>Feature sequence001 1060 44 gene locus_tag LOCUS_00010 gene wzz 1060 44 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_00010 1436 1119 gene locus_tag LOCUS_00020 gene ihfB 1436 1119 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8P6 protein_id gnl|my_center|LOCUS_00020 3206 1533 gene locus_tag LOCUS_00030 gene rpsA 3206 1533 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z2 protein_id gnl|my_center|LOCUS_00030 4021 3329 gene locus_tag LOCUS_00040 gene cmk 4021 3329 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ92 protein_id gnl|my_center|LOCUS_00040 5330 4134 gene locus_tag LOCUS_00050 gene lapB 5330 4134 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_00050 6252 5392 gene locus_tag LOCUS_00060 gene tyrA 6252 5392 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943244.1 protein_id gnl|my_center|LOCUS_00060 7394 6249 gene locus_tag LOCUS_00070 gene hisC2 7394 6249 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_00070 8524 7436 gene locus_tag LOCUS_00080 gene pheA 8524 7436 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_00080 11245 8630 gene locus_tag LOCUS_00090 gene gyrA 11245 8630 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVM3 protein_id gnl|my_center|LOCUS_00090 11476 12486 gene locus_tag LOCUS_00100 gene uge 11476 12486 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_00100 12535 13881 gene locus_tag LOCUS_00110 12535 13881 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037414.1 protein_id gnl|my_center|LOCUS_00110 13878 14600 gene locus_tag LOCUS_00120 gene ubiG 13878 14600 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ63 protein_id gnl|my_center|LOCUS_00120 15349 14627 gene locus_tag LOCUS_00130 gene dnaQ 15349 14627 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705465.1 protein_id gnl|my_center|LOCUS_00130 15790 15353 gene locus_tag LOCUS_00140 gene rnhA 15790 15353 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIS7 protein_id gnl|my_center|LOCUS_00140 16575 15793 gene locus_tag LOCUS_00150 16575 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16692 18152 gene locus_tag LOCUS_00160 16692 18152 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 protein_id gnl|my_center|LOCUS_00160 18163 18552 gene locus_tag LOCUS_00170 18163 18552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 protein_id gnl|my_center|LOCUS_00170 19580 18576 gene locus_tag LOCUS_00180 gene rpoS 19580 18576 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_00180 20507 19683 gene locus_tag LOCUS_00190 20507 19683 CDS product lipoprotein NlpD/LppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45682 protein_id gnl|my_center|LOCUS_00190 21089 20511 gene locus_tag LOCUS_00200 21089 20511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704776.1 protein_id gnl|my_center|LOCUS_00200 21763 21089 gene locus_tag LOCUS_00210 gene pcm 21763 21089 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45683 protein_id gnl|my_center|LOCUS_00210 22548 21769 gene locus_tag LOCUS_00220 gene surE 22548 21769 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S4T3 protein_id gnl|my_center|LOCUS_00220 22973 22638 gene locus_tag LOCUS_00230 22973 22638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23228 22977 gene locus_tag LOCUS_00240 23228 22977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25171 23321 gene locus_tag LOCUS_00250 25171 23321 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_00250 25666 25190 gene locus_tag LOCUS_00260 25666 25190 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_00260 25953 26534 gene locus_tag LOCUS_00270 25953 26534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27035 26544 gene locus_tag LOCUS_00280 gene ispF 27035 26544 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NT90 protein_id gnl|my_center|LOCUS_00280 27760 27032 gene locus_tag LOCUS_00290 gene ispD 27760 27032 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUJ2 protein_id gnl|my_center|LOCUS_00290 28087 27797 gene locus_tag LOCUS_00300 28087 27797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29413 28115 gene locus_tag LOCUS_00310 gene eno 29413 28115 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J10 protein_id gnl|my_center|LOCUS_00310 30310 29480 gene locus_tag LOCUS_00320 gene kdsA 30310 29480 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B43 protein_id gnl|my_center|LOCUS_00320 31964 30297 gene locus_tag LOCUS_00330 gene pyrG 31964 30297 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWA4 protein_id gnl|my_center|LOCUS_00330 32112 32768 gene locus_tag LOCUS_00340 32112 32768 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842287.1 protein_id gnl|my_center|LOCUS_00340 32892 33719 gene locus_tag LOCUS_00350 gene comL 32892 33719 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MKW7 protein_id gnl|my_center|LOCUS_00350 35383 33737 gene locus_tag LOCUS_00360 gene nadE 35383 33737 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_00360 35547 35918 gene locus_tag LOCUS_00370 35547 35918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36916 36041 gene locus_tag LOCUS_00380 gene sucD 36916 36041 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53591 protein_id gnl|my_center|LOCUS_00380 38099 36936 gene locus_tag LOCUS_00390 gene sucC 38099 36936 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY39 protein_id gnl|my_center|LOCUS_00390 38263 38502 gene locus_tag LOCUS_00400 38263 38502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 38864 38493 gene locus_tag LOCUS_00410 38864 38493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40824 38935 gene locus_tag LOCUS_00420 gene thiC 40824 38935 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9E7 protein_id gnl|my_center|LOCUS_00420 41321 42757 gene locus_tag LOCUS_00430 41321 42757 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892598.1 protein_id gnl|my_center|LOCUS_00430 42978 44069 gene locus_tag LOCUS_00440 42978 44069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00440 >Feature sequence002 1490 2266 gene locus_tag LOCUS_00450 1490 2266 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061780.1 protein_id gnl|my_center|LOCUS_00450 2558 3661 gene locus_tag LOCUS_00460 2558 3661 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810994.1 protein_id gnl|my_center|LOCUS_00460 3865 3668 gene locus_tag LOCUS_00470 3865 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 3797 4417 gene locus_tag LOCUS_00480 3797 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 4503 5831 gene locus_tag LOCUS_00490 4503 5831 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707214.1 protein_id gnl|my_center|LOCUS_00490 5871 6152 gene locus_tag LOCUS_00500 5871 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582865.1 protein_id gnl|my_center|LOCUS_00500 6160 7329 gene locus_tag LOCUS_00510 6160 7329 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582864.1 protein_id gnl|my_center|LOCUS_00510 7403 8710 gene locus_tag LOCUS_00520 gene hisD 7403 8710 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTY8 protein_id gnl|my_center|LOCUS_00520 8714 9481 gene locus_tag LOCUS_00530 8714 9481 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530852.1 protein_id gnl|my_center|LOCUS_00530 9478 10500 gene locus_tag LOCUS_00540 9478 10500 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029016.1 protein_id gnl|my_center|LOCUS_00540 11465 10557 gene locus_tag LOCUS_00550 gene bioH 11465 10557 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF3 protein_id gnl|my_center|LOCUS_00550 11868 13712 gene locus_tag LOCUS_00560 11868 13712 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211151.1 protein_id gnl|my_center|LOCUS_00560 14872 13772 gene locus_tag LOCUS_00570 gene selU 14872 13772 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAG6 protein_id gnl|my_center|LOCUS_00570 17707 14924 gene locus_tag LOCUS_00580 gene valS 17707 14924 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH0 protein_id gnl|my_center|LOCUS_00580 18240 17812 gene locus_tag LOCUS_00590 gene holC 18240 17812 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68823 protein_id gnl|my_center|LOCUS_00590 18362 18793 gene locus_tag LOCUS_00600 18362 18793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 19288 18923 gene locus_tag LOCUS_00610 19288 18923 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX8 protein_id gnl|my_center|LOCUS_00610 21244 19292 gene locus_tag LOCUS_00620 21244 19292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 21368 22222 gene locus_tag LOCUS_00630 gene rsmI 21368 22222 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCL2 protein_id gnl|my_center|LOCUS_00630 23039 23500 gene locus_tag LOCUS_00640 gene mraZ 23039 23500 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ4 protein_id gnl|my_center|LOCUS_00640 23497 24435 gene locus_tag LOCUS_00650 gene rsmH 23497 24435 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ5 protein_id gnl|my_center|LOCUS_00650 24432 24698 gene locus_tag LOCUS_00660 24432 24698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 24695 26404 gene locus_tag LOCUS_00670 gene pbpB 24695 26404 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946651.1 protein_id gnl|my_center|LOCUS_00670 26401 27921 gene locus_tag LOCUS_00680 gene murE 26401 27921 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59650 protein_id gnl|my_center|LOCUS_00680 27909 29297 gene locus_tag LOCUS_00690 gene murF 27909 29297 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F27 protein_id gnl|my_center|LOCUS_00690 29287 30369 gene locus_tag LOCUS_00700 gene mraY 29287 30369 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_00700 30372 31745 gene locus_tag LOCUS_00710 gene murD 30372 31745 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ9 protein_id gnl|my_center|LOCUS_00710 31733 32968 gene locus_tag LOCUS_00720 gene ftsW 31733 32968 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCY0 protein_id gnl|my_center|LOCUS_00720 32965 34071 gene locus_tag LOCUS_00730 gene murG 32965 34071 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX2 protein_id gnl|my_center|LOCUS_00730 34068 35543 gene locus_tag LOCUS_00740 gene murC 34068 35543 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW02 protein_id gnl|my_center|LOCUS_00740 35533 36447 gene locus_tag LOCUS_00750 gene murB 35533 36447 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA6 protein_id gnl|my_center|LOCUS_00750 36444 37397 gene locus_tag LOCUS_00760 gene ddlB 36444 37397 CDS product D-alanine--D-alanine ligase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT6 protein_id gnl|my_center|LOCUS_00760 37394 38263 gene locus_tag LOCUS_00770 gene ftsQ 37394 38263 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P9 protein_id gnl|my_center|LOCUS_00770 38274 39509 gene locus_tag LOCUS_00780 gene ftsA 38274 39509 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_00780 39594 40838 gene locus_tag LOCUS_00790 gene ftsZ 39594 40838 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSB0 protein_id gnl|my_center|LOCUS_00790 >Feature sequence003 826 89 gene locus_tag LOCUS_00800 826 89 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 protein_id gnl|my_center|LOCUS_00800 2148 823 gene locus_tag LOCUS_00810 2148 823 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058014.1 protein_id gnl|my_center|LOCUS_00810 2567 2145 gene locus_tag LOCUS_00820 2567 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058015.1 protein_id gnl|my_center|LOCUS_00820 3982 2564 gene locus_tag LOCUS_00830 3982 2564 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058017.1 protein_id gnl|my_center|LOCUS_00830 4475 4197 gene locus_tag LOCUS_00840 4475 4197 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67616 protein_id gnl|my_center|LOCUS_00840 5680 4622 gene locus_tag LOCUS_00850 5680 4622 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707926.1 protein_id gnl|my_center|LOCUS_00850 7373 5757 gene locus_tag LOCUS_00860 7373 5757 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388526.1 protein_id gnl|my_center|LOCUS_00860 8527 7439 gene locus_tag LOCUS_00870 8527 7439 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974534.1 protein_id gnl|my_center|LOCUS_00870 8827 9486 gene locus_tag LOCUS_00880 8827 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707298.1 protein_id gnl|my_center|LOCUS_00880 9490 10203 gene locus_tag LOCUS_00890 9490 10203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707299.1 protein_id gnl|my_center|LOCUS_00890 10200 11468 gene locus_tag LOCUS_00900 10200 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_00900 11472 12143 gene locus_tag LOCUS_00910 11472 12143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 12249 13169 gene locus_tag LOCUS_00920 12249 13169 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933760.1 protein_id gnl|my_center|LOCUS_00920 13166 13879 gene locus_tag LOCUS_00930 13166 13879 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_00930 13869 14735 gene locus_tag LOCUS_00940 13869 14735 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933758.1 protein_id gnl|my_center|LOCUS_00940 14732 15166 gene locus_tag LOCUS_00950 14732 15166 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247038.1 protein_id gnl|my_center|LOCUS_00950 16002 15250 gene locus_tag LOCUS_00960 16002 15250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085971.1 protein_id gnl|my_center|LOCUS_00960 16757 15999 gene locus_tag LOCUS_00970 16757 15999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086140.1 protein_id gnl|my_center|LOCUS_00970 17912 16773 gene locus_tag LOCUS_00980 17912 16773 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067081.1 protein_id gnl|my_center|LOCUS_00980 18939 17926 gene locus_tag LOCUS_00990 18939 17926 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088975.1 protein_id gnl|my_center|LOCUS_00990 20388 19033 gene locus_tag LOCUS_01000 20388 19033 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869553.1 protein_id gnl|my_center|LOCUS_01000 21288 20734 gene locus_tag LOCUS_01010 21288 20734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 protein_id gnl|my_center|LOCUS_01010 26904 21343 gene locus_tag LOCUS_01020 26904 21343 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749I5 protein_id gnl|my_center|LOCUS_01020 27060 28049 gene locus_tag LOCUS_01030 gene srkA 27060 28049 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YG6 protein_id gnl|my_center|LOCUS_01030 28367 28074 gene locus_tag LOCUS_01040 28367 28074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 28515 28591 gene locus_tag LOCUS_t00010 28515 28591 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29859 28606 gene locus_tag LOCUS_01050 29859 28606 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639983.1 protein_id gnl|my_center|LOCUS_01050 30080 29862 gene locus_tag LOCUS_01060 30080 29862 CDS product putative HTH-type transcriptional regulator y4mF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55565 protein_id gnl|my_center|LOCUS_01060 30709 30239 gene locus_tag LOCUS_01070 gene psbV 30709 30239 CDS product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A386 protein_id gnl|my_center|LOCUS_01070 31749 30748 gene locus_tag LOCUS_01080 31749 30748 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_01080 32836 32039 gene locus_tag LOCUS_01090 32836 32039 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086101.1 protein_id gnl|my_center|LOCUS_01090 33738 32833 gene locus_tag LOCUS_01100 33738 32833 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972722.1 protein_id gnl|my_center|LOCUS_01100 34669 33818 gene locus_tag LOCUS_01110 34669 33818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228671.1 protein_id gnl|my_center|LOCUS_01110 34912 35778 gene locus_tag LOCUS_01120 34912 35778 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532884.1 protein_id gnl|my_center|LOCUS_01120 35775 36878 gene locus_tag LOCUS_01130 35775 36878 CDS product L-talarate/galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218254.1 protein_id gnl|my_center|LOCUS_01130 37084 37389 gene locus_tag LOCUS_01140 37084 37389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 37392 37766 gene locus_tag LOCUS_01150 37392 37766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 37973 37886 gene locus_tag LOCUS_t00020 37973 37886 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence004 1564 179 gene locus_tag LOCUS_01160 1564 179 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809423.1 protein_id gnl|my_center|LOCUS_01160 5577 1675 gene locus_tag LOCUS_01170 5577 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 6051 7058 gene locus_tag LOCUS_01180 6051 7058 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 protein_id gnl|my_center|LOCUS_01180 7111 9201 gene locus_tag LOCUS_01190 7111 9201 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895468.1 protein_id gnl|my_center|LOCUS_01190 9677 9264 gene locus_tag LOCUS_01200 9677 9264 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141678.1 protein_id gnl|my_center|LOCUS_01200 9913 9674 gene locus_tag LOCUS_01210 9913 9674 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK01 protein_id gnl|my_center|LOCUS_01210 15081 10162 gene locus_tag LOCUS_01220 15081 10162 CDS product sugar-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267397.1 protein_id gnl|my_center|LOCUS_01220 16162 15167 gene locus_tag LOCUS_01230 16162 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 19174 16574 gene locus_tag LOCUS_01240 gene clpB 19174 16574 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP3 protein_id gnl|my_center|LOCUS_01240 19323 20639 gene locus_tag LOCUS_01250 gene aroA 19323 20639 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRB0 protein_id gnl|my_center|LOCUS_01250 21393 20662 gene locus_tag LOCUS_01260 21393 20662 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE6 protein_id gnl|my_center|LOCUS_01260 22403 21390 gene locus_tag LOCUS_01270 gene rluD 22403 21390 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P682 protein_id gnl|my_center|LOCUS_01270 22410 23486 gene locus_tag LOCUS_01280 gene hisC1 22410 23486 CDS product histidinol-phosphate aminotransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX0 protein_id gnl|my_center|LOCUS_01280 23499 25829 gene locus_tag LOCUS_01290 23499 25829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 25850 26788 gene locus_tag LOCUS_01300 25850 26788 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930857.1 protein_id gnl|my_center|LOCUS_01300 27056 26847 gene locus_tag LOCUS_01310 27056 26847 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_01310 30810 27433 gene locus_tag LOCUS_01320 gene mfd 30810 27433 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK3 protein_id gnl|my_center|LOCUS_01320 30940 31818 gene locus_tag LOCUS_01330 30940 31818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 31901 32185 gene locus_tag LOCUS_01340 31901 32185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 33071 32616 gene locus_tag LOCUS_01350 33071 32616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 35248 33242 gene locus_tag LOCUS_01360 35248 33242 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337730.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence005 49 522 gene locus_tag LOCUS_01370 49 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 720 1688 gene locus_tag LOCUS_01380 720 1688 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_01380 1681 2652 gene locus_tag LOCUS_01390 1681 2652 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_01390 2667 3191 gene locus_tag LOCUS_01400 gene kdsC 2667 3191 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZB47 protein_id gnl|my_center|LOCUS_01400 3197 3766 gene locus_tag LOCUS_01410 3197 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 3795 4319 gene locus_tag LOCUS_01420 3795 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 4339 5064 gene locus_tag LOCUS_01430 4339 5064 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996178.1 protein_id gnl|my_center|LOCUS_01430 5213 6694 gene locus_tag LOCUS_01440 gene rpoN 5213 6694 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49988 protein_id gnl|my_center|LOCUS_01440 6778 7101 gene locus_tag LOCUS_01450 gene yfiA-2 6778 7101 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_01450 7157 7627 gene locus_tag LOCUS_01460 gene ptsN 7157 7627 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202935.1 protein_id gnl|my_center|LOCUS_01460 7634 8584 gene locus_tag LOCUS_01470 gene hprK 7634 8584 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XL0 protein_id gnl|my_center|LOCUS_01470 8589 9452 gene locus_tag LOCUS_01480 gene rapZ 8589 9452 CDS product RNase adapter protein RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32BC8 protein_id gnl|my_center|LOCUS_01480 9562 9900 gene locus_tag LOCUS_01490 9562 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_01490 9934 10203 gene locus_tag LOCUS_01500 gene ptsH 9934 10203 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_01500 10219 11577 gene locus_tag LOCUS_01510 gene mgtE 10219 11577 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P704 protein_id gnl|my_center|LOCUS_01510 12184 11585 gene locus_tag LOCUS_01520 12184 11585 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476475.1 protein_id gnl|my_center|LOCUS_01520 12993 12244 gene locus_tag LOCUS_01530 12993 12244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 13248 15119 gene locus_tag LOCUS_01540 gene dxs 13248 15119 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 protein_id gnl|my_center|LOCUS_01540 16219 15158 gene locus_tag LOCUS_01550 16219 15158 CDS product farnesyl-diphosphate farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_01550 16594 16259 gene locus_tag LOCUS_01560 16594 16259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 20695 16595 gene locus_tag LOCUS_01570 20695 16595 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037738.1 protein_id gnl|my_center|LOCUS_01570 22208 20742 gene locus_tag LOCUS_01580 gene cafA 22208 20742 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_01580 22712 22236 gene locus_tag LOCUS_01590 gene rlmH 22712 22236 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ4 protein_id gnl|my_center|LOCUS_01590 23066 22725 gene locus_tag LOCUS_01600 23066 22725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 23979 23293 gene locus_tag LOCUS_01610 gene nadD 23979 23293 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX21 protein_id gnl|my_center|LOCUS_01610 25258 23960 gene locus_tag LOCUS_01620 gene proA 25258 23960 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX20 protein_id gnl|my_center|LOCUS_01620 26327 25317 gene locus_tag LOCUS_01630 gene holA 26327 25317 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268982.1 protein_id gnl|my_center|LOCUS_01630 26833 26324 gene locus_tag LOCUS_01640 26833 26324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 29418 26830 gene locus_tag LOCUS_01650 gene leuS 29418 26830 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX33 protein_id gnl|my_center|LOCUS_01650 29565 30038 gene locus_tag LOCUS_01660 gene aroQ1 29565 30038 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFR5 protein_id gnl|my_center|LOCUS_01660 <35301 30077 gene locus_tag LOCUS_01670 <35301 30077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228630.1:polyketide synthase >Feature sequence006 2179 1208 gene locus_tag LOCUS_01680 2179 1208 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969966.1 protein_id gnl|my_center|LOCUS_01680 2596 2441 gene locus_tag LOCUS_01690 2596 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 2538 3653 gene locus_tag LOCUS_01700 2538 3653 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083872.1 protein_id gnl|my_center|LOCUS_01700 3715 4647 gene locus_tag LOCUS_01710 3715 4647 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 protein_id gnl|my_center|LOCUS_01710 4650 5633 gene locus_tag LOCUS_01720 4650 5633 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083885.1 protein_id gnl|my_center|LOCUS_01720 5626 6378 gene locus_tag LOCUS_01730 5626 6378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 protein_id gnl|my_center|LOCUS_01730 6371 7069 gene locus_tag LOCUS_01740 6371 7069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 protein_id gnl|my_center|LOCUS_01740 10220 7149 gene locus_tag LOCUS_01750 10220 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 10530 11588 gene locus_tag LOCUS_01760 10530 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 11851 12156 gene locus_tag LOCUS_01770 11851 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 12351 12701 gene locus_tag LOCUS_01780 12351 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 12751 14016 gene locus_tag LOCUS_01790 gene fccB-2 12751 14016 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933736.1 protein_id gnl|my_center|LOCUS_01790 15647 14304 gene locus_tag LOCUS_01800 15647 14304 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532892.1 protein_id gnl|my_center|LOCUS_01800 15930 16136 gene locus_tag LOCUS_01810 15930 16136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 16194 17183 gene locus_tag LOCUS_01820 16194 17183 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_01820 17237 17701 gene locus_tag LOCUS_01830 gene trmL 17237 17701 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDX5 protein_id gnl|my_center|LOCUS_01830 18262 17735 gene locus_tag LOCUS_01840 18262 17735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_01840 18363 18680 gene locus_tag LOCUS_01850 18363 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 18701 20893 gene locus_tag LOCUS_01860 gene spoT 18701 20893 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_01860 20980 21369 gene locus_tag LOCUS_01870 20980 21369 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096609.1 protein_id gnl|my_center|LOCUS_01870 21482 22315 gene locus_tag LOCUS_01880 gene thyA 21482 22315 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_01880 22331 22837 gene locus_tag LOCUS_01890 gene folA 22331 22837 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_01890 23063 23812 gene locus_tag LOCUS_01900 23063 23812 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_01900 24517 23846 gene locus_tag LOCUS_01910 24517 23846 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_01910 24530 25219 gene locus_tag LOCUS_01920 24530 25219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 25253 27529 gene locus_tag LOCUS_01930 gene ptsP 25253 27529 CDS product phosphoenolpyruvate-protein phosphotransferase PtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_01930 28122 27526 gene locus_tag LOCUS_01940 28122 27526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_01940 28224 29267 gene locus_tag LOCUS_01950 gene argC 28224 29267 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Q9 protein_id gnl|my_center|LOCUS_01950 29275 30000 gene locus_tag LOCUS_01960 29275 30000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 30060 30482 gene locus_tag LOCUS_01970 30060 30482 CDS product cell shape determination protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_01970 30549 30917 gene locus_tag LOCUS_01980 gene erpA 30549 30917 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LY4 protein_id gnl|my_center|LOCUS_01980 32571 30985 gene locus_tag LOCUS_01990 32571 30985 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767873.1 protein_id gnl|my_center|LOCUS_01990 32747 33970 gene locus_tag LOCUS_02000 gene tyrS 32747 33970 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB3 protein_id gnl|my_center|LOCUS_02000 >Feature sequence007 78 299 gene locus_tag LOCUS_02010 78 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 414 980 gene locus_tag LOCUS_02020 414 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 1109 3535 gene locus_tag LOCUS_02030 gene lon 1109 3535 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5F9 protein_id gnl|my_center|LOCUS_02030 3577 4233 gene locus_tag LOCUS_02040 3577 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 4230 4727 gene locus_tag LOCUS_02050 4230 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263638.1 protein_id gnl|my_center|LOCUS_02050 5160 4789 gene locus_tag LOCUS_02060 gene trxC 5160 4789 CDS product putative thioredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RD25 protein_id gnl|my_center|LOCUS_02060 5372 7039 gene locus_tag LOCUS_02070 5372 7039 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_02070 9791 7125 gene locus_tag LOCUS_02080 9791 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 9895 10623 gene locus_tag LOCUS_02090 gene dsbC 9895 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_02090 11548 10679 gene locus_tag LOCUS_02100 11548 10679 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105274.1 protein_id gnl|my_center|LOCUS_02100 12340 12023 gene locus_tag LOCUS_02110 12340 12023 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_02110 16072 12533 gene locus_tag LOCUS_02120 gene dnaE 16072 12533 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG0 protein_id gnl|my_center|LOCUS_02120 16653 16069 gene locus_tag LOCUS_02130 gene rnhB 16653 16069 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR4 protein_id gnl|my_center|LOCUS_02130 17795 16647 gene locus_tag LOCUS_02140 gene lpxB 17795 16647 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY8 protein_id gnl|my_center|LOCUS_02140 18568 17795 gene locus_tag LOCUS_02150 gene lpxA 18568 17795 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5W3 protein_id gnl|my_center|LOCUS_02150 19175 18738 gene locus_tag LOCUS_02160 gene fabZ 19175 18738 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG4 protein_id gnl|my_center|LOCUS_02160 20310 19222 gene locus_tag LOCUS_02170 gene lpxD 20310 19222 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY6 protein_id gnl|my_center|LOCUS_02170 20924 20397 gene locus_tag LOCUS_02180 20924 20397 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208832.1 protein_id gnl|my_center|LOCUS_02180 23211 20935 gene locus_tag LOCUS_02190 gene opr86 23211 20935 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY4 protein_id gnl|my_center|LOCUS_02190 24758 23367 gene locus_tag LOCUS_02200 gene rseP 24758 23367 CDS product regulator of sigma E protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9A4 protein_id gnl|my_center|LOCUS_02200 25986 24799 gene locus_tag LOCUS_02210 gene dxr 25986 24799 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU6 protein_id gnl|my_center|LOCUS_02210 26633 25992 gene locus_tag LOCUS_02220 26633 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 26578 26859 gene locus_tag LOCUS_02230 26578 26859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 27587 26823 gene locus_tag LOCUS_02240 gene uppS 27587 26823 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG7 protein_id gnl|my_center|LOCUS_02240 28191 27634 gene locus_tag LOCUS_02250 gene frr 28191 27634 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 protein_id gnl|my_center|LOCUS_02250 28938 28222 gene locus_tag LOCUS_02260 gene pyrH 28938 28222 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82852 protein_id gnl|my_center|LOCUS_02260 29854 28982 gene locus_tag LOCUS_02270 gene tsf 29854 28982 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS9 protein_id gnl|my_center|LOCUS_02270 30697 29966 gene locus_tag LOCUS_02280 gene rpsB 30697 29966 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG3 protein_id gnl|my_center|LOCUS_02280 31111 31878 gene locus_tag LOCUS_02290 gene map 31111 31878 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_02290 >Feature sequence008 1515 766 gene locus_tag LOCUS_02300 1515 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 1684 2955 gene locus_tag LOCUS_02310 1684 2955 CDS product selenium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888164.1 protein_id gnl|my_center|LOCUS_02310 3103 4989 gene locus_tag LOCUS_02320 3103 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 5091 5609 gene locus_tag LOCUS_02330 5091 5609 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338439.1 protein_id gnl|my_center|LOCUS_02330 5921 7249 gene locus_tag LOCUS_02340 5921 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 7356 7772 gene locus_tag LOCUS_02350 7356 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 7963 8289 gene locus_tag LOCUS_02360 7963 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897305.1 protein_id gnl|my_center|LOCUS_02360 8270 8575 gene locus_tag LOCUS_02370 8270 8575 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245507.1 protein_id gnl|my_center|LOCUS_02370 10674 8728 gene locus_tag LOCUS_02380 gene acsA2 10674 8728 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_02380 11548 10901 gene locus_tag LOCUS_02390 gene hflD 11548 10901 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVC8 protein_id gnl|my_center|LOCUS_02390 12829 11573 gene locus_tag LOCUS_02400 gene mnmA 12829 11573 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 protein_id gnl|my_center|LOCUS_02400 12964 13332 gene locus_tag LOCUS_02410 gene clpS 12964 13332 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L7 protein_id gnl|my_center|LOCUS_02410 13379 15670 gene locus_tag LOCUS_02420 gene clpA 13379 15670 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_02420 15915 15697 gene locus_tag LOCUS_02430 gene infA 15915 15697 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65116 protein_id gnl|my_center|LOCUS_02430 16724 16029 gene locus_tag LOCUS_02440 gene ate 16724 16029 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRK9 protein_id gnl|my_center|LOCUS_02440 17464 16721 gene locus_tag LOCUS_02450 gene aat 17464 16721 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 protein_id gnl|my_center|LOCUS_02450 18435 17485 gene locus_tag LOCUS_02460 gene trxB1 18435 17485 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_02460 18626 20989 gene locus_tag LOCUS_02470 gene ftsK 18626 20989 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P993 protein_id gnl|my_center|LOCUS_02470 21167 21793 gene locus_tag LOCUS_02480 gene lolA 21167 21793 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUM8 protein_id gnl|my_center|LOCUS_02480 21780 23183 gene locus_tag LOCUS_02490 21780 23183 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104507.1 protein_id gnl|my_center|LOCUS_02490 23265 23639 gene locus_tag LOCUS_02500 gene crcB 23265 23639 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEF5 protein_id gnl|my_center|LOCUS_02500 24527 23694 gene locus_tag LOCUS_02510 gene folE2 24527 23694 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JF5 protein_id gnl|my_center|LOCUS_02510 25713 24811 gene locus_tag LOCUS_02520 25713 24811 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 protein_id gnl|my_center|LOCUS_02520 26082 25765 gene locus_tag LOCUS_02530 26082 25765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 26381 26797 gene locus_tag LOCUS_02540 26381 26797 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_02540 26927 28258 gene locus_tag LOCUS_02550 26927 28258 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_02550 28312 28896 gene locus_tag LOCUS_02560 28312 28896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_02560 29799 28909 gene locus_tag LOCUS_02570 29799 28909 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_02570 31129 29879 gene locus_tag LOCUS_02580 31129 29879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 >Feature sequence009 74 352 gene locus_tag LOCUS_02590 74 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605676.1 protein_id gnl|my_center|LOCUS_02590 365 673 gene locus_tag LOCUS_02600 365 673 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390589.1 protein_id gnl|my_center|LOCUS_02600 828 2714 gene locus_tag LOCUS_02610 gene parE 828 2714 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUJ8 protein_id gnl|my_center|LOCUS_02610 2717 4981 gene locus_tag LOCUS_02620 gene parC 2717 4981 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK1 protein_id gnl|my_center|LOCUS_02620 5479 4982 gene locus_tag LOCUS_02630 gene allA 5479 4982 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MG82 protein_id gnl|my_center|LOCUS_02630 6483 5476 gene locus_tag LOCUS_02640 gene alc2 6483 5476 CDS product putative allantoicase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QS9 protein_id gnl|my_center|LOCUS_02640 6959 6480 gene locus_tag LOCUS_02650 6959 6480 CDS product OHCU decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267252.1 protein_id gnl|my_center|LOCUS_02650 7965 7054 gene locus_tag LOCUS_02660 7965 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083336.1 protein_id gnl|my_center|LOCUS_02660 8125 9312 gene locus_tag LOCUS_02670 8125 9312 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887369.1 protein_id gnl|my_center|LOCUS_02670 9359 9700 gene locus_tag LOCUS_02680 9359 9700 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CI04 protein_id gnl|my_center|LOCUS_02680 9817 10752 gene locus_tag LOCUS_02690 9817 10752 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975756.1 protein_id gnl|my_center|LOCUS_02690 10753 11514 gene locus_tag LOCUS_02700 10753 11514 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGP9 protein_id gnl|my_center|LOCUS_02700 11633 12472 gene locus_tag LOCUS_02710 gene yrbF 11633 12472 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261187.1 protein_id gnl|my_center|LOCUS_02710 12469 13257 gene locus_tag LOCUS_02720 12469 13257 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707619.1 protein_id gnl|my_center|LOCUS_02720 13263 13733 gene locus_tag LOCUS_02730 13263 13733 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313587.1 protein_id gnl|my_center|LOCUS_02730 13914 14282 gene locus_tag LOCUS_02740 13914 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 14353 15618 gene locus_tag LOCUS_02750 gene murA 14353 15618 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_02750 15640 16290 gene locus_tag LOCUS_02760 gene hisG 15640 16290 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64347 protein_id gnl|my_center|LOCUS_02760 16323 17675 gene locus_tag LOCUS_02770 gene hisD 16323 17675 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW9 protein_id gnl|my_center|LOCUS_02770 18864 17731 gene locus_tag LOCUS_02780 gene algW 18864 17731 CDS product AlgW protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098831.1 protein_id gnl|my_center|LOCUS_02780 19088 19687 gene locus_tag LOCUS_02790 gene petA 19088 19687 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8B9 protein_id gnl|my_center|LOCUS_02790 19684 20904 gene locus_tag LOCUS_02800 19684 20904 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_02800 20904 21659 gene locus_tag LOCUS_02810 gene petC 20904 21659 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037465.1 protein_id gnl|my_center|LOCUS_02810 21791 22198 gene locus_tag LOCUS_02820 gene sspB 21791 22198 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037463.1 protein_id gnl|my_center|LOCUS_02820 22606 22328 gene locus_tag LOCUS_02830 22606 22328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262507.1 protein_id gnl|my_center|LOCUS_02830 22913 22593 gene locus_tag LOCUS_02840 22913 22593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 23541 22936 gene locus_tag LOCUS_02850 23541 22936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 24164 23541 gene locus_tag LOCUS_02860 gene gmhA 24164 23541 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX7 protein_id gnl|my_center|LOCUS_02860 24337 24960 gene locus_tag LOCUS_02870 gene mtnB 24337 24960 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP13 protein_id gnl|my_center|LOCUS_02870 24957 25655 gene locus_tag LOCUS_02880 gene mtnC 24957 25655 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I340 protein_id gnl|my_center|LOCUS_02880 26686 25652 gene locus_tag LOCUS_02890 gene mtnA 26686 25652 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP09 protein_id gnl|my_center|LOCUS_02890 26840 27793 gene locus_tag LOCUS_02900 gene accA 26840 27793 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63ST0 protein_id gnl|my_center|LOCUS_02900 27907 29244 gene locus_tag LOCUS_02910 gene tilS 27907 29244 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHJ7 protein_id gnl|my_center|LOCUS_02910 29272 29988 gene locus_tag LOCUS_02920 gene cmoA 29272 29988 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NS48 protein_id gnl|my_center|LOCUS_02920 29989 30996 gene locus_tag LOCUS_02930 gene cmoB 29989 30996 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QV5 protein_id gnl|my_center|LOCUS_02930 >Feature sequence010 1977 1285 gene locus_tag LOCUS_02940 gene phoB 1977 1285 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036177.1 protein_id gnl|my_center|LOCUS_02940 2751 2035 gene locus_tag LOCUS_02950 gene phoU 2751 2035 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM14 protein_id gnl|my_center|LOCUS_02950 3672 2851 gene locus_tag LOCUS_02960 gene pstB 3672 2851 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_02960 5383 3707 gene locus_tag LOCUS_02970 gene pstA 5383 3707 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_02970 7755 5434 gene locus_tag LOCUS_02980 7755 5434 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269389.1 protein_id gnl|my_center|LOCUS_02980 7845 9290 gene locus_tag LOCUS_02990 gene phr 7845 9290 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036625.1 protein_id gnl|my_center|LOCUS_02990 9956 9354 gene locus_tag LOCUS_03000 gene lexA 9956 9354 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFY7 protein_id gnl|my_center|LOCUS_03000 10934 10239 gene locus_tag LOCUS_03010 10934 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_03010 11614 10934 gene locus_tag LOCUS_03020 11614 10934 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_03020 12581 11688 gene locus_tag LOCUS_03030 12581 11688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 13193 12615 gene locus_tag LOCUS_03040 gene ampD 13193 12615 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194313.1 protein_id gnl|my_center|LOCUS_03040 15455 13230 gene locus_tag LOCUS_03050 15455 13230 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095037.1 protein_id gnl|my_center|LOCUS_03050 18328 15515 gene locus_tag LOCUS_03060 18328 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 18524 19207 gene locus_tag LOCUS_03070 18524 19207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 19770 19294 gene locus_tag LOCUS_03080 19770 19294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 20602 19913 gene locus_tag LOCUS_03090 gene lolD 20602 19913 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT78 protein_id gnl|my_center|LOCUS_03090 21752 20595 gene locus_tag LOCUS_03100 21752 20595 CDS product lipoprotein releasing system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_03100 23482 21923 gene locus_tag LOCUS_03110 23482 21923 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055172.1 protein_id gnl|my_center|LOCUS_03110 23610 25958 gene locus_tag LOCUS_03120 23610 25958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 25965 27035 gene locus_tag LOCUS_03130 gene aguA 25965 27035 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_03130 27032 27910 gene locus_tag LOCUS_03140 gene aguB 27032 27910 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_03140 28733 27924 gene locus_tag LOCUS_03150 28733 27924 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_03150 29224 28751 gene locus_tag LOCUS_03160 29224 28751 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_03160 29456 30043 gene locus_tag LOCUS_03170 29456 30043 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_03170 30040 30960 gene locus_tag LOCUS_03180 gene rarD 30040 30960 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073920.1 protein_id gnl|my_center|LOCUS_03180 >Feature sequence011 438 1106 gene locus_tag LOCUS_03190 438 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03190 1224 2324 gene locus_tag LOCUS_03200 1224 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 2321 2641 gene locus_tag LOCUS_03210 2321 2641 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259323.1 protein_id gnl|my_center|LOCUS_03210 2748 5603 gene locus_tag LOCUS_03220 2748 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 5269 5360 gene locus_tag LOCUS_t00030 5269 5360 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5607 6443 gene locus_tag LOCUS_03230 5607 6443 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564704.1 protein_id gnl|my_center|LOCUS_03230 6444 7094 gene locus_tag LOCUS_03240 6444 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 7437 7757 gene locus_tag LOCUS_03250 7437 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 7777 8139 gene locus_tag LOCUS_03260 7777 8139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03260 8404 8177 gene locus_tag LOCUS_03270 8404 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 8543 9115 gene locus_tag LOCUS_03280 8543 9115 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_03280 9278 10345 gene locus_tag LOCUS_03290 9278 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 10435 12018 gene locus_tag LOCUS_03300 gene coxA 10435 12018 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q4 protein_id gnl|my_center|LOCUS_03300 12279 12857 gene locus_tag LOCUS_03310 gene ctaG 12279 12857 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_03310 12919 13779 gene locus_tag LOCUS_03320 gene cox3 12919 13779 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_03320 14093 13875 gene locus_tag LOCUS_03330 14093 13875 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038908.1 protein_id gnl|my_center|LOCUS_03330 14194 14937 gene locus_tag LOCUS_03340 14194 14937 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XT0 protein_id gnl|my_center|LOCUS_03340 15045 15605 gene locus_tag LOCUS_03350 15045 15605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 15615 16598 gene locus_tag LOCUS_03360 gene ctaA 15615 16598 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_03360 16620 17537 gene locus_tag LOCUS_03370 gene cyoE 16620 17537 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CV6 protein_id gnl|my_center|LOCUS_03370 17589 18137 gene locus_tag LOCUS_03380 17589 18137 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_03380 18218 19009 gene locus_tag LOCUS_03390 18218 19009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 protein_id gnl|my_center|LOCUS_03390 19037 21400 gene locus_tag LOCUS_03400 gene mrcB 19037 21400 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD31 protein_id gnl|my_center|LOCUS_03400 21795 21595 gene locus_tag LOCUS_03410 21795 21595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 21795 22169 gene locus_tag LOCUS_03420 21795 22169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 22260 22415 gene locus_tag LOCUS_03430 22260 22415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 22431 23273 gene locus_tag LOCUS_03440 22431 23273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 23266 23835 gene locus_tag LOCUS_03450 23266 23835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 24224 23877 gene locus_tag LOCUS_03460 24224 23877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 24464 24252 gene locus_tag LOCUS_03470 24464 24252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 26116 24593 gene locus_tag LOCUS_03480 gene xseA 26116 24593 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8D9 protein_id gnl|my_center|LOCUS_03480 26207 27661 gene locus_tag LOCUS_03490 gene guaB 26207 27661 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX10 protein_id gnl|my_center|LOCUS_03490 27778 29367 gene locus_tag LOCUS_03500 gene guaA 27778 29367 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXM6 protein_id gnl|my_center|LOCUS_03500 29462 30175 gene locus_tag LOCUS_03510 29462 30175 CDS product methyltransferase, TIGR04325 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084681.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence012 2032 227 gene locus_tag LOCUS_03520 2032 227 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_03520 3567 2077 gene locus_tag LOCUS_03530 3567 2077 CDS product deoxycytidylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001901328.1 protein_id gnl|my_center|LOCUS_03530 3590 3841 gene locus_tag LOCUS_03540 3590 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5131 3890 gene locus_tag LOCUS_03550 5131 3890 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533371.1 protein_id gnl|my_center|LOCUS_03550 5426 5106 gene locus_tag LOCUS_03560 5426 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 5644 6126 gene locus_tag LOCUS_03570 5644 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 7513 6143 gene locus_tag LOCUS_03580 7513 6143 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703747.1 protein_id gnl|my_center|LOCUS_03580 10357 7538 gene locus_tag LOCUS_03590 gene rapA 10357 7538 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYT6 protein_id gnl|my_center|LOCUS_03590 11572 10568 gene locus_tag LOCUS_03600 gene idhA 11572 10568 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68965 protein_id gnl|my_center|LOCUS_03600 12908 11739 gene locus_tag LOCUS_03610 12908 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143177.1 protein_id gnl|my_center|LOCUS_03610 13107 16073 gene locus_tag LOCUS_03620 gene glnE 13107 16073 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF4 protein_id gnl|my_center|LOCUS_03620 16099 17019 gene locus_tag LOCUS_03630 gene ilvE 16099 17019 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_03630 17069 17284 gene locus_tag LOCUS_03640 17069 17284 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_03640 17306 18337 gene locus_tag LOCUS_03650 gene rfaF 17306 18337 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958358.1 protein_id gnl|my_center|LOCUS_03650 18511 18777 gene locus_tag LOCUS_03660 18511 18777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 18861 20075 gene locus_tag LOCUS_03670 18861 20075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 20075 22474 gene locus_tag LOCUS_03680 20075 22474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 22467 25529 gene locus_tag LOCUS_03690 22467 25529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 25519 26445 gene locus_tag LOCUS_03700 25519 26445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 26951 28651 gene locus_tag LOCUS_03710 gene cas4-cas1 26951 28651 CDS product CRISPR-associated exonuclease Cas4/endonuclease Cas1 fusion inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H36 protein_id gnl|my_center|LOCUS_03710 28704 28994 gene locus_tag LOCUS_03720 gene cas2 28704 28994 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H35 protein_id gnl|my_center|LOCUS_03720 29222 29471 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttcctcggcaggatgccgaggcctcattgaagc >Feature sequence013 1058 1621 gene locus_tag LOCUS_03730 1058 1621 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB9 protein_id gnl|my_center|LOCUS_03730 1618 3123 gene locus_tag LOCUS_03740 1618 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 3120 4172 gene locus_tag LOCUS_03750 gene rnfD 3120 4172 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV93 protein_id gnl|my_center|LOCUS_03750 4169 4819 gene locus_tag LOCUS_03760 4169 4819 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB6 protein_id gnl|my_center|LOCUS_03760 4788 5480 gene locus_tag LOCUS_03770 4788 5480 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW9 protein_id gnl|my_center|LOCUS_03770 5477 6112 gene locus_tag LOCUS_03780 gene nth 5477 6112 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRK1 protein_id gnl|my_center|LOCUS_03780 6248 7129 gene locus_tag LOCUS_03790 6248 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 8394 7174 gene locus_tag LOCUS_03800 gene argG 8394 7174 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_03800 8742 11423 gene locus_tag LOCUS_03810 gene aceE 8742 11423 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZL9 protein_id gnl|my_center|LOCUS_03810 11433 12743 gene locus_tag LOCUS_03820 11433 12743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 12903 14150 gene locus_tag LOCUS_03830 12903 14150 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529656.1 protein_id gnl|my_center|LOCUS_03830 14197 14502 gene locus_tag LOCUS_03840 gene soxD 14197 14502 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524301.1 protein_id gnl|my_center|LOCUS_03840 14499 17522 gene locus_tag LOCUS_03850 gene soxA 14499 17522 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524300.1 protein_id gnl|my_center|LOCUS_03850 17528 18112 gene locus_tag LOCUS_03860 17528 18112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 18245 19933 gene locus_tag LOCUS_03870 gene fhs 18245 19933 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92N42 protein_id gnl|my_center|LOCUS_03870 20120 20935 gene locus_tag LOCUS_03880 gene fabI 20120 20935 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUA3 protein_id gnl|my_center|LOCUS_03880 22885 20990 gene locus_tag LOCUS_03890 22885 20990 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM3 protein_id gnl|my_center|LOCUS_03890 23074 22998 gene locus_tag LOCUS_t00040 23074 22998 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 23234 23159 gene locus_tag LOCUS_t00050 23234 23159 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 23564 23292 gene locus_tag LOCUS_03900 gene hupA 23564 23292 CDS product DNA-binding protein HU 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08821 protein_id gnl|my_center|LOCUS_03900 26430 23974 gene locus_tag LOCUS_03910 gene lon 26430 23974 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS34 protein_id gnl|my_center|LOCUS_03910 27784 26459 gene locus_tag LOCUS_03920 gene clpX 27784 26459 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM6 protein_id gnl|my_center|LOCUS_03920 >Feature sequence014 444 151 gene locus_tag LOCUS_03930 444 151 CDS product DNA-binding prophage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346132.1 protein_id gnl|my_center|LOCUS_03930 1606 851 gene locus_tag LOCUS_03940 1606 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_03940 2824 1847 gene locus_tag LOCUS_03950 2824 1847 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267154.1 protein_id gnl|my_center|LOCUS_03950 3450 2821 gene locus_tag LOCUS_03960 gene tmk 3450 2821 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX2 protein_id gnl|my_center|LOCUS_03960 4460 3447 gene locus_tag LOCUS_03970 4460 3447 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267152.1 protein_id gnl|my_center|LOCUS_03970 5775 4537 gene locus_tag LOCUS_03980 5775 4537 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH6 protein_id gnl|my_center|LOCUS_03980 6195 5956 gene locus_tag LOCUS_03990 gene acpP 6195 5956 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63447 protein_id gnl|my_center|LOCUS_03990 6980 6315 gene locus_tag LOCUS_04000 gene fabG 6980 6315 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 protein_id gnl|my_center|LOCUS_04000 8035 7106 gene locus_tag LOCUS_04010 8035 7106 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLP3 protein_id gnl|my_center|LOCUS_04010 9128 8157 gene locus_tag LOCUS_04020 gene fabH 9128 8157 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV1 protein_id gnl|my_center|LOCUS_04020 10147 9125 gene locus_tag LOCUS_04030 gene plsX 10147 9125 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP8 protein_id gnl|my_center|LOCUS_04030 10485 10279 gene locus_tag LOCUS_04040 gene rpmF 10485 10279 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH0 protein_id gnl|my_center|LOCUS_04040 11286 10687 gene locus_tag LOCUS_04050 gene yceD 11286 10687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174481.1 protein_id gnl|my_center|LOCUS_04050 11379 11981 gene locus_tag LOCUS_04060 11379 11981 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG7 protein_id gnl|my_center|LOCUS_04060 13048 12065 gene locus_tag LOCUS_04070 13048 12065 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_04070 14088 13045 gene locus_tag LOCUS_04080 gene rluC 14088 13045 CDS product ribosomal large subunit pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM9 protein_id gnl|my_center|LOCUS_04080 14528 17164 gene locus_tag LOCUS_04090 14528 17164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 17742 17239 gene locus_tag LOCUS_04100 gene ptpA 17742 17239 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557108.1 protein_id gnl|my_center|LOCUS_04100 18896 17793 gene locus_tag LOCUS_04110 18896 17793 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_04110 19233 18889 gene locus_tag LOCUS_04120 19233 18889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 19592 19504 gene locus_tag LOCUS_t00060 19592 19504 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20696 19641 gene locus_tag LOCUS_04130 gene prfB 20696 19641 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EN98 protein_id gnl|my_center|LOCUS_04130 20903 21823 gene locus_tag LOCUS_04140 gene gluQ 20903 21823 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6E8 protein_id gnl|my_center|LOCUS_04140 22298 22032 gene locus_tag LOCUS_04150 22298 22032 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_04150 22710 23357 gene locus_tag LOCUS_04160 gene pdxH 22710 23357 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NTZ4 protein_id gnl|my_center|LOCUS_04160 24589 23372 gene locus_tag LOCUS_04170 gene trpS 24589 23372 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947173.1 protein_id gnl|my_center|LOCUS_04170 25320 24664 gene locus_tag LOCUS_04180 25320 24664 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_04180 25991 25344 gene locus_tag LOCUS_04190 25991 25344 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947172.1 protein_id gnl|my_center|LOCUS_04190 <26747 26049 gene locus_tag LOCUS_04200 <26747 26049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193008.1:phosphatase >Feature sequence015 833 1093 gene locus_tag LOCUS_04210 833 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 2392 1307 gene locus_tag LOCUS_04220 2392 1307 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_04220 3381 2719 gene locus_tag LOCUS_04230 3381 2719 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528294.1 protein_id gnl|my_center|LOCUS_04230 4529 3378 gene locus_tag LOCUS_04240 4529 3378 CDS product gamma-butyrobetaine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_04240 6955 4598 gene locus_tag LOCUS_04250 gene comA 6955 4598 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_04250 7956 7003 gene locus_tag LOCUS_04260 7956 7003 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038996.1 protein_id gnl|my_center|LOCUS_04260 9465 8068 gene locus_tag LOCUS_04270 gene aceA 9465 8068 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 protein_id gnl|my_center|LOCUS_04270 9743 10708 gene locus_tag LOCUS_04280 gene rbcR 9743 10708 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_04280 10853 11089 gene locus_tag LOCUS_04290 10853 11089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 11220 13022 gene locus_tag LOCUS_04300 11220 13022 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_04300 13033 14199 gene locus_tag LOCUS_04310 13033 14199 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480910.1 protein_id gnl|my_center|LOCUS_04310 14687 14277 gene locus_tag LOCUS_04320 14687 14277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 15845 14856 gene locus_tag LOCUS_04330 15845 14856 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122373.1 protein_id gnl|my_center|LOCUS_04330 17296 15923 gene locus_tag LOCUS_04340 17296 15923 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 protein_id gnl|my_center|LOCUS_04340 18433 17468 gene locus_tag LOCUS_04350 18433 17468 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089050.1 protein_id gnl|my_center|LOCUS_04350 19266 18484 gene locus_tag LOCUS_04360 gene nadX 19266 18484 CDS product putative L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63LV9 protein_id gnl|my_center|LOCUS_04360 19439 20398 gene locus_tag LOCUS_04370 19439 20398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 20601 21164 gene locus_tag LOCUS_04380 gene nbaC 20601 21164 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_04380 21195 22172 gene locus_tag LOCUS_04390 21195 22172 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087196.1 protein_id gnl|my_center|LOCUS_04390 22238 22780 gene locus_tag LOCUS_04400 22238 22780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 22777 24036 gene locus_tag LOCUS_04410 22777 24036 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975203.1 protein_id gnl|my_center|LOCUS_04410 24610 24362 gene locus_tag LOCUS_04420 24610 24362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 25312 24893 gene locus_tag LOCUS_04430 25312 24893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 26041 25535 gene locus_tag LOCUS_04440 26041 25535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 <26723 26100 gene locus_tag LOCUS_04450 <26723 26100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400420.1:MFS transporter >Feature sequence016 4 390 gene locus_tag LOCUS_04460 4 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 832 1266 gene locus_tag LOCUS_04470 832 1266 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 protein_id gnl|my_center|LOCUS_04470 2575 1292 gene locus_tag LOCUS_04480 gene moeA 2575 1292 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812683.1 protein_id gnl|my_center|LOCUS_04480 3145 2603 gene locus_tag LOCUS_04490 3145 2603 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_04490 3364 4917 gene locus_tag LOCUS_04500 3364 4917 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 protein_id gnl|my_center|LOCUS_04500 4970 7384 gene locus_tag LOCUS_04510 4970 7384 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 protein_id gnl|my_center|LOCUS_04510 7584 8300 gene locus_tag LOCUS_04520 gene ttcA 7584 8300 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW7 protein_id gnl|my_center|LOCUS_04520 8370 9260 gene locus_tag LOCUS_04530 8370 9260 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401447.1 protein_id gnl|my_center|LOCUS_04530 9869 9288 gene locus_tag LOCUS_04540 9869 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 11176 9866 gene locus_tag LOCUS_04550 gene cca 11176 9866 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7ND45 protein_id gnl|my_center|LOCUS_04550 12039 11173 gene locus_tag LOCUS_04560 12039 11173 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550970.1 protein_id gnl|my_center|LOCUS_04560 13300 12191 gene locus_tag LOCUS_04570 13300 12191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 14924 13551 gene locus_tag LOCUS_04580 14924 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 15689 14928 gene locus_tag LOCUS_04590 15689 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 16636 15686 gene locus_tag LOCUS_04600 16636 15686 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_04600 16945 16778 gene locus_tag LOCUS_04610 gene rpmG 16945 16778 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57187 protein_id gnl|my_center|LOCUS_04610 17193 16957 gene locus_tag LOCUS_04620 gene rpmB 17193 16957 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P366 protein_id gnl|my_center|LOCUS_04620 17429 18565 gene locus_tag LOCUS_04630 17429 18565 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932765.1 protein_id gnl|my_center|LOCUS_04630 20089 18596 gene locus_tag LOCUS_04640 gene ubiD 20089 18596 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZP7 protein_id gnl|my_center|LOCUS_04640 20753 20097 gene locus_tag LOCUS_04650 20753 20097 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931226.1 protein_id gnl|my_center|LOCUS_04650 21197 20886 gene locus_tag LOCUS_04660 gene soxZ 21197 20886 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_04660 21714 21256 gene locus_tag LOCUS_04670 gene soxY 21714 21256 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_04670 22045 23307 gene locus_tag LOCUS_04680 gene lysA 22045 23307 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19572 protein_id gnl|my_center|LOCUS_04680 23477 23388 gene locus_tag LOCUS_t00070 23477 23388 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23870 23598 gene locus_tag LOCUS_04690 23870 23598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 25318 24083 gene locus_tag LOCUS_04700 gene lysC 25318 24083 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69077 protein_id gnl|my_center|LOCUS_04700 >Feature sequence017 1160 510 gene locus_tag LOCUS_04710 gene trmB 1160 510 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HT7 protein_id gnl|my_center|LOCUS_04710 2019 1228 gene locus_tag LOCUS_04720 gene thiG 2019 1228 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P632 protein_id gnl|my_center|LOCUS_04720 2425 2126 gene locus_tag LOCUS_04730 2425 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 2460 2533 gene locus_tag LOCUS_t00080 2460 2533 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2621 4990 gene locus_tag LOCUS_04740 2621 4990 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732543.1 protein_id gnl|my_center|LOCUS_04740 4994 6118 gene locus_tag LOCUS_04750 gene mutY 4994 6118 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927127.1 protein_id gnl|my_center|LOCUS_04750 6679 6248 gene locus_tag LOCUS_04760 6679 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 7705 6698 gene locus_tag LOCUS_04770 7705 6698 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879022.1 protein_id gnl|my_center|LOCUS_04770 7986 8240 gene locus_tag LOCUS_04780 7986 8240 CDS product MazE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042074.1 protein_id gnl|my_center|LOCUS_04780 8240 8572 gene locus_tag LOCUS_04790 8240 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 9366 8614 gene locus_tag LOCUS_04800 9366 8614 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704853.1 protein_id gnl|my_center|LOCUS_04800 9537 9785 gene locus_tag LOCUS_04810 9537 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 10140 10847 gene locus_tag LOCUS_04820 10140 10847 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263640.1 protein_id gnl|my_center|LOCUS_04820 10929 14573 gene locus_tag LOCUS_04830 10929 14573 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920227.1 protein_id gnl|my_center|LOCUS_04830 14658 15476 gene locus_tag LOCUS_04840 14658 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 15827 15522 gene locus_tag LOCUS_04850 15827 15522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_04850 16622 15870 gene locus_tag LOCUS_04860 gene moeB 16622 15870 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114696.1 protein_id gnl|my_center|LOCUS_04860 16691 17248 gene locus_tag LOCUS_04870 gene moaC 16691 17248 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMD3 protein_id gnl|my_center|LOCUS_04870 17693 17172 gene locus_tag LOCUS_04880 17693 17172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 18138 17734 gene locus_tag LOCUS_04890 18138 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 18573 18145 gene locus_tag LOCUS_04900 18573 18145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 19400 18573 gene locus_tag LOCUS_04910 19400 18573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 20427 19519 gene locus_tag LOCUS_04920 20427 19519 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 protein_id gnl|my_center|LOCUS_04920 20543 21151 gene locus_tag LOCUS_04930 gene azoR 20543 21151 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DD3 protein_id gnl|my_center|LOCUS_04930 21157 22032 gene locus_tag LOCUS_04940 21157 22032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261699.1 protein_id gnl|my_center|LOCUS_04940 22162 22620 gene locus_tag LOCUS_04950 gene sufE 22162 22620 CDS product cysteine desulfuration protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPC1 protein_id gnl|my_center|LOCUS_04950 23507 22623 gene locus_tag LOCUS_04960 23507 22623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 23944 23504 gene locus_tag LOCUS_04970 gene hisI 23944 23504 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTY3 protein_id gnl|my_center|LOCUS_04970 24299 25444 gene locus_tag LOCUS_04980 24299 25444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence018 456 142 gene locus_tag LOCUS_04990 456 142 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_04990 538 1179 gene locus_tag LOCUS_05000 gene coq7 538 1179 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD67 protein_id gnl|my_center|LOCUS_05000 2051 1218 gene locus_tag LOCUS_05010 gene speD 2051 1218 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z9 protein_id gnl|my_center|LOCUS_05010 2476 2063 gene locus_tag LOCUS_05020 2476 2063 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_05020 3300 2497 gene locus_tag LOCUS_05030 gene trpC 3300 2497 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD70 protein_id gnl|my_center|LOCUS_05030 4319 3297 gene locus_tag LOCUS_05040 gene trpD 4319 3297 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML2 protein_id gnl|my_center|LOCUS_05040 4938 4345 gene locus_tag LOCUS_05050 gene trpG 4938 4345 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_05050 6455 4929 gene locus_tag LOCUS_05060 6455 4929 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_05060 7300 6596 gene locus_tag LOCUS_05070 gene rpe 7300 6596 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5T1 protein_id gnl|my_center|LOCUS_05070 7837 7436 gene locus_tag LOCUS_05080 7837 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 9506 8031 gene locus_tag LOCUS_05090 9506 8031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 9749 9673 gene locus_tag LOCUS_t00090 9749 9673 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10171 10830 gene locus_tag LOCUS_05100 10171 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 12187 10856 gene locus_tag LOCUS_05110 gene argA 12187 10856 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQX8 protein_id gnl|my_center|LOCUS_05110 12354 12767 gene locus_tag LOCUS_05120 12354 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 13694 12783 gene locus_tag LOCUS_05130 gene xerD 13694 12783 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWY5 protein_id gnl|my_center|LOCUS_05130 13839 14408 gene locus_tag LOCUS_05140 gene efp 13839 14408 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KX9 protein_id gnl|my_center|LOCUS_05140 14420 15418 gene locus_tag LOCUS_05150 gene epmA 14420 15418 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNS6 protein_id gnl|my_center|LOCUS_05150 15944 15447 gene locus_tag LOCUS_05160 15944 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 16747 16007 gene locus_tag LOCUS_05170 gene phbB 16747 16007 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037438.1 protein_id gnl|my_center|LOCUS_05170 18031 16835 gene locus_tag LOCUS_05180 gene atoB 18031 16835 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2A8 protein_id gnl|my_center|LOCUS_05180 18379 19317 gene locus_tag LOCUS_05190 18379 19317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 19322 20380 gene locus_tag LOCUS_05200 gene phbC 19322 20380 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_05200 20641 22371 gene locus_tag LOCUS_05210 20641 22371 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480939.1 protein_id gnl|my_center|LOCUS_05210 22575 24359 gene locus_tag LOCUS_05220 gene gspA 22575 24359 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_05220 24714 24421 gene locus_tag LOCUS_05230 24714 24421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 24662 25069 gene locus_tag LOCUS_05240 24662 25069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 >Feature sequence019 2312 3865 gene locus_tag LOCUS_05250 2312 3865 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_05250 4492 3881 gene locus_tag LOCUS_05260 gene gmk 4492 3881 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTM2 protein_id gnl|my_center|LOCUS_05260 4704 4629 gene locus_tag LOCUS_t00100 4704 4629 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5814 4906 gene locus_tag LOCUS_05270 5814 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_05270 6378 5824 gene locus_tag LOCUS_05280 6378 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 7989 6793 gene locus_tag LOCUS_05290 gene aatA 7989 6793 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZE1 protein_id gnl|my_center|LOCUS_05290 8138 10204 gene locus_tag LOCUS_05300 gene uvrB 8138 10204 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC3 protein_id gnl|my_center|LOCUS_05300 10277 10522 gene locus_tag LOCUS_05310 10277 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770970.1 protein_id gnl|my_center|LOCUS_05310 10649 10942 gene locus_tag LOCUS_05320 10649 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05320 12768 11152 gene locus_tag LOCUS_05330 12768 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 13124 14962 gene locus_tag LOCUS_05340 13124 14962 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_05340 15080 15466 gene locus_tag LOCUS_05350 gene sdhC 15080 15466 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217390.1 protein_id gnl|my_center|LOCUS_05350 15463 15804 gene locus_tag LOCUS_05360 15463 15804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 15830 17602 gene locus_tag LOCUS_05370 gene sdhA 15830 17602 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJK5 protein_id gnl|my_center|LOCUS_05370 17642 18340 gene locus_tag LOCUS_05380 gene sdhB-1 17642 18340 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAZ6 protein_id gnl|my_center|LOCUS_05380 18340 18642 gene locus_tag LOCUS_05390 18340 18642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 18659 19057 gene locus_tag LOCUS_05400 18659 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 19130 19795 gene locus_tag LOCUS_05410 19130 19795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 20166 21818 gene locus_tag LOCUS_05420 20166 21818 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_05420 23329 21887 gene locus_tag LOCUS_05430 23329 21887 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_05430 23443 23682 gene locus_tag LOCUS_05440 23443 23682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 23953 24816 gene locus_tag LOCUS_05450 23953 24816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence020 5614 3878 gene locus_tag LOCUS_05460 5614 3878 CDS product hemolysin secretion/activation protein, ShlB/FhaC/HecB family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210212.1 protein_id gnl|my_center|LOCUS_05460 6050 6793 gene locus_tag LOCUS_05470 gene nrdJb 6050 6793 CDS product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_05470 6857 9280 gene locus_tag LOCUS_05480 gene pbpC 6857 9280 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036244.1 protein_id gnl|my_center|LOCUS_05480 9356 10336 gene locus_tag LOCUS_05490 9356 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 11203 10388 gene locus_tag LOCUS_05500 gene plsC 11203 10388 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310200.1 protein_id gnl|my_center|LOCUS_05500 12174 11293 gene locus_tag LOCUS_05510 gene rpoH 12174 11293 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_05510 12299 13618 gene locus_tag LOCUS_05520 12299 13618 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_05520 13722 13970 gene locus_tag LOCUS_05530 13722 13970 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172325.1 protein_id gnl|my_center|LOCUS_05530 14955 14065 gene locus_tag LOCUS_05540 gene argB 14955 14065 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_05540 16209 14998 gene locus_tag LOCUS_05550 gene coaBC 16209 14998 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_05550 16251 16928 gene locus_tag LOCUS_05560 16251 16928 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN5 protein_id gnl|my_center|LOCUS_05560 17006 19123 gene locus_tag LOCUS_05570 gene recG 17006 19123 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEZ6 protein_id gnl|my_center|LOCUS_05570 19174 20007 gene locus_tag LOCUS_05580 19174 20007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 20679 20011 gene locus_tag LOCUS_05590 20679 20011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 21176 20676 gene locus_tag LOCUS_05600 21176 20676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 21946 21173 gene locus_tag LOCUS_05610 21946 21173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 22785 21946 gene locus_tag LOCUS_05620 22785 21946 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_05620 23095 22847 gene locus_tag LOCUS_05630 23095 22847 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947375.1 protein_id gnl|my_center|LOCUS_05630 23300 24487 gene locus_tag LOCUS_05640 23300 24487 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963666.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence021 1639 2 gene locus_tag LOCUS_05650 gene groL1 1639 2 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNR7 protein_id gnl|my_center|LOCUS_05650 1976 1686 gene locus_tag LOCUS_05660 gene groS 1976 1686 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXP4 protein_id gnl|my_center|LOCUS_05660 2610 2152 gene locus_tag LOCUS_05670 gene fxsA 2610 2152 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_05670 2743 5229 gene locus_tag LOCUS_05680 2743 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 5361 5825 gene locus_tag LOCUS_05690 gene accB 5361 5825 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707112.1 protein_id gnl|my_center|LOCUS_05690 5838 7184 gene locus_tag LOCUS_05700 gene accC 5838 7184 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035764.1 protein_id gnl|my_center|LOCUS_05700 7195 8067 gene locus_tag LOCUS_05710 gene prmA 7195 8067 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUW3 protein_id gnl|my_center|LOCUS_05710 8197 8481 gene locus_tag LOCUS_05720 gene fis 8197 8481 CDS product DNA-binding protein Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64127 protein_id gnl|my_center|LOCUS_05720 8538 10106 gene locus_tag LOCUS_05730 gene purH 8538 10106 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FJ9 protein_id gnl|my_center|LOCUS_05730 10117 11391 gene locus_tag LOCUS_05740 gene purD 10117 11391 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPD1 protein_id gnl|my_center|LOCUS_05740 11611 11904 gene locus_tag LOCUS_05750 11611 11904 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390816.1 protein_id gnl|my_center|LOCUS_05750 12979 12065 gene locus_tag LOCUS_05760 gene argF 12979 12065 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGE2 protein_id gnl|my_center|LOCUS_05760 14235 13042 gene locus_tag LOCUS_05770 gene argD 14235 13042 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MCV5 protein_id gnl|my_center|LOCUS_05770 14940 14353 gene locus_tag LOCUS_05780 14940 14353 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW3 protein_id gnl|my_center|LOCUS_05780 16393 15245 gene locus_tag LOCUS_05790 16393 15245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 16631 16954 gene locus_tag LOCUS_05800 16631 16954 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG33 protein_id gnl|my_center|LOCUS_05800 17600 16971 gene locus_tag LOCUS_05810 gene rnt 17600 16971 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY82 protein_id gnl|my_center|LOCUS_05810 18301 17597 gene locus_tag LOCUS_05820 18301 17597 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266245.1 protein_id gnl|my_center|LOCUS_05820 18978 18298 gene locus_tag LOCUS_05830 gene trmH 18978 18298 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JHV5 protein_id gnl|my_center|LOCUS_05830 20684 19155 gene locus_tag LOCUS_05840 20684 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 21218 21544 gene locus_tag LOCUS_05850 gene trxA 21218 21544 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_05850 21989 23248 gene locus_tag LOCUS_05860 gene rho 21989 23248 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A25 protein_id gnl|my_center|LOCUS_05860 23458 24015 gene locus_tag LOCUS_05870 23458 24015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703843.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence022 565 2280 gene locus_tag LOCUS_05880 565 2280 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027075.1 protein_id gnl|my_center|LOCUS_05880 2303 2584 gene locus_tag LOCUS_05890 2303 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 2604 4733 gene locus_tag LOCUS_05900 2604 4733 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_05900 4730 5827 gene locus_tag LOCUS_05910 4730 5827 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202631.1 protein_id gnl|my_center|LOCUS_05910 5992 7485 gene locus_tag LOCUS_05920 5992 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 7504 8733 gene locus_tag LOCUS_05930 7504 8733 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_05930 8871 9782 gene locus_tag LOCUS_05940 gene lpxC 8871 9782 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_05940 10887 9826 gene locus_tag LOCUS_05950 10887 9826 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090277.1 protein_id gnl|my_center|LOCUS_05950 10886 11068 gene locus_tag LOCUS_05960 10886 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 11881 11105 gene locus_tag LOCUS_05970 11881 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 12648 11977 gene locus_tag LOCUS_05980 12648 11977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 12979 12797 gene locus_tag LOCUS_05990 12979 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 13603 13097 gene locus_tag LOCUS_06000 13603 13097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 14215 13607 gene locus_tag LOCUS_06010 14215 13607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 14714 14262 gene locus_tag LOCUS_06020 gene dut 14714 14262 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52597 protein_id gnl|my_center|LOCUS_06020 15265 14927 gene locus_tag LOCUS_06030 15265 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 16007 15456 gene locus_tag LOCUS_06040 16007 15456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 16444 16848 gene locus_tag LOCUS_06050 16444 16848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 16986 17288 gene locus_tag LOCUS_06060 16986 17288 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390234.1 protein_id gnl|my_center|LOCUS_06060 17308 17673 gene locus_tag LOCUS_06070 17308 17673 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_06070 19169 17682 gene locus_tag LOCUS_06080 gene comM 19169 17682 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_06080 19505 19206 gene locus_tag LOCUS_06090 19505 19206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 protein_id gnl|my_center|LOCUS_06090 19741 21627 gene locus_tag LOCUS_06100 gene speA 19741 21627 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P448 protein_id gnl|my_center|LOCUS_06100 22594 21683 gene locus_tag LOCUS_06110 gene xerC 22594 21683 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8D1K0 protein_id gnl|my_center|LOCUS_06110 23187 22591 gene locus_tag LOCUS_06120 23187 22591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 23968 23880 gene locus_tag LOCUS_t00110 23968 23880 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence023 1499 120 gene locus_tag LOCUS_06130 1499 120 CDS product serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363717.1 protein_id gnl|my_center|LOCUS_06130 2201 1623 gene locus_tag LOCUS_06140 2201 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 2864 2208 gene locus_tag LOCUS_06150 2864 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 3576 2971 gene locus_tag LOCUS_06160 gene algU 3576 2971 CDS product RNA polymerase sigma-H factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06198 protein_id gnl|my_center|LOCUS_06160 3829 4998 gene locus_tag LOCUS_06170 gene rosB 3829 4998 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957591.1 protein_id gnl|my_center|LOCUS_06170 5406 5056 gene locus_tag LOCUS_06180 5406 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_06180 5584 5381 gene locus_tag LOCUS_06190 5584 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140129.1 protein_id gnl|my_center|LOCUS_06190 5939 5649 gene locus_tag LOCUS_06200 5939 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 7341 6025 gene locus_tag LOCUS_06210 gene gdhA 7341 6025 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_06210 8925 7579 gene locus_tag LOCUS_06220 8925 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 9406 11844 gene locus_tag LOCUS_06230 9406 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 11895 12725 gene locus_tag LOCUS_06240 11895 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 12735 14441 gene locus_tag LOCUS_06250 12735 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 14654 16825 gene locus_tag LOCUS_06260 14654 16825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 17080 16829 gene locus_tag LOCUS_06270 17080 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 16992 18782 gene locus_tag LOCUS_06280 16992 18782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 18814 22800 gene locus_tag LOCUS_06290 18814 22800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 22932 23162 gene locus_tag LOCUS_06300 22932 23162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 23162 23314 gene locus_tag LOCUS_06310 23162 23314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 24193 23288 gene locus_tag LOCUS_06320 24193 23288 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001351048.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence024 575 246 gene locus_tag LOCUS_06330 575 246 CDS product naphthalene 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004151769.1 protein_id gnl|my_center|LOCUS_06330 931 575 gene locus_tag LOCUS_06340 931 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 2298 934 gene locus_tag LOCUS_06350 gene sufD 2298 934 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958176.1 protein_id gnl|my_center|LOCUS_06350 3050 2301 gene locus_tag LOCUS_06360 3050 2301 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_06360 4588 3140 gene locus_tag LOCUS_06370 gene ycf24 4588 3140 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946338.1 protein_id gnl|my_center|LOCUS_06370 5199 4630 gene locus_tag LOCUS_06380 5199 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 6678 5380 gene locus_tag LOCUS_06390 gene xylA 6678 5380 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM4 protein_id gnl|my_center|LOCUS_06390 7649 6792 gene locus_tag LOCUS_06400 7649 6792 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_06400 8509 7670 gene locus_tag LOCUS_06410 8509 7670 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 protein_id gnl|my_center|LOCUS_06410 9513 8512 gene locus_tag LOCUS_06420 9513 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 10630 9503 gene locus_tag LOCUS_06430 10630 9503 CDS product myo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 protein_id gnl|my_center|LOCUS_06430 12148 10646 gene locus_tag LOCUS_06440 gene mmsA-1 12148 10646 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704254.1 protein_id gnl|my_center|LOCUS_06440 12957 12145 gene locus_tag LOCUS_06450 gene iolB 12957 12145 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973914.1 protein_id gnl|my_center|LOCUS_06450 13962 13069 gene locus_tag LOCUS_06460 gene iolE 13962 13069 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973915.1 protein_id gnl|my_center|LOCUS_06460 15814 13979 gene locus_tag LOCUS_06470 gene iolD 15814 13979 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973916.1 protein_id gnl|my_center|LOCUS_06470 17737 15830 gene locus_tag LOCUS_06480 gene iolC 17737 15830 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709112.1 protein_id gnl|my_center|LOCUS_06480 18588 17734 gene locus_tag LOCUS_06490 18588 17734 CDS product RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973918.1 protein_id gnl|my_center|LOCUS_06490 18661 19824 gene locus_tag LOCUS_06500 18661 19824 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031356.1 protein_id gnl|my_center|LOCUS_06500 19990 21219 gene locus_tag LOCUS_06510 19990 21219 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114300.1 protein_id gnl|my_center|LOCUS_06510 21421 23217 gene locus_tag LOCUS_06520 gene rpoD 21421 23217 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 protein_id gnl|my_center|LOCUS_06520 23262 23338 gene locus_tag LOCUS_t00120 23262 23338 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 1238 420 gene locus_tag LOCUS_06530 gene mutM 1238 420 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM34 protein_id gnl|my_center|LOCUS_06530 2650 1238 gene locus_tag LOCUS_06540 gene nhaA 2650 1238 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26076 protein_id gnl|my_center|LOCUS_06540 3225 2767 gene locus_tag LOCUS_06550 3225 2767 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKF2 protein_id gnl|my_center|LOCUS_06550 3378 4169 gene locus_tag LOCUS_06560 3378 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_06560 4159 4878 gene locus_tag LOCUS_06570 4159 4878 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393177.1 protein_id gnl|my_center|LOCUS_06570 9676 4901 gene locus_tag LOCUS_06580 9676 4901 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391410.1 protein_id gnl|my_center|LOCUS_06580 10537 9860 gene locus_tag LOCUS_06590 10537 9860 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103566.1 protein_id gnl|my_center|LOCUS_06590 11251 10673 gene locus_tag LOCUS_06600 11251 10673 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_06600 12232 11327 gene locus_tag LOCUS_06610 12232 11327 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970157.1 protein_id gnl|my_center|LOCUS_06610 12520 12320 gene locus_tag LOCUS_06620 12520 12320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 13412 12507 gene locus_tag LOCUS_06630 13412 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 14966 13695 gene locus_tag LOCUS_06640 gene moeA 14966 13695 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070542.1 protein_id gnl|my_center|LOCUS_06640 15681 14983 gene locus_tag LOCUS_06650 gene modB2 15681 14983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419416.1 protein_id gnl|my_center|LOCUS_06650 18862 15728 gene locus_tag LOCUS_06660 18862 15728 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403109.1 protein_id gnl|my_center|LOCUS_06660 20131 18869 gene locus_tag LOCUS_06670 20131 18869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887384.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence026 211 606 gene locus_tag LOCUS_06680 211 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 1445 729 gene locus_tag LOCUS_06690 1445 729 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533464.1 protein_id gnl|my_center|LOCUS_06690 2773 1730 gene locus_tag LOCUS_06700 gene tqsA 2773 1730 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_06700 4069 2783 gene locus_tag LOCUS_06710 gene purA 4069 2783 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM6 protein_id gnl|my_center|LOCUS_06710 5334 4144 gene locus_tag LOCUS_06720 gene hisZ 5334 4144 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM5 protein_id gnl|my_center|LOCUS_06720 5538 5350 gene locus_tag LOCUS_06730 5538 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_06730 6502 5627 gene locus_tag LOCUS_06740 gene hflC 6502 5627 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 protein_id gnl|my_center|LOCUS_06740 7692 6502 gene locus_tag LOCUS_06750 7692 6502 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095289.1 protein_id gnl|my_center|LOCUS_06750 9241 7919 gene locus_tag LOCUS_06760 gene hflX 9241 7919 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L08 protein_id gnl|my_center|LOCUS_06760 9587 9288 gene locus_tag LOCUS_06770 9587 9288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 10684 9782 gene locus_tag LOCUS_06780 gene miaA 10684 9782 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGS0 protein_id gnl|my_center|LOCUS_06780 12583 10748 gene locus_tag LOCUS_06790 gene mutL 12583 10748 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E4 protein_id gnl|my_center|LOCUS_06790 13844 12642 gene locus_tag LOCUS_06800 gene amiB 13844 12642 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_06800 14669 14157 gene locus_tag LOCUS_06810 14669 14157 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209146.1 protein_id gnl|my_center|LOCUS_06810 16159 14666 gene locus_tag LOCUS_06820 16159 14666 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL5 protein_id gnl|my_center|LOCUS_06820 16240 17343 gene locus_tag LOCUS_06830 gene queG 16240 17343 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_06830 17330 17719 gene locus_tag LOCUS_06840 17330 17719 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TD9 protein_id gnl|my_center|LOCUS_06840 18094 17840 gene locus_tag LOCUS_06850 gene rpmE 18094 17840 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44367 protein_id gnl|my_center|LOCUS_06850 19481 18153 gene locus_tag LOCUS_06860 19481 18153 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946411.1 protein_id gnl|my_center|LOCUS_06860 19768 20940 gene locus_tag LOCUS_06870 19768 20940 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310733.1 protein_id gnl|my_center|LOCUS_06870 20953 22125 gene locus_tag LOCUS_06880 gene redA 20953 22125 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972423.1 protein_id gnl|my_center|LOCUS_06880 22182 22673 gene locus_tag LOCUS_06890 22182 22673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 22887 22714 gene locus_tag LOCUS_06900 22887 22714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 <23657 22892 gene locus_tag LOCUS_06910 <23657 22892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124090.1:subtilisin proteinase >Feature sequence027 611 1795 gene locus_tag LOCUS_06920 611 1795 CDS product cation efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525685.1 protein_id gnl|my_center|LOCUS_06920 1999 3408 gene locus_tag LOCUS_06930 1999 3408 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE8 protein_id gnl|my_center|LOCUS_06930 3484 4569 gene locus_tag LOCUS_06940 gene ntrB 3484 4569 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_06940 4573 5970 gene locus_tag LOCUS_06950 gene ntrC 4573 5970 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_06950 6811 5984 gene locus_tag LOCUS_06960 6811 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 7018 7884 gene locus_tag LOCUS_06970 7018 7884 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA32 protein_id gnl|my_center|LOCUS_06970 8011 8526 gene locus_tag LOCUS_06980 gene fabA 8011 8526 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUV9 protein_id gnl|my_center|LOCUS_06980 8838 9194 gene locus_tag LOCUS_06990 8838 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 9206 10498 gene locus_tag LOCUS_07000 9206 10498 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105560.1 protein_id gnl|my_center|LOCUS_07000 10731 10534 gene locus_tag LOCUS_07010 10731 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 10994 11449 gene locus_tag LOCUS_07020 10994 11449 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812180.1 protein_id gnl|my_center|LOCUS_07020 11465 13642 gene locus_tag LOCUS_07030 11465 13642 CDS product exported oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063689.1 protein_id gnl|my_center|LOCUS_07030 13729 14337 gene locus_tag LOCUS_07040 13729 14337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524160.1 protein_id gnl|my_center|LOCUS_07040 14397 15953 gene locus_tag LOCUS_07050 14397 15953 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879233.1 protein_id gnl|my_center|LOCUS_07050 15968 16966 gene locus_tag LOCUS_07060 15968 16966 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_07060 17828 16974 gene locus_tag LOCUS_07070 17828 16974 CDS product D-alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339326.1 protein_id gnl|my_center|LOCUS_07070 18684 18019 gene locus_tag LOCUS_07080 gene engB 18684 18019 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ86 protein_id gnl|my_center|LOCUS_07080 18797 20344 gene locus_tag LOCUS_07090 gene mviN 18797 20344 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED5 protein_id gnl|my_center|LOCUS_07090 20890 20360 gene locus_tag LOCUS_07100 20890 20360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 20964 21941 gene locus_tag LOCUS_07110 gene ribF 20964 21941 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889E5 protein_id gnl|my_center|LOCUS_07110 22024 23499 gene locus_tag LOCUS_07120 22024 23499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence028 6831 5182 gene locus_tag LOCUS_07130 6831 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8329 6818 gene locus_tag LOCUS_07140 8329 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 10883 8733 gene locus_tag LOCUS_07150 gene relA 10883 8733 CDS product ATP--GTP 3'-pyrophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038059.1 protein_id gnl|my_center|LOCUS_07150 11214 14093 gene locus_tag LOCUS_07160 gene sucA 11214 14093 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_07160 14134 15375 gene locus_tag LOCUS_07170 gene odhB 14134 15375 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAH6 protein_id gnl|my_center|LOCUS_07170 15448 16890 gene locus_tag LOCUS_07180 15448 16890 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUW8 protein_id gnl|my_center|LOCUS_07180 16939 17712 gene locus_tag LOCUS_07190 16939 17712 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259182.1 protein_id gnl|my_center|LOCUS_07190 18082 17810 gene locus_tag LOCUS_07200 18082 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 19942 18191 gene locus_tag LOCUS_07210 gene msbA 19942 18191 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63360 protein_id gnl|my_center|LOCUS_07210 20466 20783 gene locus_tag LOCUS_07220 20466 20783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 20767 21153 gene locus_tag LOCUS_07230 20767 21153 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887492.1 protein_id gnl|my_center|LOCUS_07230 22389 21298 gene locus_tag LOCUS_07240 gene waaC 22389 21298 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244577.1 protein_id gnl|my_center|LOCUS_07240 22763 22557 gene locus_tag LOCUS_07250 22763 22557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence029 2508 679 gene locus_tag LOCUS_07260 gene glmS 2508 679 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT25 protein_id gnl|my_center|LOCUS_07260 3929 2562 gene locus_tag LOCUS_07270 gene glmU 3929 2562 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNH7 protein_id gnl|my_center|LOCUS_07270 4546 4064 gene locus_tag LOCUS_07280 gene slyD 4546 4064 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB16 protein_id gnl|my_center|LOCUS_07280 5048 4626 gene locus_tag LOCUS_07290 gene atpC 5048 4626 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PI1 protein_id gnl|my_center|LOCUS_07290 6491 5091 gene locus_tag LOCUS_07300 gene atpD 6491 5091 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT20 protein_id gnl|my_center|LOCUS_07300 7387 6518 gene locus_tag LOCUS_07310 gene atpG 7387 6518 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_07310 9001 7460 gene locus_tag LOCUS_07320 gene atpA2 9001 7460 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR99 protein_id gnl|my_center|LOCUS_07320 9617 9081 gene locus_tag LOCUS_07330 gene atpH 9617 9081 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT17 protein_id gnl|my_center|LOCUS_07330 10109 9639 gene locus_tag LOCUS_07340 gene atpF 10109 9639 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNH1 protein_id gnl|my_center|LOCUS_07340 10390 10196 gene locus_tag LOCUS_07350 gene atpE 10390 10196 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQY3 protein_id gnl|my_center|LOCUS_07350 11350 10517 gene locus_tag LOCUS_07360 gene atpB 11350 10517 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_07360 11756 11373 gene locus_tag LOCUS_07370 11756 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 12145 12342 gene locus_tag LOCUS_07380 12145 12342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 12500 13378 gene locus_tag LOCUS_07390 gene ubiA 12500 13378 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F93 protein_id gnl|my_center|LOCUS_07390 13484 15487 gene locus_tag LOCUS_07400 gene tkt 13484 15487 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX2 protein_id gnl|my_center|LOCUS_07400 15576 16580 gene locus_tag LOCUS_07410 gene gapA 15576 16580 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z0 protein_id gnl|my_center|LOCUS_07410 16684 17865 gene locus_tag LOCUS_07420 gene pgk 16684 17865 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C6Q3 protein_id gnl|my_center|LOCUS_07420 17963 19423 gene locus_tag LOCUS_07430 gene pyk 17963 19423 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AU7 protein_id gnl|my_center|LOCUS_07430 19473 20543 gene locus_tag LOCUS_07440 gene fba 19473 20543 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y1 protein_id gnl|my_center|LOCUS_07440 21242 20556 gene locus_tag LOCUS_07450 21242 20556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 22579 21434 gene locus_tag LOCUS_07460 22579 21434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence030 580 1833 gene locus_tag LOCUS_07470 580 1833 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035773.1 protein_id gnl|my_center|LOCUS_07470 2178 2462 gene locus_tag LOCUS_07480 2178 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967243.1 protein_id gnl|my_center|LOCUS_07480 2642 2568 gene locus_tag LOCUS_t00130 2642 2568 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2752 4155 gene locus_tag LOCUS_07490 gene gltX 2752 4155 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCK0 protein_id gnl|my_center|LOCUS_07490 4220 4295 gene locus_tag LOCUS_t00140 4220 4295 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4301 4376 gene locus_tag LOCUS_t00150 4301 4376 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4529 4957 gene locus_tag LOCUS_07500 4529 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695998.1 protein_id gnl|my_center|LOCUS_07500 4958 5368 gene locus_tag LOCUS_07510 4958 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 6993 5413 gene locus_tag LOCUS_07520 gene pepA 6993 5413 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA43 protein_id gnl|my_center|LOCUS_07520 6992 8152 gene locus_tag LOCUS_07530 6992 8152 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316899.1 protein_id gnl|my_center|LOCUS_07530 8152 9219 gene locus_tag LOCUS_07540 gene lptG 8152 9219 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071579.1 protein_id gnl|my_center|LOCUS_07540 9713 9249 gene locus_tag LOCUS_07550 9713 9249 CDS product DUF55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072063.1 protein_id gnl|my_center|LOCUS_07550 10408 9710 gene locus_tag LOCUS_07560 10408 9710 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZN3 protein_id gnl|my_center|LOCUS_07560 11022 10711 gene locus_tag LOCUS_07570 11022 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 11315 11070 gene locus_tag LOCUS_07580 11315 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 11433 12005 gene locus_tag LOCUS_07590 11433 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 12027 13337 gene locus_tag LOCUS_07600 gene pepP 12027 13337 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_07600 13350 14603 gene locus_tag LOCUS_07610 13350 14603 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132411.1 protein_id gnl|my_center|LOCUS_07610 14600 15814 gene locus_tag LOCUS_07620 gene visC 14600 15814 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036035.1 protein_id gnl|my_center|LOCUS_07620 15904 16299 gene locus_tag LOCUS_07630 gene gcvH 15904 16299 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NHW5 protein_id gnl|my_center|LOCUS_07630 16327 17427 gene locus_tag LOCUS_07640 gene gcvPA 16327 17427 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B08 protein_id gnl|my_center|LOCUS_07640 17490 17996 gene locus_tag LOCUS_07650 gene tpx 17490 17996 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QN7 protein_id gnl|my_center|LOCUS_07650 18035 18544 gene locus_tag LOCUS_07660 18035 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 19441 18566 gene locus_tag LOCUS_07670 19441 18566 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480609.1 protein_id gnl|my_center|LOCUS_07670 19631 20584 gene locus_tag LOCUS_07680 19631 20584 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A146 protein_id gnl|my_center|LOCUS_07680 22339 20894 gene locus_tag LOCUS_07690 22339 20894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence031 99 1697 gene locus_tag LOCUS_07700 gene prfC 99 1697 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DC7 protein_id gnl|my_center|LOCUS_07700 1788 2159 gene locus_tag LOCUS_07710 1788 2159 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940847.1 protein_id gnl|my_center|LOCUS_07710 3000 2170 gene locus_tag LOCUS_07720 gene prmC 3000 2170 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC99 protein_id gnl|my_center|LOCUS_07720 4085 2997 gene locus_tag LOCUS_07730 gene prfA 4085 2997 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47849 protein_id gnl|my_center|LOCUS_07730 5623 4082 gene locus_tag LOCUS_07740 gene hemA 5623 4082 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_07740 5703 7382 gene locus_tag LOCUS_07750 5703 7382 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42810 protein_id gnl|my_center|LOCUS_07750 7416 8078 gene locus_tag LOCUS_07760 gene lolB 7416 8078 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42812 protein_id gnl|my_center|LOCUS_07760 8140 8961 gene locus_tag LOCUS_07770 gene ispE 8140 8961 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42805 protein_id gnl|my_center|LOCUS_07770 8989 9063 gene locus_tag LOCUS_t00160 8989 9063 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9256 10194 gene locus_tag LOCUS_07780 gene prs 9256 10194 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC63 protein_id gnl|my_center|LOCUS_07780 10366 10986 gene locus_tag LOCUS_07790 gene rplY 10366 10986 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_07790 11001 11582 gene locus_tag LOCUS_07800 gene pth 11001 11582 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXX4 protein_id gnl|my_center|LOCUS_07800 11604 12695 gene locus_tag LOCUS_07810 gene ychF 11604 12695 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DD71 protein_id gnl|my_center|LOCUS_07810 12886 12962 gene locus_tag LOCUS_t00170 12886 12962 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13160 14899 gene locus_tag LOCUS_07820 13160 14899 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_07820 14975 16147 gene locus_tag LOCUS_07830 14975 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 16930 16163 gene locus_tag LOCUS_07840 gene kdsB 16930 16163 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM5 protein_id gnl|my_center|LOCUS_07840 17976 16906 gene locus_tag LOCUS_07850 gene lpxK 17976 16906 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM3 protein_id gnl|my_center|LOCUS_07850 18144 19145 gene locus_tag LOCUS_07860 18144 19145 CDS product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388337.1 protein_id gnl|my_center|LOCUS_07860 19984 19187 gene locus_tag LOCUS_07870 gene nodJ 19984 19187 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEK6 protein_id gnl|my_center|LOCUS_07870 20925 19981 gene locus_tag LOCUS_07880 gene nodI 20925 19981 CDS product Nod factor export ATP-binding protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P412 protein_id gnl|my_center|LOCUS_07880 <21613 20927 gene locus_tag LOCUS_07890 <21613 20927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9JYY3:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence032 229 456 gene locus_tag LOCUS_07900 229 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 456 788 gene locus_tag LOCUS_07910 gene pemK 456 788 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E882 protein_id gnl|my_center|LOCUS_07910 3311 1149 gene locus_tag LOCUS_07920 gene ppk 3311 1149 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747E4 protein_id gnl|my_center|LOCUS_07920 3443 4930 gene locus_tag LOCUS_07930 gene ppx 3443 4930 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036174.1 protein_id gnl|my_center|LOCUS_07930 6390 5125 gene locus_tag LOCUS_07940 6390 5125 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816469.1 protein_id gnl|my_center|LOCUS_07940 7236 6394 gene locus_tag LOCUS_07950 gene aroE 7236 6394 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43904 protein_id gnl|my_center|LOCUS_07950 8347 7247 gene locus_tag LOCUS_07960 gene nahK 8347 7247 CDS product mucin desulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_07960 8464 9549 gene locus_tag LOCUS_07970 8464 9549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 10594 9581 gene locus_tag LOCUS_07980 gene hemB 10594 9581 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q8 protein_id gnl|my_center|LOCUS_07980 10687 11403 gene locus_tag LOCUS_07990 10687 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 14123 11412 gene locus_tag LOCUS_08000 gene polA 14123 11412 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_08000 14665 14228 gene locus_tag LOCUS_08010 14665 14228 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709362.1 protein_id gnl|my_center|LOCUS_08010 15741 14677 gene locus_tag LOCUS_08020 15741 14677 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973309.1 protein_id gnl|my_center|LOCUS_08020 16623 15796 gene locus_tag LOCUS_08030 16623 15796 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_08030 17210 16614 gene locus_tag LOCUS_08040 17210 16614 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_08040 17869 17300 gene locus_tag LOCUS_08050 17869 17300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 18393 18004 gene locus_tag LOCUS_08060 18393 18004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 18392 19360 gene locus_tag LOCUS_08070 18392 19360 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_08070 19388 20437 gene locus_tag LOCUS_08080 19388 20437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 21121 20378 gene locus_tag LOCUS_08090 21121 20378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence033 444 995 gene locus_tag LOCUS_08100 444 995 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_08100 983 1999 gene locus_tag LOCUS_08110 983 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1996 3735 gene locus_tag LOCUS_08120 gene recJ 1996 3735 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707042.1 protein_id gnl|my_center|LOCUS_08120 3892 4464 gene locus_tag LOCUS_08130 3892 4464 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_08130 4692 6185 gene locus_tag LOCUS_08140 gene xdhA 4692 6185 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207271.1 protein_id gnl|my_center|LOCUS_08140 6213 8546 gene locus_tag LOCUS_08150 gene xdhB 6213 8546 CDS product xanthine dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522221.1 protein_id gnl|my_center|LOCUS_08150 8543 9526 gene locus_tag LOCUS_08160 8543 9526 CDS product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189595.1 protein_id gnl|my_center|LOCUS_08160 9523 11034 gene locus_tag LOCUS_08170 9523 11034 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967791.1 protein_id gnl|my_center|LOCUS_08170 11168 12211 gene locus_tag LOCUS_08180 11168 12211 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_08180 12212 13138 gene locus_tag LOCUS_08190 12212 13138 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529891.1 protein_id gnl|my_center|LOCUS_08190 13211 14275 gene locus_tag LOCUS_08200 13211 14275 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_08200 14552 15835 gene locus_tag LOCUS_08210 gene guaD 14552 15835 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104657.1 protein_id gnl|my_center|LOCUS_08210 15808 16191 gene locus_tag LOCUS_08220 15808 16191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 16428 16835 gene locus_tag LOCUS_08230 16428 16835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 16996 17988 gene locus_tag LOCUS_08240 gene aroC 16996 17988 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ85 protein_id gnl|my_center|LOCUS_08240 18013 18795 gene locus_tag LOCUS_08250 18013 18795 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q813L0 protein_id gnl|my_center|LOCUS_08250 18827 20029 gene locus_tag LOCUS_08260 18827 20029 CDS product MFS metabolite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_08260 20520 20110 gene locus_tag LOCUS_08270 20520 20110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08270 20854 20507 gene locus_tag LOCUS_08280 20854 20507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08280 >Feature sequence034 <1 713 gene locus_tag LOCUS_08290 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087145.1:tricarboxylate transporter 879 2360 gene locus_tag LOCUS_08300 879 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3368 2412 gene locus_tag LOCUS_08310 3368 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 5055 3409 gene locus_tag LOCUS_08320 5055 3409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256231.1 protein_id gnl|my_center|LOCUS_08320 6073 5063 gene locus_tag LOCUS_08330 6073 5063 CDS product putative binding protein component of ABC iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTX3 protein_id gnl|my_center|LOCUS_08330 6883 6362 gene locus_tag LOCUS_08340 gene purE 6883 6362 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS7 protein_id gnl|my_center|LOCUS_08340 8070 6880 gene locus_tag LOCUS_08350 gene purK 8070 6880 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS8 protein_id gnl|my_center|LOCUS_08350 10101 8125 gene locus_tag LOCUS_08360 10101 8125 CDS product acetoacetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391442.1 protein_id gnl|my_center|LOCUS_08360 11627 10227 gene locus_tag LOCUS_08370 gene engA 11627 10227 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EJS5 protein_id gnl|my_center|LOCUS_08370 12830 11637 gene locus_tag LOCUS_08380 gene bamB 12830 11637 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P980 protein_id gnl|my_center|LOCUS_08380 13533 12916 gene locus_tag LOCUS_08390 gene yfgM 13533 12916 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_08390 14839 13565 gene locus_tag LOCUS_08400 gene hisS 14839 13565 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX22 protein_id gnl|my_center|LOCUS_08400 16076 14928 gene locus_tag LOCUS_08410 16076 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 16837 16088 gene locus_tag LOCUS_08420 16837 16088 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799875.1 protein_id gnl|my_center|LOCUS_08420 17997 16873 gene locus_tag LOCUS_08430 gene rlmN 17997 16873 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV93 protein_id gnl|my_center|LOCUS_08430 18536 18042 gene locus_tag LOCUS_08440 gene ndk 18536 18042 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU0 protein_id gnl|my_center|LOCUS_08440 18992 18669 gene locus_tag LOCUS_08450 18992 18669 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY0 protein_id gnl|my_center|LOCUS_08450 19821 19075 gene locus_tag LOCUS_08460 gene trmJ 19821 19075 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI5 protein_id gnl|my_center|LOCUS_08460 >Feature sequence035 <1 1020 gene locus_tag LOCUS_08470 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118544.1:thiamine biosynthesis protein ApbE 1043 2017 gene locus_tag LOCUS_08480 gene qor 1043 2017 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_08480 3214 2069 gene locus_tag LOCUS_08490 3214 2069 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337398.1 protein_id gnl|my_center|LOCUS_08490 4590 3211 gene locus_tag LOCUS_08500 4590 3211 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976259.1 protein_id gnl|my_center|LOCUS_08500 5942 4587 gene locus_tag LOCUS_08510 gene glnA2 5942 4587 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708670.1 protein_id gnl|my_center|LOCUS_08510 7138 6092 gene locus_tag LOCUS_08520 7138 6092 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_08520 8505 7186 gene locus_tag LOCUS_08530 8505 7186 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_08530 9083 8502 gene locus_tag LOCUS_08540 9083 8502 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_08540 9775 9083 gene locus_tag LOCUS_08550 9775 9083 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719486.1 protein_id gnl|my_center|LOCUS_08550 11750 9942 gene locus_tag LOCUS_08560 11750 9942 CDS product transcriptional initiation protein Tat inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973829.1 protein_id gnl|my_center|LOCUS_08560 12863 11988 gene locus_tag LOCUS_08570 12863 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101866.1 protein_id gnl|my_center|LOCUS_08570 13608 12973 gene locus_tag LOCUS_08580 13608 12973 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887766.1 protein_id gnl|my_center|LOCUS_08580 13748 13942 gene locus_tag LOCUS_08590 13748 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 13983 14630 gene locus_tag LOCUS_08600 13983 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 15459 14683 gene locus_tag LOCUS_08610 15459 14683 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532420.1 protein_id gnl|my_center|LOCUS_08610 16593 15475 gene locus_tag LOCUS_08620 16593 15475 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 protein_id gnl|my_center|LOCUS_08620 17883 16693 gene locus_tag LOCUS_08630 17883 16693 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388758.1 protein_id gnl|my_center|LOCUS_08630 19170 18130 gene locus_tag LOCUS_08640 19170 18130 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388759.1 protein_id gnl|my_center|LOCUS_08640 20098 19424 gene locus_tag LOCUS_08650 20098 19424 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143439.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence036 287 1348 gene locus_tag LOCUS_08660 287 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037915.1 protein_id gnl|my_center|LOCUS_08660 1364 2086 gene locus_tag LOCUS_08670 1364 2086 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958403.1 protein_id gnl|my_center|LOCUS_08670 2453 2109 gene locus_tag LOCUS_08680 2453 2109 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705569.1 protein_id gnl|my_center|LOCUS_08680 3052 2450 gene locus_tag LOCUS_08690 3052 2450 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I509 protein_id gnl|my_center|LOCUS_08690 3417 3049 gene locus_tag LOCUS_08700 gene arsC 3417 3049 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Z4 protein_id gnl|my_center|LOCUS_08700 3721 4392 gene locus_tag LOCUS_08710 3721 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4702 5445 gene locus_tag LOCUS_08720 gene pyrF 4702 5445 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT0 protein_id gnl|my_center|LOCUS_08720 5475 6803 gene locus_tag LOCUS_08730 gene miaB 5475 6803 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DX3 protein_id gnl|my_center|LOCUS_08730 6808 7821 gene locus_tag LOCUS_08740 gene phoL 6808 7821 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207721.1 protein_id gnl|my_center|LOCUS_08740 7832 8296 gene locus_tag LOCUS_08750 gene ybeY 7832 8296 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN83 protein_id gnl|my_center|LOCUS_08750 8296 9156 gene locus_tag LOCUS_08760 8296 9156 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_08760 9195 10730 gene locus_tag LOCUS_08770 gene lnt 9195 10730 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN85 protein_id gnl|my_center|LOCUS_08770 10791 11771 gene locus_tag LOCUS_08780 10791 11771 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_08780 13401 11875 gene locus_tag LOCUS_08790 13401 11875 CDS product tripartite tricarboxylate transporter TctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883967.1 protein_id gnl|my_center|LOCUS_08790 13888 13406 gene locus_tag LOCUS_08800 13888 13406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 14929 13958 gene locus_tag LOCUS_08810 14929 13958 CDS product bordetella uptake gene family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464323.1 protein_id gnl|my_center|LOCUS_08810 15204 16592 gene locus_tag LOCUS_08820 gene yhxA 15204 16592 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003719.1 protein_id gnl|my_center|LOCUS_08820 16592 19078 gene locus_tag LOCUS_08830 16592 19078 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969822.1 protein_id gnl|my_center|LOCUS_08830 <19901 19159 gene locus_tag LOCUS_08840 <19901 19159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947961.1:mannosyltransferase >Feature sequence037 997 3855 gene locus_tag LOCUS_08850 gene uvrA 997 3855 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWG0 protein_id gnl|my_center|LOCUS_08850 3925 4074 gene locus_tag LOCUS_08860 3925 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 4055 5467 gene locus_tag LOCUS_08870 4055 5467 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962690.1 protein_id gnl|my_center|LOCUS_08870 5972 5628 gene locus_tag LOCUS_08880 gene rplQ 5972 5628 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF46 protein_id gnl|my_center|LOCUS_08880 7081 6071 gene locus_tag LOCUS_08890 gene rpoA 7081 6071 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52760 protein_id gnl|my_center|LOCUS_08890 7726 7100 gene locus_tag LOCUS_08900 gene rpsD 7726 7100 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS02 protein_id gnl|my_center|LOCUS_08900 8144 7755 gene locus_tag LOCUS_08910 gene rpsK 8144 7755 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U8 protein_id gnl|my_center|LOCUS_08910 8513 8157 gene locus_tag LOCUS_08920 gene rpsM 8513 8157 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF7 protein_id gnl|my_center|LOCUS_08920 10068 8710 gene locus_tag LOCUS_08930 gene secY 10068 8710 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9N8 protein_id gnl|my_center|LOCUS_08930 10593 10159 gene locus_tag LOCUS_08940 gene rplO 10593 10159 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EQ7 protein_id gnl|my_center|LOCUS_08940 10796 10596 gene locus_tag LOCUS_08950 gene rpmD 10796 10596 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF3 protein_id gnl|my_center|LOCUS_08950 11301 10831 gene locus_tag LOCUS_08960 gene rpsE 11301 10831 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF2 protein_id gnl|my_center|LOCUS_08960 11738 11373 gene locus_tag LOCUS_08970 gene rplR 11738 11373 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ16 protein_id gnl|my_center|LOCUS_08970 12296 11769 gene locus_tag LOCUS_08980 gene rplF 12296 11769 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF0 protein_id gnl|my_center|LOCUS_08980 12699 12310 gene locus_tag LOCUS_08990 gene rpsH 12699 12310 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE9 protein_id gnl|my_center|LOCUS_08990 13031 12726 gene locus_tag LOCUS_09000 gene rpsN 13031 12726 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJ99 protein_id gnl|my_center|LOCUS_09000 13588 13043 gene locus_tag LOCUS_09010 gene rplE 13588 13043 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE7 protein_id gnl|my_center|LOCUS_09010 13938 13621 gene locus_tag LOCUS_09020 gene rplX 13938 13621 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ER5 protein_id gnl|my_center|LOCUS_09020 14322 13954 gene locus_tag LOCUS_09030 gene rplN 14322 13954 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5T7 protein_id gnl|my_center|LOCUS_09030 14706 14404 gene locus_tag LOCUS_09040 gene rpsQ 14706 14404 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE4 protein_id gnl|my_center|LOCUS_09040 14915 14703 gene locus_tag LOCUS_09050 gene rpmC 14915 14703 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF29 protein_id gnl|my_center|LOCUS_09050 15328 14915 gene locus_tag LOCUS_09060 gene rplP 15328 14915 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYN6 protein_id gnl|my_center|LOCUS_09060 16027 15332 gene locus_tag LOCUS_09070 gene rpsC 16027 15332 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC44 protein_id gnl|my_center|LOCUS_09070 16391 16053 gene locus_tag LOCUS_09080 gene rplV 16391 16053 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O85387 protein_id gnl|my_center|LOCUS_09080 16674 16402 gene locus_tag LOCUS_09090 gene rpsS 16674 16402 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD9 protein_id gnl|my_center|LOCUS_09090 17517 16690 gene locus_tag LOCUS_09100 gene rplB 17517 16690 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8B2 protein_id gnl|my_center|LOCUS_09100 17879 17562 gene locus_tag LOCUS_09110 gene rplW 17879 17562 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK66 protein_id gnl|my_center|LOCUS_09110 18478 17876 gene locus_tag LOCUS_09120 gene rplD 18478 17876 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF92 protein_id gnl|my_center|LOCUS_09120 19094 18489 gene locus_tag LOCUS_09130 gene rplC 19094 18489 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T13 protein_id gnl|my_center|LOCUS_09130 19626 19309 gene locus_tag LOCUS_09140 gene rpsJ 19626 19309 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF20 protein_id gnl|my_center|LOCUS_09140 >Feature sequence038 1 132 gene locus_tag LOCUS_09150 1 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 477 1292 gene locus_tag LOCUS_09160 477 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1825 1289 gene locus_tag LOCUS_09170 gene smpB 1825 1289 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ENC1 protein_id gnl|my_center|LOCUS_09170 1725 2366 gene locus_tag LOCUS_09180 1725 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2353 2667 gene locus_tag LOCUS_09190 gene ratB 2353 2667 CDS product UPF0125 protein RatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52119 protein_id gnl|my_center|LOCUS_09190 3160 2726 gene locus_tag LOCUS_09200 3160 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 3279 3878 gene locus_tag LOCUS_09210 3279 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5574 3871 gene locus_tag LOCUS_09220 gene recN 5574 3871 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMI9 protein_id gnl|my_center|LOCUS_09220 6510 5587 gene locus_tag LOCUS_09230 gene nadK 6510 5587 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YK2 protein_id gnl|my_center|LOCUS_09230 6701 7780 gene locus_tag LOCUS_09240 gene hrcA 6701 7780 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_09240 8487 7777 gene locus_tag LOCUS_09250 8487 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861855.1 protein_id gnl|my_center|LOCUS_09250 8609 9232 gene locus_tag LOCUS_09260 gene grpE 8609 9232 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKI6 protein_id gnl|my_center|LOCUS_09260 9313 11244 gene locus_tag LOCUS_09270 gene dnaK 9313 11244 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV43 protein_id gnl|my_center|LOCUS_09270 11429 12559 gene locus_tag LOCUS_09280 gene dnaJ 11429 12559 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_09280 12570 13406 gene locus_tag LOCUS_09290 gene dapB 12570 13406 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP9 protein_id gnl|my_center|LOCUS_09290 14854 13511 gene locus_tag LOCUS_09300 14854 13511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09300 16339 14927 gene locus_tag LOCUS_09310 16339 14927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637104.2 protein_id gnl|my_center|LOCUS_09310 16962 16414 gene locus_tag LOCUS_09320 gene gcvR 16962 16414 CDS product glycine cleavage system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 protein_id gnl|my_center|LOCUS_09320 17057 17950 gene locus_tag LOCUS_09330 gene dapA 17057 17950 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_09330 18004 18654 gene locus_tag LOCUS_09340 18004 18654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 18651 19430 gene locus_tag LOCUS_09350 18651 19430 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence039 3872 4114 gene locus_tag LOCUS_09360 3872 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 4228 5097 gene locus_tag LOCUS_09370 4228 5097 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWS2 protein_id gnl|my_center|LOCUS_09370 5112 5876 gene locus_tag LOCUS_09380 5112 5876 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114075.1 protein_id gnl|my_center|LOCUS_09380 5965 6540 gene locus_tag LOCUS_09390 5965 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114076.1 protein_id gnl|my_center|LOCUS_09390 6705 8144 gene locus_tag LOCUS_09400 6705 8144 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_09400 8163 11549 gene locus_tag LOCUS_09410 8163 11549 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930421.1 protein_id gnl|my_center|LOCUS_09410 12438 11575 gene locus_tag LOCUS_09420 12438 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141758.1 protein_id gnl|my_center|LOCUS_09420 12505 13620 gene locus_tag LOCUS_09430 12505 13620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 13648 14550 gene locus_tag LOCUS_09440 13648 14550 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_09440 14556 15098 gene locus_tag LOCUS_09450 14556 15098 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 protein_id gnl|my_center|LOCUS_09450 15914 15114 gene locus_tag LOCUS_09460 gene gloB 15914 15114 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3G3 protein_id gnl|my_center|LOCUS_09460 16052 17428 gene locus_tag LOCUS_09470 gene sdaA 16052 17428 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86564 protein_id gnl|my_center|LOCUS_09470 17547 18401 gene locus_tag LOCUS_09480 17547 18401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200938.1 protein_id gnl|my_center|LOCUS_09480 18962 18438 gene locus_tag LOCUS_09490 18962 18438 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N93 protein_id gnl|my_center|LOCUS_09490 19593 19111 gene locus_tag LOCUS_09500 19593 19111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence040 501 2552 gene locus_tag LOCUS_09510 gene deaD-1 501 2552 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET5 protein_id gnl|my_center|LOCUS_09510 2830 2606 gene locus_tag LOCUS_09520 2830 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 3698 3000 gene locus_tag LOCUS_09530 3698 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3948 3760 gene locus_tag LOCUS_09540 3948 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4758 3985 gene locus_tag LOCUS_09550 4758 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 5128 6378 gene locus_tag LOCUS_09560 gene dsrA-2 5128 6378 CDS product sulfite reductase, dissimilatory-type subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_09560 6559 7635 gene locus_tag LOCUS_09570 gene dsrB-1 6559 7635 CDS product sulfite reductase, dissimilatory-type beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_09570 7654 8046 gene locus_tag LOCUS_09580 gene dsrE 7654 8046 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_09580 8060 8473 gene locus_tag LOCUS_09590 gene dsrF 8060 8473 CDS product sulfurtransferase TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_09590 8505 8813 gene locus_tag LOCUS_09600 gene dsrH 8505 8813 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_09600 8889 9221 gene locus_tag LOCUS_09610 8889 9221 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_09610 9345 10088 gene locus_tag LOCUS_09620 9345 10088 CDS product Hdr menaquinol oxidoreductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878008.1 protein_id gnl|my_center|LOCUS_09620 10115 11677 gene locus_tag LOCUS_09630 10115 11677 CDS product Hdr menaquinol oxidoreductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938585.1 protein_id gnl|my_center|LOCUS_09630 11728 13689 gene locus_tag LOCUS_09640 11728 13689 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_09640 13701 14147 gene locus_tag LOCUS_09650 13701 14147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 14165 15001 gene locus_tag LOCUS_09660 14165 15001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 15069 16289 gene locus_tag LOCUS_09670 15069 16289 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902582.1 protein_id gnl|my_center|LOCUS_09670 16347 17744 gene locus_tag LOCUS_09680 gene cbiA 16347 17744 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI09 protein_id gnl|my_center|LOCUS_09680 17741 18070 gene locus_tag LOCUS_09690 17741 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 18098 18841 gene locus_tag LOCUS_09700 gene yciK 18098 18841 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence041 5244 745 gene locus_tag LOCUS_09710 gene tcaC 5244 745 CDS product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210089.1 protein_id gnl|my_center|LOCUS_09710 6880 5534 gene locus_tag LOCUS_09720 gene rlmD 6880 5534 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB48 protein_id gnl|my_center|LOCUS_09720 7793 6978 gene locus_tag LOCUS_09730 gene panB 7793 6978 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG9 protein_id gnl|my_center|LOCUS_09730 7946 8260 gene locus_tag LOCUS_09740 7946 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 8248 8754 gene locus_tag LOCUS_09750 8248 8754 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705365.1 protein_id gnl|my_center|LOCUS_09750 9990 8785 gene locus_tag LOCUS_09760 9990 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_09760 12125 10050 gene locus_tag LOCUS_09770 gene ligA 12125 10050 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RJ4 protein_id gnl|my_center|LOCUS_09770 13395 12130 gene locus_tag LOCUS_09780 13395 12130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 17014 13502 gene locus_tag LOCUS_09790 gene smc 17014 13502 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3I6 protein_id gnl|my_center|LOCUS_09790 17289 17678 gene locus_tag LOCUS_09800 17289 17678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence042 1415 66 gene locus_tag LOCUS_09810 gene mnmE 1415 66 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQZ6 protein_id gnl|my_center|LOCUS_09810 3144 1450 gene locus_tag LOCUS_09820 gene yidC 3144 1450 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL11 protein_id gnl|my_center|LOCUS_09820 3533 3201 gene locus_tag LOCUS_09830 gene rnpA 3533 3201 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ENA4 protein_id gnl|my_center|LOCUS_09830 3985 5367 gene locus_tag LOCUS_09840 gene dnaA 3985 5367 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XBZ3 protein_id gnl|my_center|LOCUS_09840 5606 6706 gene locus_tag LOCUS_09850 gene dnaN 5606 6706 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BK2 protein_id gnl|my_center|LOCUS_09850 7445 7777 gene locus_tag LOCUS_09860 7445 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 7845 10244 gene locus_tag LOCUS_09870 gene gyrB 7845 10244 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CG93 protein_id gnl|my_center|LOCUS_09870 11029 10292 gene locus_tag LOCUS_09880 gene lptA 11029 10292 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_09880 11594 11031 gene locus_tag LOCUS_09890 gene gmhB 11594 11031 CDS product D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C0 protein_id gnl|my_center|LOCUS_09890 13675 11591 gene locus_tag LOCUS_09900 gene glyS 13675 11591 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43822 protein_id gnl|my_center|LOCUS_09900 14655 13672 gene locus_tag LOCUS_09910 gene glyQ 14655 13672 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS5 protein_id gnl|my_center|LOCUS_09910 14769 15674 gene locus_tag LOCUS_09920 14769 15674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 16902 15709 gene locus_tag LOCUS_09930 16902 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence043 2131 683 gene locus_tag LOCUS_09940 gene nuoN 2131 683 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZP2 protein_id gnl|my_center|LOCUS_09940 3670 2144 gene locus_tag LOCUS_09950 gene nuoM 3670 2144 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 protein_id gnl|my_center|LOCUS_09950 5650 3686 gene locus_tag LOCUS_09960 gene nuoL 5650 3686 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185765.1 protein_id gnl|my_center|LOCUS_09960 5964 5659 gene locus_tag LOCUS_09970 gene nuoK 5964 5659 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IP5 protein_id gnl|my_center|LOCUS_09970 6663 6055 gene locus_tag LOCUS_09980 gene nuoJ 6663 6055 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037650.1 protein_id gnl|my_center|LOCUS_09980 7166 6678 gene locus_tag LOCUS_09990 gene nuoI 7166 6678 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7U0 protein_id gnl|my_center|LOCUS_09990 8299 7193 gene locus_tag LOCUS_10000 gene nuoH 8299 7193 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU5 protein_id gnl|my_center|LOCUS_10000 10695 8296 gene locus_tag LOCUS_10010 10695 8296 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VM7 protein_id gnl|my_center|LOCUS_10010 12011 10695 gene locus_tag LOCUS_10020 gene nuoF 12011 10695 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_10020 12499 12017 gene locus_tag LOCUS_10030 gene nuoE 12499 12017 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_10030 13749 12496 gene locus_tag LOCUS_10040 gene nuoD 13749 12496 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU1 protein_id gnl|my_center|LOCUS_10040 14428 13742 gene locus_tag LOCUS_10050 gene nuoC 14428 13742 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VN1 protein_id gnl|my_center|LOCUS_10050 14922 14446 gene locus_tag LOCUS_10060 gene nuoB1 14922 14446 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN6 protein_id gnl|my_center|LOCUS_10060 15283 14927 gene locus_tag LOCUS_10070 gene nuoA 15283 14927 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ5 protein_id gnl|my_center|LOCUS_10070 15494 15410 gene locus_tag LOCUS_t00180 15494 15410 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15872 15519 gene locus_tag LOCUS_10080 gene secG 15872 15519 CDS product protein-export membrane protein SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV52 protein_id gnl|my_center|LOCUS_10080 16629 15910 gene locus_tag LOCUS_10090 gene tpiA 16629 15910 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7T0 protein_id gnl|my_center|LOCUS_10090 >Feature sequence044 1065 2096 gene locus_tag LOCUS_10100 gene pilM 1065 2096 CDS product fimbrial assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_10100 2096 2677 gene locus_tag LOCUS_10110 2096 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2734 3297 gene locus_tag LOCUS_10120 gene pilO 2734 3297 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_10120 3294 3884 gene locus_tag LOCUS_10130 3294 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 3957 5762 gene locus_tag LOCUS_10140 3957 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5796 6377 gene locus_tag LOCUS_10150 gene aroK 5796 6377 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9Q3 protein_id gnl|my_center|LOCUS_10150 6346 7440 gene locus_tag LOCUS_10160 gene aroB 6346 7440 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P34002 protein_id gnl|my_center|LOCUS_10160 7532 7783 gene locus_tag LOCUS_10170 7532 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 9056 7758 gene locus_tag LOCUS_10180 gene waaA 9056 7758 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_10180 10027 9083 gene locus_tag LOCUS_10190 gene hldD 10027 9083 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q329N6 protein_id gnl|my_center|LOCUS_10190 11493 10024 gene locus_tag LOCUS_10200 gene hldE 11493 10024 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQV6 protein_id gnl|my_center|LOCUS_10200 11661 12596 gene locus_tag LOCUS_10210 gene htrB 11661 12596 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YC9 protein_id gnl|my_center|LOCUS_10210 12596 14185 gene locus_tag LOCUS_10220 12596 14185 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387908.1 protein_id gnl|my_center|LOCUS_10220 14958 14173 gene locus_tag LOCUS_10230 gene xth 14958 14173 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_10230 14986 15672 gene locus_tag LOCUS_10240 gene pyrE 14986 15672 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNA5 protein_id gnl|my_center|LOCUS_10240 16084 15785 gene locus_tag LOCUS_10250 16084 15785 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085795.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence045 <1 1071 gene locus_tag LOCUS_10260 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038380.1:flavin monoamine oxidase 2350 1178 gene locus_tag LOCUS_10270 gene prpF 2350 1178 CDS product 2-methyl-aconitate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW4 protein_id gnl|my_center|LOCUS_10270 5024 2397 gene locus_tag LOCUS_10280 5024 2397 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P72 protein_id gnl|my_center|LOCUS_10280 6225 5080 gene locus_tag LOCUS_10290 gene prpC 6225 5080 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63NU2 protein_id gnl|my_center|LOCUS_10290 7179 6295 gene locus_tag LOCUS_10300 gene prpB 7179 6295 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E2 protein_id gnl|my_center|LOCUS_10300 8057 7602 gene locus_tag LOCUS_10310 8057 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 10004 8109 gene locus_tag LOCUS_10320 10004 8109 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_10320 10365 11498 gene locus_tag LOCUS_10330 10365 11498 CDS product putative NAD(P) transhydrogenase, alpha1 subunit PntAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705302.1 protein_id gnl|my_center|LOCUS_10330 11495 11785 gene locus_tag LOCUS_10340 11495 11785 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_10340 11789 13219 gene locus_tag LOCUS_10350 11789 13219 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLT5 protein_id gnl|my_center|LOCUS_10350 13432 15375 gene locus_tag LOCUS_10360 gene rep 13432 15375 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1T0 protein_id gnl|my_center|LOCUS_10360 >Feature sequence046 1165 509 gene locus_tag LOCUS_10370 1165 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1202 2290 gene locus_tag LOCUS_10380 1202 2290 CDS product putative D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33642 protein_id gnl|my_center|LOCUS_10380 2384 2459 gene locus_tag LOCUS_t00190 2384 2459 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2447 2932 gene locus_tag LOCUS_10390 2447 2932 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196360.1 protein_id gnl|my_center|LOCUS_10390 2982 3824 gene locus_tag LOCUS_10400 gene djlA 2982 3824 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGU4 protein_id gnl|my_center|LOCUS_10400 5017 3851 gene locus_tag LOCUS_10410 5017 3851 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 protein_id gnl|my_center|LOCUS_10410 5603 5010 gene locus_tag LOCUS_10420 gene rdgB 5603 5010 CDS product dITP/XTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3U6 protein_id gnl|my_center|LOCUS_10420 6364 5600 gene locus_tag LOCUS_10430 gene rph 6364 5600 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RV5 protein_id gnl|my_center|LOCUS_10430 6527 7870 gene locus_tag LOCUS_10440 6527 7870 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531195.1 protein_id gnl|my_center|LOCUS_10440 9788 7905 gene locus_tag LOCUS_10450 gene uup 9788 7905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706135.1 protein_id gnl|my_center|LOCUS_10450 9945 11018 gene locus_tag LOCUS_10460 gene aroG 9945 11018 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase, Phe-sensitive inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AB91 protein_id gnl|my_center|LOCUS_10460 11171 12238 gene locus_tag LOCUS_10470 gene aroG 11171 12238 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R35 protein_id gnl|my_center|LOCUS_10470 12309 13529 gene locus_tag LOCUS_10480 gene sat 12309 13529 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_10480 13526 14116 gene locus_tag LOCUS_10490 gene tag 13526 14116 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_10490 14136 14609 gene locus_tag LOCUS_10500 gene prx-4 14136 14609 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944057.1 protein_id gnl|my_center|LOCUS_10500 15119 14691 gene locus_tag LOCUS_10510 15119 14691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 15847 15188 gene locus_tag LOCUS_10520 15847 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence047 91 1392 gene locus_tag LOCUS_10530 91 1392 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222955.1 protein_id gnl|my_center|LOCUS_10530 2420 1407 gene locus_tag LOCUS_10540 gene glk 2420 1407 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT6 protein_id gnl|my_center|LOCUS_10540 2571 2888 gene locus_tag LOCUS_10550 2571 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313868.1 protein_id gnl|my_center|LOCUS_10550 2898 5114 gene locus_tag LOCUS_10560 gene priA 2898 5114 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V04 protein_id gnl|my_center|LOCUS_10560 6475 5126 gene locus_tag LOCUS_10570 gene rimO 6475 5126 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7P7 protein_id gnl|my_center|LOCUS_10570 8676 6988 gene locus_tag LOCUS_10580 gene leuA-2 8676 6988 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLS9 protein_id gnl|my_center|LOCUS_10580 8875 9369 gene locus_tag LOCUS_10590 8875 9369 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_10590 9563 11422 gene locus_tag LOCUS_10600 gene argS 9563 11422 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTX7 protein_id gnl|my_center|LOCUS_10600 11445 12068 gene locus_tag LOCUS_10610 11445 12068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 12079 14034 gene locus_tag LOCUS_10620 12079 14034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_10620 14068 15258 gene locus_tag LOCUS_10630 14068 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence048 1698 226 gene locus_tag LOCUS_10640 gene gatB 1698 226 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_10640 3261 1804 gene locus_tag LOCUS_10650 gene gatA 3261 1804 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_10650 3612 3325 gene locus_tag LOCUS_10660 gene gatC 3612 3325 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNS8 protein_id gnl|my_center|LOCUS_10660 3867 4916 gene locus_tag LOCUS_10670 gene mreB 3867 4916 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A9X8 protein_id gnl|my_center|LOCUS_10670 4985 5887 gene locus_tag LOCUS_10680 gene mreC 4985 5887 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFA8 protein_id gnl|my_center|LOCUS_10680 5884 6372 gene locus_tag LOCUS_10690 5884 6372 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNT1 protein_id gnl|my_center|LOCUS_10690 6596 8479 gene locus_tag LOCUS_10700 gene pbpA 6596 8479 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_10700 8476 9612 gene locus_tag LOCUS_10710 8476 9612 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_10710 9621 10694 gene locus_tag LOCUS_10720 9621 10694 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_10720 10691 11644 gene locus_tag LOCUS_10730 10691 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_10730 11655 12839 gene locus_tag LOCUS_10740 gene dacC 11655 12839 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_10740 12849 13112 gene locus_tag LOCUS_10750 12849 13112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 13109 13738 gene locus_tag LOCUS_10760 gene lipB 13109 13738 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6V9 protein_id gnl|my_center|LOCUS_10760 13798 14643 gene locus_tag LOCUS_10770 13798 14643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_10770 14633 15181 gene locus_tag LOCUS_10780 gene ppa 14633 15181 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8Y6 protein_id gnl|my_center|LOCUS_10780 >Feature sequence049 485 147 gene locus_tag LOCUS_10790 gene glnK 485 147 CDS product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_10790 1328 921 gene locus_tag LOCUS_10800 gene msrB 1328 921 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q1 protein_id gnl|my_center|LOCUS_10800 1646 6172 gene locus_tag LOCUS_10810 gene gltB 1646 6172 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105326.1 protein_id gnl|my_center|LOCUS_10810 6189 7595 gene locus_tag LOCUS_10820 gene gltD 6189 7595 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403026.1 protein_id gnl|my_center|LOCUS_10820 7738 8388 gene locus_tag LOCUS_10830 7738 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 8389 9441 gene locus_tag LOCUS_10840 gene hemE 8389 9441 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95458 protein_id gnl|my_center|LOCUS_10840 11513 9540 gene locus_tag LOCUS_10850 gene apsA 11513 9540 CDS product adenylylsulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_10850 12041 11577 gene locus_tag LOCUS_10860 gene aspB 12041 11577 CDS product adenylylsulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_10860 12786 12361 gene locus_tag LOCUS_10870 12786 12361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 13011 13916 gene locus_tag LOCUS_10880 13011 13916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 14213 15190 gene locus_tag LOCUS_10890 14213 15190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence050 1371 1144 gene locus_tag LOCUS_10900 1371 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1259 1996 gene locus_tag LOCUS_10910 1259 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2131 3456 gene locus_tag LOCUS_10920 gene icd 2131 3456 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39126 protein_id gnl|my_center|LOCUS_10920 3536 5266 gene locus_tag LOCUS_10930 gene aceK 3536 5266 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4D0 protein_id gnl|my_center|LOCUS_10930 5296 5658 gene locus_tag LOCUS_10940 5296 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 5806 6705 gene locus_tag LOCUS_10950 5806 6705 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088069.1 protein_id gnl|my_center|LOCUS_10950 7614 6799 gene locus_tag LOCUS_10960 7614 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 11512 8786 gene locus_tag LOCUS_10970 11512 8786 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_10970 12171 11515 gene locus_tag LOCUS_10980 12171 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083175.1 protein_id gnl|my_center|LOCUS_10980 12206 12385 gene locus_tag LOCUS_10990 12206 12385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 12453 13460 gene locus_tag LOCUS_11000 12453 13460 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124092.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence051 113 1147 gene locus_tag LOCUS_11010 gene pilT 113 1147 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_11010 1168 2214 gene locus_tag LOCUS_11020 gene pyrD 1168 2214 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBI7 protein_id gnl|my_center|LOCUS_11020 2485 2219 gene locus_tag LOCUS_11030 2485 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2741 2451 gene locus_tag LOCUS_11040 2741 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_11040 4140 2830 gene locus_tag LOCUS_11050 gene pyrC' 4140 2830 CDS product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51551 protein_id gnl|my_center|LOCUS_11050 5147 4137 gene locus_tag LOCUS_11060 gene pyrB 5147 4137 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I89 protein_id gnl|my_center|LOCUS_11060 5656 5144 gene locus_tag LOCUS_11070 gene yqgF 5656 5144 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHG2 protein_id gnl|my_center|LOCUS_11070 6200 5640 gene locus_tag LOCUS_11080 6200 5640 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RH9 protein_id gnl|my_center|LOCUS_11080 7243 6278 gene locus_tag LOCUS_11090 gene gshB 7243 6278 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ65 protein_id gnl|my_center|LOCUS_11090 8646 7252 gene locus_tag LOCUS_11100 8646 7252 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958508.1 protein_id gnl|my_center|LOCUS_11100 9503 8727 gene locus_tag LOCUS_11110 9503 8727 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRE6 protein_id gnl|my_center|LOCUS_11110 9729 11936 gene locus_tag LOCUS_11120 gene gidA 9729 11936 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 protein_id gnl|my_center|LOCUS_11120 12668 11979 gene locus_tag LOCUS_11130 gene pcgL 12668 11979 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z749 protein_id gnl|my_center|LOCUS_11130 12817 13365 gene locus_tag LOCUS_11140 12817 13365 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK70 protein_id gnl|my_center|LOCUS_11140 13371 14147 gene locus_tag LOCUS_11150 13371 14147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 14272 14361 gene locus_tag LOCUS_t00200 14272 14361 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence052 1983 523 gene locus_tag LOCUS_11160 gene xcpR 1983 523 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00512 protein_id gnl|my_center|LOCUS_11160 3979 2003 gene locus_tag LOCUS_11170 gene xcpQ 3979 2003 CDS product type II secretion system protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35818 protein_id gnl|my_center|LOCUS_11170 4905 3988 gene locus_tag LOCUS_11180 4905 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 5105 6523 gene locus_tag LOCUS_11190 gene cysG 5105 6523 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M7 protein_id gnl|my_center|LOCUS_11190 7203 6556 gene locus_tag LOCUS_11200 gene narL 7203 6556 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_11200 8728 7229 gene locus_tag LOCUS_11210 8728 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 9050 8736 gene locus_tag LOCUS_11220 9050 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 9219 10004 gene locus_tag LOCUS_11230 9219 10004 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_11230 10001 10705 gene locus_tag LOCUS_11240 10001 10705 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_11240 10717 11745 gene locus_tag LOCUS_11250 10717 11745 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_11250 11766 13145 gene locus_tag LOCUS_11260 11766 13145 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 protein_id gnl|my_center|LOCUS_11260 13208 14404 gene locus_tag LOCUS_11270 13208 14404 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence053 361 975 gene locus_tag LOCUS_11280 gene cc4 361 975 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00106 protein_id gnl|my_center|LOCUS_11280 1029 1769 gene locus_tag LOCUS_11290 1029 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1766 2281 gene locus_tag LOCUS_11300 1766 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390639.1 protein_id gnl|my_center|LOCUS_11300 2421 3077 gene locus_tag LOCUS_11310 gene dsbA 2421 3077 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIP0 protein_id gnl|my_center|LOCUS_11310 3797 3144 gene locus_tag LOCUS_11320 3797 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3996 3920 gene locus_tag LOCUS_t00210 3996 3920 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4192 4689 gene locus_tag LOCUS_11330 4192 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 5734 4673 gene locus_tag LOCUS_11340 gene gpsA 5734 4673 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF08 protein_id gnl|my_center|LOCUS_11340 6314 5763 gene locus_tag LOCUS_11350 gene secB 6314 5763 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY16 protein_id gnl|my_center|LOCUS_11350 6867 6442 gene locus_tag LOCUS_11360 6867 6442 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035458.1 protein_id gnl|my_center|LOCUS_11360 7488 7114 gene locus_tag LOCUS_11370 7488 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 7606 8748 gene locus_tag LOCUS_11380 7606 8748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_11380 8947 10230 gene locus_tag LOCUS_11390 8947 10230 CDS product carboxyl-terminal protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_11390 11317 10250 gene locus_tag LOCUS_11400 gene tsaD 11317 10250 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43764 protein_id gnl|my_center|LOCUS_11400 11447 11662 gene locus_tag LOCUS_11410 gene rpsU 11447 11662 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57165 protein_id gnl|my_center|LOCUS_11410 11774 12178 gene locus_tag LOCUS_11420 11774 12178 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173892.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence054 887 252 gene locus_tag LOCUS_11430 887 252 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103924.1 protein_id gnl|my_center|LOCUS_11430 901 1587 gene locus_tag LOCUS_11440 901 1587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063877.1 protein_id gnl|my_center|LOCUS_11440 1584 4073 gene locus_tag LOCUS_11450 1584 4073 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813269.1 protein_id gnl|my_center|LOCUS_11450 4106 4768 gene locus_tag LOCUS_11460 4106 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4854 6881 gene locus_tag LOCUS_11470 4854 6881 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527789.1 protein_id gnl|my_center|LOCUS_11470 7128 8036 gene locus_tag LOCUS_11480 7128 8036 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969803.1 protein_id gnl|my_center|LOCUS_11480 8039 9514 gene locus_tag LOCUS_11490 gene lcdH 8039 9514 CDS product L-carnitine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBH7 protein_id gnl|my_center|LOCUS_11490 9610 10770 gene locus_tag LOCUS_11500 9610 10770 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976305.1 protein_id gnl|my_center|LOCUS_11500 10775 12865 gene locus_tag LOCUS_11510 10775 12865 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528297.1 protein_id gnl|my_center|LOCUS_11510 12862 13647 gene locus_tag LOCUS_11520 12862 13647 CDS product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528298.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence055 1135 1959 gene locus_tag LOCUS_11530 gene dinD 1135 1959 CDS product DNA-damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001377125.1 protein_id gnl|my_center|LOCUS_11530 2064 2588 gene locus_tag LOCUS_11540 2064 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2585 3193 gene locus_tag LOCUS_11550 2585 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3214 4863 gene locus_tag LOCUS_11560 3214 4863 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396174.1 protein_id gnl|my_center|LOCUS_11560 4877 5524 gene locus_tag LOCUS_11570 4877 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 6026 5559 gene locus_tag LOCUS_11580 6026 5559 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978225.1 protein_id gnl|my_center|LOCUS_11580 6281 7210 gene locus_tag LOCUS_11590 6281 7210 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 protein_id gnl|my_center|LOCUS_11590 7864 7202 gene locus_tag LOCUS_11600 7864 7202 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_11600 8217 8423 gene locus_tag LOCUS_11610 8217 8423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 8438 11332 gene locus_tag LOCUS_11620 8438 11332 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453899.1 protein_id gnl|my_center|LOCUS_11620 11348 11953 gene locus_tag LOCUS_11630 gene fdhB 11348 11953 CDS product formate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 protein_id gnl|my_center|LOCUS_11630 11958 13121 gene locus_tag LOCUS_11640 11958 13121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 13207 13437 gene locus_tag LOCUS_11650 gene moaD 13207 13437 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQI4 protein_id gnl|my_center|LOCUS_11650 >Feature sequence056 785 474 gene locus_tag LOCUS_11660 785 474 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6Z6 protein_id gnl|my_center|LOCUS_11660 2522 801 gene locus_tag LOCUS_11670 2522 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 <13377 3045 gene locus_tag LOCUS_11680 <13377 3045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000052484.1:adhesin >Feature sequence057 129 1124 gene locus_tag LOCUS_11690 129 1124 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TIA3 protein_id gnl|my_center|LOCUS_11690 1201 2097 gene locus_tag LOCUS_11700 1201 2097 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708374.1 protein_id gnl|my_center|LOCUS_11700 2101 2493 gene locus_tag LOCUS_11710 2101 2493 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531901.1 protein_id gnl|my_center|LOCUS_11710 3331 2663 gene locus_tag LOCUS_11720 3331 2663 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_11720 3494 5299 gene locus_tag LOCUS_11730 gene lepA 3494 5299 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF8 protein_id gnl|my_center|LOCUS_11730 5375 6172 gene locus_tag LOCUS_11740 gene lepB 5375 6172 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB54 protein_id gnl|my_center|LOCUS_11740 6173 6862 gene locus_tag LOCUS_11750 gene rnc 6173 6862 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LN9 protein_id gnl|my_center|LOCUS_11750 6843 7784 gene locus_tag LOCUS_11760 gene era 6843 7784 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB51 protein_id gnl|my_center|LOCUS_11760 7823 8542 gene locus_tag LOCUS_11770 gene recO 7823 8542 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPE3 protein_id gnl|my_center|LOCUS_11770 8593 9333 gene locus_tag LOCUS_11780 gene pdxJ 8593 9333 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCP4 protein_id gnl|my_center|LOCUS_11780 9324 10247 gene locus_tag LOCUS_11790 9324 10247 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUI4 protein_id gnl|my_center|LOCUS_11790 10280 11014 gene locus_tag LOCUS_11800 10280 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 11011 11703 gene locus_tag LOCUS_11810 11011 11703 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707332.1 protein_id gnl|my_center|LOCUS_11810 11737 12162 gene locus_tag LOCUS_11820 11737 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 12219 12776 gene locus_tag LOCUS_11830 12219 12776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence058 2404 1556 gene locus_tag LOCUS_11840 gene fadB 2404 1556 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087728.1 protein_id gnl|my_center|LOCUS_11840 3870 2530 gene locus_tag LOCUS_11850 3870 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082852.1 protein_id gnl|my_center|LOCUS_11850 6179 3969 gene locus_tag LOCUS_11860 6179 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 7663 6320 gene locus_tag LOCUS_11870 7663 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 7822 9036 gene locus_tag LOCUS_11880 7822 9036 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 protein_id gnl|my_center|LOCUS_11880 9033 10484 gene locus_tag LOCUS_11890 9033 10484 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533461.1 protein_id gnl|my_center|LOCUS_11890 10876 10646 gene locus_tag LOCUS_11900 10876 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 11132 11881 gene locus_tag LOCUS_11910 gene etfB 11132 11881 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039481.1 protein_id gnl|my_center|LOCUS_11910 11882 12823 gene locus_tag LOCUS_11920 11882 12823 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence059 490 1038 gene locus_tag LOCUS_11930 gene ppa 490 1038 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3Z2 protein_id gnl|my_center|LOCUS_11930 1051 1575 gene locus_tag LOCUS_11940 1051 1575 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIP7 protein_id gnl|my_center|LOCUS_11940 2300 1653 gene locus_tag LOCUS_11950 gene phcN 2300 1653 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KRS7 protein_id gnl|my_center|LOCUS_11950 3190 2315 gene locus_tag LOCUS_11960 gene phnD 3190 2315 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_11960 3721 3299 gene locus_tag LOCUS_11970 3721 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 4172 3744 gene locus_tag LOCUS_11980 4172 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258477.1 protein_id gnl|my_center|LOCUS_11980 4621 4184 gene locus_tag LOCUS_11990 4621 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 5522 4647 gene locus_tag LOCUS_12000 5522 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_12000 6044 5721 gene locus_tag LOCUS_12010 6044 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 protein_id gnl|my_center|LOCUS_12010 7594 6086 gene locus_tag LOCUS_12020 7594 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 8879 8013 gene locus_tag LOCUS_12030 8879 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640567.1 protein_id gnl|my_center|LOCUS_12030 9793 8951 gene locus_tag LOCUS_12040 gene lgt 9793 8951 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F2 protein_id gnl|my_center|LOCUS_12040 11288 9873 gene locus_tag LOCUS_12050 gene argH 11288 9873 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50987 protein_id gnl|my_center|LOCUS_12050 11735 11328 gene locus_tag LOCUS_12060 11735 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 11844 12770 gene locus_tag LOCUS_12070 gene hemC 11844 12770 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFH6 protein_id gnl|my_center|LOCUS_12070 >Feature sequence060 20 1171 gene locus_tag LOCUS_12080 20 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037134.1 protein_id gnl|my_center|LOCUS_12080 1168 1647 gene locus_tag LOCUS_12090 1168 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12090 2672 2187 gene locus_tag LOCUS_12100 2672 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 3008 5920 gene locus_tag LOCUS_12110 gene preP2 3008 5920 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_12110 5963 6856 gene locus_tag LOCUS_12120 5963 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_12120 6841 7707 gene locus_tag LOCUS_12130 gene trx 6841 7707 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037752.1 protein_id gnl|my_center|LOCUS_12130 7718 8443 gene locus_tag LOCUS_12140 7718 8443 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947427.1 protein_id gnl|my_center|LOCUS_12140 9472 8540 gene locus_tag LOCUS_12150 9472 8540 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337924.1 protein_id gnl|my_center|LOCUS_12150 9592 10668 gene locus_tag LOCUS_12160 9592 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 11561 10878 gene locus_tag LOCUS_12170 11561 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 11846 12694 gene locus_tag LOCUS_12180 11846 12694 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence061 881 336 gene locus_tag LOCUS_12190 gene hslV 881 336 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_12190 1178 1756 gene locus_tag LOCUS_12200 gene dcd 1178 1756 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQK4 protein_id gnl|my_center|LOCUS_12200 2053 2526 gene locus_tag LOCUS_12210 2053 2526 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 protein_id gnl|my_center|LOCUS_12210 3235 2558 gene locus_tag LOCUS_12220 gene nfi 3235 2558 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGM4 protein_id gnl|my_center|LOCUS_12220 3311 4192 gene locus_tag LOCUS_12230 gene bioC 3311 4192 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDF5 protein_id gnl|my_center|LOCUS_12230 4200 5042 gene locus_tag LOCUS_12240 4200 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 6009 5077 gene locus_tag LOCUS_12250 gene hemF 6009 5077 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX7 protein_id gnl|my_center|LOCUS_12250 6633 6046 gene locus_tag LOCUS_12260 gene tsaC 6633 6046 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVT5 protein_id gnl|my_center|LOCUS_12260 9097 6668 gene locus_tag LOCUS_12270 gene topA 9097 6668 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4F3 protein_id gnl|my_center|LOCUS_12270 9780 9304 gene locus_tag LOCUS_12280 gene smg 9780 9304 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CSI4 protein_id gnl|my_center|LOCUS_12280 10907 9780 gene locus_tag LOCUS_12290 gene smf 10907 9780 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_12290 11021 11551 gene locus_tag LOCUS_12300 gene def 11021 11551 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_12300 11606 12544 gene locus_tag LOCUS_12310 gene fmt 11606 12544 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O85732 protein_id gnl|my_center|LOCUS_12310 >Feature sequence062 342 2432 gene locus_tag LOCUS_12320 342 2432 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119822.1 protein_id gnl|my_center|LOCUS_12320 2613 3725 gene locus_tag LOCUS_12330 2613 3725 CDS product alkylhalidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119821.1 protein_id gnl|my_center|LOCUS_12330 4591 4166 gene locus_tag LOCUS_12340 4591 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 7388 4764 gene locus_tag LOCUS_12350 gene mutS 7388 4764 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CQ2 protein_id gnl|my_center|LOCUS_12350 7473 7982 gene locus_tag LOCUS_12360 7473 7982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209445.1 protein_id gnl|my_center|LOCUS_12360 8096 9190 gene locus_tag LOCUS_12370 gene recA 8096 9190 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08280 protein_id gnl|my_center|LOCUS_12370 9194 9652 gene locus_tag LOCUS_12380 gene recX 9194 9652 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWP2 protein_id gnl|my_center|LOCUS_12380 9787 12390 gene locus_tag LOCUS_12390 gene alaS 9787 12390 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TF9 protein_id gnl|my_center|LOCUS_12390 >Feature sequence063 2164 2379 gene locus_tag LOCUS_12400 2164 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2376 2762 gene locus_tag LOCUS_12410 2376 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 6446 2790 gene locus_tag LOCUS_12420 6446 2790 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_12420 7792 6554 gene locus_tag LOCUS_12430 7792 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 8271 9446 gene locus_tag LOCUS_12440 8271 9446 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence064 1661 141 gene locus_tag LOCUS_12450 1661 141 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAC6 protein_id gnl|my_center|LOCUS_12450 2432 1707 gene locus_tag LOCUS_12460 2432 1707 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388026.1 protein_id gnl|my_center|LOCUS_12460 2597 3958 gene locus_tag LOCUS_12470 2597 3958 CDS product fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_12470 4487 5746 gene locus_tag LOCUS_12480 4487 5746 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_12480 6801 5815 gene locus_tag LOCUS_12490 6801 5815 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112640.1 protein_id gnl|my_center|LOCUS_12490 7259 8968 gene locus_tag LOCUS_12500 7259 8968 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_12500 8965 11721 gene locus_tag LOCUS_12510 8965 11721 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence065 350 275 gene locus_tag LOCUS_t00220 350 275 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1380 541 gene locus_tag LOCUS_12520 1380 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1967 1383 gene locus_tag LOCUS_12530 1967 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3368 2037 gene locus_tag LOCUS_12540 gene tolB 3368 2037 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6F2 protein_id gnl|my_center|LOCUS_12540 4796 3372 gene locus_tag LOCUS_12550 4796 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 5212 4808 gene locus_tag LOCUS_12560 gene tolR 5212 4808 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242259.1 protein_id gnl|my_center|LOCUS_12560 5973 5272 gene locus_tag LOCUS_12570 gene tolQ 5973 5272 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_12570 6476 6000 gene locus_tag LOCUS_12580 6476 6000 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186455.1 protein_id gnl|my_center|LOCUS_12580 7535 6486 gene locus_tag LOCUS_12590 gene ruvB 7535 6486 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NG44 protein_id gnl|my_center|LOCUS_12590 8134 7532 gene locus_tag LOCUS_12600 gene ruvA 8134 7532 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y34 protein_id gnl|my_center|LOCUS_12600 8649 8131 gene locus_tag LOCUS_12610 gene ruvC 8649 8131 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHU1 protein_id gnl|my_center|LOCUS_12610 9390 8650 gene locus_tag LOCUS_12620 9390 8650 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF0 protein_id gnl|my_center|LOCUS_12620 11100 9454 gene locus_tag LOCUS_12630 gene pgi 11100 9454 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUY4 protein_id gnl|my_center|LOCUS_12630 12057 11167 gene locus_tag LOCUS_12640 12057 11167 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104396.1 protein_id gnl|my_center|LOCUS_12640 12395 12042 gene locus_tag LOCUS_12650 12395 12042 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence066 643 341 gene locus_tag LOCUS_12660 643 341 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y82 protein_id gnl|my_center|LOCUS_12660 1860 640 gene locus_tag LOCUS_12670 1860 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2142 3641 gene locus_tag LOCUS_12680 gene glcD 2142 3641 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765139.1 protein_id gnl|my_center|LOCUS_12680 3644 4723 gene locus_tag LOCUS_12690 gene glcE 3644 4723 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_12690 4755 5744 gene locus_tag LOCUS_12700 4755 5744 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_12700 5744 6511 gene locus_tag LOCUS_12710 5744 6511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_12710 8839 6530 gene locus_tag LOCUS_12720 8839 6530 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389064.1 protein_id gnl|my_center|LOCUS_12720 9728 8895 gene locus_tag LOCUS_12730 9728 8895 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 protein_id gnl|my_center|LOCUS_12730 11047 9728 gene locus_tag LOCUS_12740 gene cysD 11047 9728 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084053.1 protein_id gnl|my_center|LOCUS_12740 11204 12307 gene locus_tag LOCUS_12750 11204 12307 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence067 1079 3433 gene locus_tag LOCUS_12760 gene lptD 1079 3433 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB96 protein_id gnl|my_center|LOCUS_12760 3441 4871 gene locus_tag LOCUS_12770 gene surA 3441 4871 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_12770 4868 5905 gene locus_tag LOCUS_12780 gene pdxA1 4868 5905 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U4 protein_id gnl|my_center|LOCUS_12780 5905 6717 gene locus_tag LOCUS_12790 gene rsmA 5905 6717 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U5 protein_id gnl|my_center|LOCUS_12790 7252 6695 gene locus_tag LOCUS_12800 7252 6695 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_12800 7386 8558 gene locus_tag LOCUS_12810 gene metK 7386 8558 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPE1 protein_id gnl|my_center|LOCUS_12810 8704 10125 gene locus_tag LOCUS_12820 gene ahcY 8704 10125 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEG8 protein_id gnl|my_center|LOCUS_12820 10290 11579 gene locus_tag LOCUS_12830 10290 11579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence068 673 1410 gene locus_tag LOCUS_12840 gene rstA 673 1410 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_12840 1543 2286 gene locus_tag LOCUS_12850 1543 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3332 2382 gene locus_tag LOCUS_12860 gene lipA 3332 2382 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ6 protein_id gnl|my_center|LOCUS_12860 5208 3457 gene locus_tag LOCUS_12870 gene lpd 5208 3457 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NW1 protein_id gnl|my_center|LOCUS_12870 6597 5293 gene locus_tag LOCUS_12880 6597 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12880 9360 6676 gene locus_tag LOCUS_12890 gene aceE 9360 6676 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F939 protein_id gnl|my_center|LOCUS_12890 10104 9493 gene locus_tag LOCUS_12900 10104 9493 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087105.1 protein_id gnl|my_center|LOCUS_12900 11165 10191 gene locus_tag LOCUS_12910 11165 10191 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721008.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence069 643 3288 gene locus_tag LOCUS_12920 gene glnD 643 3288 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_12920 5120 3318 gene locus_tag LOCUS_12930 5120 3318 CDS product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228742.1 protein_id gnl|my_center|LOCUS_12930 6394 5120 gene locus_tag LOCUS_12940 gene serS 6394 5120 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M6 protein_id gnl|my_center|LOCUS_12940 6564 8324 gene locus_tag LOCUS_12950 6564 8324 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_12950 8357 9583 gene locus_tag LOCUS_12960 gene yfdZ 8357 9583 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVI1 protein_id gnl|my_center|LOCUS_12960 9609 10940 gene locus_tag LOCUS_12970 gene hom 9609 10940 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_12970 11010 11810 gene locus_tag LOCUS_12980 11010 11810 CDS product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence070 2351 255 gene locus_tag LOCUS_12990 gene fusA 2351 255 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ES7 protein_id gnl|my_center|LOCUS_12990 2877 2407 gene locus_tag LOCUS_13000 gene rpsG 2877 2407 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44376 protein_id gnl|my_center|LOCUS_13000 3149 2919 gene locus_tag LOCUS_13010 3149 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 7766 3534 gene locus_tag LOCUS_13020 gene rpoC 7766 3534 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC9 protein_id gnl|my_center|LOCUS_13020 11912 7833 gene locus_tag LOCUS_13030 gene rpoB 11912 7833 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51561 protein_id gnl|my_center|LOCUS_13030 12436 12311 gene locus_tag LOCUS_13040 12436 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence071 1196 387 gene locus_tag LOCUS_13050 1196 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1279 2127 gene locus_tag LOCUS_13060 1279 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937664.1 protein_id gnl|my_center|LOCUS_13060 2222 2016 gene locus_tag LOCUS_13070 2222 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2285 3931 gene locus_tag LOCUS_13080 2285 3931 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706041.1 protein_id gnl|my_center|LOCUS_13080 4065 4550 gene locus_tag LOCUS_13090 4065 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 4840 4664 gene locus_tag LOCUS_13100 4840 4664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 4793 6715 gene locus_tag LOCUS_13110 gene thrS 4793 6715 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKP9 protein_id gnl|my_center|LOCUS_13110 6868 7305 gene locus_tag LOCUS_13120 gene infC 6868 7305 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9U3 protein_id gnl|my_center|LOCUS_13120 7461 7658 gene locus_tag LOCUS_13130 gene rpmI 7461 7658 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67917 protein_id gnl|my_center|LOCUS_13130 7673 8038 gene locus_tag LOCUS_13140 gene rplT 7673 8038 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS07 protein_id gnl|my_center|LOCUS_13140 8201 9232 gene locus_tag LOCUS_13150 gene pheS 8201 9232 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_13150 9290 11680 gene locus_tag LOCUS_13160 gene pheT 9290 11680 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN07 protein_id gnl|my_center|LOCUS_13160 11695 11994 gene locus_tag LOCUS_13170 gene ihfA 11695 11994 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0T9 protein_id gnl|my_center|LOCUS_13170 11975 12343 gene locus_tag LOCUS_13180 11975 12343 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995911.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence072 748 1212 gene locus_tag LOCUS_13190 748 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 1244 2164 gene locus_tag LOCUS_13200 1244 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3722 2232 gene locus_tag LOCUS_13210 3722 2232 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368514.1 protein_id gnl|my_center|LOCUS_13210 3962 4834 gene locus_tag LOCUS_13220 gene speE 3962 4834 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_13220 4906 6243 gene locus_tag LOCUS_13230 gene pyrC 4906 6243 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8I4 protein_id gnl|my_center|LOCUS_13230 6265 6465 gene locus_tag LOCUS_13240 6265 6465 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXJ8 protein_id gnl|my_center|LOCUS_13240 7092 6535 gene locus_tag LOCUS_13250 7092 6535 CDS product ATP--cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_13250 7294 7914 gene locus_tag LOCUS_13260 7294 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 8012 8983 gene locus_tag LOCUS_13270 8012 8983 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_13270 9047 11599 gene locus_tag LOCUS_13280 9047 11599 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454675.1 protein_id gnl|my_center|LOCUS_13280 11609 12085 gene locus_tag LOCUS_13290 11609 12085 CDS product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204789.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence073 956 498 gene locus_tag LOCUS_13300 956 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3679 1265 gene locus_tag LOCUS_13310 3679 1265 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533447.1 protein_id gnl|my_center|LOCUS_13310 4703 5563 gene locus_tag LOCUS_13320 gene phnD 4703 5563 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_13320 6935 5739 gene locus_tag LOCUS_13330 gene ackA 6935 5739 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYF1 protein_id gnl|my_center|LOCUS_13330 8715 6949 gene locus_tag LOCUS_13340 8715 6949 CDS product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808155.1 protein_id gnl|my_center|LOCUS_13340 8886 9650 gene locus_tag LOCUS_13350 8886 9650 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061780.1 protein_id gnl|my_center|LOCUS_13350 9864 11228 gene locus_tag LOCUS_13360 9864 11228 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_13360 11419 11682 gene locus_tag LOCUS_13370 11419 11682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence074 262 993 gene locus_tag LOCUS_13380 gene aotM 262 993 CDS product arginine/ornithine transporter AotM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085936.1 protein_id gnl|my_center|LOCUS_13380 2359 1070 gene locus_tag LOCUS_13390 2359 1070 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226936.1 protein_id gnl|my_center|LOCUS_13390 4245 2356 gene locus_tag LOCUS_13400 4245 2356 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731205.1 protein_id gnl|my_center|LOCUS_13400 4672 4262 gene locus_tag LOCUS_13410 4672 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 6191 4713 gene locus_tag LOCUS_13420 6191 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 7753 6362 gene locus_tag LOCUS_13430 7753 6362 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546390.1 protein_id gnl|my_center|LOCUS_13430 9172 8018 gene locus_tag LOCUS_13440 9172 8018 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTH4 protein_id gnl|my_center|LOCUS_13440 9292 11547 gene locus_tag LOCUS_13450 9292 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence075 1142 2398 gene locus_tag LOCUS_13460 gene glyA 1142 2398 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ59 protein_id gnl|my_center|LOCUS_13460 2534 3634 gene locus_tag LOCUS_13470 gene ribD 2534 3634 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCN1 protein_id gnl|my_center|LOCUS_13470 3638 4315 gene locus_tag LOCUS_13480 gene ribC 3638 4315 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_13480 4330 5433 gene locus_tag LOCUS_13490 gene ribB 4330 5433 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPU3 protein_id gnl|my_center|LOCUS_13490 5479 5952 gene locus_tag LOCUS_13500 gene ribH 5479 5952 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX5 protein_id gnl|my_center|LOCUS_13500 5957 6382 gene locus_tag LOCUS_13510 gene nusB 5957 6382 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_13510 6465 7436 gene locus_tag LOCUS_13520 gene thiL 6465 7436 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNS0 protein_id gnl|my_center|LOCUS_13520 7444 7914 gene locus_tag LOCUS_13530 gene pgpA 7444 7914 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX8 protein_id gnl|my_center|LOCUS_13530 8412 7957 gene locus_tag LOCUS_13540 8412 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 8507 10021 gene locus_tag LOCUS_13550 gene pcnB 8507 10021 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9C3 protein_id gnl|my_center|LOCUS_13550 10018 10530 gene locus_tag LOCUS_13560 gene folK-1 10018 10530 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 protein_id gnl|my_center|LOCUS_13560 10583 11230 gene locus_tag LOCUS_13570 10583 11230 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886944.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence076 342 620 gene locus_tag LOCUS_13580 342 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1451 630 gene locus_tag LOCUS_13590 1451 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1661 2098 gene locus_tag LOCUS_13600 1661 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709438.1 protein_id gnl|my_center|LOCUS_13600 3161 2163 gene locus_tag LOCUS_13610 3161 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 6085 3158 gene locus_tag LOCUS_13620 6085 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 7010 6075 gene locus_tag LOCUS_13630 7010 6075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_13630 8137 7208 gene locus_tag LOCUS_13640 8137 7208 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337354.1 protein_id gnl|my_center|LOCUS_13640 9123 8164 gene locus_tag LOCUS_13650 gene mtlR 9123 8164 CDS product transcriptional regulator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089438.1 protein_id gnl|my_center|LOCUS_13650 9317 10627 gene locus_tag LOCUS_13660 9317 10627 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066581.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence077 361 2955 gene locus_tag LOCUS_13670 361 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3005 3967 gene locus_tag LOCUS_13680 3005 3967 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_13680 4582 3971 gene locus_tag LOCUS_13690 gene msrQ 4582 3971 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU7 protein_id gnl|my_center|LOCUS_13690 5578 4586 gene locus_tag LOCUS_13700 gene msrP 5578 4586 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZY64 protein_id gnl|my_center|LOCUS_13700 5692 6408 gene locus_tag LOCUS_13710 5692 6408 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 protein_id gnl|my_center|LOCUS_13710 6405 7820 gene locus_tag LOCUS_13720 6405 7820 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205389.1 protein_id gnl|my_center|LOCUS_13720 7817 8365 gene locus_tag LOCUS_13730 7817 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 8397 9293 gene locus_tag LOCUS_13740 gene purC 8397 9293 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD87 protein_id gnl|my_center|LOCUS_13740 9410 10522 gene locus_tag LOCUS_13750 gene hemH1 9410 10522 CDS product ferrochelatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF4 protein_id gnl|my_center|LOCUS_13750 >Feature sequence078 2195 102 gene locus_tag LOCUS_13760 gene soxB 2195 102 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932700.1 protein_id gnl|my_center|LOCUS_13760 2195 3370 gene locus_tag LOCUS_13770 2195 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3351 3521 gene locus_tag LOCUS_13780 3351 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3885 5135 gene locus_tag LOCUS_13790 3885 5135 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940951.1 protein_id gnl|my_center|LOCUS_13790 5181 7295 gene locus_tag LOCUS_13800 5181 7295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940950.1 protein_id gnl|my_center|LOCUS_13800 7298 8599 gene locus_tag LOCUS_13810 7298 8599 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940949.1 protein_id gnl|my_center|LOCUS_13810 8677 9366 gene locus_tag LOCUS_13820 8677 9366 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722886.1 protein_id gnl|my_center|LOCUS_13820 10523 10224 gene locus_tag LOCUS_13830 10523 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence079 426 1385 gene locus_tag LOCUS_13840 426 1385 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550082.1 protein_id gnl|my_center|LOCUS_13840 1558 1634 gene locus_tag LOCUS_t00230 1558 1634 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3146 1680 gene locus_tag LOCUS_13850 gene htrA 3146 1680 CDS product putative periplasmic serine endoprotease DegP-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6T0 protein_id gnl|my_center|LOCUS_13850 3136 3342 gene locus_tag LOCUS_13860 3136 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 4067 3378 gene locus_tag LOCUS_13870 4067 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 3960 4304 gene locus_tag LOCUS_13880 3960 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 4323 4505 gene locus_tag LOCUS_13890 4323 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 4762 4427 gene locus_tag LOCUS_13900 4762 4427 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU09 protein_id gnl|my_center|LOCUS_13900 5086 4802 gene locus_tag LOCUS_13910 5086 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 6363 5074 gene locus_tag LOCUS_13920 6363 5074 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 protein_id gnl|my_center|LOCUS_13920 6520 7074 gene locus_tag LOCUS_13930 gene orn 6520 7074 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57665 protein_id gnl|my_center|LOCUS_13930 8046 7177 gene locus_tag LOCUS_13940 8046 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 8341 8793 gene locus_tag LOCUS_13950 8341 8793 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921241.1 protein_id gnl|my_center|LOCUS_13950 8819 9982 gene locus_tag LOCUS_13960 gene cfa 8819 9982 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210940.1 protein_id gnl|my_center|LOCUS_13960 9989 10768 gene locus_tag LOCUS_13970 9989 10768 CDS product histidine/lysine/arginine/ornithine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133012.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence080 339 1316 gene locus_tag LOCUS_13980 339 1316 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705170.1 protein_id gnl|my_center|LOCUS_13980 2601 1390 gene locus_tag LOCUS_13990 2601 1390 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974900.1 protein_id gnl|my_center|LOCUS_13990 3915 2623 gene locus_tag LOCUS_14000 gene wbpO 3915 2623 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931326.1 protein_id gnl|my_center|LOCUS_14000 4844 3999 gene locus_tag LOCUS_14010 4844 3999 CDS product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807737.1 protein_id gnl|my_center|LOCUS_14010 5337 5684 gene locus_tag LOCUS_14020 5337 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 7356 5701 gene locus_tag LOCUS_14030 7356 5701 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267220.1 protein_id gnl|my_center|LOCUS_14030 8408 7383 gene locus_tag LOCUS_14040 8408 7383 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104693.1 protein_id gnl|my_center|LOCUS_14040 9515 8418 gene locus_tag LOCUS_14050 9515 8418 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104692.1 protein_id gnl|my_center|LOCUS_14050 <10774 9538 gene locus_tag LOCUS_14060 <10774 9538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003098136.1:ABC transporter >Feature sequence081 677 1759 gene locus_tag LOCUS_14070 gene nagZ 677 1759 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NKH2 protein_id gnl|my_center|LOCUS_14070 1773 2513 gene locus_tag LOCUS_14080 1773 2513 CDS product putative S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB40 protein_id gnl|my_center|LOCUS_14080 2585 3775 gene locus_tag LOCUS_14090 gene metZ 2585 3775 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV5 protein_id gnl|my_center|LOCUS_14090 6227 3783 gene locus_tag LOCUS_14100 gene ppsA 6227 3783 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLP8 protein_id gnl|my_center|LOCUS_14100 7740 6448 gene locus_tag LOCUS_14110 gene tolC 7740 6448 CDS product outer membrane channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262654.1 protein_id gnl|my_center|LOCUS_14110 8494 7802 gene locus_tag LOCUS_14120 gene pcm 8494 7802 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_14120 9784 8819 gene locus_tag LOCUS_14130 9784 8819 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706561.1 protein_id gnl|my_center|LOCUS_14130 10585 9845 gene locus_tag LOCUS_14140 10585 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence082 358 272 gene locus_tag LOCUS_t00240 358 272 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 463 2751 gene locus_tag LOCUS_14150 gene rnr 463 2751 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYX3 protein_id gnl|my_center|LOCUS_14150 2758 3504 gene locus_tag LOCUS_14160 gene rlmB 2758 3504 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG8 protein_id gnl|my_center|LOCUS_14160 3655 4047 gene locus_tag LOCUS_14170 gene rpsF 3655 4047 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG67 protein_id gnl|my_center|LOCUS_14170 4144 4368 gene locus_tag LOCUS_14180 gene rpsR 4144 4368 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN0 protein_id gnl|my_center|LOCUS_14180 4559 5464 gene locus_tag LOCUS_14190 4559 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_14190 5549 5998 gene locus_tag LOCUS_14200 gene rplI 5549 5998 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK6 protein_id gnl|my_center|LOCUS_14200 6070 7464 gene locus_tag LOCUS_14210 gene dnaB 6070 7464 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXJ3 protein_id gnl|my_center|LOCUS_14210 7581 8963 gene locus_tag LOCUS_14220 gene radA 7581 8963 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96963 protein_id gnl|my_center|LOCUS_14220 10308 9019 gene locus_tag LOCUS_14230 10308 9019 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence083 324 1415 gene locus_tag LOCUS_14240 gene zapE 324 1415 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVX7 protein_id gnl|my_center|LOCUS_14240 1509 1733 gene locus_tag LOCUS_14250 1509 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1911 3161 gene locus_tag LOCUS_14260 gene soxB 1911 3161 CDS product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87388 protein_id gnl|my_center|LOCUS_14260 3161 3457 gene locus_tag LOCUS_14270 3161 3457 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821030.1 protein_id gnl|my_center|LOCUS_14270 3454 6399 gene locus_tag LOCUS_14280 3454 6399 CDS product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532909.1 protein_id gnl|my_center|LOCUS_14280 6392 6967 gene locus_tag LOCUS_14290 6392 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 7259 7957 gene locus_tag LOCUS_14300 7259 7957 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089752.1 protein_id gnl|my_center|LOCUS_14300 8262 9392 gene locus_tag LOCUS_14310 gene ispG 8262 9392 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0A6 protein_id gnl|my_center|LOCUS_14310 10217 9396 gene locus_tag LOCUS_14320 10217 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence084 1282 974 gene locus_tag LOCUS_14330 1282 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1690 1364 gene locus_tag LOCUS_14340 1690 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2259 1705 gene locus_tag LOCUS_14350 2259 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 3719 2373 gene locus_tag LOCUS_14360 3719 2373 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331280.1 protein_id gnl|my_center|LOCUS_14360 4650 3736 gene locus_tag LOCUS_14370 4650 3736 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331282.1 protein_id gnl|my_center|LOCUS_14370 5720 4656 gene locus_tag LOCUS_14380 5720 4656 CDS product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971231.1 protein_id gnl|my_center|LOCUS_14380 6775 5741 gene locus_tag LOCUS_14390 6775 5741 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708564.1 protein_id gnl|my_center|LOCUS_14390 7890 6946 gene locus_tag LOCUS_14400 7890 6946 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971233.1 protein_id gnl|my_center|LOCUS_14400 9709 8138 gene locus_tag LOCUS_14410 9709 8138 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331276.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence085 622 1290 gene locus_tag LOCUS_14420 622 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1465 3579 gene locus_tag LOCUS_14430 1465 3579 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390899.1 protein_id gnl|my_center|LOCUS_14430 3576 4340 gene locus_tag LOCUS_14440 3576 4340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114657.1 protein_id gnl|my_center|LOCUS_14440 4372 5568 gene locus_tag LOCUS_14450 4372 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083634.1 protein_id gnl|my_center|LOCUS_14450 5774 6199 gene locus_tag LOCUS_14460 gene napF 5774 6199 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172332.1 protein_id gnl|my_center|LOCUS_14460 6196 6462 gene locus_tag LOCUS_14470 6196 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 6459 8999 gene locus_tag LOCUS_14480 gene napA 6459 8999 CDS product periplasmic nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIM1 protein_id gnl|my_center|LOCUS_14480 9108 9557 gene locus_tag LOCUS_14490 gene napB 9108 9557 CDS product periplasmic nitrate reductase, electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3J7 protein_id gnl|my_center|LOCUS_14490 9577 10131 gene locus_tag LOCUS_14500 9577 10131 CDS product cytochrome c-type protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIM5 protein_id gnl|my_center|LOCUS_14500 >Feature sequence086 3 620 gene locus_tag LOCUS_14510 3 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 688 1248 gene locus_tag LOCUS_14520 688 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968625.1 protein_id gnl|my_center|LOCUS_14520 2195 1299 gene locus_tag LOCUS_14530 2195 1299 CDS product heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_14530 2846 2208 gene locus_tag LOCUS_14540 2846 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 5127 2866 gene locus_tag LOCUS_14550 5127 2866 CDS product heterodisulfide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545086.1 protein_id gnl|my_center|LOCUS_14550 6550 5147 gene locus_tag LOCUS_14560 6550 5147 CDS product heterodisulfide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878166.1 protein_id gnl|my_center|LOCUS_14560 6716 7528 gene locus_tag LOCUS_14570 gene norQ 6716 7528 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_14570 7804 7544 gene locus_tag LOCUS_14580 7804 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 7909 10044 gene locus_tag LOCUS_14590 7909 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence087 9489 9226 gene locus_tag LOCUS_14600 9489 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 9684 9496 gene locus_tag LOCUS_14610 9684 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence088 877 1743 gene locus_tag LOCUS_14620 877 1743 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389380.1 protein_id gnl|my_center|LOCUS_14620 2050 2745 gene locus_tag LOCUS_14630 2050 2745 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890391.1 protein_id gnl|my_center|LOCUS_14630 2798 4648 gene locus_tag LOCUS_14640 gene uvrC 2798 4648 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q880X7 protein_id gnl|my_center|LOCUS_14640 4648 5205 gene locus_tag LOCUS_14650 gene pgsA 4648 5205 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037265.1 protein_id gnl|my_center|LOCUS_14650 5281 5356 gene locus_tag LOCUS_t00250 5281 5356 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5435 5508 gene locus_tag LOCUS_t00260 5435 5508 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5654 7138 gene locus_tag LOCUS_14660 gene lysS 5654 7138 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWW0 protein_id gnl|my_center|LOCUS_14660 7373 7810 gene locus_tag LOCUS_14670 7373 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 8955 7858 gene locus_tag LOCUS_14680 8955 7858 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5H0 protein_id gnl|my_center|LOCUS_14680 9146 9811 gene locus_tag LOCUS_14690 9146 9811 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087105.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence089 926 363 gene locus_tag LOCUS_14700 926 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1519 923 gene locus_tag LOCUS_14710 gene mobA 1519 923 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMS8 protein_id gnl|my_center|LOCUS_14710 2211 1519 gene locus_tag LOCUS_14720 gene tupC 2211 1519 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074307.1 protein_id gnl|my_center|LOCUS_14720 3083 2232 gene locus_tag LOCUS_14730 gene tupA 3083 2232 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074305.1 protein_id gnl|my_center|LOCUS_14730 3479 4903 gene locus_tag LOCUS_14740 3479 4903 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 protein_id gnl|my_center|LOCUS_14740 6312 4945 gene locus_tag LOCUS_14750 6312 4945 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479029.1 protein_id gnl|my_center|LOCUS_14750 6945 6316 gene locus_tag LOCUS_14760 6945 6316 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479032.1 protein_id gnl|my_center|LOCUS_14760 8063 7068 gene locus_tag LOCUS_14770 8063 7068 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479018.1 protein_id gnl|my_center|LOCUS_14770 8977 8207 gene locus_tag LOCUS_14780 gene ptr1 8977 8207 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence090 1938 544 gene locus_tag LOCUS_14790 gene ntrX 1938 544 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087262.1 protein_id gnl|my_center|LOCUS_14790 3527 2058 gene locus_tag LOCUS_14800 gene dhaS 3527 2058 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973674.1 protein_id gnl|my_center|LOCUS_14800 4570 3536 gene locus_tag LOCUS_14810 4570 3536 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970938.1 protein_id gnl|my_center|LOCUS_14810 5307 4567 gene locus_tag LOCUS_14820 5307 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 5917 5318 gene locus_tag LOCUS_14830 5917 5318 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973670.1 protein_id gnl|my_center|LOCUS_14830 8212 6068 gene locus_tag LOCUS_14840 8212 6068 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_14840 8766 8209 gene locus_tag LOCUS_14850 8766 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 9619 8831 gene locus_tag LOCUS_14860 9619 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence091 382 98 gene locus_tag LOCUS_14870 382 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 601 1842 gene locus_tag LOCUS_14880 gene carA 601 1842 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPH8 protein_id gnl|my_center|LOCUS_14880 1848 5066 gene locus_tag LOCUS_14890 gene carB 1848 5066 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2C7 protein_id gnl|my_center|LOCUS_14890 5130 5609 gene locus_tag LOCUS_14900 gene greA 5130 5609 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNF4 protein_id gnl|my_center|LOCUS_14900 5659 7446 gene locus_tag LOCUS_14910 5659 7446 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_14910 7468 7836 gene locus_tag LOCUS_14920 7468 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 7844 8185 gene locus_tag LOCUS_14930 7844 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence092 1063 973 gene locus_tag LOCUS_t00270 1063 973 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1196 2593 gene locus_tag LOCUS_14940 gene mltF 1196 2593 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX03 protein_id gnl|my_center|LOCUS_14940 3126 2620 gene locus_tag LOCUS_14950 3126 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3222 4007 gene locus_tag LOCUS_14960 gene modA 3222 4007 CDS product molybdate-binding periplasmic protein ModA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 protein_id gnl|my_center|LOCUS_14960 4004 4687 gene locus_tag LOCUS_14970 gene modC 4004 4687 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064503.1 protein_id gnl|my_center|LOCUS_14970 4687 5754 gene locus_tag LOCUS_14980 gene modC 4687 5754 CDS product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q881C1 protein_id gnl|my_center|LOCUS_14980 9282 5767 gene locus_tag LOCUS_14990 9282 5767 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957676.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence093 727 230 gene locus_tag LOCUS_15000 727 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1051 731 gene locus_tag LOCUS_15010 1051 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337732.1 protein_id gnl|my_center|LOCUS_15010 1693 1058 gene locus_tag LOCUS_15020 1693 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337251.1 protein_id gnl|my_center|LOCUS_15020 2388 1690 gene locus_tag LOCUS_15030 2388 1690 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708366.1 protein_id gnl|my_center|LOCUS_15030 3078 2566 gene locus_tag LOCUS_15040 3078 2566 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011132.1 protein_id gnl|my_center|LOCUS_15040 3897 3172 gene locus_tag LOCUS_15050 3897 3172 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_15050 4091 5233 gene locus_tag LOCUS_15060 gene thrC 4091 5233 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_15060 6191 5262 gene locus_tag LOCUS_15070 6191 5262 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969107.1 protein_id gnl|my_center|LOCUS_15070 7526 6270 gene locus_tag LOCUS_15080 7526 6270 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383234.1 protein_id gnl|my_center|LOCUS_15080 7741 8397 gene locus_tag LOCUS_15090 7741 8397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 9032 8487 gene locus_tag LOCUS_15100 9032 8487 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_208455.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence094 293 589 gene locus_tag LOCUS_15110 293 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 608 730 gene locus_tag LOCUS_15120 608 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 3107 897 gene locus_tag LOCUS_15130 gene uvrD 3107 897 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P03018 protein_id gnl|my_center|LOCUS_15130 3203 3649 gene locus_tag LOCUS_15140 gene dtd 3203 3649 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA4 protein_id gnl|my_center|LOCUS_15140 3761 4354 gene locus_tag LOCUS_15150 gene hisB 3761 4354 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_15150 4387 5013 gene locus_tag LOCUS_15160 gene hisH1 4387 5013 CDS product imidazole glycerol phosphate synthase subunit HisH 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU42 protein_id gnl|my_center|LOCUS_15160 5043 5810 gene locus_tag LOCUS_15170 gene hisA 5043 5810 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU43 protein_id gnl|my_center|LOCUS_15170 5807 6580 gene locus_tag LOCUS_15180 gene hisF1 5807 6580 CDS product imidazole glycerol phosphate synthase subunit hisF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU44 protein_id gnl|my_center|LOCUS_15180 6599 6925 gene locus_tag LOCUS_15190 gene hisE 6599 6925 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB6 protein_id gnl|my_center|LOCUS_15190 7004 7234 gene locus_tag LOCUS_15200 gene tatA 7004 7234 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R4 protein_id gnl|my_center|LOCUS_15200 7264 7716 gene locus_tag LOCUS_15210 gene tatB 7264 7716 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MPF0 protein_id gnl|my_center|LOCUS_15210 7739 8611 gene locus_tag LOCUS_15220 gene tatC 7739 8611 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB3 protein_id gnl|my_center|LOCUS_15220 >Feature sequence095 880 266 gene locus_tag LOCUS_15230 880 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2714 945 gene locus_tag LOCUS_15240 2714 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 3433 2861 gene locus_tag LOCUS_15250 3433 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3600 4223 gene locus_tag LOCUS_15260 3600 4223 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705371.1 protein_id gnl|my_center|LOCUS_15260 4313 4627 gene locus_tag LOCUS_15270 4313 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 4620 5855 gene locus_tag LOCUS_15280 4620 5855 CDS product putative kinase Y4dM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55412 protein_id gnl|my_center|LOCUS_15280 6724 5900 gene locus_tag LOCUS_15290 6724 5900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 7656 6727 gene locus_tag LOCUS_15300 7656 6727 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_15300 <8958 7667 gene locus_tag LOCUS_15310 <8958 7667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112350.1:TonB-dependent receptor >Feature sequence096 265 1536 gene locus_tag LOCUS_15320 gene amt-1 265 1536 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B15 protein_id gnl|my_center|LOCUS_15320 2180 1590 gene locus_tag LOCUS_15330 2180 1590 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930694.1 protein_id gnl|my_center|LOCUS_15330 2473 2715 gene locus_tag LOCUS_15340 2473 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 2919 3821 gene locus_tag LOCUS_15350 gene birA 2919 3821 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Y0 protein_id gnl|my_center|LOCUS_15350 3818 4567 gene locus_tag LOCUS_15360 gene coaX 3818 4567 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC1 protein_id gnl|my_center|LOCUS_15360 5077 7170 gene locus_tag LOCUS_15370 gene katG2 5077 7170 CDS product catalase-peroxidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIV5 protein_id gnl|my_center|LOCUS_15370 7329 7404 gene locus_tag LOCUS_t00280 7329 7404 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8758 7433 gene locus_tag LOCUS_15380 gene ugd 8758 7433 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence097 1935 1 gene locus_tag LOCUS_15390 1935 1 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128847.1 protein_id gnl|my_center|LOCUS_15390 2093 2665 gene locus_tag LOCUS_15400 gene ppiB-2 2093 2665 CDS product peptidyl-prolyl cis-trans isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_011090.2 protein_id gnl|my_center|LOCUS_15400 2668 3390 gene locus_tag LOCUS_15410 gene lpxH 2668 3390 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2V0 protein_id gnl|my_center|LOCUS_15410 3457 4464 gene locus_tag LOCUS_15420 3457 4464 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383345.1 protein_id gnl|my_center|LOCUS_15420 4469 7543 gene locus_tag LOCUS_15430 4469 7543 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_15430 7632 8681 gene locus_tag LOCUS_15440 7632 8681 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence098 1503 376 gene locus_tag LOCUS_15450 gene proB 1503 376 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVL9 protein_id gnl|my_center|LOCUS_15450 2609 1518 gene locus_tag LOCUS_15460 gene obg 2609 1518 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CKJ6 protein_id gnl|my_center|LOCUS_15460 2728 2907 gene locus_tag LOCUS_15470 2728 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3312 2992 gene locus_tag LOCUS_15480 gene rplU 3312 2992 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EE0 protein_id gnl|my_center|LOCUS_15480 3473 4441 gene locus_tag LOCUS_15490 3473 4441 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_15490 4514 4590 gene locus_tag LOCUS_t00290 4514 4590 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5321 4644 gene locus_tag LOCUS_15500 gene bioD 5321 4644 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMB2 protein_id gnl|my_center|LOCUS_15500 5769 5365 gene locus_tag LOCUS_15510 5769 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 6265 5915 gene locus_tag LOCUS_15520 6265 5915 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_15520 6939 6370 gene locus_tag LOCUS_15530 6939 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P25254 protein_id gnl|my_center|LOCUS_15530 7839 7012 gene locus_tag LOCUS_15540 gene proC 7839 7012 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22008 protein_id gnl|my_center|LOCUS_15540 8705 7836 gene locus_tag LOCUS_15550 8705 7836 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence099 1102 284 gene locus_tag LOCUS_15560 1102 284 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_15560 1215 2573 gene locus_tag LOCUS_15570 gene ffh 1215 2573 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32CX8 protein_id gnl|my_center|LOCUS_15570 2779 3066 gene locus_tag LOCUS_15580 gene rpsP 2779 3066 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBU7 protein_id gnl|my_center|LOCUS_15580 3106 3618 gene locus_tag LOCUS_15590 gene rimM 3106 3618 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7F1 protein_id gnl|my_center|LOCUS_15590 3635 4381 gene locus_tag LOCUS_15600 gene trmD 3635 4381 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG25 protein_id gnl|my_center|LOCUS_15600 4471 4830 gene locus_tag LOCUS_15610 gene rplS 4471 4830 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYH7 protein_id gnl|my_center|LOCUS_15610 5150 4923 gene locus_tag LOCUS_15620 5150 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 5127 6755 gene locus_tag LOCUS_15630 5127 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence100 320 1510 gene locus_tag LOCUS_15640 320 1510 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103591.1 protein_id gnl|my_center|LOCUS_15640 1558 2385 gene locus_tag LOCUS_15650 gene dapD 1558 2385 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG0 protein_id gnl|my_center|LOCUS_15650 2385 2735 gene locus_tag LOCUS_15660 2385 2735 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970786.1 protein_id gnl|my_center|LOCUS_15660 2732 3868 gene locus_tag LOCUS_15670 gene dapE 2732 3868 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIB5 protein_id gnl|my_center|LOCUS_15670 4439 6115 gene locus_tag LOCUS_15680 4439 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 6117 6866 gene locus_tag LOCUS_15690 6117 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence101 326 147 gene locus_tag LOCUS_15700 326 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 678 442 gene locus_tag LOCUS_15710 678 442 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815785.1 protein_id gnl|my_center|LOCUS_15710 2715 763 gene locus_tag LOCUS_15720 2715 763 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_15720 2751 5465 gene locus_tag LOCUS_15730 gene pepN 2751 5465 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267176.1 protein_id gnl|my_center|LOCUS_15730 5513 6874 gene locus_tag LOCUS_15740 5513 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 protein_id gnl|my_center|LOCUS_15740 6879 7184 gene locus_tag LOCUS_15750 6879 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence102 209 484 gene locus_tag LOCUS_15760 209 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 902 1906 gene locus_tag LOCUS_15770 902 1906 CDS product glycine/betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706547.1 protein_id gnl|my_center|LOCUS_15770 1998 2885 gene locus_tag LOCUS_15780 1998 2885 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708564.1 protein_id gnl|my_center|LOCUS_15780 2893 3963 gene locus_tag LOCUS_15790 2893 3963 CDS product proline/glycine betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971231.1 protein_id gnl|my_center|LOCUS_15790 6352 4112 gene locus_tag LOCUS_15800 gene glcB 6352 4112 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFM9 protein_id gnl|my_center|LOCUS_15800 7131 6364 gene locus_tag LOCUS_15810 7131 6364 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814178.1 protein_id gnl|my_center|LOCUS_15810 7471 7286 gene locus_tag LOCUS_15820 7471 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 8105 7626 gene locus_tag LOCUS_15830 8105 7626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence103 1022 561 gene locus_tag LOCUS_15840 1022 561 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_15840 1407 1928 gene locus_tag LOCUS_15850 gene greB 1407 1928 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7P8 protein_id gnl|my_center|LOCUS_15850 2011 2472 gene locus_tag LOCUS_15860 2011 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_15860 3463 2501 gene locus_tag LOCUS_15870 3463 2501 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTQ8 protein_id gnl|my_center|LOCUS_15870 4124 3669 gene locus_tag LOCUS_15880 4124 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 <7866 4226 gene locus_tag LOCUS_15890 <7866 4226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXN2:phosphoribosylformylglycinamidine synthase >Feature sequence104 2058 796 gene locus_tag LOCUS_15900 2058 796 CDS product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_15900 3254 2154 gene locus_tag LOCUS_15910 3254 2154 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480736.1 protein_id gnl|my_center|LOCUS_15910 4403 3309 gene locus_tag LOCUS_15920 4403 3309 CDS product polyamine-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5A4 protein_id gnl|my_center|LOCUS_15920 5340 4531 gene locus_tag LOCUS_15930 gene rhdA 5340 4531 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 protein_id gnl|my_center|LOCUS_15930 6537 5374 gene locus_tag LOCUS_15940 6537 5374 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706898.1 protein_id gnl|my_center|LOCUS_15940 6496 6822 gene locus_tag LOCUS_15950 6496 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 6840 7721 gene locus_tag LOCUS_15960 6840 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244513.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence105 <1 1242 gene locus_tag LOCUS_15970 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390242.1:catalase 1614 1300 gene locus_tag LOCUS_15980 1614 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530739.1 protein_id gnl|my_center|LOCUS_15980 1947 2480 gene locus_tag LOCUS_15990 1947 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257122.1 protein_id gnl|my_center|LOCUS_15990 2542 5457 gene locus_tag LOCUS_16000 2542 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 5519 7078 gene locus_tag LOCUS_16010 5519 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 7603 7160 gene locus_tag LOCUS_16020 7603 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence106 1150 407 gene locus_tag LOCUS_16030 1150 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1659 1147 gene locus_tag LOCUS_16040 1659 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2927 1656 gene locus_tag LOCUS_16050 2927 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3915 2920 gene locus_tag LOCUS_16060 gene gspK 3915 2920 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC2 protein_id gnl|my_center|LOCUS_16060 4523 3912 gene locus_tag LOCUS_16070 4523 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 4924 4520 gene locus_tag LOCUS_16080 gene yst1I 4924 4520 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173839.1 protein_id gnl|my_center|LOCUS_16080 5511 4924 gene locus_tag LOCUS_16090 5511 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 6014 5508 gene locus_tag LOCUS_16100 gene gspG 6014 5508 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_16100 7219 6002 gene locus_tag LOCUS_16110 gene xcpS 7219 6002 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00513 protein_id gnl|my_center|LOCUS_16110 >Feature sequence107 2350 167 gene locus_tag LOCUS_16120 gene fusA2 2350 167 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M30 protein_id gnl|my_center|LOCUS_16120 3979 2546 gene locus_tag LOCUS_16130 gene sbcB 3979 2546 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW85 protein_id gnl|my_center|LOCUS_16130 4135 4902 gene locus_tag LOCUS_16140 4135 4902 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8M8 protein_id gnl|my_center|LOCUS_16140 4899 5591 gene locus_tag LOCUS_16150 4899 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 5581 6495 gene locus_tag LOCUS_16160 gene rluB 5581 6495 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEY6 protein_id gnl|my_center|LOCUS_16160 6513 7178 gene locus_tag LOCUS_16170 gene nth 6513 7178 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z0 protein_id gnl|my_center|LOCUS_16170 >Feature sequence108 1681 317 gene locus_tag LOCUS_16180 gene degQ 1681 317 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886707.1 protein_id gnl|my_center|LOCUS_16180 3232 1814 gene locus_tag LOCUS_16190 3232 1814 CDS product UPF0061 protein R00982 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RB2 protein_id gnl|my_center|LOCUS_16190 4553 3408 gene locus_tag LOCUS_16200 4553 3408 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462916.1 protein_id gnl|my_center|LOCUS_16200 4750 5607 gene locus_tag LOCUS_16210 4750 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_16210 5612 6697 gene locus_tag LOCUS_16220 5612 6697 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089020.1 protein_id gnl|my_center|LOCUS_16220 6797 7264 gene locus_tag LOCUS_16230 6797 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence109 1528 443 gene locus_tag LOCUS_16240 1528 443 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_16240 1926 1525 gene locus_tag LOCUS_16250 1926 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2957 2031 gene locus_tag LOCUS_16260 2957 2031 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_16260 3537 3058 gene locus_tag LOCUS_16270 3537 3058 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_16270 3822 3595 gene locus_tag LOCUS_16280 3822 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_16280 4040 5545 gene locus_tag LOCUS_16290 4040 5545 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW80 protein_id gnl|my_center|LOCUS_16290 5681 6058 gene locus_tag LOCUS_16300 5681 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 6095 6931 gene locus_tag LOCUS_16310 gene soxA 6095 6931 CDS product SoxAX cytochrome complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDM7 protein_id gnl|my_center|LOCUS_16310 >Feature sequence110 <1 1797 gene locus_tag LOCUS_16320 <1 1797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705582.1:alpha-2-macroglobulin 2574 1981 gene locus_tag LOCUS_16330 2574 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 3400 2597 gene locus_tag LOCUS_16340 3400 2597 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F3 protein_id gnl|my_center|LOCUS_16340 3685 4041 gene locus_tag LOCUS_16350 3685 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 5015 4083 gene locus_tag LOCUS_16360 gene ispH 5015 4083 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 protein_id gnl|my_center|LOCUS_16360 5608 5102 gene locus_tag LOCUS_16370 gene lspA 5608 5102 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIM3 protein_id gnl|my_center|LOCUS_16370 <7331 5624 gene locus_tag LOCUS_16380 <7331 5624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KG39:isoleucine--tRNA ligase >Feature sequence111 316 981 gene locus_tag LOCUS_16390 316 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1094 2707 gene locus_tag LOCUS_16400 1094 2707 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257910.1 protein_id gnl|my_center|LOCUS_16400 2748 3545 gene locus_tag LOCUS_16410 2748 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 3532 3858 gene locus_tag LOCUS_16420 3532 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3871 4605 gene locus_tag LOCUS_16430 3871 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16430 4602 4751 gene locus_tag LOCUS_16440 4602 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 5882 5025 gene locus_tag LOCUS_16450 gene cbpA 5882 5025 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CJ2 protein_id gnl|my_center|LOCUS_16450 6465 6031 gene locus_tag LOCUS_16460 gene hspA 6465 6031 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence112 428 1114 gene locus_tag LOCUS_16470 428 1114 CDS product pilus assembly protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266584.1 protein_id gnl|my_center|LOCUS_16470 1167 2393 gene locus_tag LOCUS_16480 1167 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3072 2455 gene locus_tag LOCUS_16490 gene ubiX 3072 2455 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 protein_id gnl|my_center|LOCUS_16490 4439 3072 gene locus_tag LOCUS_16500 gene mpl 4439 3072 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889M0 protein_id gnl|my_center|LOCUS_16500 4921 4454 gene locus_tag LOCUS_16510 4921 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 5954 5082 gene locus_tag LOCUS_16520 5954 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 6633 6244 gene locus_tag LOCUS_16530 gene rpsI 6633 6244 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG3 protein_id gnl|my_center|LOCUS_16530 >Feature sequence113 <1 620 gene locus_tag LOCUS_16540 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337987.1:sugar ABC transporter permease 617 1447 gene locus_tag LOCUS_16550 617 1447 CDS product mannitol ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708987.1 protein_id gnl|my_center|LOCUS_16550 1463 2461 gene locus_tag LOCUS_16560 1463 2461 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708986.1 protein_id gnl|my_center|LOCUS_16560 2464 3990 gene locus_tag LOCUS_16570 gene mtlK 2464 3990 CDS product mannitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337991.1 protein_id gnl|my_center|LOCUS_16570 4040 5500 gene locus_tag LOCUS_16580 gene xylB 4040 5500 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970274.1 protein_id gnl|my_center|LOCUS_16580 5985 6521 gene locus_tag LOCUS_16590 5985 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence114 471 1358 gene locus_tag LOCUS_16600 471 1358 CDS product formate dehydrogenase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231159.2 protein_id gnl|my_center|LOCUS_16600 1461 2345 gene locus_tag LOCUS_16610 1461 2345 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706863.1 protein_id gnl|my_center|LOCUS_16610 2736 2392 gene locus_tag LOCUS_16620 2736 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3256 2765 gene locus_tag LOCUS_16630 gene folK-2 3256 2765 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_16630 3630 3253 gene locus_tag LOCUS_16640 gene folB 3630 3253 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_16640 3719 4330 gene locus_tag LOCUS_16650 gene plsY 3719 4330 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C89 protein_id gnl|my_center|LOCUS_16650 5365 4355 gene locus_tag LOCUS_16660 5365 4355 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZM46 protein_id gnl|my_center|LOCUS_16660 6033 5362 gene locus_tag LOCUS_16670 gene ftsE 6033 5362 CDS product cell division protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391337.1 protein_id gnl|my_center|LOCUS_16670 <6963 6102 gene locus_tag LOCUS_16680 <6963 6102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZM44:signal recognition particle receptor FtsY >Feature sequence115 <1 1194 gene locus_tag LOCUS_16690 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I3N2:cytochrome c-type biogenesis protein CcmF 1191 1787 gene locus_tag LOCUS_16700 gene dsbE 1191 1787 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 protein_id gnl|my_center|LOCUS_16700 1787 2248 gene locus_tag LOCUS_16710 1787 2248 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705303.1 protein_id gnl|my_center|LOCUS_16710 2245 3576 gene locus_tag LOCUS_16720 gene cycH 2245 3576 CDS product cytochrome c-type biogenesis protein CycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3M9 protein_id gnl|my_center|LOCUS_16720 3670 5097 gene locus_tag LOCUS_16730 gene gltX2 3670 5097 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BL6 protein_id gnl|my_center|LOCUS_16730 5152 6561 gene locus_tag LOCUS_16740 gene cysS 5152 6561 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5D6 protein_id gnl|my_center|LOCUS_16740 6669 6938 gene locus_tag LOCUS_16750 6669 6938 CDS product toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence116 469 2010 gene locus_tag LOCUS_16760 gene nusA 469 2010 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_16760 2146 4734 gene locus_tag LOCUS_16770 2146 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 4750 5127 gene locus_tag LOCUS_16780 gene rbfA 4750 5127 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097322.1 protein_id gnl|my_center|LOCUS_16780 5199 6167 gene locus_tag LOCUS_16790 gene truB 5199 6167 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4AAX7 protein_id gnl|my_center|LOCUS_16790 6248 6517 gene locus_tag LOCUS_16800 gene rpsO 6248 6517 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLD9 protein_id gnl|my_center|LOCUS_16800 >Feature sequence117 844 236 gene locus_tag LOCUS_16810 844 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1989 841 gene locus_tag LOCUS_16820 1989 841 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061518.1 protein_id gnl|my_center|LOCUS_16820 3232 2003 gene locus_tag LOCUS_16830 gene redB 3232 2003 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975627.1 protein_id gnl|my_center|LOCUS_16830 3358 5799 gene locus_tag LOCUS_16840 3358 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310719.1 protein_id gnl|my_center|LOCUS_16840 6199 6495 gene locus_tag LOCUS_16850 gene brnT 6199 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918377.1 protein_id gnl|my_center|LOCUS_16850 6473 6751 gene locus_tag LOCUS_16860 6473 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence118 408 1823 gene locus_tag LOCUS_16870 408 1823 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_16870 1820 3175 gene locus_tag LOCUS_16880 1820 3175 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_16880 3193 3783 gene locus_tag LOCUS_16890 3193 3783 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CKW9 protein_id gnl|my_center|LOCUS_16890 3875 4354 gene locus_tag LOCUS_16900 gene coaD 3875 4354 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P857 protein_id gnl|my_center|LOCUS_16900 4360 4611 gene locus_tag LOCUS_16910 4360 4611 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_16910 5521 4643 gene locus_tag LOCUS_16920 gene spoOJ 5521 4643 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_16920 6321 5554 gene locus_tag LOCUS_16930 gene parA 6321 5554 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence119 875 1723 gene locus_tag LOCUS_16940 875 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142265.1 protein_id gnl|my_center|LOCUS_16940 2755 1742 gene locus_tag LOCUS_16950 gene lhpD 2755 1742 CDS product delta(1)-pyrroline-2-carboxylate/Delta(1)-piperideine-2-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I492 protein_id gnl|my_center|LOCUS_16950 2931 4376 gene locus_tag LOCUS_16960 2931 4376 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061410.1 protein_id gnl|my_center|LOCUS_16960 4380 5363 gene locus_tag LOCUS_16970 4380 5363 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence120 405 1082 gene locus_tag LOCUS_16980 405 1082 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704884.1 protein_id gnl|my_center|LOCUS_16980 1075 1743 gene locus_tag LOCUS_16990 1075 1743 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974784.1 protein_id gnl|my_center|LOCUS_16990 1858 2466 gene locus_tag LOCUS_17000 gene msrA 1858 2466 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH4 protein_id gnl|my_center|LOCUS_17000 2490 3134 gene locus_tag LOCUS_17010 2490 3134 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_17010 3318 3121 gene locus_tag LOCUS_17020 3318 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 4616 3360 gene locus_tag LOCUS_17030 gene pfp 4616 3360 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_17030 5172 4741 gene locus_tag LOCUS_17040 5172 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence121 1602 394 gene locus_tag LOCUS_17050 1602 394 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706311.1 protein_id gnl|my_center|LOCUS_17050 2700 1630 gene locus_tag LOCUS_17060 gene ltaE 2700 1630 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065118.1 protein_id gnl|my_center|LOCUS_17060 3861 2710 gene locus_tag LOCUS_17070 3861 2710 CDS product gamma-butyrobetaine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531043.1 protein_id gnl|my_center|LOCUS_17070 5372 3924 gene locus_tag LOCUS_17080 gene betB 5372 3924 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4E9 protein_id gnl|my_center|LOCUS_17080 >Feature sequence122 1973 111 gene locus_tag LOCUS_17090 gene ilvD1 1973 111 CDS product dihydroxy-acid dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W069 protein_id gnl|my_center|LOCUS_17090 2479 2051 gene locus_tag LOCUS_17100 gene dksA 2479 2051 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8I6 protein_id gnl|my_center|LOCUS_17100 2641 3462 gene locus_tag LOCUS_17110 gene galU 2641 3462 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I291 protein_id gnl|my_center|LOCUS_17110 3612 4466 gene locus_tag LOCUS_17120 3612 4466 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406592.1 protein_id gnl|my_center|LOCUS_17120 4501 4884 gene locus_tag LOCUS_17130 gene apaG 4501 4884 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCE4 protein_id gnl|my_center|LOCUS_17130 4918 5766 gene locus_tag LOCUS_17140 gene apaH 4918 5766 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS4 protein_id gnl|my_center|LOCUS_17140 >Feature sequence123 1485 544 gene locus_tag LOCUS_17150 gene secF 1485 544 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S33 protein_id gnl|my_center|LOCUS_17150 3377 1509 gene locus_tag LOCUS_17160 gene secD 3377 1509 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY7 protein_id gnl|my_center|LOCUS_17160 3899 3480 gene locus_tag LOCUS_17170 gene yajC 3899 3480 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015446.1 protein_id gnl|my_center|LOCUS_17170 4986 3880 gene locus_tag LOCUS_17180 gene tgt 4986 3880 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM3 protein_id gnl|my_center|LOCUS_17180 6140 5073 gene locus_tag LOCUS_17190 gene queA 6140 5073 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXH8 protein_id gnl|my_center|LOCUS_17190 6223 6309 gene locus_tag LOCUS_t00300 6223 6309 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence124 1151 18 gene locus_tag LOCUS_17200 1151 18 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061528.1 protein_id gnl|my_center|LOCUS_17200 2164 1169 gene locus_tag LOCUS_17210 2164 1169 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887332.1 protein_id gnl|my_center|LOCUS_17210 4063 2168 gene locus_tag LOCUS_17220 4063 2168 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887331.1 protein_id gnl|my_center|LOCUS_17220 5946 4048 gene locus_tag LOCUS_17230 5946 4048 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975624.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence125 791 1306 gene locus_tag LOCUS_17240 791 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1937 1389 gene locus_tag LOCUS_17250 1937 1389 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337790.1 protein_id gnl|my_center|LOCUS_17250 2259 2008 gene locus_tag LOCUS_17260 2259 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406383.1 protein_id gnl|my_center|LOCUS_17260 2423 2767 gene locus_tag LOCUS_17270 2423 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2771 3442 gene locus_tag LOCUS_17280 2771 3442 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920607.1 protein_id gnl|my_center|LOCUS_17280 3442 4794 gene locus_tag LOCUS_17290 3442 4794 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532638.1 protein_id gnl|my_center|LOCUS_17290 4791 5906 gene locus_tag LOCUS_17300 4791 5906 CDS product porphyromonas-type peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701340.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence126 1392 178 gene locus_tag LOCUS_17310 1392 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1805 3589 gene locus_tag LOCUS_17320 1805 3589 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388194.1 protein_id gnl|my_center|LOCUS_17320 3662 4135 gene locus_tag LOCUS_17330 3662 4135 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207037.1 protein_id gnl|my_center|LOCUS_17330 4250 5917 gene locus_tag LOCUS_17340 4250 5917 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP5 protein_id gnl|my_center|LOCUS_17340 >Feature sequence127 263 1282 gene locus_tag LOCUS_17350 263 1282 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533458.1 protein_id gnl|my_center|LOCUS_17350 1391 2230 gene locus_tag LOCUS_17360 1391 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2223 2723 gene locus_tag LOCUS_17370 gene rimI 2223 2723 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCS0 protein_id gnl|my_center|LOCUS_17370 2852 3979 gene locus_tag LOCUS_17380 gene agxT 2852 3979 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_17380 4959 3994 gene locus_tag LOCUS_17390 4959 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 5410 4994 gene locus_tag LOCUS_17400 5410 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 <6002 5420 gene locus_tag LOCUS_17410 <6002 5420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUN4:alanine racemase, biosynthetic >Feature sequence128 218 988 gene locus_tag LOCUS_17420 218 988 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221014.1 protein_id gnl|my_center|LOCUS_17420 963 1592 gene locus_tag LOCUS_17430 gene rlmE 963 1592 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7M3 protein_id gnl|my_center|LOCUS_17430 1732 3660 gene locus_tag LOCUS_17440 gene hflB 1732 3660 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNF0 protein_id gnl|my_center|LOCUS_17440 3787 4575 gene locus_tag LOCUS_17450 3787 4575 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F745 protein_id gnl|my_center|LOCUS_17450 >Feature sequence129 421 906 gene locus_tag LOCUS_17460 421 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1410 1066 gene locus_tag LOCUS_17470 1410 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2003 1503 gene locus_tag LOCUS_17480 2003 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 2348 2103 gene locus_tag LOCUS_17490 2348 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3416 2409 gene locus_tag LOCUS_17500 gene oxyR 3416 2409 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_17500 3445 4278 gene locus_tag LOCUS_17510 3445 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 4288 5613 gene locus_tag LOCUS_17520 gene hemY 4288 5613 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940690.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence130 1875 142 gene locus_tag LOCUS_17530 gene proS 1875 142 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP53 protein_id gnl|my_center|LOCUS_17530 1807 1983 gene locus_tag LOCUS_17540 1807 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2178 3911 gene locus_tag LOCUS_17550 gene ilvI 2178 3911 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP8 protein_id gnl|my_center|LOCUS_17550 3925 4416 gene locus_tag LOCUS_17560 gene ilvH 3925 4416 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212817.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence131 1136 651 gene locus_tag LOCUS_17570 1136 651 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314011.1 protein_id gnl|my_center|LOCUS_17570 1271 2575 gene locus_tag LOCUS_17580 gene dadA 1271 2575 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89T28 protein_id gnl|my_center|LOCUS_17580 2625 3083 gene locus_tag LOCUS_17590 2625 3083 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529191.1 protein_id gnl|my_center|LOCUS_17590 3103 5385 gene locus_tag LOCUS_17600 3103 5385 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529192.1 protein_id gnl|my_center|LOCUS_17600 >Feature sequence132 565 207 gene locus_tag LOCUS_tm00010 565 207 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 705 884 gene locus_tag LOCUS_17610 705 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2269 881 gene locus_tag LOCUS_17620 2269 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2808 2269 gene locus_tag LOCUS_17630 2808 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 2927 3238 gene locus_tag LOCUS_17640 2927 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 4100 3246 gene locus_tag LOCUS_17650 gene panC 4100 3246 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV69 protein_id gnl|my_center|LOCUS_17650 5228 4170 gene locus_tag LOCUS_17660 5228 4170 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029699.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence133 143 805 gene locus_tag LOCUS_17670 143 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 802 1617 gene locus_tag LOCUS_17680 802 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 1641 2132 gene locus_tag LOCUS_17690 1641 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2470 2156 gene locus_tag LOCUS_17700 2470 2156 CDS product branched-chain amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392756.1 protein_id gnl|my_center|LOCUS_17700 3260 2463 gene locus_tag LOCUS_17710 3260 2463 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088307.1 protein_id gnl|my_center|LOCUS_17710 3576 3253 gene locus_tag LOCUS_17720 3576 3253 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191709.1 protein_id gnl|my_center|LOCUS_17720 3677 5017 gene locus_tag LOCUS_17730 3677 5017 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038874.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence134 >Feature sequence135 329 523 gene locus_tag LOCUS_17740 329 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1953 544 gene locus_tag LOCUS_17750 1953 544 CDS product NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975617.1 protein_id gnl|my_center|LOCUS_17750 2128 2394 gene locus_tag LOCUS_17760 2128 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2727 4130 gene locus_tag LOCUS_17770 gene fleQ 2727 4130 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086448.1 protein_id gnl|my_center|LOCUS_17770 4244 4320 gene locus_tag LOCUS_t00310 4244 4320 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence136 <1 511 gene locus_tag LOCUS_17780 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705722.1:ATPase AAA 508 1212 gene locus_tag LOCUS_17790 508 1212 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088845.1 protein_id gnl|my_center|LOCUS_17790 1205 2560 gene locus_tag LOCUS_17800 1205 2560 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705724.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence137 <1 987 gene locus_tag LOCUS_17810 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003107053.1:potassium transporter inner membrane associated protein 1000 2451 gene locus_tag LOCUS_17820 gene trkH 1000 2451 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8X4 protein_id gnl|my_center|LOCUS_17820 2471 2884 gene locus_tag LOCUS_17830 2471 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2900 3049 gene locus_tag LOCUS_17840 2900 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence138 <1 1153 gene locus_tag LOCUS_17850 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUC5:ATP-dependent protease ATPase subunit HslU 1175 1543 gene locus_tag LOCUS_17860 1175 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_17860 1585 2328 gene locus_tag LOCUS_17870 gene ubiE 1585 2328 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUC0 protein_id gnl|my_center|LOCUS_17870 2338 2997 gene locus_tag LOCUS_17880 2338 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2994 4658 gene locus_tag LOCUS_17890 gene ubiB 2994 4658 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRH7 protein_id gnl|my_center|LOCUS_17890 >Feature sequence139 1746 697 gene locus_tag LOCUS_17900 1746 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 2256 1783 gene locus_tag LOCUS_17910 gene ccmE 2256 1783 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_17910 3183 2461 gene locus_tag LOCUS_17920 gene ccmC 3183 2461 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N5 protein_id gnl|my_center|LOCUS_17920 3940 3275 gene locus_tag LOCUS_17930 gene ccmB 3940 3275 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 protein_id gnl|my_center|LOCUS_17930 4581 3937 gene locus_tag LOCUS_17940 gene ccmA 4581 3937 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD58 protein_id gnl|my_center|LOCUS_17940 >Feature sequence140 550 1524 gene locus_tag LOCUS_17950 550 1524 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528706.1 protein_id gnl|my_center|LOCUS_17950 1602 2408 gene locus_tag LOCUS_17960 gene tauB 1602 2408 CDS product Taurine import ATP-binding protein TauB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UJ14 protein_id gnl|my_center|LOCUS_17960 2423 4312 gene locus_tag LOCUS_17970 2423 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence141 354 94 gene locus_tag LOCUS_17980 gene rpsT 354 94 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH9 protein_id gnl|my_center|LOCUS_17980 1883 483 gene locus_tag LOCUS_17990 gene manB 1883 483 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338528.1 protein_id gnl|my_center|LOCUS_17990 3371 1941 gene locus_tag LOCUS_18000 gene xanB 3371 1941 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338527.1 protein_id gnl|my_center|LOCUS_18000 4304 3381 gene locus_tag LOCUS_18010 gene wcaG 4304 3381 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV57 protein_id gnl|my_center|LOCUS_18010 >Feature sequence142 2074 1076 gene locus_tag LOCUS_18020 gene bioB 2074 1076 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1WN69 protein_id gnl|my_center|LOCUS_18020 2488 2970 gene locus_tag LOCUS_18030 2488 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3399 3097 gene locus_tag LOCUS_18040 3399 3097 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814065.1 protein_id gnl|my_center|LOCUS_18040 4089 3472 gene locus_tag LOCUS_18050 4089 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence143 585 1652 gene locus_tag LOCUS_18060 gene purM 585 1652 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I513 protein_id gnl|my_center|LOCUS_18060 1668 2336 gene locus_tag LOCUS_18070 gene purN 1668 2336 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I514 protein_id gnl|my_center|LOCUS_18070 2351 3085 gene locus_tag LOCUS_18080 2351 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207724.1 protein_id gnl|my_center|LOCUS_18080 <4228 3091 gene locus_tag LOCUS_18090 <4228 3091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747Q8:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence144 754 395 gene locus_tag LOCUS_18100 754 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 1065 2315 gene locus_tag LOCUS_18110 1065 2315 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_18110 2426 3727 gene locus_tag LOCUS_18120 2426 3727 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTZ5 protein_id gnl|my_center|LOCUS_18120 3913 4137 gene locus_tag LOCUS_18130 3913 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 >Feature sequence145 1381 104 gene locus_tag LOCUS_18140 1381 104 CDS product MCD, Malonyl-CoA decarboxylase MCD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706350.1 protein_id gnl|my_center|LOCUS_18140 2301 1540 gene locus_tag LOCUS_18150 2301 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3667 2537 gene locus_tag LOCUS_18160 3667 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606740.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence146 760 386 gene locus_tag LOCUS_18170 760 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_18170 3441 775 gene locus_tag LOCUS_18180 3441 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 <4117 3443 gene locus_tag LOCUS_18190 <4117 3443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403750.1:C4-dicarboxylate ABC transporter substrate-binding protein >Feature sequence147 987 3158 gene locus_tag LOCUS_18200 987 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 3471 3169 gene locus_tag LOCUS_18210 3471 3169 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213446.1 protein_id gnl|my_center|LOCUS_18210 3716 3477 gene locus_tag LOCUS_18220 3716 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence148 819 655 gene locus_tag LOCUS_18230 gene rubA 819 655 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGV4 protein_id gnl|my_center|LOCUS_18230 914 1669 gene locus_tag LOCUS_18240 914 1669 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427216.1 protein_id gnl|my_center|LOCUS_18240 1666 2292 gene locus_tag LOCUS_18250 gene thiE 1666 2292 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX40 protein_id gnl|my_center|LOCUS_18250 2289 3581 gene locus_tag LOCUS_18260 gene hemL 2289 3581 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5R4 protein_id gnl|my_center|LOCUS_18260 >Feature sequence149 1001 474 gene locus_tag LOCUS_18270 gene rplJ 1001 474 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ2 protein_id gnl|my_center|LOCUS_18270 2061 1366 gene locus_tag LOCUS_18280 gene rplA 2061 1366 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC6 protein_id gnl|my_center|LOCUS_18280 2495 2064 gene locus_tag LOCUS_18290 gene rplK 2495 2064 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYQ4 protein_id gnl|my_center|LOCUS_18290 3128 2592 gene locus_tag LOCUS_18300 gene nusG 3128 2592 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Y3 protein_id gnl|my_center|LOCUS_18300 3439 3128 gene locus_tag LOCUS_18310 gene secE 3439 3128 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ET6 protein_id gnl|my_center|LOCUS_18310 3648 3573 gene locus_tag LOCUS_t00320 3648 3573 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3848 3720 gene locus_tag LOCUS_18320 3848 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence150 134 1261 gene locus_tag LOCUS_18330 gene tnpA 134 1261 CDS product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 protein_id gnl|my_center|LOCUS_18330 1346 1873 gene locus_tag LOCUS_18340 1346 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence151 2403 334 gene locus_tag LOCUS_18350 gene metG 2403 334 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XN0 protein_id gnl|my_center|LOCUS_18350 2631 3200 gene locus_tag LOCUS_18360 2631 3200 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267607.1 protein_id gnl|my_center|LOCUS_18360 3269 3356 gene locus_tag LOCUS_t00330 3269 3356 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence152 65 1156 gene locus_tag LOCUS_18370 65 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039036.1 protein_id gnl|my_center|LOCUS_18370 1265 2380 gene locus_tag LOCUS_18380 1265 2380 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925971.1 protein_id gnl|my_center|LOCUS_18380 2377 3213 gene locus_tag LOCUS_18390 gene ubiG 2377 3213 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence153 370 295 gene locus_tag LOCUS_t00340 370 295 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 781 1701 gene locus_tag LOCUS_18400 781 1701 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223780.1 protein_id gnl|my_center|LOCUS_18400 1809 2936 gene locus_tag LOCUS_18410 1809 2936 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203895.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence154 <3355 1770 gene locus_tag LOCUS_18420 <3355 1770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I2V5:aconitate hydratase B >Feature sequence155 504 971 gene locus_tag LOCUS_18430 504 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 1171 1815 gene locus_tag LOCUS_18440 1171 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence156 990 331 gene locus_tag LOCUS_18450 gene rpiA 990 331 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_18450 1122 2633 gene locus_tag LOCUS_18460 gene ilvA1 1122 2633 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_18460 >Feature sequence157 2299 2165 gene locus_tag LOCUS_18470 2299 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2581 3156 gene locus_tag LOCUS_18480 2581 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence158 426 2300 gene locus_tag LOCUS_18490 gene mnmG 426 2300 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQY9 protein_id gnl|my_center|LOCUS_18490 2290 2940 gene locus_tag LOCUS_18500 gene rsmG 2290 2940 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JTD7 protein_id gnl|my_center|LOCUS_18500 >Feature sequence159 682 32 gene locus_tag LOCUS_18510 gene clpP 682 32 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY6 protein_id gnl|my_center|LOCUS_18510 2140 845 gene locus_tag LOCUS_18520 gene tig 2140 845 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V42 protein_id gnl|my_center|LOCUS_18520 2307 2223 gene locus_tag LOCUS_t00350 2307 2223 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2455 2380 gene locus_tag LOCUS_t00360 2455 2380 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2627 2551 gene locus_tag LOCUS_t00370 2627 2551 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2785 2709 gene locus_tag LOCUS_t00380 2785 2709 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence160 >Feature sequence161 109 1146 gene locus_tag LOCUS_18530 gene prmB 109 1146 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVC5 protein_id gnl|my_center|LOCUS_18530 1143 1490 gene locus_tag LOCUS_18540 1143 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2562 1579 gene locus_tag LOCUS_18550 2562 1579 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338390.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence162 623 1621 gene locus_tag LOCUS_18560 623 1621 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704193.1 protein_id gnl|my_center|LOCUS_18560 <2790 1679 gene locus_tag LOCUS_18570 <2790 1679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930118.1:oxidoreductase >Feature sequence163 <1 1540 gene locus_tag LOCUS_18580 <1 1540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67026:UPF0753 protein 1537 1866 gene locus_tag LOCUS_18590 1537 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880524.1 protein_id gnl|my_center|LOCUS_18590 >Feature sequence164 538 1287 gene locus_tag LOCUS_18600 gene minC 538 1287 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ7 protein_id gnl|my_center|LOCUS_18600 1352 2170 gene locus_tag LOCUS_18610 gene minD 1352 2170 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CIC9 protein_id gnl|my_center|LOCUS_18610 2167 2427 gene locus_tag LOCUS_18620 gene minE 2167 2427 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYZ5 protein_id gnl|my_center|LOCUS_18620 >Feature sequence165 >Feature sequence166 <1 665 gene locus_tag LOCUS_18630 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971758.1:dimethylglycine dehydrogenase 879 1970 gene locus_tag LOCUS_18640 879 1970 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1M7 protein_id gnl|my_center|LOCUS_18640 2079 2163 gene locus_tag LOCUS_t00390 2079 2163 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2233 2306 gene locus_tag LOCUS_t00400 2233 2306 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2320 2395 gene locus_tag LOCUS_t00410 2320 2395 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence167 2564 2046 gene locus_tag LOCUS_18650 2564 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705044.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence168 1460 405 gene locus_tag LOCUS_18660 gene nadA 1460 405 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGY8 protein_id gnl|my_center|LOCUS_18660 2253 1513 gene locus_tag LOCUS_18670 gene cysZ 2253 1513 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJF4 protein_id gnl|my_center|LOCUS_18670 >Feature sequence169 833 1588 gene locus_tag LOCUS_18680 gene cysE 833 1588 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence170 310 927 gene locus_tag LOCUS_18690 310 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 <2435 1626 gene locus_tag LOCUS_18700 <2435 1626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZRJ8:adenylosuccinate lyase >Feature sequence171 <2415 522 gene locus_tag LOCUS_18710 <2415 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266375.1:peptidoglycan glycosyltransferase >Feature sequence172 1 1998 gene locus_tag LOCUS_18720 gene pnp 1 1998 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KND9 protein_id gnl|my_center|LOCUS_18720 2087 2389 gene locus_tag LOCUS_18730 2087 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence173 <2390 1491 gene locus_tag LOCUS_18740 <2390 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808458.1:glycosyl transferase >Feature sequence174 59 619 gene locus_tag LOCUS_18750 59 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 621 1733 gene locus_tag LOCUS_18760 gene per 621 1733 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9H3 protein_id gnl|my_center|LOCUS_18760 >Feature sequence175 990 166 gene locus_tag LOCUS_18770 gene uppP1 990 166 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD3 protein_id gnl|my_center|LOCUS_18770 1754 1035 gene locus_tag LOCUS_18780 1754 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251759.2 protein_id gnl|my_center|LOCUS_18780 <2345 1754 gene locus_tag LOCUS_18790 <2345 1754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958470.1:SAM-dependent methyltransferase >Feature sequence176 588 316 gene locus_tag LOCUS_18800 588 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1702 746 gene locus_tag LOCUS_18810 1702 746 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence177 549 1052 gene locus_tag LOCUS_18820 549 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1077 2012 gene locus_tag LOCUS_18830 1077 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence178 361 1521 gene locus_tag LOCUS_18840 361 1521 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775991.1 protein_id gnl|my_center|LOCUS_18840 1657 2004 gene locus_tag LOCUS_18850 1657 2004 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337712.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence179 >Feature sequence180 295 1839 gene locus_tag LOCUS_18860 gene cyaC 295 1839 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969945.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence181 505 1881 gene locus_tag LOCUS_18870 505 1881 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894578.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence182 <1884 1067 gene locus_tag LOCUS_18880 <1884 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706561.1:membrane protein >Feature sequence183 173 577 gene locus_tag LOCUS_18890 173 577 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972117.1 protein_id gnl|my_center|LOCUS_18890 769 693 gene locus_tag LOCUS_t00420 769 693 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1258 872 gene locus_tag LOCUS_18900 1258 872 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence184 <1 1063 gene locus_tag LOCUS_18910 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185343.1:CDP-6-deoxy-delta-3,4-glucoseen reductase >Feature sequence185 >Feature sequence186 276 200 gene locus_tag LOCUS_t00430 276 200 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 550 1398 gene locus_tag LOCUS_18920 gene folD 550 1398 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG21 protein_id gnl|my_center|LOCUS_18920 >Feature sequence187 <1515 760 gene locus_tag LOCUS_18930 <1515 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003530526.1:amino acid ABC transporter