium uptake protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53949 protein_id gnl|my_center|LOCUS_19800 856 2946 gene locus_tag LOCUS_19810 856 2946 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224484.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence387 417 1271 gene locus_tag LOCUS_19820 417 1271 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776057.1 protein_id gnl|my_center|LOCUS_19820 1268 2173 gene locus_tag LOCUS_19830 1268 2173 CDS product pilus assembly protein TadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776056.1 protein_id gnl|my_center|LOCUS_19830 2197 2409 gene locus_tag LOCUS_19840 2197 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2414 2803 gene locus_tag LOCUS_19850 2414 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence388 1307 456 gene locus_tag LOCUS_19860 gene bacA 1307 456 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D5Y1 protein_id gnl|my_center|LOCUS_19860 1372 2376 gene locus_tag LOCUS_19870 1372 2376 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977155.1 protein_id gnl|my_center|LOCUS_19870 2421 2648 gene locus_tag LOCUS_19880 2421 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence389 2648 1197 gene locus_tag LOCUS_19890 gene lysA 2648 1197 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDU4 protein_id gnl|my_center|LOCUS_19890 >Feature sequence390 1415 693 gene locus_tag LOCUS_19900 1415 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 1557 2030 gene locus_tag LOCUS_19910 1557 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2946 2047 gene locus_tag LOCUS_19920 2946 2047 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence391 <1 1588 gene locus_tag LOCUS_19930 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D0N6:GTPase HflX 2038 1592 gene locus_tag LOCUS_19940 2038 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2490 2080 gene locus_tag LOCUS_19950 2490 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence392 1498 1145 gene locus_tag LOCUS_19960 1498 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2186 1575 gene locus_tag LOCUS_19970 gene gmk 2186 1575 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MCK4 protein_id gnl|my_center|LOCUS_19970 2499 2179 gene locus_tag LOCUS_19980 2499 2179 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977346.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence393 116 42 gene locus_tag LOCUS_t00360 116 42 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 311 1219 gene locus_tag LOCUS_19990 311 1219 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704948.1 protein_id gnl|my_center|LOCUS_19990 1293 2507 gene locus_tag LOCUS_20000 1293 2507 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777090.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence394 1295 636 gene locus_tag LOCUS_20010 1295 636 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226748.1 protein_id gnl|my_center|LOCUS_20010 <3059 1292 gene locus_tag LOCUS_20020 <3059 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729624.1:methionine synthase >Feature sequence395 <1 620 gene locus_tag LOCUS_20030 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MBV2:tryptophan synthase alpha chain 604 1278 gene locus_tag LOCUS_20040 604 1278 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974978.1 protein_id gnl|my_center|LOCUS_20040 1280 1615 gene locus_tag LOCUS_20050 1280 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 1653 2558 gene locus_tag LOCUS_20060 gene lgt1 1653 2558 CDS product prolipoprotein diacylglyceryl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2U8 protein_id gnl|my_center|LOCUS_20060 2570 3019 gene locus_tag LOCUS_20070 2570 3019 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105215.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence396 1029 205 gene locus_tag LOCUS_20080 gene menG 1029 205 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAP8 protein_id gnl|my_center|LOCUS_20080 1038 2384 gene locus_tag LOCUS_20090 1038 2384 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776409.1 protein_id gnl|my_center|LOCUS_20090 <3041 2472 gene locus_tag LOCUS_20100 <3041 2472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CWB9:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase >Feature sequence397 1247 267 gene locus_tag LOCUS_20110 1247 267 CDS product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 protein_id gnl|my_center|LOCUS_20110 2046 1354 gene locus_tag LOCUS_20120 2046 1354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030627.1 protein_id gnl|my_center|LOCUS_20120 2759 2046 gene locus_tag LOCUS_20130 2759 2046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731210.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence398 575 2068 gene locus_tag LOCUS_20140 575 2068 CDS product proteasome accessory factor PafA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_20140 2153 2356 gene locus_tag LOCUS_20150 2153 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence399 387 2888 gene locus_tag LOCUS_20160 387 2888 CDS product aculeacin A acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence400 1023 1493 gene locus_tag LOCUS_20170 1023 1493 CDS product potassium-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089904.1 protein_id gnl|my_center|LOCUS_20170 1490 2377 gene locus_tag LOCUS_20180 gene dapF 1490 2377 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69969 protein_id gnl|my_center|LOCUS_20180 2783 2349 gene locus_tag LOCUS_20190 2783 2349 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013845.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence401 432 1019 gene locus_tag LOCUS_20200 432 1019 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528962.1 protein_id gnl|my_center|LOCUS_20200 1057 1278 gene locus_tag LOCUS_20210 1057 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2269 1268 gene locus_tag LOCUS_20220 2269 1268 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405120.1 protein_id gnl|my_center|LOCUS_20220 3003 2311 gene locus_tag LOCUS_20230 3003 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence402 2706 1336 gene locus_tag LOCUS_20240 2706 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence403 1946 222 gene locus_tag LOCUS_20250 1946 222 CDS product putative pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700888.1 protein_id gnl|my_center|LOCUS_20250 <3015 2005 gene locus_tag LOCUS_20260 <3015 2005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225397.1:FMN-binding glutamate synthase family protein >Feature sequence404 334 1185 gene locus_tag LOCUS_20270 334 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 1206 1997 gene locus_tag LOCUS_20280 1206 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977478.1 protein_id gnl|my_center|LOCUS_20280 1958 2377 gene locus_tag LOCUS_20290 1958 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027736.1 protein_id gnl|my_center|LOCUS_20290 2428 2643 gene locus_tag LOCUS_20300 2428 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 >Feature sequence405 1247 108 gene locus_tag LOCUS_20310 1247 108 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 protein_id gnl|my_center|LOCUS_20310 2043 1252 gene locus_tag LOCUS_20320 2043 1252 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_20320 <3006 2043 gene locus_tag LOCUS_20330 <3006 2043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731311.1:glycosyl transferase family 1 >Feature sequence406 2734 1805 gene locus_tag LOCUS_20340 2734 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence407 1446 391 gene locus_tag LOCUS_20350 1446 391 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975028.1 protein_id gnl|my_center|LOCUS_20350 2333 1524 gene locus_tag LOCUS_20360 gene paaG 2333 1524 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224354.1 protein_id gnl|my_center|LOCUS_20360 <2997 2335 gene locus_tag LOCUS_20370 <2997 2335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029108.1:peptidoglycan bridge formation protein FemAB >Feature sequence408 2060 273 gene locus_tag LOCUS_20380 2060 273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 protein_id gnl|my_center|LOCUS_20380 <2972 2060 gene locus_tag LOCUS_20390 <2972 2060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DJS5:4-diphosphocytidyl-2-C-methyl-D-erythritol kinase >Feature sequence409 731 291 gene locus_tag LOCUS_20400 731 291 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217592.1 protein_id gnl|my_center|LOCUS_20400 1759 863 gene locus_tag LOCUS_20410 1759 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_20410 1748 2587 gene locus_tag LOCUS_20420 1748 2587 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775888.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence410 1812 424 gene locus_tag LOCUS_20430 1812 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence411 <2950 1305 gene locus_tag LOCUS_20440 <2950 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679450.1:glycosyl hydrolase >Feature sequence412 898 227 gene locus_tag LOCUS_20450 898 227 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973834.1 protein_id gnl|my_center|LOCUS_20450 1026 1673 gene locus_tag LOCUS_20460 1026 1673 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_20460 1780 2298 gene locus_tag LOCUS_20470 1780 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20470 >Feature sequence413 1558 422 gene locus_tag LOCUS_20480 1558 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 <2940 1574 gene locus_tag LOCUS_20490 <2940 1574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9L278:threonine--tRNA ligase >Feature sequence414 1844 957 gene locus_tag LOCUS_20500 1844 957 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942704.1 protein_id gnl|my_center|LOCUS_20500 2099 2791 gene locus_tag LOCUS_20510 2099 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence415 2597 1242 gene locus_tag LOCUS_20520 gene glmM 2597 1242 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEW4 protein_id gnl|my_center|LOCUS_20520 >Feature sequence416 1082 108 gene locus_tag LOCUS_20530 1082 108 CDS product folate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974789.1 protein_id gnl|my_center|LOCUS_20530 1237 2022 gene locus_tag LOCUS_20540 1237 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223993.1 protein_id gnl|my_center|LOCUS_20540 2340 2633 gene locus_tag LOCUS_20550 2340 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence417 3 353 gene locus_tag LOCUS_20560 3 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 410 1183 gene locus_tag LOCUS_20570 410 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 1620 1123 gene locus_tag LOCUS_20580 1620 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 1736 2773 gene locus_tag LOCUS_20590 1736 2773 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728115.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence418 1528 593 gene locus_tag LOCUS_20600 gene thrB 1528 593 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADB2 protein_id gnl|my_center|LOCUS_20600 2641 1541 gene locus_tag LOCUS_20610 2641 1541 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADB3 protein_id gnl|my_center|LOCUS_20610 2913 2638 gene locus_tag LOCUS_20620 2913 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence419 <1 932 gene locus_tag LOCUS_20630 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812985.1:cardiolipin synthase B 1398 934 gene locus_tag LOCUS_20640 gene phnB 1398 934 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224943.1 protein_id gnl|my_center|LOCUS_20640 1518 2447 gene locus_tag LOCUS_20650 1518 2447 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224944.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence420 323 1936 gene locus_tag LOCUS_20660 323 1936 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028798.1 protein_id gnl|my_center|LOCUS_20660 2071 2589 gene locus_tag LOCUS_20670 2071 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence421 2140 371 gene locus_tag LOCUS_20680 2140 371 CDS product putative serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XA16 protein_id gnl|my_center|LOCUS_20680 2808 2140 gene locus_tag LOCUS_20690 2808 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence422 230 961 gene locus_tag LOCUS_20700 230 961 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815420.1 protein_id gnl|my_center|LOCUS_20700 1077 2507 gene locus_tag LOCUS_20710 1077 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence423 745 443 gene locus_tag LOCUS_20720 745 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 1821 742 gene locus_tag LOCUS_20730 gene mca 1821 742 CDS product mycothiol S-conjugate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DI54 protein_id gnl|my_center|LOCUS_20730 1870 2331 gene locus_tag LOCUS_20740 1870 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence424 676 1185 gene locus_tag LOCUS_20750 676 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1261 2616 gene locus_tag LOCUS_20760 1261 2616 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R5T4 protein_id gnl|my_center|LOCUS_20760 >Feature sequence425 186 1220 gene locus_tag LOCUS_20770 186 1220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029178.1 protein_id gnl|my_center|LOCUS_20770 1272 2327 gene locus_tag LOCUS_20780 1272 2327 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBN2 protein_id gnl|my_center|LOCUS_20780 >Feature sequence426 906 193 gene locus_tag LOCUS_20790 gene dedA 906 193 CDS product cytochrome o ubiquinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230830.1 protein_id gnl|my_center|LOCUS_20790 1019 1681 gene locus_tag LOCUS_20800 1019 1681 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853622.1 protein_id gnl|my_center|LOCUS_20800 1744 2775 gene locus_tag LOCUS_20810 gene fbaA 1744 2775 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230818.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence427 1484 948 gene locus_tag LOCUS_20820 1484 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1565 2701 gene locus_tag LOCUS_20830 1565 2701 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893096.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence428 1646 186 gene locus_tag LOCUS_20840 1646 186 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029268.1 protein_id gnl|my_center|LOCUS_20840 <2867 1643 gene locus_tag LOCUS_20850 <2867 1643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029267.1:cell division protein FtsW >Feature sequence429 1514 846 gene locus_tag LOCUS_20860 1514 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 <2860 1544 gene locus_tag LOCUS_20870 <2860 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730844.1:GTP pyrophosphokinase >Feature sequence430 <1 787 gene locus_tag LOCUS_20880 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RJ61:Pup--protein ligase 973 1932 gene locus_tag LOCUS_20890 973 1932 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977187.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence431 <1 522 gene locus_tag LOCUS_20900 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226682.1:IclR family transcriptional regulator 642 1811 gene locus_tag LOCUS_20910 642 1811 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226683.1 protein_id gnl|my_center|LOCUS_20910 1808 2614 gene locus_tag LOCUS_20920 gene gltA 1808 2614 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226684.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence432 >Feature sequence433 1262 441 gene locus_tag LOCUS_20930 1262 441 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029335.1 protein_id gnl|my_center|LOCUS_20930 2133 1309 gene locus_tag LOCUS_20940 2133 1309 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804321.1 protein_id gnl|my_center|LOCUS_20940 <2842 2126 gene locus_tag LOCUS_20950 <2842 2126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9ZBX1:serine--tRNA ligase >Feature sequence434 <1 551 gene locus_tag LOCUS_20960 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222886.1:hydroxymethylglutaryl-CoA lyase 607 1803 gene locus_tag LOCUS_20970 607 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence435 2420 1140 gene locus_tag LOCUS_20980 2420 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence436 <1 958 gene locus_tag LOCUS_20990 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776726.1:two-component sensor histidine kinase 1385 963 gene locus_tag LOCUS_21000 1385 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777020.1 protein_id gnl|my_center|LOCUS_21000 1621 1545 gene locus_tag LOCUS_t00370 1621 1545 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2033 2356 gene locus_tag LOCUS_21010 2033 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence437 <1 572 gene locus_tag LOCUS_21020 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028111.1:membrane protein 690 1556 gene locus_tag LOCUS_21030 gene trpC1 690 1556 CDS product indole-3-glycerol phosphate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68814 protein_id gnl|my_center|LOCUS_21030 >Feature sequence438 1904 285 gene locus_tag LOCUS_21040 1904 285 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_21040 2019 2600 gene locus_tag LOCUS_21050 2019 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence439 1299 19 gene locus_tag LOCUS_21060 gene glgC 1299 19 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MCV8 protein_id gnl|my_center|LOCUS_21060 <2801 1374 gene locus_tag LOCUS_21070 <2801 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224114.1:type VII secretion protein EccC >Feature sequence440 931 251 gene locus_tag LOCUS_21080 931 251 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_21080 2267 924 gene locus_tag LOCUS_21090 2267 924 CDS product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence441 942 172 gene locus_tag LOCUS_21100 942 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891759.1 protein_id gnl|my_center|LOCUS_21100 1754 996 gene locus_tag LOCUS_21110 1754 996 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975902.1 protein_id gnl|my_center|LOCUS_21110 2575 1751 gene locus_tag LOCUS_21120 gene murI 2575 1751 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XDZ7 protein_id gnl|my_center|LOCUS_21120 2795 2631 gene locus_tag LOCUS_21130 2795 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence442 2602 986 gene locus_tag LOCUS_21140 2602 986 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027780.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence443 <2786 372 gene locus_tag LOCUS_21150 <2786 372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WIQ5:RecBCD enzyme subunit RecC >Feature sequence444 <1 1138 gene locus_tag LOCUS_21160 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DCP2:tryptophan synthase beta chain 1268 2548 gene locus_tag LOCUS_21170 1268 2548 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119349.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence445 <1 938 gene locus_tag LOCUS_21180 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029948.1:NAD(P)H-quinone dehydrogenase 1181 2452 gene locus_tag LOCUS_21190 1181 2452 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887217.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence446 <1 678 gene locus_tag LOCUS_21200 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R580:pantothenate synthetase 675 1151 gene locus_tag LOCUS_21210 gene panD 675 1151 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58286 protein_id gnl|my_center|LOCUS_21210 >Feature sequence447 118 300 gene locus_tag LOCUS_21220 gene rpmD 118 300 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46789 protein_id gnl|my_center|LOCUS_21220 302 742 gene locus_tag LOCUS_21230 gene rplO 302 742 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFD6 protein_id gnl|my_center|LOCUS_21230 888 2195 gene locus_tag LOCUS_21240 gene secY 888 2195 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46785 protein_id gnl|my_center|LOCUS_21240 >Feature sequence448 <1 1228 gene locus_tag LOCUS_21250 <1 1228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027797.1:inosine 5-monophosphate dehydrogenase >Feature sequence449 >Feature sequence450 646 1428 gene locus_tag LOCUS_21260 646 1428 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775964.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence451 <1 590 gene locus_tag LOCUS_21270 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259048.1:formate dehydrogenase 757 1839 gene locus_tag LOCUS_21280 757 1839 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FBK6 protein_id gnl|my_center|LOCUS_21280 >Feature sequence452 1329 2423 gene locus_tag LOCUS_21290 1329 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence453 1932 1582 gene locus_tag LOCUS_21300 1932 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2532 2017 gene locus_tag LOCUS_21310 2532 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence454 300 2471 gene locus_tag LOCUS_21320 300 2471 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence455 1098 223 gene locus_tag LOCUS_21330 1098 223 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975728.1 protein_id gnl|my_center|LOCUS_21330 1312 1239 gene locus_tag LOCUS_t00380 1312 1239 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2118 1324 gene locus_tag LOCUS_21340 2118 1324 CDS product putative transcriptional regulator, TetR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703946.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence456 108 482 gene locus_tag LOCUS_21350 gene gcvH 108 482 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D905 protein_id gnl|my_center|LOCUS_21350 662 1207 gene locus_tag LOCUS_21360 662 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 1218 1994 gene locus_tag LOCUS_21370 1218 1994 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226818.1 protein_id gnl|my_center|LOCUS_21370 2019 2489 gene locus_tag LOCUS_21380 2019 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977444.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence457 360 1730 gene locus_tag LOCUS_21390 360 1730 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027778.1 protein_id gnl|my_center|LOCUS_21390 1863 2243 gene locus_tag LOCUS_21400 gene rbpA 1863 2243 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKY0 protein_id gnl|my_center|LOCUS_21400 2704 2264 gene locus_tag LOCUS_21410 2704 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 >Feature sequence458 691 281 gene locus_tag LOCUS_21420 691 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 1509 688 gene locus_tag LOCUS_21430 1509 688 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977611.1 protein_id gnl|my_center|LOCUS_21430 2654 1506 gene locus_tag LOCUS_21440 2654 1506 CDS product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977614.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence459 <1 969 gene locus_tag LOCUS_21450 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KXR2:aspartate carbamoyltransferase 966 2306 gene locus_tag LOCUS_21460 gene pyrC 966 2306 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXR3 protein_id gnl|my_center|LOCUS_21460 >Feature sequence460 996 253 gene locus_tag LOCUS_21470 996 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 908 1222 gene locus_tag LOCUS_21480 908 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 1219 2136 gene locus_tag LOCUS_21490 1219 2136 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KYV7 protein_id gnl|my_center|LOCUS_21490 >Feature sequence461 381 1622 gene locus_tag LOCUS_21500 gene cfa 381 1622 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224736.1 protein_id gnl|my_center|LOCUS_21500 2085 1672 gene locus_tag LOCUS_21510 2085 1672 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976618.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence462 <1 848 gene locus_tag LOCUS_21520 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224288.1:galactokinase 931 858 gene locus_tag LOCUS_t00390 931 858 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence463 806 2335 gene locus_tag LOCUS_21530 gene mmsA 806 2335 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence464 <1 1306 gene locus_tag LOCUS_21540 <1 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728243.1:formate dehydrogenase 2357 1368 gene locus_tag LOCUS_21550 2357 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence465 >Feature sequence466 2123 843 gene locus_tag LOCUS_21560 2123 843 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401260.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence467 1513 2178 gene locus_tag LOCUS_21570 1513 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence468 525 707 gene locus_tag LOCUS_21580 525 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 743 1375 gene locus_tag LOCUS_21590 gene nadD 743 1375 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDI3 protein_id gnl|my_center|LOCUS_21590 1372 1773 gene locus_tag LOCUS_21600 gene rsfS 1372 1773 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDK9 protein_id gnl|my_center|LOCUS_21600 1770 2465 gene locus_tag LOCUS_21610 1770 2465 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908345.1 protein_id gnl|my_center|LOCUS_21610 2571 2645 gene locus_tag LOCUS_t00400 2571 2645 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence469 <1 1651 gene locus_tag LOCUS_21620 <1 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MBA2:proline--tRNA ligase 1648 2388 gene locus_tag LOCUS_21630 1648 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence470 1930 278 gene locus_tag LOCUS_21640 1930 278 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030246.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence471 932 579 gene locus_tag LOCUS_21650 932 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223907.1 protein_id gnl|my_center|LOCUS_21650 1240 2385 gene locus_tag LOCUS_21660 1240 2385 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence472 <1 540 gene locus_tag LOCUS_21670 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973586.1:MarR family transcriptional regulator 1276 563 gene locus_tag LOCUS_21680 1276 563 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence473 2259 493 gene locus_tag LOCUS_21690 2259 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence474 580 38 gene locus_tag LOCUS_21700 580 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728883.1 protein_id gnl|my_center|LOCUS_21700 1555 671 gene locus_tag LOCUS_21710 1555 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 <2620 1772 gene locus_tag LOCUS_21720 <2620 1772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776699.1:multidrug ABC transporter ATP-binding protein >Feature sequence475 74 1048 gene locus_tag LOCUS_21730 74 1048 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 protein_id gnl|my_center|LOCUS_21730 1048 1818 gene locus_tag LOCUS_21740 gene gno 1048 1818 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337278.1 protein_id gnl|my_center|LOCUS_21740 2407 1823 gene locus_tag LOCUS_21750 2407 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2551 2477 gene locus_tag LOCUS_t00410 2551 2477 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence476 2471 1605 gene locus_tag LOCUS_21760 2471 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222911.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence477 719 168 gene locus_tag LOCUS_21770 719 168 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028955.1 protein_id gnl|my_center|LOCUS_21770 1785 778 gene locus_tag LOCUS_21780 gene tilS 1785 778 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X8I6 protein_id gnl|my_center|LOCUS_21780 >Feature sequence478 1903 812 gene locus_tag LOCUS_21790 1903 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776084.1 protein_id gnl|my_center|LOCUS_21790 >Feature sequence479 564 1190 gene locus_tag LOCUS_21800 564 1190 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L1U6 protein_id gnl|my_center|LOCUS_21800 1283 1549 gene locus_tag LOCUS_21810 1283 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975863.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence480 1177 683 gene locus_tag LOCUS_21820 1177 683 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230720.1 protein_id gnl|my_center|LOCUS_21820 1945 1445 gene locus_tag LOCUS_21830 1945 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence481 <1 863 gene locus_tag LOCUS_21840 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RJH9:catalase-peroxidase note possible pseudo, internal stop codon 972 2249 gene locus_tag LOCUS_21850 972 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21850 >Feature sequence482 17 904 gene locus_tag LOCUS_21860 17 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703590.1 protein_id gnl|my_center|LOCUS_21860 917 2101 gene locus_tag LOCUS_21870 917 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703589.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence483 >Feature sequence484 694 1719 gene locus_tag LOCUS_21880 694 1719 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119877.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence485 1574 486 gene locus_tag LOCUS_21890 1574 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2068 1571 gene locus_tag LOCUS_21900 2068 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence486 1470 2321 gene locus_tag LOCUS_21910 1470 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977163.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence487 693 16 gene locus_tag LOCUS_21920 693 16 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029519.1 protein_id gnl|my_center|LOCUS_21920 1904 690 gene locus_tag LOCUS_21930 1904 690 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974746.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence488 589 122 gene locus_tag LOCUS_21940 589 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 699 1412 gene locus_tag LOCUS_21950 699 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence489 1068 715 gene locus_tag LOCUS_21960 1068 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 2405 1065 gene locus_tag LOCUS_21970 2405 1065 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029304.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence490 <1 1956 gene locus_tag LOCUS_21980 <1 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030465.1:ATP-dependent helicase >Feature sequence491 <1 1750 gene locus_tag LOCUS_21990 <1 1750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028428.1:AMP-dependent synthetase >Feature sequence492 >Feature sequence493 >Feature sequence494 227 463 gene locus_tag LOCUS_22000 227 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 460 849 gene locus_tag LOCUS_22010 460 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 958 2037 gene locus_tag LOCUS_22020 958 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence495 1411 305 gene locus_tag LOCUS_22030 1411 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence496 2225 558 gene locus_tag LOCUS_22040 2225 558 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727568.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence497 251 1627 gene locus_tag LOCUS_22050 gene narU 251 1627 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401380.1 protein_id gnl|my_center|LOCUS_22050 >Feature sequence498 2 2449 gene locus_tag LOCUS_22060 2 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 >Feature sequence499 460 2124 gene locus_tag LOCUS_22070 460 2124 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224753.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence500 1028 549 gene locus_tag LOCUS_22080 1028 549 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225559.1 protein_id gnl|my_center|LOCUS_22080 1109 1603 gene locus_tag LOCUS_22090 1109 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 1885 1640 gene locus_tag LOCUS_22100 1885 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 1999 2355 gene locus_tag LOCUS_22110 1999 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22110 >Feature sequence501 <2486 1421 gene locus_tag LOCUS_22120 <2486 1421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888993.1:potassium transporter KefB >Feature sequence502 1011 160 gene locus_tag LOCUS_22130 1011 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence503 5 838 gene locus_tag LOCUS_22140 5 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 >Feature sequence504 >Feature sequence505 >Feature sequence506 <1 1235 gene locus_tag LOCUS_22150 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DAE7:UDP-N-acetylmuramate--L-alanine ligase 1232 2029 gene locus_tag LOCUS_22160 1232 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 >Feature sequence507 1378 71 gene locus_tag LOCUS_22170 1378 71 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WB55 protein_id gnl|my_center|LOCUS_22170 >Feature sequence508 <1 1204 gene locus_tag LOCUS_22180 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O88054:phenylalanine--tRNA ligase beta subunit 1336 2388 gene locus_tag LOCUS_22190 gene argC 1336 2388 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54895 protein_id gnl|my_center|LOCUS_22190 >Feature sequence509 261 803 gene locus_tag LOCUS_22200 261 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 908 1903 gene locus_tag LOCUS_22210 908 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence510 290 1513 gene locus_tag LOCUS_22220 290 1513 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198965.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence511 283 1965 gene locus_tag LOCUS_22230 283 1965 CDS product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975519.1 protein_id gnl|my_center|LOCUS_22230 >Feature sequence512 >Feature sequence513 1479 394 gene locus_tag LOCUS_22240 1479 394 CDS product NAD-binding protein of Kef-type K+ transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975108.1 protein_id gnl|my_center|LOCUS_22240 <2436 1489 gene locus_tag LOCUS_22250 <2436 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972813.1:membrane protein >Feature sequence514 <2428 930 gene locus_tag LOCUS_22260 <2428 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228252.1:long-chain-fatty-acid--CoA ligase >Feature sequence515 1299 1496 gene locus_tag LOCUS_22270 1299 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2423 1512 gene locus_tag LOCUS_22280 2423 1512 CDS product formate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729731.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence516 1804 1076 gene locus_tag LOCUS_22290 1804 1076 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230054.1 protein_id gnl|my_center|LOCUS_22290 2424 1801 gene locus_tag LOCUS_22300 2424 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230053.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence517 1864 1562 gene locus_tag LOCUS_22310 1864 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974805.1 protein_id gnl|my_center|LOCUS_22310 <2421 1864 gene locus_tag LOCUS_22320 <2421 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0R4C9:putative thiosulfate sulfurtransferase >Feature sequence518 310 561 gene locus_tag LOCUS_22330 310 561 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776072.1 protein_id gnl|my_center|LOCUS_22330 1172 558 gene locus_tag LOCUS_22340 1172 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1253 1828 gene locus_tag LOCUS_22350 1253 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence519 <1 867 gene locus_tag LOCUS_22360 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776859.1:arylsulfatase A family protein 878 1747 gene locus_tag LOCUS_22370 878 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031741.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence520 946 1518 gene locus_tag LOCUS_22380 946 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2132 1533 gene locus_tag LOCUS_22390 2132 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence521 <2408 171 gene locus_tag LOCUS_22400 <2408 171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027613.1:helicase >Feature sequence522 2017 1715 gene locus_tag LOCUS_22410 2017 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2406 2014 gene locus_tag LOCUS_22420 2406 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 >Feature sequence523 <1 668 gene locus_tag LOCUS_22430 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MAK6:succinate--CoA ligase [ADP-forming] subunit alpha >Feature sequence524 198 878 gene locus_tag LOCUS_22440 198 878 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_22440 1011 1814 gene locus_tag LOCUS_22450 1011 1814 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208394.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence525 <1 544 gene locus_tag LOCUS_22460 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WFF7:decaprenyl diphosphate synthase 973 569 gene locus_tag LOCUS_22470 973 569 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007449657.1 protein_id gnl|my_center|LOCUS_22470 1982 960 gene locus_tag LOCUS_22480 1982 960 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028393.1 protein_id gnl|my_center|LOCUS_22480 >Feature sequence526 895 260 gene locus_tag LOCUS_22490 895 260 CDS product TIGR03085 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028115.1 protein_id gnl|my_center|LOCUS_22490 >Feature sequence527 <1 1085 gene locus_tag LOCUS_22500 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939886.1:sodium/hydrogen exchanger 1900 1076 gene locus_tag LOCUS_22510 gene mutM 1900 1076 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228777.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence528 908 708 gene locus_tag LOCUS_22520 908 708 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949541.1 protein_id gnl|my_center|LOCUS_22520 1465 1268 gene locus_tag LOCUS_22530 1465 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230732.1 protein_id gnl|my_center|LOCUS_22530 <2356 1615 gene locus_tag LOCUS_22540 <2356 1615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7AKK2:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence529 601 1788 gene locus_tag LOCUS_22550 601 1788 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729720.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence530 <1 1013 gene locus_tag LOCUS_22560 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877378.1:cryptochrome/photolyase family protein 1462 1028 gene locus_tag LOCUS_22570 1462 1028 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 protein_id gnl|my_center|LOCUS_22570 <2352 1542 gene locus_tag LOCUS_22580 <2352 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730565.1:peptidase S1 >Feature sequence531 1735 1175 gene locus_tag LOCUS_22590 1735 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 <2352 1735 gene locus_tag LOCUS_22600 <2352 1735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015411.1:tricarboxylic transport membrane protein >Feature sequence532 409 1776 gene locus_tag LOCUS_22610 409 1776 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776047.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence533 110 673 gene locus_tag LOCUS_22620 110 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028194.1 protein_id gnl|my_center|LOCUS_22620 716 1969 gene locus_tag LOCUS_22630 716 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence534 176 2224 gene locus_tag LOCUS_22640 176 2224 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229814.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence535 <1 1217 gene locus_tag LOCUS_22650 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9EX26:apolipoprotein N-acyltransferase 1214 2002 gene locus_tag LOCUS_22660 1214 2002 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence536 1185 703 gene locus_tag LOCUS_22670 1185 703 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223641.1 protein_id gnl|my_center|LOCUS_22670 1514 1182 gene locus_tag LOCUS_22680 1514 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1978 1511 gene locus_tag LOCUS_22690 1978 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 >Feature sequence537 1591 254 gene locus_tag LOCUS_22700 1591 254 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_22700 1674 2312 gene locus_tag LOCUS_22710 1674 2312 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RKA5 protein_id gnl|my_center|LOCUS_22710 >Feature sequence538 86 922 gene locus_tag LOCUS_22720 86 922 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702226.1 protein_id gnl|my_center|LOCUS_22720 919 2025 gene locus_tag LOCUS_22730 919 2025 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228457.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence539 477 1730 gene locus_tag LOCUS_22740 477 1730 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029959.1 protein_id gnl|my_center|LOCUS_22740 1734 2135 gene locus_tag LOCUS_22750 1734 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence540 1712 198 gene locus_tag LOCUS_22760 gene gatA 1712 198 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MDP7 protein_id gnl|my_center|LOCUS_22760 2011 1709 gene locus_tag LOCUS_22770 gene gatC 2011 1709 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CYQ1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence541 435 103 gene locus_tag LOCUS_22780 435 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 927 523 gene locus_tag LOCUS_22790 927 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977690.1 protein_id gnl|my_center|LOCUS_22790 1464 937 gene locus_tag LOCUS_22800 1464 937 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222096.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence542 1150 164 gene locus_tag LOCUS_22810 1150 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 1125 2066 gene locus_tag LOCUS_22820 1125 2066 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence543 >Feature sequence544 >Feature sequence545 136 1032 gene locus_tag LOCUS_22830 136 1032 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383500.1 protein_id gnl|my_center|LOCUS_22830 1627 1112 gene locus_tag LOCUS_22840 1627 1112 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222096.1 protein_id gnl|my_center|LOCUS_22840 2273 1620 gene locus_tag LOCUS_22850 2273 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence546 <1 705 gene locus_tag LOCUS_22860 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257847.1:NADH-quinone oxidoreductase subunit N 708 2114 gene locus_tag LOCUS_22870 708 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence547 1023 58 gene locus_tag LOCUS_22880 1023 58 CDS product adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975480.1 protein_id gnl|my_center|LOCUS_22880 1188 2021 gene locus_tag LOCUS_22890 1188 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence548 1566 442 gene locus_tag LOCUS_22900 1566 442 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891989.1 protein_id gnl|my_center|LOCUS_22900 2118 1594 gene locus_tag LOCUS_22910 2118 1594 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891993.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence549 >Feature sequence550 <2296 764 gene locus_tag LOCUS_22920 <2296 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975721.1:ABC transporter >Feature sequence551 <1 1226 gene locus_tag LOCUS_22930 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258908.1:MFS transporter 1499 1287 gene locus_tag LOCUS_22940 1499 1287 CDS product PspC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222993.1 protein_id gnl|my_center|LOCUS_22940 <2294 1518 gene locus_tag LOCUS_22950 <2294 1518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118811.1:formaldehyde dehydrogenase, glutathione-independent >Feature sequence552 1066 743 gene locus_tag LOCUS_22960 1066 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2211 1141 gene locus_tag LOCUS_22970 gene ruvB 2211 1141 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L291 protein_id gnl|my_center|LOCUS_22970 >Feature sequence553 1123 290 gene locus_tag LOCUS_22980 gene pyrF 1123 290 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXR8 protein_id gnl|my_center|LOCUS_22980 2187 1120 gene locus_tag LOCUS_22990 gene pyrD 2187 1120 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXR7 protein_id gnl|my_center|LOCUS_22990 >Feature sequence554 1594 137 gene locus_tag LOCUS_23000 1594 137 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P356 protein_id gnl|my_center|LOCUS_23000 >Feature sequence555 124 1449 gene locus_tag LOCUS_23010 124 1449 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014153.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence556 287 697 gene locus_tag LOCUS_23020 287 697 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230241.1 protein_id gnl|my_center|LOCUS_23020 694 1530 gene locus_tag LOCUS_23030 694 1530 CDS product molybdate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029176.1 protein_id gnl|my_center|LOCUS_23030 >Feature sequence557 167 1453 gene locus_tag LOCUS_23040 167 1453 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence558 357 797 gene locus_tag LOCUS_23050 357 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 842 1309 gene locus_tag LOCUS_23060 842 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1311 1676 gene locus_tag LOCUS_23070 1311 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence559 345 1244 gene locus_tag LOCUS_23080 345 1244 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_23080 1574 1260 gene locus_tag LOCUS_23090 1574 1260 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 protein_id gnl|my_center|LOCUS_23090 2040 1564 gene locus_tag LOCUS_23100 2040 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence560 1235 675 gene locus_tag LOCUS_23110 1235 675 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406264.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence561 1419 1096 gene locus_tag LOCUS_23120 1419 1096 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803685.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence562 <1 1572 gene locus_tag LOCUS_23130 <1 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224484.1:amino acid transporter >Feature sequence563 309 1172 gene locus_tag LOCUS_23140 309 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence564 <1 552 gene locus_tag LOCUS_23150 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028909.1:hydrolase 667 1575 gene locus_tag LOCUS_23160 667 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence565 985 152 gene locus_tag LOCUS_23170 985 152 CDS product rpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002348159.1 protein_id gnl|my_center|LOCUS_23170 <2226 982 gene locus_tag LOCUS_23180 <2226 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088888.1:Zn-dependent hydrolase >Feature sequence566 810 58 gene locus_tag LOCUS_23190 810 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 1272 1087 gene locus_tag LOCUS_23200 1272 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776783.1 protein_id gnl|my_center|LOCUS_23200 1368 1634 gene locus_tag LOCUS_23210 1368 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599308.1 protein_id gnl|my_center|LOCUS_23210 1896 1705 gene locus_tag LOCUS_23220 1896 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 >Feature sequence567 227 484 gene locus_tag LOCUS_23230 227 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 673 1416 gene locus_tag LOCUS_23240 673 1416 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_23240 1482 1754 gene locus_tag LOCUS_23250 1482 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1979 1803 gene locus_tag LOCUS_23260 1979 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence568 1454 354 gene locus_tag LOCUS_23270 1454 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1858 2166 gene locus_tag LOCUS_23280 gene rpsJ 1858 2166 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66337 protein_id gnl|my_center|LOCUS_23280 >Feature sequence569 >Feature sequence570 1180 650 gene locus_tag LOCUS_23290 1180 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence571 1233 502 gene locus_tag LOCUS_23300 1233 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 1333 2100 gene locus_tag LOCUS_23310 gene aat 1333 2100 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJT7 protein_id gnl|my_center|LOCUS_23310 >Feature sequence572 1381 236 gene locus_tag LOCUS_23320 1381 236 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700819.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence573 1440 592 gene locus_tag LOCUS_23330 gene truA 1440 592 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MEW9 protein_id gnl|my_center|LOCUS_23330 2130 1525 gene locus_tag LOCUS_23340 2130 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence574 <1 737 gene locus_tag LOCUS_23350 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118616.1:PAS domain-containing sensor histidine kinase 770 1867 gene locus_tag LOCUS_23360 gene yqiG 770 1867 CDS product putative NADH-dependent flavin oxidoreductase YqiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54524 protein_id gnl|my_center|LOCUS_23360 >Feature sequence575 327 1886 gene locus_tag LOCUS_23370 327 1886 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030655.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence576 1938 1108 gene locus_tag LOCUS_23380 gene nfo 1938 1108 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63536 protein_id gnl|my_center|LOCUS_23380 >Feature sequence577 <2193 978 gene locus_tag LOCUS_23390 <2193 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223097.1:ribonuclease R >Feature sequence578 1647 736 gene locus_tag LOCUS_23400 1647 736 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222519.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence579 1689 1522 gene locus_tag LOCUS_23410 1689 1522 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222969.1 protein_id gnl|my_center|LOCUS_23410 2182 1820 gene locus_tag LOCUS_23420 2182 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence580 882 322 gene locus_tag LOCUS_23430 882 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence581 305 1282 gene locus_tag LOCUS_23440 305 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 1348 2154 gene locus_tag LOCUS_23450 1348 2154 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence582 839 66 gene locus_tag LOCUS_23460 839 66 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563067.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence583 1008 172 gene locus_tag LOCUS_23470 1008 172 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227997.1 protein_id gnl|my_center|LOCUS_23470 1088 1891 gene locus_tag LOCUS_23480 1088 1891 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_311657.2 protein_id gnl|my_center|LOCUS_23480 >Feature sequence584 <1 714 gene locus_tag LOCUS_23490 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003414736.1:D-alanyl-D-alanine carboxypeptidase 829 1965 gene locus_tag LOCUS_23500 829 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence585 484 1953 gene locus_tag LOCUS_23510 gene gltD 484 1953 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976791.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence586 <1 1306 gene locus_tag LOCUS_23520 <1 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977408.1:GntR family transcriptional regulator <2161 1320 gene locus_tag LOCUS_23530 <2161 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030121.1:AraC family transcriptional regulator >Feature sequence587 1588 347 gene locus_tag LOCUS_23540 1588 347 CDS product LPS kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390376.1 protein_id gnl|my_center|LOCUS_23540 1651 1726 gene locus_tag LOCUS_t00420 1651 1726 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2103 1744 gene locus_tag LOCUS_23550 2103 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence588 371 1999 gene locus_tag LOCUS_23560 gene dnaA 371 1999 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CT75 protein_id gnl|my_center|LOCUS_23560 >Feature sequence589 970 32 gene locus_tag LOCUS_23570 970 32 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729520.1 protein_id gnl|my_center|LOCUS_23570 2130 1024 gene locus_tag LOCUS_23580 gene ligC 2130 1024 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031122.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence590 518 1393 gene locus_tag LOCUS_23590 518 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891671.1 protein_id gnl|my_center|LOCUS_23590 <2152 1448 gene locus_tag LOCUS_23600 <2152 1448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227917.1:SAM-dependent methyltransferase >Feature sequence591 965 93 gene locus_tag LOCUS_23610 gene mutM 965 93 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBQ6 protein_id gnl|my_center|LOCUS_23610 1733 972 gene locus_tag LOCUS_23620 gene rnc 1733 972 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBQ7 protein_id gnl|my_center|LOCUS_23620 1927 1742 gene locus_tag LOCUS_23630 gene rpmF 1927 1742 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D273 protein_id gnl|my_center|LOCUS_23630 >Feature sequence592 <1 594 gene locus_tag LOCUS_23640 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939915.1:D-cysteine desulfhydrase 591 1772 gene locus_tag LOCUS_23650 591 1772 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804165.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence593 1826 126 gene locus_tag LOCUS_23660 1826 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975874.1 protein_id gnl|my_center|LOCUS_23660 2137 1943 gene locus_tag LOCUS_23670 2137 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence594 1638 166 gene locus_tag LOCUS_23680 1638 166 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NQI2 protein_id gnl|my_center|LOCUS_23680 2032 1730 gene locus_tag LOCUS_23690 2032 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence595 1032 2030 gene locus_tag LOCUS_23700 1032 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence596 103 1431 gene locus_tag LOCUS_23710 103 1431 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228271.1 protein_id gnl|my_center|LOCUS_23710 1428 2108 gene locus_tag LOCUS_23720 1428 2108 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence597 <1 786 gene locus_tag LOCUS_23730 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DK35:D-alanine--D-alanine ligase 932 1696 gene locus_tag LOCUS_23740 932 1696 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222170.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence598 >Feature sequence599 167 92 gene locus_tag LOCUS_t00430 167 92 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 287 1930 gene locus_tag LOCUS_23750 287 1930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142816.1 protein_id gnl|my_center|LOCUS_23750 1927 2103 gene locus_tag LOCUS_23760 1927 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence600 875 1450 gene locus_tag LOCUS_23770 875 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence601 >Feature sequence602 <1 624 gene locus_tag LOCUS_23780 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226289.1:prepilin peptidase 814 629 gene locus_tag LOCUS_23790 814 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 <2100 1077 gene locus_tag LOCUS_23800 <2100 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975395.1:proteinase >Feature sequence603 181 600 gene locus_tag LOCUS_23810 181 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 597 1775 gene locus_tag LOCUS_23820 597 1775 CDS product putative acyl CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702820.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence604 <1 1131 gene locus_tag LOCUS_23830 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9F2Q3:enolase 1 1142 1654 gene locus_tag LOCUS_23840 1142 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence605 <2092 803 gene locus_tag LOCUS_23850 <2092 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531176.1:trimethylamine methyltransferase >Feature sequence606 <1 861 gene locus_tag LOCUS_23860 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719921.1:methyltetrahydrofolate--corrinoid methyltransferase >Feature sequence607 421 1176 gene locus_tag LOCUS_23870 421 1176 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030116.1 protein_id gnl|my_center|LOCUS_23870 1181 1921 gene locus_tag LOCUS_23880 1181 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973757.1 protein_id gnl|my_center|LOCUS_23880 >Feature sequence608 <2083 782 gene locus_tag LOCUS_23890 <2083 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223026.1:molybdopterin oxidoreductase >Feature sequence609 1980 622 gene locus_tag LOCUS_23900 1980 622 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence610 <1 1200 gene locus_tag LOCUS_23910 <1 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230945.1:ATPase >Feature sequence611 1049 48 gene locus_tag LOCUS_23920 1049 48 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031881.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence612 1969 986 gene locus_tag LOCUS_23930 1969 986 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029292.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence613 1036 371 gene locus_tag LOCUS_23940 1036 371 CDS product corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_23940 1821 1033 gene locus_tag LOCUS_23950 1821 1033 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931406.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence614 339 1877 gene locus_tag LOCUS_23960 gene gatB 339 1877 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z578 protein_id gnl|my_center|LOCUS_23960 >Feature sequence615 301 1368 gene locus_tag LOCUS_23970 301 1368 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 protein_id gnl|my_center|LOCUS_23970 >Feature sequence616 742 476 gene locus_tag LOCUS_23980 742 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 >Feature sequence617 194 583 gene locus_tag LOCUS_23990 194 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 610 1395 gene locus_tag LOCUS_24000 610 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 1995 1423 gene locus_tag LOCUS_24010 1995 1423 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764534.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence618 <2031 131 gene locus_tag LOCUS_24020 <2031 131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776607.1:carboxypeptidase >Feature sequence619 1003 1977 gene locus_tag LOCUS_24030 1003 1977 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence620 <1 578 gene locus_tag LOCUS_24040 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972818.1:sulfite reductase 575 742 gene locus_tag LOCUS_24050 575 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972819.1 protein_id gnl|my_center|LOCUS_24050 739 1485 gene locus_tag LOCUS_24060 gene cysH 739 1485 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ADG3 protein_id gnl|my_center|LOCUS_24060 >Feature sequence621 574 1419 gene locus_tag LOCUS_24070 574 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 >Feature sequence622 <1 1390 gene locus_tag LOCUS_24080 <1 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DEX6:dihydrolipoyl dehydrogenase 1387 1758 gene locus_tag LOCUS_24090 1387 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence623 >Feature sequence624 <2007 1242 gene locus_tag LOCUS_24100 <2007 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003895076.1:NADH dehydrogenase >Feature sequence625 <1 1524 gene locus_tag LOCUS_24110 <1 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887578.1:alpha-amylase 1694 1503 gene locus_tag LOCUS_24120 1694 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence626 545 1366 gene locus_tag LOCUS_24130 545 1366 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EWV2 protein_id gnl|my_center|LOCUS_24130 >Feature sequence627 1504 755 gene locus_tag LOCUS_24140 1504 755 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031779.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence628 209 1429 gene locus_tag LOCUS_24150 209 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence629 968 1879 gene locus_tag LOCUS_24160 968 1879 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230607.1 protein_id gnl|my_center|LOCUS_24160 >Feature sequence630 706 413 gene locus_tag LOCUS_24170 706 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857164.1 protein_id gnl|my_center|LOCUS_24170 1896 703 gene locus_tag LOCUS_24180 1896 703 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222356.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence631 348 1058 gene locus_tag LOCUS_24190 348 1058 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095816.1 protein_id gnl|my_center|LOCUS_24190 >Feature sequence632 113 1324 gene locus_tag LOCUS_24200 gene murB 113 1324 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MED8 protein_id gnl|my_center|LOCUS_24200 >Feature sequence633 141 1058 gene locus_tag LOCUS_24210 141 1058 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228493.1 protein_id gnl|my_center|LOCUS_24210 1055 1741 gene locus_tag LOCUS_24220 gene ung 1055 1741 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7M9R9 protein_id gnl|my_center|LOCUS_24220 >Feature sequence634 >Feature sequence635 285 1067 gene locus_tag LOCUS_24230 gene priA 285 1067 CDS product phosphoribosyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P16250 protein_id gnl|my_center|LOCUS_24230 1064 1843 gene locus_tag LOCUS_24240 gene hisF 1064 1843 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2T7 protein_id gnl|my_center|LOCUS_24240 >Feature sequence636 1385 570 gene locus_tag LOCUS_24250 1385 570 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896587.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence637 >Feature sequence638 <1 735 gene locus_tag LOCUS_24260 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932715.1:epimerase 728 1372 gene locus_tag LOCUS_24270 728 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410207.1 protein_id gnl|my_center|LOCUS_24270 1454 1824 gene locus_tag LOCUS_tm00010 1454 1824 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence639 234 836 gene locus_tag LOCUS_24280 gene desR 234 836 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228375.1 protein_id gnl|my_center|LOCUS_24280 1292 843 gene locus_tag LOCUS_24290 gene mce 1292 843 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223476.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence640 <1 810 gene locus_tag LOCUS_24300 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228679.1:two-component sensor histidine kinase 1770 838 gene locus_tag LOCUS_24310 gene cysK 1770 838 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5G2 protein_id gnl|my_center|LOCUS_24310 >Feature sequence641 927 613 gene locus_tag LOCUS_24320 927 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724575.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence642 <1922 481 gene locus_tag LOCUS_24330 <1922 481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896427.1:FAD-dependent oxidoreductase >Feature sequence643 979 383 gene locus_tag LOCUS_24340 979 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 1395 976 gene locus_tag LOCUS_24350 1395 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 1564 1388 gene locus_tag LOCUS_24360 1564 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence644 252 1328 gene locus_tag LOCUS_24370 252 1328 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013805.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence645 1458 496 gene locus_tag LOCUS_24380 1458 496 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z513 protein_id gnl|my_center|LOCUS_24380 >Feature sequence646 <1 971 gene locus_tag LOCUS_24390 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805132.1:prephenate dehydrogenase 997 1689 gene locus_tag LOCUS_24400 gene cmk 997 1689 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9EWW6 protein_id gnl|my_center|LOCUS_24400 >Feature sequence647 1890 748 gene locus_tag LOCUS_24410 1890 748 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_628557.2 protein_id gnl|my_center|LOCUS_24410 >Feature sequence648 127 597 gene locus_tag LOCUS_24420 127 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 1454 681 gene locus_tag LOCUS_24430 1454 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence649 <1 897 gene locus_tag LOCUS_24440 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225688.1:nitronate monooxygenase <1911 1071 gene locus_tag LOCUS_24450 <1911 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036508.1:alkene reductase >Feature sequence650 >Feature sequence651 1470 199 gene locus_tag LOCUS_24460 gene thrC 1470 199 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228462.1 protein_id gnl|my_center|LOCUS_24460 1904 1749 gene locus_tag LOCUS_24470 1904 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence652 <1 684 gene locus_tag LOCUS_24480 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721008.1:esterase 1525 674 gene locus_tag LOCUS_24490 1525 674 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014152.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence653 626 213 gene locus_tag LOCUS_24500 626 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 protein_id gnl|my_center|LOCUS_24500 <1894 654 gene locus_tag LOCUS_24510 <1894 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P65155:dihydroxy-acid dehydratase >Feature sequence654 134 370 gene locus_tag LOCUS_24520 134 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 394 1392 gene locus_tag LOCUS_24530 394 1392 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728471.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence655 <1 758 gene locus_tag LOCUS_24540 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977439.1:membrane protein 755 1087 gene locus_tag LOCUS_24550 755 1087 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977440.1 protein_id gnl|my_center|LOCUS_24550 1084 1815 gene locus_tag LOCUS_24560 1084 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence656 >Feature sequence657 312 563 gene locus_tag LOCUS_24570 312 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1562 597 gene locus_tag LOCUS_24580 1562 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence658 181 882 gene locus_tag LOCUS_24590 181 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 863 1414 gene locus_tag LOCUS_24600 863 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703825.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence659 1144 686 gene locus_tag LOCUS_24610 1144 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence660 77 886 gene locus_tag LOCUS_24620 77 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 927 1853 gene locus_tag LOCUS_24630 927 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence661 <1861 872 gene locus_tag LOCUS_24640 <1861 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031501.1:alanine glycine permease >Feature sequence662 926 474 gene locus_tag LOCUS_24650 926 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 1155 1307 gene locus_tag LOCUS_24660 1155 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 1426 1800 gene locus_tag LOCUS_24670 1426 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence663 >Feature sequence664 2 442 gene locus_tag LOCUS_24680 2 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence665 609 1742 gene locus_tag LOCUS_24690 609 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence666 1837 527 gene locus_tag LOCUS_24700 1837 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence667 218 580 gene locus_tag LOCUS_24710 218 580 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QZZ6 protein_id gnl|my_center|LOCUS_24710 947 585 gene locus_tag LOCUS_24720 947 585 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390276.1 protein_id gnl|my_center|LOCUS_24720 1025 1432 gene locus_tag LOCUS_24730 1025 1432 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031693.1 protein_id gnl|my_center|LOCUS_24730 >Feature sequence668 1 936 gene locus_tag LOCUS_24740 gene lig 1 936 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226451.1 protein_id gnl|my_center|LOCUS_24740 933 1490 gene locus_tag LOCUS_24750 933 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence669 6 215 gene locus_tag LOCUS_24760 6 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 212 862 gene locus_tag LOCUS_24770 212 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 <1823 1245 gene locus_tag LOCUS_24780 <1823 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707946.1:dienelactone hydrolase >Feature sequence670 1648 863 gene locus_tag LOCUS_24790 1648 863 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_24790 >Feature sequence671 <1 630 gene locus_tag LOCUS_24800 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027902.1:peptidase M50 729 1679 gene locus_tag LOCUS_24810 729 1679 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027901.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence672 124 429 gene locus_tag LOCUS_24820 124 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 <1811 441 gene locus_tag LOCUS_24830 <1811 441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729718.1:methyltransferase >Feature sequence673 542 276 gene locus_tag LOCUS_24840 542 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 <1798 535 gene locus_tag LOCUS_24850 <1798 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9FBM3:exodeoxyribonuclease 7 large subunit >Feature sequence674 225 911 gene locus_tag LOCUS_24860 225 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence675 1794 1006 gene locus_tag LOCUS_24870 1794 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 >Feature sequence676 <1 556 gene locus_tag LOCUS_24880 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III >Feature sequence677 <1 766 gene locus_tag LOCUS_24890 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QYQ1:pseudouridine synthase 847 1230 gene locus_tag LOCUS_24900 847 1230 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977062.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence678 189 1643 gene locus_tag LOCUS_24910 189 1643 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267888.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence679 65 739 gene locus_tag LOCUS_24920 65 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 736 1329 gene locus_tag LOCUS_24930 736 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 1362 1772 gene locus_tag LOCUS_24940 1362 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence680 >Feature sequence681 1196 144 gene locus_tag LOCUS_24950 1196 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24950 >Feature sequence682 <1758 969 gene locus_tag LOCUS_24960 <1758 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001048829.1:Na+/H+ antiporter >Feature sequence683 1623 565 gene locus_tag LOCUS_24970 gene gmdA 1623 565 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71790 protein_id gnl|my_center|LOCUS_24970 >Feature sequence684 642 1046 gene locus_tag LOCUS_24980 642 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 1043 1519 gene locus_tag LOCUS_24990 1043 1519 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804014.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence685 797 36 gene locus_tag LOCUS_25000 797 36 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975722.1 protein_id gnl|my_center|LOCUS_25000 832 1482 gene locus_tag LOCUS_25010 832 1482 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225286.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence686 1033 341 gene locus_tag LOCUS_25020 1033 341 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777132.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence687 455 222 gene locus_tag LOCUS_25030 455 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 <1750 496 gene locus_tag LOCUS_25040 <1750 496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224530.1:1-pyrroline-5-carboxylate dehydrogenase >Feature sequence688 <1750 1025 gene locus_tag LOCUS_25050 <1750 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705398.1:putative carboxyl transferase/pyruvate carboxylase >Feature sequence689 1077 328 gene locus_tag LOCUS_25060 1077 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 <1748 1064 gene locus_tag LOCUS_25070 <1748 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9S2X8:pseudouridine synthase >Feature sequence690 >Feature sequence691 289 1569 gene locus_tag LOCUS_25080 289 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence692 431 1093 gene locus_tag LOCUS_25090 431 1093 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973146.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence693 1330 134 gene locus_tag LOCUS_25100 gene dnaJ1 1330 134 CDS product chaperone protein DnaJ 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40170 protein_id gnl|my_center|LOCUS_25100 >Feature sequence694 >Feature sequence695 <1720 762 gene locus_tag LOCUS_25110 <1720 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975394.1:DNA polymerase III subunit delta >Feature sequence696 >Feature sequence697 266 1438 gene locus_tag LOCUS_25120 266 1438 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MNT5 protein_id gnl|my_center|LOCUS_25120 >Feature sequence698 <1 937 gene locus_tag LOCUS_25130 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029875.1:ATPase >Feature sequence699 1235 261 gene locus_tag LOCUS_25140 1235 261 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RJ79 protein_id gnl|my_center|LOCUS_25140 1430 1248 gene locus_tag LOCUS_25150 1430 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence700 <1 584 gene locus_tag LOCUS_25160 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001785213.1:ATP-dependent RNA helicase HrpA 1359 823 gene locus_tag LOCUS_25170 1359 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence701 <1699 849 gene locus_tag LOCUS_25180 <1699 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WQG3:acyl-CoA dehydrogenase fadE12 >Feature sequence702 1231 440 gene locus_tag LOCUS_25190 1231 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532886.1 protein_id gnl|my_center|LOCUS_25190 >Feature sequence703 <1 867 gene locus_tag LOCUS_25200 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RDC9:elongation factor 4 <1697 879 gene locus_tag LOCUS_25210 <1697 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879818.1:glutamyl-tRNA(Gln) amidotransferase >Feature sequence704 396 163 gene locus_tag LOCUS_25220 396 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 <1695 469 gene locus_tag LOCUS_25230 <1695 469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704012.1:putative lipase >Feature sequence705 1534 239 gene locus_tag LOCUS_25240 gene ftsZ 1534 239 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45500 protein_id gnl|my_center|LOCUS_25240 >Feature sequence706 >Feature sequence707 <1 738 gene locus_tag LOCUS_25250 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977273.1:rRNA methyltransferase 769 1338 gene locus_tag LOCUS_25260 gene def 769 1338 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJE7 protein_id gnl|my_center|LOCUS_25260 >Feature sequence708 375 1475 gene locus_tag LOCUS_25270 375 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 >Feature sequence709 1396 149 gene locus_tag LOCUS_25280 1396 149 CDS product transposase for insertion sequence element IS1081 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60230 protein_id gnl|my_center|LOCUS_25280 >Feature sequence710 >Feature sequence711 409 1395 gene locus_tag LOCUS_25290 409 1395 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405405.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence712 646 14 gene locus_tag LOCUS_25300 646 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 protein_id gnl|my_center|LOCUS_25300 <1659 745 gene locus_tag LOCUS_25310 <1659 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224376.1:alpha/beta hydrolase >Feature sequence713 127 792 gene locus_tag LOCUS_25320 127 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 789 1658 gene locus_tag LOCUS_25330 789 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702358.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence714 <1 792 gene locus_tag LOCUS_25340 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9FBM1:4-hydroxy-3-methylbut-2-enyl diphosphate reductase 800 1420 gene locus_tag LOCUS_25350 800 1420 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228646.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence715 1329 463 gene locus_tag LOCUS_25360 1329 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 >Feature sequence716 42 854 gene locus_tag LOCUS_25370 42 854 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072376.1 protein_id gnl|my_center|LOCUS_25370 1169 882 gene locus_tag LOCUS_25380 1169 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267656.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence717 235 648 gene locus_tag LOCUS_25390 gene hisI 235 648 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2U1 protein_id gnl|my_center|LOCUS_25390 645 1274 gene locus_tag LOCUS_25400 645 1274 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028113.1 protein_id gnl|my_center|LOCUS_25400 1409 1624 gene locus_tag LOCUS_25410 1409 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence718 <1 591 gene locus_tag LOCUS_25420 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224815.1:cyclopropane-fatty-acyl-phospholipid synthase 651 1484 gene locus_tag LOCUS_25430 651 1484 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224814.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence719 1024 119 gene locus_tag LOCUS_25440 1024 119 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223020.1 protein_id gnl|my_center|LOCUS_25440 1563 1036 gene locus_tag LOCUS_25450 gene ispF 1563 1036 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MAL7 protein_id gnl|my_center|LOCUS_25450 >Feature sequence720 257 178 gene locus_tag LOCUS_t00440 257 178 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1205 357 gene locus_tag LOCUS_25460 1205 357 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974354.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence721 >Feature sequence722 1330 824 gene locus_tag LOCUS_25470 1330 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence723 784 89 gene locus_tag LOCUS_25480 784 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 <1637 790 gene locus_tag LOCUS_25490 <1637 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X909:DNA topoisomerase 1 >Feature sequence724 <1632 717 gene locus_tag LOCUS_25500 <1632 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222688.1:cholesterol oxidase >Feature sequence725 297 1190 gene locus_tag LOCUS_25510 297 1190 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978272.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence726 1629 226 gene locus_tag LOCUS_25520 1629 226 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224866.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence727 251 1066 gene locus_tag LOCUS_25530 251 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113090.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence728 >Feature sequence729 1162 488 gene locus_tag LOCUS_25540 1162 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028120.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence730 1616 693 gene locus_tag LOCUS_25550 1616 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence731 1616 1425 gene locus_tag LOCUS_25560 1616 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence732 1445 1293 gene locus_tag LOCUS_25570 1445 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 >Feature sequence733 462 10 gene locus_tag LOCUS_25580 462 10 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225005.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence734 >Feature sequence735 >Feature sequence736 >Feature sequence737 >Feature sequence738 <1 586 gene locus_tag LOCUS_25590 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E3D8U1:transport permease protein 586 1386 gene locus_tag LOCUS_25600 586 1386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_25600 >Feature sequence739 <1592 1026 gene locus_tag LOCUS_25610 <1592 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WGR7:putative oxidoreductase >Feature sequence740 479 1591 gene locus_tag LOCUS_25620 479 1591 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MKX7 protein_id gnl|my_center|LOCUS_25620 >Feature sequence741 <1 1429 gene locus_tag LOCUS_25630 <1 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MBH4:DNA-directed DNA polymerase >Feature sequence742 167 1090 gene locus_tag LOCUS_25640 gene miaA 167 1090 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0N2 protein_id gnl|my_center|LOCUS_25640 >Feature sequence743 >Feature sequence744 >Feature sequence745 <1 1320 gene locus_tag LOCUS_25650 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001252808.1:sensor histidine kinase >Feature sequence746 <1 526 gene locus_tag LOCUS_25660 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973941.1:PadR family transcriptional regulator 523 1263 gene locus_tag LOCUS_25670 523 1263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_25670 >Feature sequence747 600 28 gene locus_tag LOCUS_25680 gene rimM 600 28 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4D3 protein_id gnl|my_center|LOCUS_25680 940 701 gene locus_tag LOCUS_25690 940 701 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A4Q4 protein_id gnl|my_center|LOCUS_25690 1437 943 gene locus_tag LOCUS_25700 gene rpsP 1437 943 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MDI6 protein_id gnl|my_center|LOCUS_25700 >Feature sequence748 805 188 gene locus_tag LOCUS_25710 805 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 <1550 870 gene locus_tag LOCUS_25720 <1550 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3DES2:kynureninase >Feature sequence749 257 1498 gene locus_tag LOCUS_25730 257 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence750 1 1155 gene locus_tag LOCUS_25740 1 1155 CDS product major facilitator superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705338.1 protein_id gnl|my_center|LOCUS_25740 1548 1174 gene locus_tag LOCUS_25750 1548 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence751 >Feature sequence752 361 840 gene locus_tag LOCUS_25760 361 840 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975090.1 protein_id gnl|my_center|LOCUS_25760 >Feature sequence753 408 1067 gene locus_tag LOCUS_25770 408 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 >Feature sequence754 <1 756 gene locus_tag LOCUS_25780 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804976.1:thiamin pyrophosphokinase >Feature sequence755 412 1350 gene locus_tag LOCUS_25790 gene atpG 412 1350 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K4D4 protein_id gnl|my_center|LOCUS_25790 >Feature sequence756 <1 603 gene locus_tag LOCUS_25800 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015557.1:RNA-splicing ligase RtcB >Feature sequence757 268 723 gene locus_tag LOCUS_25810 268 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence758 >Feature sequence759 >Feature sequence760 843 256 gene locus_tag LOCUS_25820 843 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820