>Feature sequence01 635 1015 gene locus_tag LOCUS_00010 gene bolA 635 1015 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114074.1 protein_id gnl|my_center|LOCUS_00010 999 2258 gene locus_tag LOCUS_00020 999 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2298 4658 gene locus_tag LOCUS_00030 2298 4658 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883002.1 protein_id gnl|my_center|LOCUS_00030 4779 5927 gene locus_tag LOCUS_00040 gene ribD 4779 5927 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z8X7 protein_id gnl|my_center|LOCUS_00040 5938 6669 gene locus_tag LOCUS_00050 5938 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252936.1 protein_id gnl|my_center|LOCUS_00050 7254 6874 gene locus_tag LOCUS_00060 7254 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8075 7254 gene locus_tag LOCUS_00070 gene dapB 8075 7254 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJE5 protein_id gnl|my_center|LOCUS_00070 9309 8182 gene locus_tag LOCUS_00080 gene dnaJ 9309 8182 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_00080 11381 9420 gene locus_tag LOCUS_00090 gene dnaK 11381 9420 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87712 protein_id gnl|my_center|LOCUS_00090 12143 11496 gene locus_tag LOCUS_00100 gene grpE 12143 11496 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY2 protein_id gnl|my_center|LOCUS_00100 13359 12424 gene locus_tag LOCUS_00110 gene rpoH 13359 12424 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42378 protein_id gnl|my_center|LOCUS_00110 14637 13540 gene locus_tag LOCUS_00120 gene ispG 14637 13540 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ4 protein_id gnl|my_center|LOCUS_00120 15536 14784 gene locus_tag LOCUS_00130 15536 14784 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRE6 protein_id gnl|my_center|LOCUS_00130 15685 16476 gene locus_tag LOCUS_00140 15685 16476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16823 16479 gene locus_tag LOCUS_00150 gene bamE 16823 16479 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFM4 protein_id gnl|my_center|LOCUS_00150 16919 17359 gene locus_tag LOCUS_00160 gene fur 16919 17359 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428651.1 protein_id gnl|my_center|LOCUS_00160 17423 18619 gene locus_tag LOCUS_00170 gene metZ 17423 18619 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM6 protein_id gnl|my_center|LOCUS_00170 18725 20074 gene locus_tag LOCUS_00180 18725 20074 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061372.1 protein_id gnl|my_center|LOCUS_00180 20235 20663 gene locus_tag LOCUS_00190 20235 20663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20734 22182 gene locus_tag LOCUS_00200 20734 22182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 22280 23152 gene locus_tag LOCUS_00210 22280 23152 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU65 protein_id gnl|my_center|LOCUS_00210 23293 24144 gene locus_tag LOCUS_00220 23293 24144 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_00220 24154 24990 gene locus_tag LOCUS_00230 24154 24990 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SA2 protein_id gnl|my_center|LOCUS_00230 24997 25782 gene locus_tag LOCUS_00240 gene lgt 24997 25782 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BG0 protein_id gnl|my_center|LOCUS_00240 25984 25909 gene locus_tag LOCUS_t00010 25984 25909 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 27229 26147 gene locus_tag LOCUS_00250 27229 26147 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954183.1 protein_id gnl|my_center|LOCUS_00250 28840 27608 gene locus_tag LOCUS_00260 gene folC 28840 27608 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262248.1 protein_id gnl|my_center|LOCUS_00260 29481 28981 gene locus_tag LOCUS_00270 29481 28981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30194 30715 gene locus_tag LOCUS_00280 30194 30715 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105493.1 protein_id gnl|my_center|LOCUS_00280 30786 32291 gene locus_tag LOCUS_00290 30786 32291 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261636.1 protein_id gnl|my_center|LOCUS_00290 32345 32854 gene locus_tag LOCUS_00300 gene hcpB 32345 32854 CDS product secreted protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253954.1 protein_id gnl|my_center|LOCUS_00300 32964 33689 gene locus_tag LOCUS_00310 32964 33689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 33799 35124 gene locus_tag LOCUS_00320 gene tssK 33799 35124 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941098.1 protein_id gnl|my_center|LOCUS_00320 35236 35931 gene locus_tag LOCUS_00330 35236 35931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35971 39579 gene locus_tag LOCUS_00340 gene tssM 35971 39579 CDS product type VI secretion system protein ImpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943786.1 protein_id gnl|my_center|LOCUS_00340 39635 41068 gene locus_tag LOCUS_00350 gene tolC 39635 41068 CDS product outer membrane channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262654.1 protein_id gnl|my_center|LOCUS_00350 41974 41039 gene locus_tag LOCUS_00360 gene cyoE1 41974 41039 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I719 protein_id gnl|my_center|LOCUS_00360 43048 41993 gene locus_tag LOCUS_00370 43048 41993 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_00370 43369 44916 gene locus_tag LOCUS_00380 gene ilvA1 43369 44916 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G0 protein_id gnl|my_center|LOCUS_00380 45119 45796 gene locus_tag LOCUS_00390 45119 45796 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK84 protein_id gnl|my_center|LOCUS_00390 46077 46898 gene locus_tag LOCUS_00400 gene apaH 46077 46898 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_00400 46900 47430 gene locus_tag LOCUS_00410 gene aroK 46900 47430 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFS0 protein_id gnl|my_center|LOCUS_00410 48673 47606 gene locus_tag LOCUS_00420 gene rfe 48673 47606 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880302.1 protein_id gnl|my_center|LOCUS_00420 49455 48760 gene locus_tag LOCUS_00430 gene ung 49455 48760 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD2 protein_id gnl|my_center|LOCUS_00430 52343 49587 gene locus_tag LOCUS_00440 52343 49587 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072980.1 protein_id gnl|my_center|LOCUS_00440 53528 52554 gene locus_tag LOCUS_00450 gene pstS 53528 52554 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA8 protein_id gnl|my_center|LOCUS_00450 53664 54581 gene locus_tag LOCUS_00460 gene nadK 53664 54581 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVT9 protein_id gnl|my_center|LOCUS_00460 54661 55959 gene locus_tag LOCUS_00470 54661 55959 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_00470 55949 56650 gene locus_tag LOCUS_00480 55949 56650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 57058 59388 gene locus_tag LOCUS_00490 gene opr86 57058 59388 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY4 protein_id gnl|my_center|LOCUS_00490 59484 60011 gene locus_tag LOCUS_00500 59484 60011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 60052 61473 gene locus_tag LOCUS_00510 gene rimO 60052 61473 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS95 protein_id gnl|my_center|LOCUS_00510 61463 62815 gene locus_tag LOCUS_00520 gene rocG 61463 62815 CDS product catabolic NAD-specific glutamate dehydrogenase RocG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39633 protein_id gnl|my_center|LOCUS_00520 62839 63936 gene locus_tag LOCUS_00530 gene aroB 62839 63936 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK19 protein_id gnl|my_center|LOCUS_00530 63989 64525 gene locus_tag LOCUS_00540 63989 64525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 64574 65695 gene locus_tag LOCUS_00550 gene ald 64574 65695 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU16 protein_id gnl|my_center|LOCUS_00550 65797 65721 gene locus_tag LOCUS_t00020 65797 65721 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 67192 65975 gene locus_tag LOCUS_00560 gene fabB 67192 65975 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769613.1 protein_id gnl|my_center|LOCUS_00560 68032 67505 gene locus_tag LOCUS_00570 gene fabA 68032 67505 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WC3 protein_id gnl|my_center|LOCUS_00570 68340 68990 gene locus_tag LOCUS_00580 68340 68990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 69046 70503 gene locus_tag LOCUS_00590 gene murD 69046 70503 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F20 protein_id gnl|my_center|LOCUS_00590 71047 70652 gene locus_tag LOCUS_00600 71047 70652 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_00600 71558 73021 gene locus_tag LOCUS_00610 gene lpdG 71558 73021 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_00610 73368 74528 gene locus_tag LOCUS_00620 gene sucC 73368 74528 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53593 protein_id gnl|my_center|LOCUS_00620 74583 75455 gene locus_tag LOCUS_00630 gene sucD 74583 75455 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51567 protein_id gnl|my_center|LOCUS_00630 75875 77773 gene locus_tag LOCUS_00640 gene rpoD 75875 77773 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26480 protein_id gnl|my_center|LOCUS_00640 77926 78002 gene locus_tag LOCUS_t00030 77926 78002 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 78358 78074 gene locus_tag LOCUS_00650 78358 78074 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UF5 protein_id gnl|my_center|LOCUS_00650 78511 78600 gene locus_tag LOCUS_t00040 78511 78600 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 78831 79349 gene locus_tag LOCUS_00660 78831 79349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886920.1 protein_id gnl|my_center|LOCUS_00660 80069 79479 gene locus_tag LOCUS_00670 80069 79479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 81221 80088 gene locus_tag LOCUS_00680 gene rlmN 81221 80088 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886Z3 protein_id gnl|my_center|LOCUS_00680 81719 81294 gene locus_tag LOCUS_00690 gene ndk 81719 81294 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU0 protein_id gnl|my_center|LOCUS_00690 82310 82110 gene locus_tag LOCUS_00700 82310 82110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51384 protein_id gnl|my_center|LOCUS_00700 83678 82797 gene locus_tag LOCUS_00710 83678 82797 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF83 protein_id gnl|my_center|LOCUS_00710 85154 83856 gene locus_tag LOCUS_00720 85154 83856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_00720 85406 85209 gene locus_tag LOCUS_00730 85406 85209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 86028 85546 gene locus_tag LOCUS_00740 86028 85546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 87399 86206 gene locus_tag LOCUS_00750 gene bioF 87399 86206 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWP1 protein_id gnl|my_center|LOCUS_00750 89588 87459 gene locus_tag LOCUS_00760 89588 87459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 89716 90789 gene locus_tag LOCUS_00770 gene ispB 89716 90789 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44916 protein_id gnl|my_center|LOCUS_00770 91895 90807 gene locus_tag LOCUS_00780 gene nagZ 91895 90807 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SA0 protein_id gnl|my_center|LOCUS_00780 91996 92745 gene locus_tag LOCUS_00790 91996 92745 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704670.1 protein_id gnl|my_center|LOCUS_00790 92783 93124 gene locus_tag LOCUS_00800 gene fdx 92783 93124 CDS product 2Fe-2S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51383 protein_id gnl|my_center|LOCUS_00800 95604 93193 gene locus_tag LOCUS_00810 gene ftsK 95604 93193 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZS5 protein_id gnl|my_center|LOCUS_00810 96168 97502 gene locus_tag LOCUS_00820 96168 97502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 97576 98265 gene locus_tag LOCUS_00830 gene pyrE 97576 98265 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHD4 protein_id gnl|my_center|LOCUS_00830 98448 99242 gene locus_tag LOCUS_00840 98448 99242 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXZ7 protein_id gnl|my_center|LOCUS_00840 99239 99859 gene locus_tag LOCUS_00850 99239 99859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 >Feature sequence02 3029 2481 gene locus_tag LOCUS_00860 3029 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 3907 3038 gene locus_tag LOCUS_00870 3907 3038 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_00870 5902 4079 gene locus_tag LOCUS_00880 5902 4079 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388585.1 protein_id gnl|my_center|LOCUS_00880 6579 5899 gene locus_tag LOCUS_00890 6579 5899 CDS product type I-C CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_00890 7404 7012 gene locus_tag LOCUS_00900 7404 7012 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928351.1 protein_id gnl|my_center|LOCUS_00900 8021 7788 gene locus_tag LOCUS_00910 8021 7788 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_00910 8347 8018 gene locus_tag LOCUS_00920 8347 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_00920 8467 8727 gene locus_tag LOCUS_00930 8467 8727 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213183.1 protein_id gnl|my_center|LOCUS_00930 8705 8992 gene locus_tag LOCUS_00940 8705 8992 CDS product RelE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221352.1 protein_id gnl|my_center|LOCUS_00940 11058 8989 gene locus_tag LOCUS_00950 gene cas3 11058 8989 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176706.1 protein_id gnl|my_center|LOCUS_00950 13277 11478 gene locus_tag LOCUS_00960 gene aspS 13277 11478 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL5 protein_id gnl|my_center|LOCUS_00960 13563 15557 gene locus_tag LOCUS_00970 gene ccmF 13563 15557 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_00970 15847 15922 gene locus_tag LOCUS_t00050 15847 15922 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15928 16012 gene locus_tag LOCUS_t00060 15928 16012 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 16236 16309 gene locus_tag LOCUS_t00070 16236 16309 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16344 16419 gene locus_tag LOCUS_t00080 16344 16419 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16499 16574 gene locus_tag LOCUS_t00090 16499 16574 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 16740 17174 gene locus_tag LOCUS_00980 gene secE 16740 17174 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC3 protein_id gnl|my_center|LOCUS_00980 17188 17724 gene locus_tag LOCUS_00990 gene nusG 17188 17724 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEY9 protein_id gnl|my_center|LOCUS_00990 17923 18354 gene locus_tag LOCUS_01000 gene rplK 17923 18354 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GJ3 protein_id gnl|my_center|LOCUS_01000 18359 19054 gene locus_tag LOCUS_01010 gene rplA 18359 19054 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NID5 protein_id gnl|my_center|LOCUS_01010 19331 19864 gene locus_tag LOCUS_01020 gene rplJ 19331 19864 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ET2 protein_id gnl|my_center|LOCUS_01020 19885 20265 gene locus_tag LOCUS_01030 gene rplL 19885 20265 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8S3 protein_id gnl|my_center|LOCUS_01030 20434 24603 gene locus_tag LOCUS_01040 gene rpoB 20434 24603 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51561 protein_id gnl|my_center|LOCUS_01040 24705 28865 gene locus_tag LOCUS_01050 gene rpoC 24705 28865 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC9 protein_id gnl|my_center|LOCUS_01050 29180 29551 gene locus_tag LOCUS_01060 gene rpsL 29180 29551 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD0 protein_id gnl|my_center|LOCUS_01060 29596 30066 gene locus_tag LOCUS_01070 gene rpsG 29596 30066 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X5 protein_id gnl|my_center|LOCUS_01070 30138 32219 gene locus_tag LOCUS_01080 gene fusA1 30138 32219 CDS product elongation factor G 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L45 protein_id gnl|my_center|LOCUS_01080 32273 33451 gene locus_tag LOCUS_01090 gene tufB 32273 33451 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_252967.1 protein_id gnl|my_center|LOCUS_01090 33710 34030 gene locus_tag LOCUS_01100 gene rpsJ 33710 34030 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889X2 protein_id gnl|my_center|LOCUS_01100 34038 34703 gene locus_tag LOCUS_01110 gene rplC 34038 34703 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJA9 protein_id gnl|my_center|LOCUS_01110 34767 35423 gene locus_tag LOCUS_01120 gene rplD 34767 35423 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWD6 protein_id gnl|my_center|LOCUS_01120 35429 35743 gene locus_tag LOCUS_01130 gene rplW 35429 35743 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC47 protein_id gnl|my_center|LOCUS_01130 35754 36578 gene locus_tag LOCUS_01140 gene rplB 35754 36578 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK65 protein_id gnl|my_center|LOCUS_01140 36616 36888 gene locus_tag LOCUS_01150 36616 36888 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_003856781.1 protein_id gnl|my_center|LOCUS_01150 36921 37265 gene locus_tag LOCUS_01160 gene rplV 36921 37265 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE0 protein_id gnl|my_center|LOCUS_01160 37288 37959 gene locus_tag LOCUS_01170 gene rpsC 37288 37959 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE1 protein_id gnl|my_center|LOCUS_01170 37965 38378 gene locus_tag LOCUS_01180 gene rplP 37965 38378 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYN6 protein_id gnl|my_center|LOCUS_01180 38394 38615 gene locus_tag LOCUS_01190 38394 38615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 38630 38893 gene locus_tag LOCUS_01200 gene rpsQ 38630 38893 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC41 protein_id gnl|my_center|LOCUS_01200 38924 39292 gene locus_tag LOCUS_01210 gene rplN 38924 39292 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE5 protein_id gnl|my_center|LOCUS_01210 39302 39619 gene locus_tag LOCUS_01220 gene rplX 39302 39619 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ER5 protein_id gnl|my_center|LOCUS_01220 39631 40167 gene locus_tag LOCUS_01230 gene rplE 39631 40167 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK57 protein_id gnl|my_center|LOCUS_01230 40195 40500 gene locus_tag LOCUS_01240 gene rpsN 40195 40500 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ19 protein_id gnl|my_center|LOCUS_01240 40569 40937 gene locus_tag LOCUS_01250 gene rpsH 40569 40937 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWE9 protein_id gnl|my_center|LOCUS_01250 40976 41512 gene locus_tag LOCUS_01260 gene rplF 40976 41512 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KQ17 protein_id gnl|my_center|LOCUS_01260 41542 41898 gene locus_tag LOCUS_01270 gene rplR 41542 41898 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF1 protein_id gnl|my_center|LOCUS_01270 41917 42384 gene locus_tag LOCUS_01280 gene rpsE 41917 42384 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32B48 protein_id gnl|my_center|LOCUS_01280 42400 42594 gene locus_tag LOCUS_01290 gene rpmD 42400 42594 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDS9 protein_id gnl|my_center|LOCUS_01290 42620 43111 gene locus_tag LOCUS_01300 42620 43111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 43125 44447 gene locus_tag LOCUS_01310 gene secY 43125 44447 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF5 protein_id gnl|my_center|LOCUS_01310 44638 44982 gene locus_tag LOCUS_01320 gene rpsM 44638 44982 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U9 protein_id gnl|my_center|LOCUS_01320 45017 45403 gene locus_tag LOCUS_01330 gene rpsK 45017 45403 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWF8 protein_id gnl|my_center|LOCUS_01330 45432 46055 gene locus_tag LOCUS_01340 gene rpsD 45432 46055 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SZ1 protein_id gnl|my_center|LOCUS_01340 46094 47128 gene locus_tag LOCUS_01350 gene rpoA 46094 47128 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EQ2 protein_id gnl|my_center|LOCUS_01350 47206 47829 gene locus_tag LOCUS_01360 47206 47829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 48152 49069 gene locus_tag LOCUS_01370 gene gshB 48152 49069 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC9 protein_id gnl|my_center|LOCUS_01370 49197 49466 gene locus_tag LOCUS_01380 gene rpsO 49197 49466 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ7 protein_id gnl|my_center|LOCUS_01380 49858 52020 gene locus_tag LOCUS_01390 gene pnp 49858 52020 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV59 protein_id gnl|my_center|LOCUS_01390 52194 52457 gene locus_tag LOCUS_01400 52194 52457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 52543 54324 gene locus_tag LOCUS_01410 gene purH 52543 54324 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y4D3 protein_id gnl|my_center|LOCUS_01410 55108 54395 gene locus_tag LOCUS_01420 55108 54395 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPU8 protein_id gnl|my_center|LOCUS_01420 55761 55225 gene locus_tag LOCUS_01430 55761 55225 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_01430 56541 55942 gene locus_tag LOCUS_01440 56541 55942 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316724.1 protein_id gnl|my_center|LOCUS_01440 57850 56606 gene locus_tag LOCUS_01450 gene metX 57850 56606 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM58 protein_id gnl|my_center|LOCUS_01450 59272 57992 gene locus_tag LOCUS_01460 gene purD 59272 57992 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFU6 protein_id gnl|my_center|LOCUS_01460 59432 60268 gene locus_tag LOCUS_01470 59432 60268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 60325 62637 gene locus_tag LOCUS_01480 60325 62637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 62746 64353 gene locus_tag LOCUS_01490 62746 64353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918490.1 protein_id gnl|my_center|LOCUS_01490 64435 66666 gene locus_tag LOCUS_01500 64435 66666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 66696 68306 gene locus_tag LOCUS_01510 66696 68306 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140950.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence03 <1 793 gene locus_tag LOCUS_01520 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114105.1:glycosyltransferase WbpZ 2320 866 gene locus_tag LOCUS_01530 gene gatA 2320 866 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR9 protein_id gnl|my_center|LOCUS_01530 2711 2424 gene locus_tag LOCUS_01540 gene gatC 2711 2424 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVT9 protein_id gnl|my_center|LOCUS_01540 2955 3815 gene locus_tag LOCUS_01550 gene cdsA 2955 3815 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ABG1 protein_id gnl|my_center|LOCUS_01550 3831 4376 gene locus_tag LOCUS_01560 gene coaD 3831 4376 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JHR9 protein_id gnl|my_center|LOCUS_01560 4367 4915 gene locus_tag LOCUS_01570 gene kdsC 4367 4915 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZB47 protein_id gnl|my_center|LOCUS_01570 5001 6017 gene locus_tag LOCUS_01580 gene pdxA 5001 6017 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPK2 protein_id gnl|my_center|LOCUS_01580 6058 6846 gene locus_tag LOCUS_01590 gene rsmA 6058 6846 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRF4 protein_id gnl|my_center|LOCUS_01590 7065 7388 gene locus_tag LOCUS_01600 gene fdxA 7065 7388 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_01600 7483 8064 gene locus_tag LOCUS_01610 7483 8064 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA9 protein_id gnl|my_center|LOCUS_01610 8081 8386 gene locus_tag LOCUS_01620 8081 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 9272 8634 gene locus_tag LOCUS_01630 9272 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 10725 9247 gene locus_tag LOCUS_01640 10725 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 12503 10707 gene locus_tag LOCUS_01650 gene proS 12503 10707 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP53 protein_id gnl|my_center|LOCUS_01650 13090 12941 gene locus_tag LOCUS_01660 13090 12941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 13052 14491 gene locus_tag LOCUS_01670 13052 14491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 14524 15543 gene locus_tag LOCUS_01680 gene nadA 14524 15543 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KP08 protein_id gnl|my_center|LOCUS_01680 16232 15561 gene locus_tag LOCUS_01690 gene tolQ 16232 15561 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958307.1 protein_id gnl|my_center|LOCUS_01690 16972 16337 gene locus_tag LOCUS_01700 gene orn 16972 16337 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_01700 17244 17319 gene locus_tag LOCUS_t00100 17244 17319 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17702 18376 gene locus_tag LOCUS_01710 gene cysE 17702 18376 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 protein_id gnl|my_center|LOCUS_01710 18470 20281 gene locus_tag LOCUS_01720 18470 20281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 20496 21257 gene locus_tag LOCUS_01730 20496 21257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 21332 22132 gene locus_tag LOCUS_01740 21332 22132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 22148 22645 gene locus_tag LOCUS_01750 gene rnhA 22148 22645 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UU3 protein_id gnl|my_center|LOCUS_01750 23459 22758 gene locus_tag LOCUS_01760 23459 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 24934 23459 gene locus_tag LOCUS_01770 24934 23459 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_01770 25995 24931 gene locus_tag LOCUS_01780 25995 24931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 26976 26398 gene locus_tag LOCUS_01790 26976 26398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 27167 27400 gene locus_tag LOCUS_01800 27167 27400 CDS product HicA-related toxin-antitoxin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265861.1 protein_id gnl|my_center|LOCUS_01800 27397 27762 gene locus_tag LOCUS_01810 gene hicB 27397 27762 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993678.1 protein_id gnl|my_center|LOCUS_01810 28576 27950 gene locus_tag LOCUS_01820 28576 27950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 28733 31516 gene locus_tag LOCUS_01830 gene valS 28733 31516 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXL2 protein_id gnl|my_center|LOCUS_01830 31542 32162 gene locus_tag LOCUS_01840 31542 32162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 32168 33637 gene locus_tag LOCUS_01850 gene cysG 32168 33637 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZT0 protein_id gnl|my_center|LOCUS_01850 34919 34365 gene locus_tag LOCUS_01860 34919 34365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 35375 34956 gene locus_tag LOCUS_01870 35375 34956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 36095 35397 gene locus_tag LOCUS_01880 36095 35397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 37206 36127 gene locus_tag LOCUS_01890 37206 36127 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_01890 37984 37223 gene locus_tag LOCUS_01900 37984 37223 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804111.1 protein_id gnl|my_center|LOCUS_01900 39324 37981 gene locus_tag LOCUS_01910 39324 37981 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726801.1 protein_id gnl|my_center|LOCUS_01910 40564 39443 gene locus_tag LOCUS_01920 gene lpxK 40564 39443 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUI0 protein_id gnl|my_center|LOCUS_01920 42161 40629 gene locus_tag LOCUS_01930 gene purF 42161 40629 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_01930 42675 42241 gene locus_tag LOCUS_01940 42675 42241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 44375 43008 gene locus_tag LOCUS_01950 gene trkA 44375 43008 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401453.1 protein_id gnl|my_center|LOCUS_01950 45244 44396 gene locus_tag LOCUS_01960 gene panB 45244 44396 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UA91 protein_id gnl|my_center|LOCUS_01960 46304 45390 gene locus_tag LOCUS_01970 gene oxyR 46304 45390 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_01970 46578 47117 gene locus_tag LOCUS_01980 46578 47117 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948056.1 protein_id gnl|my_center|LOCUS_01980 47768 49939 gene locus_tag LOCUS_01990 47768 49939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 49936 50814 gene locus_tag LOCUS_02000 49936 50814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 52318 51032 gene locus_tag LOCUS_02010 52318 51032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 53330 52452 gene locus_tag LOCUS_02020 53330 52452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 54604 53402 gene locus_tag LOCUS_02030 gene pcnB 54604 53402 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP05 protein_id gnl|my_center|LOCUS_02030 55272 56375 gene locus_tag LOCUS_02040 gene prfA 55272 56375 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42806 protein_id gnl|my_center|LOCUS_02040 57030 56377 gene locus_tag LOCUS_02050 57030 56377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 >Feature sequence04 1654 2310 gene locus_tag LOCUS_02060 gene sspA 1654 2310 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_02060 2658 2828 gene locus_tag LOCUS_02070 2658 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 2830 4230 gene locus_tag LOCUS_02080 gene purB 2830 4230 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WGE1 protein_id gnl|my_center|LOCUS_02080 4366 4920 gene locus_tag LOCUS_02090 gene folA 4366 4920 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0P1 protein_id gnl|my_center|LOCUS_02090 5268 6167 gene locus_tag LOCUS_02100 gene lpxC 5268 6167 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P47205 protein_id gnl|my_center|LOCUS_02100 6959 6189 gene locus_tag LOCUS_02110 gene uppP1 6959 6189 CDS product undecaprenyl-diphosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81HV4 protein_id gnl|my_center|LOCUS_02110 7885 7190 gene locus_tag LOCUS_02120 7885 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 8811 7882 gene locus_tag LOCUS_02130 8811 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 11251 8819 gene locus_tag LOCUS_02140 gene gyrB 11251 8819 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C2 protein_id gnl|my_center|LOCUS_02140 12365 11238 gene locus_tag LOCUS_02150 gene recF 12365 11238 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT0 protein_id gnl|my_center|LOCUS_02150 13853 12618 gene locus_tag LOCUS_02160 13853 12618 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500U6 protein_id gnl|my_center|LOCUS_02160 15207 13867 gene locus_tag LOCUS_02170 gene dnaA 15207 13867 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT2 protein_id gnl|my_center|LOCUS_02170 16582 15488 gene locus_tag LOCUS_02180 16582 15488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_02180 17170 16724 gene locus_tag LOCUS_02190 17170 16724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 18803 17517 gene locus_tag LOCUS_02200 18803 17517 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105257.1 protein_id gnl|my_center|LOCUS_02200 20420 18882 gene locus_tag LOCUS_02210 gene mpl 20420 18882 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KPF6 protein_id gnl|my_center|LOCUS_02210 21206 20439 gene locus_tag LOCUS_02220 gene ccmC 21206 20439 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765259.1 protein_id gnl|my_center|LOCUS_02220 21839 21273 gene locus_tag LOCUS_02230 21839 21273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 22044 21971 gene locus_tag LOCUS_t00110 22044 21971 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 22267 22193 gene locus_tag LOCUS_t00120 22267 22193 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23251 23826 gene locus_tag LOCUS_02240 23251 23826 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS19 protein_id gnl|my_center|LOCUS_02240 24399 25049 gene locus_tag LOCUS_02250 24399 25049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 25354 26703 gene locus_tag LOCUS_02260 gene mdtK 25354 26703 CDS product multidrug resistance protein MdtK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV52 protein_id gnl|my_center|LOCUS_02260 27184 26819 gene locus_tag LOCUS_02270 27184 26819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 28990 27539 gene locus_tag LOCUS_02280 28990 27539 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705774.1 protein_id gnl|my_center|LOCUS_02280 30441 28990 gene locus_tag LOCUS_02290 gene trkH 30441 28990 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MK54 protein_id gnl|my_center|LOCUS_02290 32473 30533 gene locus_tag LOCUS_02300 gene fabY 32473 30533 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_02300 33236 32841 gene locus_tag LOCUS_02310 gene rpsI 33236 32841 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WW8 protein_id gnl|my_center|LOCUS_02310 33802 33371 gene locus_tag LOCUS_02320 gene rplM 33802 33371 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AA15 protein_id gnl|my_center|LOCUS_02320 34268 33930 gene locus_tag LOCUS_02330 34268 33930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 34815 34459 gene locus_tag LOCUS_02340 34815 34459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 36015 34879 gene locus_tag LOCUS_02350 36015 34879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 37118 36567 gene locus_tag LOCUS_02360 37118 36567 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703633.1 protein_id gnl|my_center|LOCUS_02360 37117 39246 gene locus_tag LOCUS_02370 37117 39246 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001337565.1 protein_id gnl|my_center|LOCUS_02370 39333 41087 gene locus_tag LOCUS_02380 gene recJ 39333 41087 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_02380 41187 42110 gene locus_tag LOCUS_02390 41187 42110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_02390 42136 43131 gene locus_tag LOCUS_02400 gene hemB 42136 43131 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG3 protein_id gnl|my_center|LOCUS_02400 43150 44124 gene locus_tag LOCUS_02410 43150 44124 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_02410 44350 46014 gene locus_tag LOCUS_02420 gene yejF 44350 46014 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537535.1 protein_id gnl|my_center|LOCUS_02420 46297 46046 gene locus_tag LOCUS_02430 46297 46046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 <47436 46418 gene locus_tag LOCUS_02440 <47436 46418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HU53:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence05 385 1257 gene locus_tag LOCUS_02450 gene panC 385 1257 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Q6 protein_id gnl|my_center|LOCUS_02450 2441 1335 gene locus_tag LOCUS_02460 2441 1335 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 protein_id gnl|my_center|LOCUS_02460 3534 2785 gene locus_tag LOCUS_02470 gene dsbA 3534 2785 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_02470 4656 3595 gene locus_tag LOCUS_02480 4656 3595 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_02480 5671 4673 gene locus_tag LOCUS_02490 5671 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 6616 5912 gene locus_tag LOCUS_02500 gene uppS 6616 5912 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS4 protein_id gnl|my_center|LOCUS_02500 7236 6697 gene locus_tag LOCUS_02510 gene frr 7236 6697 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 protein_id gnl|my_center|LOCUS_02510 7961 7239 gene locus_tag LOCUS_02520 gene pyrH 7961 7239 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886P1 protein_id gnl|my_center|LOCUS_02520 9932 8097 gene locus_tag LOCUS_02530 9932 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 12259 10319 gene locus_tag LOCUS_02540 gene ftsH 12259 10319 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV48 protein_id gnl|my_center|LOCUS_02540 12993 12304 gene locus_tag LOCUS_02550 gene rlmE 12993 12304 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNQ4 protein_id gnl|my_center|LOCUS_02550 14563 13016 gene locus_tag LOCUS_02560 gene murJ 14563 13016 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI2 protein_id gnl|my_center|LOCUS_02560 16238 14538 gene locus_tag LOCUS_02570 gene lnt 16238 14538 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX7 protein_id gnl|my_center|LOCUS_02570 16693 17463 gene locus_tag LOCUS_02580 16693 17463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 17463 18728 gene locus_tag LOCUS_02590 gene ftsA 17463 18728 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_02590 18807 20027 gene locus_tag LOCUS_02600 gene ftsZ 18807 20027 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSB0 protein_id gnl|my_center|LOCUS_02600 20247 21296 gene locus_tag LOCUS_02610 gene hofC 20247 21296 CDS product type II secretion protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167094.1 protein_id gnl|my_center|LOCUS_02610 21521 21596 gene locus_tag LOCUS_t00130 21521 21596 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 22330 21728 gene locus_tag LOCUS_02620 gene lolA 22330 21728 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMG9 protein_id gnl|my_center|LOCUS_02620 22686 23738 gene locus_tag LOCUS_02630 22686 23738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087942.1 protein_id gnl|my_center|LOCUS_02630 24256 23873 gene locus_tag LOCUS_02640 24256 23873 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020832.1 protein_id gnl|my_center|LOCUS_02640 24800 25456 gene locus_tag LOCUS_02650 gene omt 24800 25456 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_02650 25504 26847 gene locus_tag LOCUS_02660 gene tilS 25504 26847 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP61 protein_id gnl|my_center|LOCUS_02660 27221 28516 gene locus_tag LOCUS_02670 gene glyA 27221 28516 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXK6 protein_id gnl|my_center|LOCUS_02670 28591 29946 gene locus_tag LOCUS_02680 28591 29946 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920161.1 protein_id gnl|my_center|LOCUS_02680 30765 29965 gene locus_tag LOCUS_02690 gene thyA 30765 29965 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32C94 protein_id gnl|my_center|LOCUS_02690 31214 32554 gene locus_tag LOCUS_02700 gene tolB 31214 32554 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y40 protein_id gnl|my_center|LOCUS_02700 32605 33219 gene locus_tag LOCUS_02710 32605 33219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 33346 33915 gene locus_tag LOCUS_02720 33346 33915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 34461 33988 gene locus_tag LOCUS_02730 34461 33988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 36594 34498 gene locus_tag LOCUS_02740 gene mnmC 36594 34498 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYF0 protein_id gnl|my_center|LOCUS_02740 37282 36599 gene locus_tag LOCUS_02750 gene gph 37282 36599 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_02750 37620 38288 gene locus_tag LOCUS_02760 37620 38288 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529253.1 protein_id gnl|my_center|LOCUS_02760 38834 38394 gene locus_tag LOCUS_02770 gene atpC 38834 38394 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_02770 40288 38867 gene locus_tag LOCUS_02780 gene atpD 40288 38867 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q329S1 protein_id gnl|my_center|LOCUS_02780 40497 40297 gene locus_tag LOCUS_02790 40497 40297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 40794 40642 gene locus_tag LOCUS_02800 40794 40642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02800 41760 40825 gene locus_tag LOCUS_02810 gene atpG 41760 40825 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT19 protein_id gnl|my_center|LOCUS_02810 <42690 41816 gene locus_tag LOCUS_02820 <42690 41816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZL22:ATP synthase subunit alpha >Feature sequence06 2057 702 gene locus_tag LOCUS_02830 gene glmM 2057 702 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_02830 3086 2307 gene locus_tag LOCUS_02840 gene yadH 3086 2307 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2T0 protein_id gnl|my_center|LOCUS_02840 4038 3100 gene locus_tag LOCUS_02850 4038 3100 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_02850 5367 4447 gene locus_tag LOCUS_02860 5367 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 6370 5384 gene locus_tag LOCUS_02870 6370 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 6781 8037 gene locus_tag LOCUS_02880 gene nqrA 6781 8037 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK6 protein_id gnl|my_center|LOCUS_02880 8169 9380 gene locus_tag LOCUS_02890 gene nqrB 8169 9380 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_02890 9550 10251 gene locus_tag LOCUS_02900 gene nqrC 9550 10251 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_02900 10397 11074 gene locus_tag LOCUS_02910 gene nqrD 10397 11074 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK9 protein_id gnl|my_center|LOCUS_02910 11169 11780 gene locus_tag LOCUS_02920 gene nqrE 11169 11780 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_02920 11836 13068 gene locus_tag LOCUS_02930 gene nqrF 11836 13068 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL1 protein_id gnl|my_center|LOCUS_02930 13164 13994 gene locus_tag LOCUS_02940 gene mutM 13164 13994 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2H2 protein_id gnl|my_center|LOCUS_02940 14640 15797 gene locus_tag LOCUS_02950 14640 15797 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_02950 15814 18909 gene locus_tag LOCUS_02960 15814 18909 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_02960 19040 20341 gene locus_tag LOCUS_02970 19040 20341 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946399.1 protein_id gnl|my_center|LOCUS_02970 20689 20402 gene locus_tag LOCUS_02980 20689 20402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 20989 21165 gene locus_tag LOCUS_02990 20989 21165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 21162 21563 gene locus_tag LOCUS_03000 21162 21563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 21578 21727 gene locus_tag LOCUS_03010 21578 21727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_03010 21743 23581 gene locus_tag LOCUS_03020 gene nolO 21743 23581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887298.1 protein_id gnl|my_center|LOCUS_03020 23568 24527 gene locus_tag LOCUS_03030 23568 24527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 25196 25750 gene locus_tag LOCUS_03040 25196 25750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 25901 26920 gene locus_tag LOCUS_03050 25901 26920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 26981 27472 gene locus_tag LOCUS_03060 gene greA 26981 27472 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV46 protein_id gnl|my_center|LOCUS_03060 27528 28253 gene locus_tag LOCUS_03070 27528 28253 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948360.1 protein_id gnl|my_center|LOCUS_03070 28510 28779 gene locus_tag LOCUS_03080 28510 28779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 28924 30486 gene locus_tag LOCUS_03090 gene miaB 28924 30486 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN97 protein_id gnl|my_center|LOCUS_03090 30508 31854 gene locus_tag LOCUS_03100 30508 31854 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_03100 31937 32467 gene locus_tag LOCUS_03110 31937 32467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 32468 32965 gene locus_tag LOCUS_03120 32468 32965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 33669 32962 gene locus_tag LOCUS_03130 33669 32962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 33924 36815 gene locus_tag LOCUS_03140 gene gcvP1 33924 36815 CDS product glycine dehydrogenase (decarboxylating) 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I137 protein_id gnl|my_center|LOCUS_03140 36900 37850 gene locus_tag LOCUS_03150 gene trxB1 36900 37850 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0M2 protein_id gnl|my_center|LOCUS_03150 38051 38884 gene locus_tag LOCUS_03160 gene ispD 38051 38884 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LQ2 protein_id gnl|my_center|LOCUS_03160 40536 38959 gene locus_tag LOCUS_03170 gene gshA 40536 38959 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTY6 protein_id gnl|my_center|LOCUS_03170 42219 40630 gene locus_tag LOCUS_03180 42219 40630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 >Feature sequence07 603 1973 gene locus_tag LOCUS_03190 603 1973 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886672.1 protein_id gnl|my_center|LOCUS_03190 2789 2061 gene locus_tag LOCUS_03200 2789 2061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996178.1 protein_id gnl|my_center|LOCUS_03200 4634 2805 gene locus_tag LOCUS_03210 gene nadE2 4634 2805 CDS product putative glutamine-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0Y0 protein_id gnl|my_center|LOCUS_03210 5056 4697 gene locus_tag LOCUS_03220 gene erpA 5056 4697 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z2 protein_id gnl|my_center|LOCUS_03220 5762 5334 gene locus_tag LOCUS_03230 gene ccmE 5762 5334 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX72 protein_id gnl|my_center|LOCUS_03230 6358 6888 gene locus_tag LOCUS_03240 gene yfhC 6358 6888 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMD4 protein_id gnl|my_center|LOCUS_03240 6881 8377 gene locus_tag LOCUS_03250 gene shaD 6881 8377 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958316.1 protein_id gnl|my_center|LOCUS_03250 8387 8872 gene locus_tag LOCUS_03260 8387 8872 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639705.1 protein_id gnl|my_center|LOCUS_03260 9953 8934 gene locus_tag LOCUS_03270 gene murB 9953 8934 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZM7 protein_id gnl|my_center|LOCUS_03270 10505 13132 gene locus_tag LOCUS_03280 10505 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039747.1 protein_id gnl|my_center|LOCUS_03280 13111 14262 gene locus_tag LOCUS_03290 13111 14262 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039748.1 protein_id gnl|my_center|LOCUS_03290 16504 14399 gene locus_tag LOCUS_03300 gene mutL 16504 14399 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8M6 protein_id gnl|my_center|LOCUS_03300 18256 16550 gene locus_tag LOCUS_03310 18256 16550 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_03310 18518 19036 gene locus_tag LOCUS_03320 18518 19036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 19017 20330 gene locus_tag LOCUS_03330 19017 20330 CDS product recombinase RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705743.1 protein_id gnl|my_center|LOCUS_03330 20495 21067 gene locus_tag LOCUS_03340 20495 21067 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197907.1 protein_id gnl|my_center|LOCUS_03340 21560 21198 gene locus_tag LOCUS_03350 gene phhB 21560 21198 CDS product pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L1 protein_id gnl|my_center|LOCUS_03350 22301 21591 gene locus_tag LOCUS_03360 22301 21591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 23346 22270 gene locus_tag LOCUS_03370 gene aroF-1 23346 22270 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883S5 protein_id gnl|my_center|LOCUS_03370 23994 23617 gene locus_tag LOCUS_03380 23994 23617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 24721 24314 gene locus_tag LOCUS_03390 24721 24314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 25415 24828 gene locus_tag LOCUS_03400 25415 24828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 26052 25489 gene locus_tag LOCUS_03410 26052 25489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 27318 26068 gene locus_tag LOCUS_03420 27318 26068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114706.1 protein_id gnl|my_center|LOCUS_03420 28623 27331 gene locus_tag LOCUS_03430 28623 27331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 28979 30277 gene locus_tag LOCUS_03440 28979 30277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 30350 30724 gene locus_tag LOCUS_03450 30350 30724 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527651.1 protein_id gnl|my_center|LOCUS_03450 30858 33158 gene locus_tag LOCUS_03460 30858 33158 CDS product tyrosine-protein kinase involved in EPS biosynthesis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532211.1 protein_id gnl|my_center|LOCUS_03460 33206 33868 gene locus_tag LOCUS_03470 33206 33868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 33942 34874 gene locus_tag LOCUS_03480 gene ilvE 33942 34874 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86428 protein_id gnl|my_center|LOCUS_03480 36490 35420 gene locus_tag LOCUS_03490 gene thiL 36490 35420 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4A5 protein_id gnl|my_center|LOCUS_03490 36607 37260 gene locus_tag LOCUS_03500 36607 37260 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P856 protein_id gnl|my_center|LOCUS_03500 38258 37275 gene locus_tag LOCUS_03510 38258 37275 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LM8 protein_id gnl|my_center|LOCUS_03510 38478 39425 gene locus_tag LOCUS_03520 gene accA 38478 39425 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWR2 protein_id gnl|my_center|LOCUS_03520 39554 40483 gene locus_tag LOCUS_03530 gene accD 39554 40483 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVW0 protein_id gnl|my_center|LOCUS_03530 >Feature sequence08 375 1079 gene locus_tag LOCUS_03540 gene sdhB 375 1079 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382004.1 protein_id gnl|my_center|LOCUS_03540 1400 1882 gene locus_tag LOCUS_03550 1400 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2041 4890 gene locus_tag LOCUS_03560 gene sucA 2041 4890 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_03560 5246 6502 gene locus_tag LOCUS_03570 gene sucB 5246 6502 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D2 protein_id gnl|my_center|LOCUS_03570 6679 7722 gene locus_tag LOCUS_03580 gene recA 6679 7722 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUJ7 protein_id gnl|my_center|LOCUS_03580 7774 8385 gene locus_tag LOCUS_03590 gene coaE 7774 8385 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJP9 protein_id gnl|my_center|LOCUS_03590 8423 9835 gene locus_tag LOCUS_03600 8423 9835 CDS product 2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097917.1 protein_id gnl|my_center|LOCUS_03600 9875 10501 gene locus_tag LOCUS_03610 9875 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 10592 11584 gene locus_tag LOCUS_03620 gene miaA 10592 11584 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL9 protein_id gnl|my_center|LOCUS_03620 11787 13586 gene locus_tag LOCUS_03630 11787 13586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 13583 14626 gene locus_tag LOCUS_03640 13583 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687768.1 protein_id gnl|my_center|LOCUS_03640 15063 14623 gene locus_tag LOCUS_03650 15063 14623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 15481 15002 gene locus_tag LOCUS_03660 15481 15002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03660 15671 15997 gene locus_tag LOCUS_03670 15671 15997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 16003 16332 gene locus_tag LOCUS_03680 16003 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 16444 17727 gene locus_tag LOCUS_03690 gene hflX 16444 17727 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L08 protein_id gnl|my_center|LOCUS_03690 17763 18989 gene locus_tag LOCUS_03700 gene hflK 17763 18989 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106427.1 protein_id gnl|my_center|LOCUS_03700 19157 20026 gene locus_tag LOCUS_03710 gene hflC 19157 20026 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM3 protein_id gnl|my_center|LOCUS_03710 21485 20214 gene locus_tag LOCUS_03720 gene argA 21485 20214 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPB6 protein_id gnl|my_center|LOCUS_03720 22473 21559 gene locus_tag LOCUS_03730 gene era 22473 21559 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51836 protein_id gnl|my_center|LOCUS_03730 23272 22538 gene locus_tag LOCUS_03740 gene lpxH 23272 22538 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2V0 protein_id gnl|my_center|LOCUS_03740 23445 24932 gene locus_tag LOCUS_03750 gene gltX2 23445 24932 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BL6 protein_id gnl|my_center|LOCUS_03750 25039 25824 gene locus_tag LOCUS_03760 gene ampDh3 25039 25824 CDS product protein AmpDh3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114198.1 protein_id gnl|my_center|LOCUS_03760 25855 26220 gene locus_tag LOCUS_03770 25855 26220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 26524 26613 gene locus_tag LOCUS_t00140 26524 26613 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28294 26852 gene locus_tag LOCUS_03780 gene glmU 28294 26852 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT6 protein_id gnl|my_center|LOCUS_03780 28610 29071 gene locus_tag LOCUS_03790 28610 29071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 29152 30348 gene locus_tag LOCUS_03800 29152 30348 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483658.1 protein_id gnl|my_center|LOCUS_03800 30402 31436 gene locus_tag LOCUS_03810 30402 31436 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_03810 31439 32686 gene locus_tag LOCUS_03820 gene dacC 31439 32686 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_03820 32729 33343 gene locus_tag LOCUS_03830 gene lipB 32729 33343 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF8 protein_id gnl|my_center|LOCUS_03830 33368 34090 gene locus_tag LOCUS_03840 33368 34090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 37227 34135 gene locus_tag LOCUS_03850 37227 34135 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479069.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence09 396 472 gene locus_tag LOCUS_t00150 396 472 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 709 491 gene locus_tag LOCUS_03860 709 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 1341 1544 gene locus_tag LOCUS_03870 1341 1544 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263390.1 protein_id gnl|my_center|LOCUS_03870 2389 1688 gene locus_tag LOCUS_03880 2389 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 3199 2717 gene locus_tag LOCUS_03890 gene ruvC 3199 2717 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRK2 protein_id gnl|my_center|LOCUS_03890 3952 3233 gene locus_tag LOCUS_03900 3952 3233 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF0 protein_id gnl|my_center|LOCUS_03900 5206 3962 gene locus_tag LOCUS_03910 5206 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230407.2 protein_id gnl|my_center|LOCUS_03910 6018 5338 gene locus_tag LOCUS_03920 6018 5338 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191981.1 protein_id gnl|my_center|LOCUS_03920 6546 6238 gene locus_tag LOCUS_03930 6546 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 6782 7249 gene locus_tag LOCUS_03940 gene iscR 6782 7249 CDS product HTH-type transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKQ1 protein_id gnl|my_center|LOCUS_03940 7260 8474 gene locus_tag LOCUS_03950 gene yfhO 7260 8474 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32D34 protein_id gnl|my_center|LOCUS_03950 8505 8942 gene locus_tag LOCUS_03960 gene iscU 8505 8942 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI9 protein_id gnl|my_center|LOCUS_03960 9109 9444 gene locus_tag LOCUS_03970 9109 9444 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMY4 protein_id gnl|my_center|LOCUS_03970 9456 10010 gene locus_tag LOCUS_03980 9456 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 10125 12047 gene locus_tag LOCUS_03990 gene hscA 10125 12047 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKQ7 protein_id gnl|my_center|LOCUS_03990 13634 12159 gene locus_tag LOCUS_04000 gene mltF 13634 12159 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E750 protein_id gnl|my_center|LOCUS_04000 15540 13738 gene locus_tag LOCUS_04010 15540 13738 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_04010 16155 15577 gene locus_tag LOCUS_04020 16155 15577 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_04020 16233 17168 gene locus_tag LOCUS_04030 gene ispE 16233 17168 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42805 protein_id gnl|my_center|LOCUS_04030 17148 17222 gene locus_tag LOCUS_t00160 17148 17222 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 17637 18836 gene locus_tag LOCUS_04040 17637 18836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 19614 20600 gene locus_tag LOCUS_04050 19614 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 20677 21966 gene locus_tag LOCUS_04060 gene anmK 20677 21966 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMM5 protein_id gnl|my_center|LOCUS_04060 21963 23123 gene locus_tag LOCUS_04070 gene dadX 21963 23123 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BB4 protein_id gnl|my_center|LOCUS_04070 23235 24368 gene locus_tag LOCUS_04080 23235 24368 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768795.1 protein_id gnl|my_center|LOCUS_04080 25706 24429 gene locus_tag LOCUS_04090 25706 24429 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383798.1 protein_id gnl|my_center|LOCUS_04090 26525 25851 gene locus_tag LOCUS_04100 26525 25851 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687300.1 protein_id gnl|my_center|LOCUS_04100 28009 26579 gene locus_tag LOCUS_04110 28009 26579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 28944 28240 gene locus_tag LOCUS_04120 28944 28240 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086528.1 protein_id gnl|my_center|LOCUS_04120 29425 28925 gene locus_tag LOCUS_04130 29425 28925 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970806.1 protein_id gnl|my_center|LOCUS_04130 29811 29518 gene locus_tag LOCUS_04140 29811 29518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767847.1 protein_id gnl|my_center|LOCUS_04140 33542 29967 gene locus_tag LOCUS_04150 gene mfd 33542 29967 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV82 protein_id gnl|my_center|LOCUS_04150 34101 33727 gene locus_tag LOCUS_04160 34101 33727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04160 34553 34179 gene locus_tag LOCUS_04170 34553 34179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04170 34986 34558 gene locus_tag LOCUS_04180 34986 34558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence10 722 69 gene locus_tag LOCUS_04190 gene adk 722 69 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF5 protein_id gnl|my_center|LOCUS_04190 1942 734 gene locus_tag LOCUS_04200 1942 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 3719 2016 gene locus_tag LOCUS_04210 gene aceF 3719 2016 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVD7 protein_id gnl|my_center|LOCUS_04210 6656 3795 gene locus_tag LOCUS_04220 gene aceE 6656 3795 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59637 protein_id gnl|my_center|LOCUS_04220 8106 6691 gene locus_tag LOCUS_04230 gene aspA 8106 6691 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PC50 protein_id gnl|my_center|LOCUS_04230 8557 10017 gene locus_tag LOCUS_04240 8557 10017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 10226 10302 gene locus_tag LOCUS_t00170 10226 10302 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10326 10402 gene locus_tag LOCUS_t00180 10326 10402 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11951 10536 gene locus_tag LOCUS_04250 11951 10536 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266494.1 protein_id gnl|my_center|LOCUS_04250 12551 11982 gene locus_tag LOCUS_04260 12551 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 14596 12584 gene locus_tag LOCUS_04270 14596 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 14980 15561 gene locus_tag LOCUS_04280 gene nfuA 14980 15561 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_04280 17208 15721 gene locus_tag LOCUS_04290 gene tldD 17208 15721 CDS product protease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704382.1 protein_id gnl|my_center|LOCUS_04290 17560 19278 gene locus_tag LOCUS_04300 gene pbpA 17560 19278 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_04300 19712 19275 gene locus_tag LOCUS_04310 19712 19275 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388367.1 protein_id gnl|my_center|LOCUS_04310 22358 19740 gene locus_tag LOCUS_04320 22358 19740 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704330.1 protein_id gnl|my_center|LOCUS_04320 23488 22538 gene locus_tag LOCUS_04330 23488 22538 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_04330 24305 23601 gene locus_tag LOCUS_04340 gene cioD 24305 23601 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA42 protein_id gnl|my_center|LOCUS_04340 25122 24319 gene locus_tag LOCUS_04350 gene bioC 25122 24319 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818X2 protein_id gnl|my_center|LOCUS_04350 25726 25259 gene locus_tag LOCUS_04360 gene rlmH 25726 25259 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVR4 protein_id gnl|my_center|LOCUS_04360 28753 25796 gene locus_tag LOCUS_04370 28753 25796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 30134 28758 gene locus_tag LOCUS_04380 30134 28758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 32567 30240 gene locus_tag LOCUS_04390 32567 30240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence11 1330 785 gene locus_tag LOCUS_04400 gene atpH 1330 785 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT1 protein_id gnl|my_center|LOCUS_04400 1893 1423 gene locus_tag LOCUS_04410 gene atpF 1893 1423 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG5 protein_id gnl|my_center|LOCUS_04410 2234 1977 gene locus_tag LOCUS_04420 gene atpE 2234 1977 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS9 protein_id gnl|my_center|LOCUS_04420 3129 2311 gene locus_tag LOCUS_04430 gene atpB 3129 2311 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_04430 3425 3625 gene locus_tag LOCUS_04440 3425 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 4073 4975 gene locus_tag LOCUS_04450 4073 4975 CDS product 3-beta-hydroxy-Delta(5)-steroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528195.1 protein_id gnl|my_center|LOCUS_04450 5363 7315 gene locus_tag LOCUS_04460 gene speA 5363 7315 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72F01 protein_id gnl|my_center|LOCUS_04460 7312 8484 gene locus_tag LOCUS_04470 7312 8484 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_04470 8630 9520 gene locus_tag LOCUS_04480 gene proC 8630 9520 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A21 protein_id gnl|my_center|LOCUS_04480 9656 10345 gene locus_tag LOCUS_04490 gene parA 9656 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_04490 10361 10846 gene locus_tag LOCUS_04500 gene ispF 10361 10846 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57708 protein_id gnl|my_center|LOCUS_04500 10986 11219 gene locus_tag LOCUS_04510 gene rpmB 10986 11219 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEM3 protein_id gnl|my_center|LOCUS_04510 11247 11402 gene locus_tag LOCUS_04520 gene rpmG 11247 11402 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJP1 protein_id gnl|my_center|LOCUS_04520 11812 12357 gene locus_tag LOCUS_04530 11812 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 12565 14106 gene locus_tag LOCUS_04540 gene nusA 12565 14106 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV54 protein_id gnl|my_center|LOCUS_04540 14127 16760 gene locus_tag LOCUS_04550 gene infB 14127 16760 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV55 protein_id gnl|my_center|LOCUS_04550 16893 17294 gene locus_tag LOCUS_04560 16893 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 17352 18086 gene locus_tag LOCUS_04570 gene truB 17352 18086 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72154 protein_id gnl|my_center|LOCUS_04570 19672 18359 gene locus_tag LOCUS_04580 19672 18359 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSC6 protein_id gnl|my_center|LOCUS_04580 20395 19706 gene locus_tag LOCUS_04590 gene dnaQ 20395 19706 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957503.1 protein_id gnl|my_center|LOCUS_04590 20655 23468 gene locus_tag LOCUS_04600 gene alaS 20655 23468 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I553 protein_id gnl|my_center|LOCUS_04600 23732 26002 gene locus_tag LOCUS_04610 gene katG2 23732 26002 CDS product catalase-peroxidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIV5 protein_id gnl|my_center|LOCUS_04610 26067 26999 gene locus_tag LOCUS_04620 26067 26999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 27620 28657 gene locus_tag LOCUS_04630 27620 28657 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705890.1 protein_id gnl|my_center|LOCUS_04630 28650 29009 gene locus_tag LOCUS_04640 28650 29009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 29391 29185 gene locus_tag LOCUS_04650 29391 29185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 29496 31076 gene locus_tag LOCUS_04660 29496 31076 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_04660 31095 32138 gene locus_tag LOCUS_04670 31095 32138 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405435.1 protein_id gnl|my_center|LOCUS_04670 >Feature sequence12 1356 97 gene locus_tag LOCUS_04680 gene rho 1356 97 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTV1 protein_id gnl|my_center|LOCUS_04680 2338 2012 gene locus_tag LOCUS_04690 gene trx-2 2338 2012 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ3 protein_id gnl|my_center|LOCUS_04690 3675 2401 gene locus_tag LOCUS_04700 gene gltA 3675 2401 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14165 protein_id gnl|my_center|LOCUS_04700 5107 3788 gene locus_tag LOCUS_04710 gene eno 5107 3788 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ5 protein_id gnl|my_center|LOCUS_04710 5373 5921 gene locus_tag LOCUS_04720 5373 5921 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D36 protein_id gnl|my_center|LOCUS_04720 5980 6840 gene locus_tag LOCUS_04730 5980 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 7129 7213 gene locus_tag LOCUS_t00190 7129 7213 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7592 8410 gene locus_tag LOCUS_04740 gene trmD 7592 8410 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWY7 protein_id gnl|my_center|LOCUS_04740 8535 8900 gene locus_tag LOCUS_04750 gene rplS 8535 8900 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXQ2 protein_id gnl|my_center|LOCUS_04750 9222 10763 gene locus_tag LOCUS_04760 gene algC 9222 10763 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26276 protein_id gnl|my_center|LOCUS_04760 10903 11820 gene locus_tag LOCUS_04770 gene argB 10903 11820 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN2 protein_id gnl|my_center|LOCUS_04770 11866 12786 gene locus_tag LOCUS_04780 11866 12786 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_04780 12902 13681 gene locus_tag LOCUS_04790 12902 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 13758 14057 gene locus_tag LOCUS_04800 13758 14057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 15698 14127 gene locus_tag LOCUS_04810 gene pyrG 15698 14127 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_04810 16828 15845 gene locus_tag LOCUS_04820 gene mdh 16828 15845 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKV7 protein_id gnl|my_center|LOCUS_04820 18288 16990 gene locus_tag LOCUS_04830 gene icd 18288 16990 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZH99 protein_id gnl|my_center|LOCUS_04830 18870 19997 gene locus_tag LOCUS_04840 gene gmd 18870 19997 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06952 protein_id gnl|my_center|LOCUS_04840 19994 20989 gene locus_tag LOCUS_04850 gene fcI 19994 20989 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DBF6 protein_id gnl|my_center|LOCUS_04850 21070 22485 gene locus_tag LOCUS_04860 21070 22485 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694809.1 protein_id gnl|my_center|LOCUS_04860 22573 23421 gene locus_tag LOCUS_04870 22573 23421 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582730.1 protein_id gnl|my_center|LOCUS_04870 23487 25115 gene locus_tag LOCUS_04880 23487 25115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 >Feature sequence13 <1 4461 gene locus_tag LOCUS_04890 <1 4461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001001535.1:membrane protein 5972 4659 gene locus_tag LOCUS_04900 5972 4659 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016899.1 protein_id gnl|my_center|LOCUS_04900 6794 6387 gene locus_tag LOCUS_04910 gene gcvH 6794 6387 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6T9 protein_id gnl|my_center|LOCUS_04910 7945 6842 gene locus_tag LOCUS_04920 gene gcvT 7945 6842 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B06 protein_id gnl|my_center|LOCUS_04920 9496 8336 gene locus_tag LOCUS_04930 gene rnd 9496 8336 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I450 protein_id gnl|my_center|LOCUS_04930 10142 9543 gene locus_tag LOCUS_04940 gene recR 10142 9543 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H9 protein_id gnl|my_center|LOCUS_04940 10658 10335 gene locus_tag LOCUS_04950 10658 10335 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD5 protein_id gnl|my_center|LOCUS_04950 10933 12030 gene locus_tag LOCUS_04960 gene hisC2 10933 12030 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57004 protein_id gnl|my_center|LOCUS_04960 13344 12064 gene locus_tag LOCUS_04970 gene hom 13344 12064 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_04970 14314 13505 gene locus_tag LOCUS_04980 14314 13505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 16954 14918 gene locus_tag LOCUS_04990 gene tktA 16954 14918 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_04990 18607 17099 gene locus_tag LOCUS_05000 gene pepA 18607 17099 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68822 protein_id gnl|my_center|LOCUS_05000 19668 18724 gene locus_tag LOCUS_05010 gene hemF 19668 18724 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_05010 20207 19743 gene locus_tag LOCUS_05020 20207 19743 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388086.1 protein_id gnl|my_center|LOCUS_05020 20601 20936 gene locus_tag LOCUS_05030 20601 20936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 20986 22032 gene locus_tag LOCUS_05040 gene fba 20986 22032 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763563.1 protein_id gnl|my_center|LOCUS_05040 22149 22667 gene locus_tag LOCUS_05050 gene rppH 22149 22667 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UL1 protein_id gnl|my_center|LOCUS_05050 22833 23099 gene locus_tag LOCUS_05060 22833 23099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence14 309 1157 gene locus_tag LOCUS_05070 gene psd 309 1157 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHY4 protein_id gnl|my_center|LOCUS_05070 1937 1170 gene locus_tag LOCUS_05080 1937 1170 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG3 protein_id gnl|my_center|LOCUS_05080 2775 2065 gene locus_tag LOCUS_05090 gene lolD 2775 2065 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZV73 protein_id gnl|my_center|LOCUS_05090 4118 2880 gene locus_tag LOCUS_05100 4118 2880 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315078.1 protein_id gnl|my_center|LOCUS_05100 5941 4388 gene locus_tag LOCUS_05110 5941 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6527 6192 gene locus_tag LOCUS_05120 6527 6192 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533331.1 protein_id gnl|my_center|LOCUS_05120 6961 9576 gene locus_tag LOCUS_05130 gene clpB 6961 9576 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F55 protein_id gnl|my_center|LOCUS_05130 10867 9695 gene locus_tag LOCUS_05140 10867 9695 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_05140 11571 11041 gene locus_tag LOCUS_05150 11571 11041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 12496 11744 gene locus_tag LOCUS_05160 12496 11744 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873844.1 protein_id gnl|my_center|LOCUS_05160 13339 12509 gene locus_tag LOCUS_05170 13339 12509 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_05170 13469 14338 gene locus_tag LOCUS_05180 13469 14338 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPC2 protein_id gnl|my_center|LOCUS_05180 14385 15143 gene locus_tag LOCUS_05190 gene lptA 14385 15143 CDS product lysophosphatidic acid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100265.1 protein_id gnl|my_center|LOCUS_05190 15178 16491 gene locus_tag LOCUS_05200 gene hemA 15178 16491 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42807 protein_id gnl|my_center|LOCUS_05200 16593 17300 gene locus_tag LOCUS_05210 gene coq7 16593 17300 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889Z8 protein_id gnl|my_center|LOCUS_05210 17402 18214 gene locus_tag LOCUS_05220 17402 18214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 18386 18907 gene locus_tag LOCUS_05230 18386 18907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 19098 21905 gene locus_tag LOCUS_05240 gene secA 19098 21905 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCT3 protein_id gnl|my_center|LOCUS_05240 >Feature sequence15 936 181 gene locus_tag LOCUS_05250 gene surE 936 181 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45681 protein_id gnl|my_center|LOCUS_05250 2131 995 gene locus_tag LOCUS_05260 gene xcsK 2131 995 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5C3 protein_id gnl|my_center|LOCUS_05260 2943 2128 gene locus_tag LOCUS_05270 2943 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 3385 2954 gene locus_tag LOCUS_05280 3385 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 5721 3391 gene locus_tag LOCUS_05290 gene lptD 5721 3391 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG8 protein_id gnl|my_center|LOCUS_05290 6730 5885 gene locus_tag LOCUS_05300 gene pstB 6730 5885 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51546 protein_id gnl|my_center|LOCUS_05300 8343 6883 gene locus_tag LOCUS_05310 gene mnmE 8343 6883 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94612 protein_id gnl|my_center|LOCUS_05310 10156 8432 gene locus_tag LOCUS_05320 gene yidC 10156 8432 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL11 protein_id gnl|my_center|LOCUS_05320 10589 10167 gene locus_tag LOCUS_05330 10589 10167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 11748 11314 gene locus_tag LOCUS_05340 11748 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 13530 11929 gene locus_tag LOCUS_05350 13530 11929 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267098.1 protein_id gnl|my_center|LOCUS_05350 14237 13608 gene locus_tag LOCUS_05360 14237 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870648.1 protein_id gnl|my_center|LOCUS_05360 15348 14281 gene locus_tag LOCUS_05370 gene aroC 15348 14281 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKS7 protein_id gnl|my_center|LOCUS_05370 16461 15352 gene locus_tag LOCUS_05380 gene obg 16461 15352 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83ED8 protein_id gnl|my_center|LOCUS_05380 17327 16587 gene locus_tag LOCUS_05390 gene rph 17327 16587 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50597 protein_id gnl|my_center|LOCUS_05390 18815 17511 gene locus_tag LOCUS_05400 18815 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 19943 19038 gene locus_tag LOCUS_05410 19943 19038 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948578.1 protein_id gnl|my_center|LOCUS_05410 21417 20026 gene locus_tag LOCUS_05420 gene pmbA 21417 20026 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence16 1765 752 gene locus_tag LOCUS_05430 gene ilvC 1765 752 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP6 protein_id gnl|my_center|LOCUS_05430 2323 1817 gene locus_tag LOCUS_05440 gene ilvH 2323 1817 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_05440 4056 2323 gene locus_tag LOCUS_05450 gene ilvI 4056 2323 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVA0 protein_id gnl|my_center|LOCUS_05450 6416 4569 gene locus_tag LOCUS_05460 6416 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 7525 6494 gene locus_tag LOCUS_05470 gene asd 7525 6494 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT63 protein_id gnl|my_center|LOCUS_05470 8069 9328 gene locus_tag LOCUS_05480 gene dxr 8069 9328 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGD2 protein_id gnl|my_center|LOCUS_05480 9667 10386 gene locus_tag LOCUS_05490 9667 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 10367 12796 gene locus_tag LOCUS_05500 gene vacB 10367 12796 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WE40 protein_id gnl|my_center|LOCUS_05500 13135 13210 gene locus_tag LOCUS_t00200 13135 13210 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13262 15196 gene locus_tag LOCUS_05510 gene thrS 13262 15196 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C10 protein_id gnl|my_center|LOCUS_05510 15438 15860 gene locus_tag LOCUS_05520 15438 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 15973 16164 gene locus_tag LOCUS_05530 gene rpmI 15973 16164 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNE0 protein_id gnl|my_center|LOCUS_05530 16288 16650 gene locus_tag LOCUS_05540 gene rplT 16288 16650 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C13 protein_id gnl|my_center|LOCUS_05540 16826 17887 gene locus_tag LOCUS_05550 gene pheS 16826 17887 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG3 protein_id gnl|my_center|LOCUS_05550 18144 20813 gene locus_tag LOCUS_05560 gene pheT 18144 20813 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C15 protein_id gnl|my_center|LOCUS_05560 20810 21121 gene locus_tag LOCUS_05570 gene ihfA 20810 21121 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N550 protein_id gnl|my_center|LOCUS_05570 21181 21257 gene locus_tag LOCUS_t00210 21181 21257 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence17 1483 662 gene locus_tag LOCUS_05580 gene trpA 1483 662 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P07344 protein_id gnl|my_center|LOCUS_05580 2751 1480 gene locus_tag LOCUS_05590 gene trpB 2751 1480 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12290 protein_id gnl|my_center|LOCUS_05590 3719 3060 gene locus_tag LOCUS_05600 gene leuD 3719 3060 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA4 protein_id gnl|my_center|LOCUS_05600 3953 4585 gene locus_tag LOCUS_05610 3953 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 4677 5711 gene locus_tag LOCUS_05620 4677 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_05620 5954 7498 gene locus_tag LOCUS_05630 5954 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 7775 8644 gene locus_tag LOCUS_05640 gene bamD 7775 8644 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE8 protein_id gnl|my_center|LOCUS_05640 8784 9461 gene locus_tag LOCUS_05650 8784 9461 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_05650 9454 9828 gene locus_tag LOCUS_05660 9454 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 10146 10230 gene locus_tag LOCUS_t00220 10146 10230 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11695 10301 gene locus_tag LOCUS_05670 gene fumC 11695 10301 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9L0 protein_id gnl|my_center|LOCUS_05670 12887 12096 gene locus_tag LOCUS_05680 gene rlmB 12887 12096 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63180 protein_id gnl|my_center|LOCUS_05680 14022 13066 gene locus_tag LOCUS_05690 14022 13066 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390826.1 protein_id gnl|my_center|LOCUS_05690 14610 14041 gene locus_tag LOCUS_05700 14610 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 15141 14632 gene locus_tag LOCUS_05710 15141 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 16170 15367 gene locus_tag LOCUS_05720 gene etfB 16170 15367 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_05720 16382 17554 gene locus_tag LOCUS_05730 gene ftsW 16382 17554 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA4 protein_id gnl|my_center|LOCUS_05730 17564 18709 gene locus_tag LOCUS_05740 gene murG 17564 18709 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820X3 protein_id gnl|my_center|LOCUS_05740 18735 20309 gene locus_tag LOCUS_05750 gene murC 18735 20309 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC7 protein_id gnl|my_center|LOCUS_05750 20315 21250 gene locus_tag LOCUS_05760 gene ddlB 20315 21250 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC6 protein_id gnl|my_center|LOCUS_05760 >Feature sequence18 2046 1282 gene locus_tag LOCUS_05770 2046 1282 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103280.1 protein_id gnl|my_center|LOCUS_05770 2383 2171 gene locus_tag LOCUS_05780 gene rpmE 2383 2171 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHS9 protein_id gnl|my_center|LOCUS_05780 3668 2571 gene locus_tag LOCUS_05790 gene serC 3668 2571 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_05790 4563 3754 gene locus_tag LOCUS_05800 4563 3754 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_05800 7111 4739 gene locus_tag LOCUS_05810 7111 4739 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUN9 protein_id gnl|my_center|LOCUS_05810 8172 7207 gene locus_tag LOCUS_05820 gene glyQ 8172 7207 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3I4 protein_id gnl|my_center|LOCUS_05820 8400 9038 gene locus_tag LOCUS_05830 8400 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 9951 9127 gene locus_tag LOCUS_05840 gene pyrF 9951 9127 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK37 protein_id gnl|my_center|LOCUS_05840 10983 12818 gene locus_tag LOCUS_05850 10983 12818 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_05850 12880 13983 gene locus_tag LOCUS_05860 12880 13983 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957508.1 protein_id gnl|my_center|LOCUS_05860 14137 16959 gene locus_tag LOCUS_05870 14137 16959 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ23 protein_id gnl|my_center|LOCUS_05870 17030 18487 gene locus_tag LOCUS_05880 17030 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 19417 18596 gene locus_tag LOCUS_05890 19417 18596 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930771.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence19 <1 1175 gene locus_tag LOCUS_05900 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKM9:argininosuccinate lyase 1179 1901 gene locus_tag LOCUS_05910 1179 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 2585 2007 gene locus_tag LOCUS_05920 gene rnhB 2585 2007 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI71 protein_id gnl|my_center|LOCUS_05920 3244 2585 gene locus_tag LOCUS_05930 gene trpF 3244 2585 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI1 protein_id gnl|my_center|LOCUS_05930 4644 3277 gene locus_tag LOCUS_05940 4644 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 6425 4713 gene locus_tag LOCUS_05950 gene gspA 6425 4713 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_05950 8132 6516 gene locus_tag LOCUS_05960 gene der 8132 6516 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44536 protein_id gnl|my_center|LOCUS_05960 9433 8132 gene locus_tag LOCUS_05970 gene bamB 9433 8132 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTW8 protein_id gnl|my_center|LOCUS_05970 10303 9527 gene locus_tag LOCUS_05980 10303 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 11629 10532 gene locus_tag LOCUS_05990 gene speB 11629 10532 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964304.1 protein_id gnl|my_center|LOCUS_05990 12029 11670 gene locus_tag LOCUS_06000 12029 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 13924 12698 gene locus_tag LOCUS_06010 gene radA 13924 12698 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7H3 protein_id gnl|my_center|LOCUS_06010 14291 14980 gene locus_tag LOCUS_06020 14291 14980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090296.1 protein_id gnl|my_center|LOCUS_06020 15245 18436 gene locus_tag LOCUS_06030 15245 18436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 18821 19459 gene locus_tag LOCUS_06040 18821 19459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence20 2871 2038 gene locus_tag LOCUS_06050 2871 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 3071 3991 gene locus_tag LOCUS_06060 3071 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3995 4537 gene locus_tag LOCUS_06070 3995 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 6527 4680 gene locus_tag LOCUS_06080 6527 4680 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121969.1 protein_id gnl|my_center|LOCUS_06080 6962 6540 gene locus_tag LOCUS_06090 6962 6540 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947265.1 protein_id gnl|my_center|LOCUS_06090 7267 8031 gene locus_tag LOCUS_06100 7267 8031 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_06100 8296 8571 gene locus_tag LOCUS_06110 8296 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 9156 11246 gene locus_tag LOCUS_06120 gene recG 9156 11246 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XVU4 protein_id gnl|my_center|LOCUS_06120 11351 13678 gene locus_tag LOCUS_06130 11351 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 13685 15904 gene locus_tag LOCUS_06140 13685 15904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 15941 18022 gene locus_tag LOCUS_06150 15941 18022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence21 653 57 gene locus_tag LOCUS_06160 gene petA 653 57 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DD50 protein_id gnl|my_center|LOCUS_06160 918 1133 gene locus_tag LOCUS_06170 918 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 1118 3238 gene locus_tag LOCUS_06180 gene ligA 1118 3238 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RJ4 protein_id gnl|my_center|LOCUS_06180 4189 3491 gene locus_tag LOCUS_06190 gene hisG 4189 3491 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNH1 protein_id gnl|my_center|LOCUS_06190 5453 4191 gene locus_tag LOCUS_06200 gene murA 5453 4191 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVW7 protein_id gnl|my_center|LOCUS_06200 5774 5508 gene locus_tag LOCUS_06210 5774 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 6176 5817 gene locus_tag LOCUS_06220 6176 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 6979 6179 gene locus_tag LOCUS_06230 6979 6179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 7615 7157 gene locus_tag LOCUS_06240 7615 7157 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377572.1 protein_id gnl|my_center|LOCUS_06240 8482 7676 gene locus_tag LOCUS_06250 8482 7676 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105008.1 protein_id gnl|my_center|LOCUS_06250 9457 8570 gene locus_tag LOCUS_06260 9457 8570 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707618.1 protein_id gnl|my_center|LOCUS_06260 9668 10168 gene locus_tag LOCUS_06270 9668 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 10974 10267 gene locus_tag LOCUS_06280 gene nadD 10974 10267 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTF5 protein_id gnl|my_center|LOCUS_06280 12292 10967 gene locus_tag LOCUS_06290 gene proA 12292 10967 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMN5 protein_id gnl|my_center|LOCUS_06290 14118 12439 gene locus_tag LOCUS_06300 gene msbA 14118 12439 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUG8 protein_id gnl|my_center|LOCUS_06300 14425 14261 gene locus_tag LOCUS_06310 14425 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 14837 14418 gene locus_tag LOCUS_06320 14837 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 15388 16485 gene locus_tag LOCUS_06330 gene leuB 15388 16485 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P562 protein_id gnl|my_center|LOCUS_06330 >Feature sequence22 1163 279 gene locus_tag LOCUS_06340 1163 279 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ43 protein_id gnl|my_center|LOCUS_06340 2237 1173 gene locus_tag LOCUS_06350 gene pyrD 2237 1173 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRZ2 protein_id gnl|my_center|LOCUS_06350 2329 3021 gene locus_tag LOCUS_06360 gene dsbA 2329 3021 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_06360 3130 3342 gene locus_tag LOCUS_06370 3130 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 4657 3425 gene locus_tag LOCUS_06380 4657 3425 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_06380 5746 5162 gene locus_tag LOCUS_06390 gene gmhA 5746 5162 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AI36 protein_id gnl|my_center|LOCUS_06390 6735 6001 gene locus_tag LOCUS_06400 gene ubiG 6735 6001 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820B5 protein_id gnl|my_center|LOCUS_06400 8198 6750 gene locus_tag LOCUS_06410 gene gabD 8198 6750 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368063.1 protein_id gnl|my_center|LOCUS_06410 10424 8358 gene locus_tag LOCUS_06420 gene htpG 10424 8358 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EL0 protein_id gnl|my_center|LOCUS_06420 11999 10611 gene locus_tag LOCUS_06430 11999 10611 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268469.1 protein_id gnl|my_center|LOCUS_06430 13176 12085 gene locus_tag LOCUS_06440 13176 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 13601 13185 gene locus_tag LOCUS_06450 gene tolR 13601 13185 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772109.1 protein_id gnl|my_center|LOCUS_06450 14879 13713 gene locus_tag LOCUS_06460 gene metK 14879 13713 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32C11 protein_id gnl|my_center|LOCUS_06460 15221 15820 gene locus_tag LOCUS_06470 gene pgsA 15221 15820 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_06470 15810 16355 gene locus_tag LOCUS_06480 15810 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence23 2629 1901 gene locus_tag LOCUS_06490 2629 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 4427 3060 gene locus_tag LOCUS_06500 gene accC 4427 3060 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37798 protein_id gnl|my_center|LOCUS_06500 5143 4658 gene locus_tag LOCUS_06510 gene accB 5143 4658 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262775.1 protein_id gnl|my_center|LOCUS_06510 5712 5224 gene locus_tag LOCUS_06520 gene aroQ1 5712 5224 CDS product 3-dehydroquinate dehydratase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O30557 protein_id gnl|my_center|LOCUS_06520 7544 5907 gene locus_tag LOCUS_06530 gene metG 7544 5907 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX2 protein_id gnl|my_center|LOCUS_06530 8061 7561 gene locus_tag LOCUS_06540 gene pgpA 8061 7561 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44157 protein_id gnl|my_center|LOCUS_06540 10845 8119 gene locus_tag LOCUS_06550 gene leuS 10845 8119 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NG64 protein_id gnl|my_center|LOCUS_06550 11566 10889 gene locus_tag LOCUS_06560 11566 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 12198 11578 gene locus_tag LOCUS_06570 12198 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 13322 12480 gene locus_tag LOCUS_06580 gene kdsA 13322 12480 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZFK4 protein_id gnl|my_center|LOCUS_06580 13439 13759 gene locus_tag LOCUS_06590 13439 13759 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729333.1 protein_id gnl|my_center|LOCUS_06590 14136 13786 gene locus_tag LOCUS_06600 gene folX 14136 13786 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365570.1 protein_id gnl|my_center|LOCUS_06600 14977 14216 gene locus_tag LOCUS_06610 14977 14216 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 protein_id gnl|my_center|LOCUS_06610 15757 15044 gene locus_tag LOCUS_06620 gene rsmG 15757 15044 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64238 protein_id gnl|my_center|LOCUS_06620 16472 15750 gene locus_tag LOCUS_06630 16472 15750 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969361.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence24 335 1177 gene locus_tag LOCUS_06640 335 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389838.1 protein_id gnl|my_center|LOCUS_06640 1538 1278 gene locus_tag LOCUS_06650 gene yoeB 1538 1278 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69348 protein_id gnl|my_center|LOCUS_06650 1786 1535 gene locus_tag LOCUS_06660 gene yefM 1786 1535 CDS product antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69346 protein_id gnl|my_center|LOCUS_06660 1952 2833 gene locus_tag LOCUS_06670 1952 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3302 3721 gene locus_tag LOCUS_06680 3302 3721 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 protein_id gnl|my_center|LOCUS_06680 3838 4761 gene locus_tag LOCUS_06690 gene mrr 3838 4761 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026697.1 protein_id gnl|my_center|LOCUS_06690 4848 5519 gene locus_tag LOCUS_06700 4848 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485361.1 protein_id gnl|my_center|LOCUS_06700 6096 5692 gene locus_tag LOCUS_06710 6096 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 6548 6790 gene locus_tag LOCUS_06720 6548 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 6787 7050 gene locus_tag LOCUS_06730 6787 7050 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305108.1 protein_id gnl|my_center|LOCUS_06730 7352 7510 gene locus_tag LOCUS_06740 7352 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 7592 7837 gene locus_tag LOCUS_06750 7592 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 7982 8587 gene locus_tag LOCUS_06760 7982 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 9316 8891 gene locus_tag LOCUS_06770 9316 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 9792 9406 gene locus_tag LOCUS_06780 9792 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 10637 9702 gene locus_tag LOCUS_06790 10637 9702 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455166.1 protein_id gnl|my_center|LOCUS_06790 12102 10651 gene locus_tag LOCUS_06800 gene hldE 12102 10651 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XEW9 protein_id gnl|my_center|LOCUS_06800 12844 12155 gene locus_tag LOCUS_06810 gene trmB 12844 12155 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX8 protein_id gnl|my_center|LOCUS_06810 12906 13217 gene locus_tag LOCUS_06820 12906 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 15304 13274 gene locus_tag LOCUS_06830 15304 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence25 <1 1493 gene locus_tag LOCUS_06840 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZYJ4:isoleucine--tRNA ligase 1564 2664 gene locus_tag LOCUS_06850 gene tsaD 1564 2664 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KII7 protein_id gnl|my_center|LOCUS_06850 2776 3894 gene locus_tag LOCUS_06860 gene argC 2776 3894 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUW0 protein_id gnl|my_center|LOCUS_06860 3923 4756 gene locus_tag LOCUS_06870 gene trpC 3923 4756 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML3 protein_id gnl|my_center|LOCUS_06870 5003 5434 gene locus_tag LOCUS_06880 5003 5434 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_06880 5523 6524 gene locus_tag LOCUS_06890 gene lipA 5523 6524 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN84 protein_id gnl|my_center|LOCUS_06890 7022 6552 gene locus_tag LOCUS_06900 gene smpB 7022 6552 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRP1 protein_id gnl|my_center|LOCUS_06900 7105 8481 gene locus_tag LOCUS_06910 7105 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 8481 8936 gene locus_tag LOCUS_06920 8481 8936 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815744.1 protein_id gnl|my_center|LOCUS_06920 9971 9042 gene locus_tag LOCUS_06930 gene dapF 9971 9042 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H5 protein_id gnl|my_center|LOCUS_06930 11301 9976 gene locus_tag LOCUS_06940 gene lysA 11301 9976 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVL7 protein_id gnl|my_center|LOCUS_06940 12380 11994 gene locus_tag LOCUS_06950 12380 11994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 13429 12731 gene locus_tag LOCUS_06960 13429 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 14613 13489 gene locus_tag LOCUS_06970 14613 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 15969 15244 gene locus_tag LOCUS_06980 gene phoU 15969 15244 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM14 protein_id gnl|my_center|LOCUS_06980 >Feature sequence26 512 1246 gene locus_tag LOCUS_06990 512 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 1263 2075 gene locus_tag LOCUS_07000 1263 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 4492 2186 gene locus_tag LOCUS_07010 gene uvrD 4492 2186 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD04 protein_id gnl|my_center|LOCUS_07010 4870 5343 gene locus_tag LOCUS_07020 4870 5343 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948527.1 protein_id gnl|my_center|LOCUS_07020 5960 7897 gene locus_tag LOCUS_07030 5960 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 7888 7964 gene locus_tag LOCUS_t00230 7888 7964 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8073 9023 gene locus_tag LOCUS_07040 gene hemC 8073 9023 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFH6 protein_id gnl|my_center|LOCUS_07040 10061 9039 gene locus_tag LOCUS_07050 10061 9039 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_07050 10660 10112 gene locus_tag LOCUS_07060 10660 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 10971 11630 gene locus_tag LOCUS_07070 10971 11630 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_07070 11701 12543 gene locus_tag LOCUS_07080 gene folP 11701 12543 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSL4 protein_id gnl|my_center|LOCUS_07080 12974 12651 gene locus_tag LOCUS_07090 12974 12651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 14325 13048 gene locus_tag LOCUS_07100 gene coaC 14325 13048 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114358.1 protein_id gnl|my_center|LOCUS_07100 15540 14332 gene locus_tag LOCUS_07110 gene tyrS 15540 14332 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY07 protein_id gnl|my_center|LOCUS_07110 >Feature sequence27 761 186 gene locus_tag LOCUS_07120 761 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 1180 917 gene locus_tag LOCUS_07130 gene rpmA 1180 917 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR69 protein_id gnl|my_center|LOCUS_07130 1574 1239 gene locus_tag LOCUS_07140 gene rplU 1574 1239 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBH2 protein_id gnl|my_center|LOCUS_07140 3365 2073 gene locus_tag LOCUS_07150 gene hisD 3365 2073 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNV9 protein_id gnl|my_center|LOCUS_07150 4431 3379 gene locus_tag LOCUS_07160 4431 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 5553 4459 gene locus_tag LOCUS_07170 gene sohB 5553 4459 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422072.1 protein_id gnl|my_center|LOCUS_07170 6811 5600 gene locus_tag LOCUS_07180 gene argD 6811 5600 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQH5 protein_id gnl|my_center|LOCUS_07180 7496 6864 gene locus_tag LOCUS_07190 7496 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 8283 7618 gene locus_tag LOCUS_07200 8283 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 8726 8280 gene locus_tag LOCUS_07210 8726 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 9022 9957 gene locus_tag LOCUS_07220 gene cysD 9022 9957 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SY0 protein_id gnl|my_center|LOCUS_07220 10126 11484 gene locus_tag LOCUS_07230 gene cysN 10126 11484 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKE9 protein_id gnl|my_center|LOCUS_07230 11553 12887 gene locus_tag LOCUS_07240 gene ahcY 11553 12887 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY7 protein_id gnl|my_center|LOCUS_07240 12906 13964 gene locus_tag LOCUS_07250 12906 13964 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_07250 14024 14626 gene locus_tag LOCUS_07260 14024 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 14635 14790 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccacgcacccgcacggggtgcgac >Feature sequence28 426 1505 gene locus_tag LOCUS_07270 gene purK 426 1505 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ3 protein_id gnl|my_center|LOCUS_07270 2111 1590 gene locus_tag LOCUS_07280 2111 1590 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N93 protein_id gnl|my_center|LOCUS_07280 3446 2127 gene locus_tag LOCUS_07290 3446 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_07290 4528 3746 gene locus_tag LOCUS_07300 4528 3746 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_07300 5470 4586 gene locus_tag LOCUS_07310 5470 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114541.1 protein_id gnl|my_center|LOCUS_07310 6339 5563 gene locus_tag LOCUS_07320 gene map 6339 5563 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_07320 6420 6563 gene locus_tag LOCUS_07330 6420 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 6820 7893 gene locus_tag LOCUS_07340 6820 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 8006 8533 gene locus_tag LOCUS_07350 8006 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 8561 8725 gene locus_tag LOCUS_07360 8561 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 8750 9178 gene locus_tag LOCUS_07370 8750 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 9171 9419 gene locus_tag LOCUS_07380 9171 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_07380 9423 9671 gene locus_tag LOCUS_07390 9423 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392154.1 protein_id gnl|my_center|LOCUS_07390 9809 10102 gene locus_tag LOCUS_07400 9809 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 10206 10925 gene locus_tag LOCUS_07410 10206 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 11238 11435 gene locus_tag LOCUS_07420 11238 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 11475 11723 gene locus_tag LOCUS_07430 11475 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_07430 11735 12004 gene locus_tag LOCUS_07440 11735 12004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 12776 13822 gene locus_tag LOCUS_07450 12776 13822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 13982 14440 gene locus_tag LOCUS_07460 13982 14440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence29 2253 1309 gene locus_tag LOCUS_07470 gene bioB 2253 1309 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_07470 3333 2692 gene locus_tag LOCUS_07480 3333 2692 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017028.1 protein_id gnl|my_center|LOCUS_07480 3828 3460 gene locus_tag LOCUS_07490 gene grxD 3828 3460 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT8 protein_id gnl|my_center|LOCUS_07490 4833 3919 gene locus_tag LOCUS_07500 gene trmJ 4833 3919 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP6 protein_id gnl|my_center|LOCUS_07500 5394 5152 gene locus_tag LOCUS_07510 5394 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 7203 5533 gene locus_tag LOCUS_07520 gene rpsA 7203 5533 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ71 protein_id gnl|my_center|LOCUS_07520 7856 9808 gene locus_tag LOCUS_07530 7856 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 10598 9945 gene locus_tag LOCUS_07540 gene lolB 10598 9945 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6T5 protein_id gnl|my_center|LOCUS_07540 12478 10595 gene locus_tag LOCUS_07550 gene mnmG 12478 10595 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q329T0 protein_id gnl|my_center|LOCUS_07550 13014 14084 gene locus_tag LOCUS_07560 gene gpsA 13014 14084 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIK0 protein_id gnl|my_center|LOCUS_07560 >Feature sequence30 1584 1033 gene locus_tag LOCUS_07570 1584 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_07570 2628 1633 gene locus_tag LOCUS_07580 gene fmt 2628 1633 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ9 protein_id gnl|my_center|LOCUS_07580 3204 2695 gene locus_tag LOCUS_07590 gene def 3204 2695 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7A8 protein_id gnl|my_center|LOCUS_07590 3866 3273 gene locus_tag LOCUS_07600 gene slmA 3866 3273 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_07600 4664 3963 gene locus_tag LOCUS_07610 4664 3963 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536848.1 protein_id gnl|my_center|LOCUS_07610 5738 4995 gene locus_tag LOCUS_07620 gene pdxJ 5738 4995 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKK6 protein_id gnl|my_center|LOCUS_07620 5943 7340 gene locus_tag LOCUS_07630 5943 7340 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_07630 7486 7701 gene locus_tag LOCUS_07640 gene rpsU 7486 7701 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66532 protein_id gnl|my_center|LOCUS_07640 7774 8229 gene locus_tag LOCUS_07650 7774 8229 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704780.1 protein_id gnl|my_center|LOCUS_07650 8298 8939 gene locus_tag LOCUS_07660 gene ccmA 8298 8939 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQE3 protein_id gnl|my_center|LOCUS_07660 8983 9591 gene locus_tag LOCUS_07670 8983 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 10863 9619 gene locus_tag LOCUS_07680 10863 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 12053 10884 gene locus_tag LOCUS_07690 12053 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039327.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence31 <1 896 gene locus_tag LOCUS_07700 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970138.1:amino acid ABC transporter substrate-binding protein 962 2866 gene locus_tag LOCUS_07710 gene xcpR 962 2866 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207223.1 protein_id gnl|my_center|LOCUS_07710 3202 3405 gene locus_tag LOCUS_07720 gene cspA 3202 3405 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089994.1 protein_id gnl|my_center|LOCUS_07720 4326 3748 gene locus_tag LOCUS_07730 gene rimM 4326 3748 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYH5 protein_id gnl|my_center|LOCUS_07730 4671 4414 gene locus_tag LOCUS_07740 gene rpsP 4671 4414 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44382 protein_id gnl|my_center|LOCUS_07740 6250 4940 gene locus_tag LOCUS_07750 gene hslU 6250 4940 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZF8 protein_id gnl|my_center|LOCUS_07750 6854 6315 gene locus_tag LOCUS_07760 gene hslV 6854 6315 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_07760 7178 7537 gene locus_tag LOCUS_07770 7178 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 8797 7634 gene locus_tag LOCUS_07780 8797 7634 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975326.1 protein_id gnl|my_center|LOCUS_07780 9227 10018 gene locus_tag LOCUS_07790 9227 10018 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_07790 10194 10817 gene locus_tag LOCUS_07800 10194 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 11532 10837 gene locus_tag LOCUS_07810 11532 10837 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388896.1 protein_id gnl|my_center|LOCUS_07810 12615 11764 gene locus_tag LOCUS_07820 12615 11764 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2X0 protein_id gnl|my_center|LOCUS_07820 >Feature sequence32 32 367 gene locus_tag LOCUS_07830 gene hit 32 367 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_07830 1348 2100 gene locus_tag LOCUS_07840 gene ubiE 1348 2100 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFE1 protein_id gnl|my_center|LOCUS_07840 2122 2700 gene locus_tag LOCUS_07850 2122 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105095.1 protein_id gnl|my_center|LOCUS_07850 2797 3276 gene locus_tag LOCUS_07860 2797 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 3269 7234 gene locus_tag LOCUS_07870 3269 7234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 8993 7803 gene locus_tag LOCUS_07880 gene aatA 8993 7803 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZE1 protein_id gnl|my_center|LOCUS_07880 9461 9756 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttggttactcctcaaatcaggagacacaaaac >Feature sequence33 654 124 gene locus_tag LOCUS_07890 654 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 4254 667 gene locus_tag LOCUS_07900 gene dnaE 4254 667 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M8 protein_id gnl|my_center|LOCUS_07900 4922 4290 gene locus_tag LOCUS_07910 gene nth 4922 4290 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRK1 protein_id gnl|my_center|LOCUS_07910 6101 4926 gene locus_tag LOCUS_07920 6101 4926 CDS product phage integrase family site specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_819027.1 protein_id gnl|my_center|LOCUS_07920 6211 6894 gene locus_tag LOCUS_07930 6211 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 7678 6887 gene locus_tag LOCUS_07940 gene dnr 7678 6887 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113234.1 protein_id gnl|my_center|LOCUS_07940 7950 8246 gene locus_tag LOCUS_07950 7950 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 8357 8281 gene locus_tag LOCUS_t00240 8357 8281 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8642 8989 gene locus_tag LOCUS_07960 8642 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 9454 10680 gene locus_tag LOCUS_07970 gene carA 9454 10680 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQB3 protein_id gnl|my_center|LOCUS_07970 >Feature sequence34 1270 638 gene locus_tag LOCUS_07980 1270 638 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313806.1 protein_id gnl|my_center|LOCUS_07980 1686 2456 gene locus_tag LOCUS_07990 1686 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_07990 2838 3974 gene locus_tag LOCUS_08000 gene thrC 2838 3974 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KK49 protein_id gnl|my_center|LOCUS_08000 4123 5814 gene locus_tag LOCUS_08010 4123 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 5795 6292 gene locus_tag LOCUS_08020 5795 6292 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113583.1 protein_id gnl|my_center|LOCUS_08020 7178 6375 gene locus_tag LOCUS_08030 gene znuB 7178 6375 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969555.1 protein_id gnl|my_center|LOCUS_08030 7937 7209 gene locus_tag LOCUS_08040 gene znuC 7937 7209 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UN0 protein_id gnl|my_center|LOCUS_08040 8553 7942 gene locus_tag LOCUS_08050 8553 7942 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425978.1 protein_id gnl|my_center|LOCUS_08050 9228 9001 gene locus_tag LOCUS_08060 9228 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 9654 10217 gene locus_tag LOCUS_08070 9654 10217 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066380.1 protein_id gnl|my_center|LOCUS_08070 11028 10237 gene locus_tag LOCUS_08080 gene tatC 11028 10237 CDS product sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM51 protein_id gnl|my_center|LOCUS_08080 11366 11025 gene locus_tag LOCUS_08090 11366 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 11606 11433 gene locus_tag LOCUS_08100 11606 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 12050 11646 gene locus_tag LOCUS_08110 gene hisE 12050 11646 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA47 protein_id gnl|my_center|LOCUS_08110 >Feature sequence35 186 1991 gene locus_tag LOCUS_08120 gene lepA 186 1991 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XF8 protein_id gnl|my_center|LOCUS_08120 2052 2948 gene locus_tag LOCUS_08130 gene lepB 2052 2948 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5G7 protein_id gnl|my_center|LOCUS_08130 2973 3686 gene locus_tag LOCUS_08140 gene rnc 2973 3686 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LN9 protein_id gnl|my_center|LOCUS_08140 4942 3998 gene locus_tag LOCUS_08150 gene ispH 4942 3998 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM7 protein_id gnl|my_center|LOCUS_08150 5541 4990 gene locus_tag LOCUS_08160 gene lspA 5541 4990 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM5 protein_id gnl|my_center|LOCUS_08160 6120 5698 gene locus_tag LOCUS_08170 6120 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 6898 6140 gene locus_tag LOCUS_08180 gene hisA 6898 6140 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU43 protein_id gnl|my_center|LOCUS_08180 8157 6940 gene locus_tag LOCUS_08190 gene surA 8157 6940 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMG7 protein_id gnl|my_center|LOCUS_08190 8466 9305 gene locus_tag LOCUS_08200 gene xthA 8466 9305 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104169.1 protein_id gnl|my_center|LOCUS_08200 10610 9342 gene locus_tag LOCUS_08210 10610 9342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 11362 10598 gene locus_tag LOCUS_08220 gene suhB 11362 10598 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947474.1 protein_id gnl|my_center|LOCUS_08220 11806 11543 gene locus_tag LOCUS_08230 gene rpsT 11806 11543 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH9 protein_id gnl|my_center|LOCUS_08230 12314 11853 gene locus_tag LOCUS_08240 gene rplI 12314 11853 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYW8 protein_id gnl|my_center|LOCUS_08240 >Feature sequence36 <1 1698 gene locus_tag LOCUS_08250 <1 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003096603.1:guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 2897 1743 gene locus_tag LOCUS_08260 gene proB 2897 1743 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QM1 protein_id gnl|my_center|LOCUS_08260 3384 2950 gene locus_tag LOCUS_08270 3384 2950 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398830.1 protein_id gnl|my_center|LOCUS_08270 3785 3396 gene locus_tag LOCUS_08280 3785 3396 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707329.1 protein_id gnl|my_center|LOCUS_08280 5100 3901 gene locus_tag LOCUS_08290 5100 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 7341 5392 gene locus_tag LOCUS_08300 gene ppiD 7341 5392 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6Q1 protein_id gnl|my_center|LOCUS_08300 8091 7810 gene locus_tag LOCUS_08310 gene hupB 8091 7810 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772706.1 protein_id gnl|my_center|LOCUS_08310 10819 8408 gene locus_tag LOCUS_08320 gene lon 10819 8408 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY4 protein_id gnl|my_center|LOCUS_08320 12271 10832 gene locus_tag LOCUS_08330 gene clpX 12271 10832 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMM3 protein_id gnl|my_center|LOCUS_08330 >Feature sequence37 <1 718 gene locus_tag LOCUS_08340 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZJ5:DNA topoisomerase 1 836 1678 gene locus_tag LOCUS_08350 gene truA 836 1678 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTA4 protein_id gnl|my_center|LOCUS_08350 3475 1826 gene locus_tag LOCUS_08360 gene cysI 3475 1826 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_08360 3715 4530 gene locus_tag LOCUS_08370 3715 4530 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_08370 4550 6103 gene locus_tag LOCUS_08380 gene murE 4550 6103 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59650 protein_id gnl|my_center|LOCUS_08380 6205 7773 gene locus_tag LOCUS_08390 gene murF 6205 7773 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ7 protein_id gnl|my_center|LOCUS_08390 7851 8933 gene locus_tag LOCUS_08400 gene mraY 7851 8933 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ8 protein_id gnl|my_center|LOCUS_08400 9866 9120 gene locus_tag LOCUS_08410 9866 9120 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884094.1 protein_id gnl|my_center|LOCUS_08410 11155 9863 gene locus_tag LOCUS_08420 11155 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884099.1 protein_id gnl|my_center|LOCUS_08420 11967 11152 gene locus_tag LOCUS_08430 11967 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence38 207 2108 gene locus_tag LOCUS_08440 gene argS 207 2108 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTX7 protein_id gnl|my_center|LOCUS_08440 2169 2939 gene locus_tag LOCUS_08450 2169 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2974 4503 gene locus_tag LOCUS_08460 gene ubiB 2974 4503 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUB8 protein_id gnl|my_center|LOCUS_08460 4670 4927 gene locus_tag LOCUS_08470 4670 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 5170 6150 gene locus_tag LOCUS_08480 5170 6150 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890517.1 protein_id gnl|my_center|LOCUS_08480 6276 6614 gene locus_tag LOCUS_08490 6276 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 6618 7172 gene locus_tag LOCUS_08500 6618 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 7190 7546 gene locus_tag LOCUS_08510 7190 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 7546 8292 gene locus_tag LOCUS_08520 7546 8292 CDS product gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730760.1 protein_id gnl|my_center|LOCUS_08520 8389 8622 gene locus_tag LOCUS_08530 8389 8622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 8706 8957 gene locus_tag LOCUS_08540 8706 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 8938 9273 gene locus_tag LOCUS_08550 gene gvpK 8938 9273 CDS product gas vesicle protein GvpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730759.1 protein_id gnl|my_center|LOCUS_08550 9325 9813 gene locus_tag LOCUS_08560 9325 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 9814 10112 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agttacggttggactacaaaatctgaatagctaaaat 10474 10184 gene locus_tag LOCUS_08570 10474 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 11471 10536 gene locus_tag LOCUS_08580 gene cas1 11471 10536 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_08580 11584 11985 gene locus_tag LOCUS_08590 11584 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence39 <1 827 gene locus_tag LOCUS_08600 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003687776.1:restriction endonuclease 1079 1417 gene locus_tag LOCUS_08610 1079 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08610 1613 2716 gene locus_tag LOCUS_08620 1613 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08620 3137 5170 gene locus_tag LOCUS_08630 gene uvrC 3137 5170 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_08630 5241 5612 gene locus_tag LOCUS_08640 5241 5612 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 protein_id gnl|my_center|LOCUS_08640 5738 7012 gene locus_tag LOCUS_08650 gene metY 5738 7012 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 protein_id gnl|my_center|LOCUS_08650 8088 7075 gene locus_tag LOCUS_08660 8088 7075 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_08660 8323 9285 gene locus_tag LOCUS_08670 gene gnnA 8323 9285 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_08670 9424 9714 gene locus_tag LOCUS_08680 gene borD 9424 9714 CDS product prophage lipoprotein Bor homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77330 protein_id gnl|my_center|LOCUS_08680 >Feature sequence40 <1 690 gene locus_tag LOCUS_08690 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JKS3:histidine--tRNA ligase 2893 863 gene locus_tag LOCUS_08700 gene dxs 2893 863 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNR7 protein_id gnl|my_center|LOCUS_08700 3765 2899 gene locus_tag LOCUS_08710 gene mreC 3765 2899 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFA8 protein_id gnl|my_center|LOCUS_08710 5028 3985 gene locus_tag LOCUS_08720 5028 3985 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555108.1 protein_id gnl|my_center|LOCUS_08720 6920 5064 gene locus_tag LOCUS_08730 6920 5064 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LN1 protein_id gnl|my_center|LOCUS_08730 7888 7100 gene locus_tag LOCUS_08740 gene kdsB 7888 7100 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338754.1 protein_id gnl|my_center|LOCUS_08740 8706 7999 gene locus_tag LOCUS_08750 8706 7999 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_08750 9073 8834 gene locus_tag LOCUS_08760 9073 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101213.1 protein_id gnl|my_center|LOCUS_08760 10482 9097 gene locus_tag LOCUS_08770 gene recN 10482 9097 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV41 protein_id gnl|my_center|LOCUS_08770 >Feature sequence41 <1 546 gene locus_tag LOCUS_08780 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZWW0:lysine--tRNA ligase 659 1186 gene locus_tag LOCUS_08790 659 1186 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703230.1 protein_id gnl|my_center|LOCUS_08790 1241 1633 gene locus_tag LOCUS_08800 1241 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1656 2951 gene locus_tag LOCUS_08810 gene serS 1656 2951 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY59 protein_id gnl|my_center|LOCUS_08810 2948 3916 gene locus_tag LOCUS_08820 gene nadC 2948 3916 CDS product nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070778.1 protein_id gnl|my_center|LOCUS_08820 4140 4934 gene locus_tag LOCUS_08830 4140 4934 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_08830 4996 6066 gene locus_tag LOCUS_08840 gene hemE 4996 6066 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD0 protein_id gnl|my_center|LOCUS_08840 6148 6993 gene locus_tag LOCUS_08850 gene rhdA 6148 6993 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUK9 protein_id gnl|my_center|LOCUS_08850 7199 8284 gene locus_tag LOCUS_08860 7199 8284 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TC20 protein_id gnl|my_center|LOCUS_08860 8476 9153 gene locus_tag LOCUS_08870 8476 9153 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810926.1 protein_id gnl|my_center|LOCUS_08870 9307 10410 gene locus_tag LOCUS_08880 9307 10410 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9M8 protein_id gnl|my_center|LOCUS_08880 >Feature sequence42 594 989 gene locus_tag LOCUS_08890 594 989 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I87 protein_id gnl|my_center|LOCUS_08890 1127 1052 gene locus_tag LOCUS_t00250 1127 1052 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2478 1273 gene locus_tag LOCUS_08900 gene lys1 2478 1273 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937725.1 protein_id gnl|my_center|LOCUS_08900 3163 2516 gene locus_tag LOCUS_08910 3163 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 3740 3207 gene locus_tag LOCUS_08920 3740 3207 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096058.1 protein_id gnl|my_center|LOCUS_08920 3881 4999 gene locus_tag LOCUS_08930 gene ychF 3881 4999 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C9 protein_id gnl|my_center|LOCUS_08930 5106 5561 gene locus_tag LOCUS_08940 gene dut 5106 5561 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJP5 protein_id gnl|my_center|LOCUS_08940 6346 5669 gene locus_tag LOCUS_08950 6346 5669 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTN5 protein_id gnl|my_center|LOCUS_08950 6738 7823 gene locus_tag LOCUS_08960 6738 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 7970 8362 gene locus_tag LOCUS_08970 7970 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 8359 9198 gene locus_tag LOCUS_08980 8359 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 9239 9916 gene locus_tag LOCUS_08990 9239 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 10221 10021 gene locus_tag LOCUS_09000 10221 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence43 682 861 gene locus_tag LOCUS_09010 682 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1549 944 gene locus_tag LOCUS_09020 1549 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2619 1606 gene locus_tag LOCUS_09030 gene secF 2619 1606 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX40 protein_id gnl|my_center|LOCUS_09030 4556 2622 gene locus_tag LOCUS_09040 gene secD 4556 2622 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXI1 protein_id gnl|my_center|LOCUS_09040 5573 4830 gene locus_tag LOCUS_09050 5573 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 5695 8070 gene locus_tag LOCUS_09060 5695 8070 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105330.1 protein_id gnl|my_center|LOCUS_09060 8224 9165 gene locus_tag LOCUS_09070 gene prs 8224 9165 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C6 protein_id gnl|my_center|LOCUS_09070 9577 10212 gene locus_tag LOCUS_09080 gene rplY 9577 10212 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC4 protein_id gnl|my_center|LOCUS_09080 >Feature sequence44 719 21 gene locus_tag LOCUS_09090 gene clpP 719 21 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBY6 protein_id gnl|my_center|LOCUS_09090 2214 853 gene locus_tag LOCUS_09100 gene tig 2214 853 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U2 protein_id gnl|my_center|LOCUS_09100 5101 2471 gene locus_tag LOCUS_09110 gene gyrA 5101 2471 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5J7 protein_id gnl|my_center|LOCUS_09110 5584 5228 gene locus_tag LOCUS_09120 5584 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313868.1 protein_id gnl|my_center|LOCUS_09120 7613 5787 gene locus_tag LOCUS_09130 7613 5787 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389741.1 protein_id gnl|my_center|LOCUS_09130 9452 7635 gene locus_tag LOCUS_09140 9452 7635 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389742.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence45 1867 1337 gene locus_tag LOCUS_09150 1867 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 3349 2396 gene locus_tag LOCUS_09160 gene yraL 3349 2396 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2P1 protein_id gnl|my_center|LOCUS_09160 3406 5352 gene locus_tag LOCUS_09170 gene lpoA 3406 5352 CDS product penicillin-binding protein activator LpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SH4 protein_id gnl|my_center|LOCUS_09170 5456 5845 gene locus_tag LOCUS_09180 5456 5845 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX8 protein_id gnl|my_center|LOCUS_09180 6021 6239 gene locus_tag LOCUS_09190 6021 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09190 6523 6762 gene locus_tag LOCUS_09200 6523 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933584.1 protein_id gnl|my_center|LOCUS_09200 6821 6988 gene locus_tag LOCUS_09210 6821 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 7386 7997 gene locus_tag LOCUS_09220 7386 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 8162 8404 gene locus_tag LOCUS_09230 8162 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 8622 9365 gene locus_tag LOCUS_09240 gene htrB 8622 9365 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YC9 protein_id gnl|my_center|LOCUS_09240 <9927 9427 gene locus_tag LOCUS_09250 <9927 9427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002213164.1:DNA polymerase I >Feature sequence46 1597 1121 gene locus_tag LOCUS_09260 gene recX 1597 1121 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CQ5 protein_id gnl|my_center|LOCUS_09260 2524 1643 gene locus_tag LOCUS_09270 gene tonB3 2524 1643 CDS product transporter TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_09270 3267 2572 gene locus_tag LOCUS_09280 3267 2572 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNI7 protein_id gnl|my_center|LOCUS_09280 4287 3619 gene locus_tag LOCUS_09290 gene rpiA 4287 3619 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZB7 protein_id gnl|my_center|LOCUS_09290 4361 4807 gene locus_tag LOCUS_09300 gene epsG 4361 4807 CDS product type II secretion system protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45773 protein_id gnl|my_center|LOCUS_09300 5453 4920 gene locus_tag LOCUS_09310 5453 4920 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 protein_id gnl|my_center|LOCUS_09310 6480 5476 gene locus_tag LOCUS_09320 gene arcB 6480 5476 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44770 protein_id gnl|my_center|LOCUS_09320 7941 6976 gene locus_tag LOCUS_09330 gene dusA 7941 6976 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD0 protein_id gnl|my_center|LOCUS_09330 8543 8037 gene locus_tag LOCUS_09340 8543 8037 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_09340 9475 8552 gene locus_tag LOCUS_09350 9475 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence47 2121 1387 gene locus_tag LOCUS_09360 2121 1387 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_09360 3069 2314 gene locus_tag LOCUS_09370 3069 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4804 3383 gene locus_tag LOCUS_09380 gene cysS 4804 3383 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWK2 protein_id gnl|my_center|LOCUS_09380 5534 4917 gene locus_tag LOCUS_09390 gene folE 5534 4917 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2W9H7 protein_id gnl|my_center|LOCUS_09390 5844 7910 gene locus_tag LOCUS_09400 gene uvrB 5844 7910 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E18 protein_id gnl|my_center|LOCUS_09400 >Feature sequence48 <1 1100 gene locus_tag LOCUS_09410 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003382085.1:D-3-phosphoglycerate dehydrogenase 1485 3956 gene locus_tag LOCUS_09420 gene pstC 1485 3956 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895703.1 protein_id gnl|my_center|LOCUS_09420 3969 5762 gene locus_tag LOCUS_09430 gene pstA 3969 5762 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTJ5 protein_id gnl|my_center|LOCUS_09430 7021 5786 gene locus_tag LOCUS_09440 gene cca 7021 5786 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45269 protein_id gnl|my_center|LOCUS_09440 8265 7165 gene locus_tag LOCUS_09450 8265 7165 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260993.1 protein_id gnl|my_center|LOCUS_09450 8929 8666 gene locus_tag LOCUS_09460 gene fdx1 8929 8666 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084462.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence49 135 1892 gene locus_tag LOCUS_09470 135 1892 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957499.1 protein_id gnl|my_center|LOCUS_09470 1889 3274 gene locus_tag LOCUS_09480 1889 3274 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004789757.1 protein_id gnl|my_center|LOCUS_09480 3644 3444 gene locus_tag LOCUS_09490 3644 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3862 3641 gene locus_tag LOCUS_09500 3862 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4957 4172 gene locus_tag LOCUS_09510 gene thiG 4957 4172 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV73 protein_id gnl|my_center|LOCUS_09510 6209 5013 gene locus_tag LOCUS_09520 gene dapE 6209 5013 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIB5 protein_id gnl|my_center|LOCUS_09520 7452 6307 gene locus_tag LOCUS_09530 gene hisC 7452 6307 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBF1 protein_id gnl|my_center|LOCUS_09530 7729 8061 gene locus_tag LOCUS_09540 gene yajC 7729 8061 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552468.1 protein_id gnl|my_center|LOCUS_09540 8239 8596 gene locus_tag LOCUS_tm00010 8239 8596 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 9132 8992 gene locus_tag LOCUS_09550 9132 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence50 433 882 gene locus_tag LOCUS_09560 433 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 904 2685 gene locus_tag LOCUS_09570 904 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2710 3198 gene locus_tag LOCUS_09580 gene tssD 2710 3198 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943794.1 protein_id gnl|my_center|LOCUS_09580 3223 5001 gene locus_tag LOCUS_09590 gene tssF 3223 5001 CDS product type VI secretion system protein ImpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941100.1 protein_id gnl|my_center|LOCUS_09590 4965 6014 gene locus_tag LOCUS_09600 4965 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 6064 6771 gene locus_tag LOCUS_09610 6064 6771 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211184.1 protein_id gnl|my_center|LOCUS_09610 6904 8754 gene locus_tag LOCUS_09620 gene glmS 6904 8754 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZL28 protein_id gnl|my_center|LOCUS_09620 >Feature sequence51 <1 1145 gene locus_tag LOCUS_09630 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q886X6:inosine-5'-monophosphate dehydrogenase 1291 2169 gene locus_tag LOCUS_09640 1291 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2231 3148 gene locus_tag LOCUS_09650 gene prmA 2231 3148 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VS3 protein_id gnl|my_center|LOCUS_09650 3170 3688 gene locus_tag LOCUS_09660 gene ssb 3170 3688 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U1 protein_id gnl|my_center|LOCUS_09660 3736 4953 gene locus_tag LOCUS_09670 gene argG 3736 4953 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_09670 4963 5718 gene locus_tag LOCUS_09680 4963 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 5877 7217 gene locus_tag LOCUS_09690 5877 7217 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLG1 protein_id gnl|my_center|LOCUS_09690 8078 7335 gene locus_tag LOCUS_09700 8078 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8485 8410 gene locus_tag LOCUS_t00260 8485 8410 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8740 8988 gene locus_tag LOCUS_09710 8740 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence52 293 96 gene locus_tag LOCUS_09720 293 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1174 1380 gene locus_tag LOCUS_09730 1174 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2409 1456 gene locus_tag LOCUS_09740 2409 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3827 2589 gene locus_tag LOCUS_09750 3827 2589 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684824.1 protein_id gnl|my_center|LOCUS_09750 4209 3796 gene locus_tag LOCUS_09760 4209 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 5636 4758 gene locus_tag LOCUS_09770 gene perA 5636 4758 CDS product GDP-perosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DBF3 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09770 6449 5709 gene locus_tag LOCUS_09780 6449 5709 CDS product polyprenol phosphate mannosyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122067.1 protein_id gnl|my_center|LOCUS_09780 7746 6475 gene locus_tag LOCUS_09790 7746 6475 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887438.1 protein_id gnl|my_center|LOCUS_09790 8117 7806 gene locus_tag LOCUS_09800 8117 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 8181 8444 gene locus_tag LOCUS_09810 8181 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 8468 8836 gene locus_tag LOCUS_09820 8468 8836 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640094.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence53 2160 430 gene locus_tag LOCUS_09830 gene ilvD 2160 430 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKA4 protein_id gnl|my_center|LOCUS_09830 4253 2301 gene locus_tag LOCUS_09840 gene acsA 4253 2301 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MAS0 protein_id gnl|my_center|LOCUS_09840 4721 5971 gene locus_tag LOCUS_09850 gene pfp 4721 5971 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_09850 6326 6859 gene locus_tag LOCUS_09860 gene ppa 6326 6859 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP34 protein_id gnl|my_center|LOCUS_09860 7378 7806 gene locus_tag LOCUS_09870 7378 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 7971 7786 gene locus_tag LOCUS_09880 7971 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence54 3009 1918 gene locus_tag LOCUS_09890 3009 1918 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FU86 protein_id gnl|my_center|LOCUS_09890 3302 3766 gene locus_tag LOCUS_09900 gene nusB 3302 3766 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG6 protein_id gnl|my_center|LOCUS_09900 3787 5730 gene locus_tag LOCUS_09910 3787 5730 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098136.1 protein_id gnl|my_center|LOCUS_09910 5747 6955 gene locus_tag LOCUS_09920 gene mnmA 5747 6955 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L2 protein_id gnl|my_center|LOCUS_09920 7075 7680 gene locus_tag LOCUS_09930 7075 7680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence55 214 1461 gene locus_tag LOCUS_09940 214 1461 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460050.1 protein_id gnl|my_center|LOCUS_09940 1452 2228 gene locus_tag LOCUS_09950 1452 2228 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_09950 2323 3489 gene locus_tag LOCUS_09960 2323 3489 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919303.1 protein_id gnl|my_center|LOCUS_09960 3482 4057 gene locus_tag LOCUS_09970 3482 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4073 5395 gene locus_tag LOCUS_09980 4073 5395 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_09980 5409 5876 gene locus_tag LOCUS_09990 5409 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_09990 5883 6653 gene locus_tag LOCUS_10000 5883 6653 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022442.1 protein_id gnl|my_center|LOCUS_10000 7923 6712 gene locus_tag LOCUS_10010 gene gspF 7923 6712 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence56 693 899 gene locus_tag LOCUS_10020 gene rpmF 693 899 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP9 protein_id gnl|my_center|LOCUS_10020 1184 2095 gene locus_tag LOCUS_10030 1184 2095 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX8 protein_id gnl|my_center|LOCUS_10030 2107 2877 gene locus_tag LOCUS_10040 gene fabG 2107 2877 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54438 protein_id gnl|my_center|LOCUS_10040 3011 3256 gene locus_tag LOCUS_10050 gene acpP 3011 3256 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX6 protein_id gnl|my_center|LOCUS_10050 3389 4597 gene locus_tag LOCUS_10060 gene fabF 3389 4597 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AAI5 protein_id gnl|my_center|LOCUS_10060 4678 5718 gene locus_tag LOCUS_10070 4678 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104128.1 protein_id gnl|my_center|LOCUS_10070 5836 6510 gene locus_tag LOCUS_10080 gene tmk 5836 6510 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVX2 protein_id gnl|my_center|LOCUS_10080 7677 6598 gene locus_tag LOCUS_10090 gene idiA 7677 6598 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_10090 >Feature sequence57 2582 1062 gene locus_tag LOCUS_10100 gene gatB 2582 1062 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_10100 2871 3860 gene locus_tag LOCUS_10110 2871 3860 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_10110 4527 4090 gene locus_tag LOCUS_10120 gene hisI 4527 4090 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTY3 protein_id gnl|my_center|LOCUS_10120 4737 6845 gene locus_tag LOCUS_10130 4737 6845 CDS product protein-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703424.1 protein_id gnl|my_center|LOCUS_10130 <7663 6887 gene locus_tag LOCUS_10140 <7663 6887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RWW9:4-hydroxybenzoate octaprenyltransferase >Feature sequence58 2982 3380 gene locus_tag LOCUS_10150 gene fabZ 2982 3380 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY7 protein_id gnl|my_center|LOCUS_10150 3380 4180 gene locus_tag LOCUS_10160 gene lpxA 3380 4180 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X6P4 protein_id gnl|my_center|LOCUS_10160 4200 5462 gene locus_tag LOCUS_10170 gene lpxB 4200 5462 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZH55 protein_id gnl|my_center|LOCUS_10170 5468 6583 gene locus_tag LOCUS_10180 gene wlbC 5468 6583 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807112.1 protein_id gnl|my_center|LOCUS_10180 7026 6781 gene locus_tag LOCUS_10190 7026 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence59 379 762 gene locus_tag LOCUS_10200 gene tusE 379 762 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57539 protein_id gnl|my_center|LOCUS_10200 879 2351 gene locus_tag LOCUS_10210 879 2351 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y51 protein_id gnl|my_center|LOCUS_10210 2438 3451 gene locus_tag LOCUS_10220 gene folD2 2438 3451 CDS product bifunctional protein FolD 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883B5 protein_id gnl|my_center|LOCUS_10220 5530 3443 gene locus_tag LOCUS_10230 gene parE 5530 3443 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPD9 protein_id gnl|my_center|LOCUS_10230 6788 5688 gene locus_tag LOCUS_10240 gene ribF 6788 5688 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG38 protein_id gnl|my_center|LOCUS_10240 7332 6796 gene locus_tag LOCUS_10250 gene pth 7332 6796 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC3 protein_id gnl|my_center|LOCUS_10250 >Feature sequence60 906 481 gene locus_tag LOCUS_10260 906 481 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_10260 1604 972 gene locus_tag LOCUS_10270 1604 972 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_10270 3926 1668 gene locus_tag LOCUS_10280 gene comA 3926 1668 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_10280 4950 4258 gene locus_tag LOCUS_10290 4950 4258 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918603.1 protein_id gnl|my_center|LOCUS_10290 6198 5005 gene locus_tag LOCUS_10300 gene pgk 6198 5005 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AK3 protein_id gnl|my_center|LOCUS_10300 >Feature sequence61 617 39 gene locus_tag LOCUS_10310 617 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932797.1 protein_id gnl|my_center|LOCUS_10310 1064 684 gene locus_tag LOCUS_10320 1064 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_10320 2808 1285 gene locus_tag LOCUS_10330 2808 1285 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020819.1 protein_id gnl|my_center|LOCUS_10330 4229 2817 gene locus_tag LOCUS_10340 gene phrB 4229 2817 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945973.1 protein_id gnl|my_center|LOCUS_10340 4945 4226 gene locus_tag LOCUS_10350 4945 4226 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_10350 5738 5109 gene locus_tag LOCUS_10360 5738 5109 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_10360 6180 7328 gene locus_tag LOCUS_10370 6180 7328 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209587.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence62 352 810 gene locus_tag LOCUS_10380 352 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 807 2015 gene locus_tag LOCUS_10390 807 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2015 4531 gene locus_tag LOCUS_10400 2015 4531 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419149.1 protein_id gnl|my_center|LOCUS_10400 4556 5590 gene locus_tag LOCUS_10410 gene gmd 4556 5590 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888L3 protein_id gnl|my_center|LOCUS_10410 5593 6489 gene locus_tag LOCUS_10420 5593 6489 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525198.1 protein_id gnl|my_center|LOCUS_10420 6638 6985 gene locus_tag LOCUS_10430 6638 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10430 7156 7416 gene locus_tag LOCUS_10440 7156 7416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence63 2 742 gene locus_tag LOCUS_10450 2 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 810 1172 gene locus_tag LOCUS_10460 810 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1174 2376 gene locus_tag LOCUS_10470 gene apbE 1174 2376 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44550 protein_id gnl|my_center|LOCUS_10470 3722 2493 gene locus_tag LOCUS_10480 3722 2493 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885I9 protein_id gnl|my_center|LOCUS_10480 4636 3872 gene locus_tag LOCUS_10490 4636 3872 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNW3 protein_id gnl|my_center|LOCUS_10490 <7441 4633 gene locus_tag LOCUS_10500 <7441 4633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064283.1:nuclease/helicase >Feature sequence64 1903 188 gene locus_tag LOCUS_10510 1903 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261758.1 protein_id gnl|my_center|LOCUS_10510 3609 1900 gene locus_tag LOCUS_10520 3609 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261757.1 protein_id gnl|my_center|LOCUS_10520 4151 5722 gene locus_tag LOCUS_10530 gene leuA 4151 5722 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZG1 protein_id gnl|my_center|LOCUS_10530 6247 6987 gene locus_tag LOCUS_10540 6247 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10540 >Feature sequence65 3003 1669 gene locus_tag LOCUS_10550 gene pepP 3003 1669 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_10550 5199 3031 gene locus_tag LOCUS_10560 gene katG1 5199 3031 CDS product catalase-peroxidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSX7 protein_id gnl|my_center|LOCUS_10560 5645 5196 gene locus_tag LOCUS_10570 5645 5196 CDS product ferric uptake regulation protein FurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703206.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence66 583 1497 gene locus_tag LOCUS_10580 583 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 3049 1553 gene locus_tag LOCUS_10590 3049 1553 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_10590 4817 3150 gene locus_tag LOCUS_10600 gene ftsI 4817 3150 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073906.1 protein_id gnl|my_center|LOCUS_10600 5355 4987 gene locus_tag LOCUS_10610 5355 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 <6408 5556 gene locus_tag LOCUS_10620 <6408 5556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PCK7:ribosomal RNA small subunit methyltransferase H >Feature sequence67 1950 1615 gene locus_tag LOCUS_10630 gene sdhD 1950 1615 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JR67 protein_id gnl|my_center|LOCUS_10630 2338 1958 gene locus_tag LOCUS_10640 gene sdhC 2338 1958 CDS product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51055 protein_id gnl|my_center|LOCUS_10640 3830 2655 gene locus_tag LOCUS_10650 3830 2655 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_10650 6229 4463 gene locus_tag LOCUS_10660 gene glyS 6229 4463 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500T7 protein_id gnl|my_center|LOCUS_10660 >Feature sequence68 78 344 gene locus_tag LOCUS_10670 78 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1788 643 gene locus_tag LOCUS_10680 1788 643 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_10680 3318 1915 gene locus_tag LOCUS_10690 gene mucD 3318 1915 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_10690 4092 3469 gene locus_tag LOCUS_10700 gene ruvA 4092 3469 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Y34 protein_id gnl|my_center|LOCUS_10700 4887 4132 gene locus_tag LOCUS_10710 4887 4132 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_10710 <6205 4970 gene locus_tag LOCUS_10720 <6205 4970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVY5:cytochrome b >Feature sequence69 450 539 gene locus_tag LOCUS_t00270 450 539 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1021 638 gene locus_tag LOCUS_10730 1021 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1302 1526 gene locus_tag LOCUS_10740 1302 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1934 2287 gene locus_tag LOCUS_10750 1934 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 2309 2860 gene locus_tag LOCUS_10760 2309 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3032 3178 gene locus_tag LOCUS_10770 3032 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4561 3170 gene locus_tag LOCUS_10780 4561 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4848 4651 gene locus_tag LOCUS_10790 4848 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5097 5360 gene locus_tag LOCUS_10800 5097 5360 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974003.1 protein_id gnl|my_center|LOCUS_10800 5792 6172 gene locus_tag LOCUS_10810 5792 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10810 >Feature sequence70 1239 160 gene locus_tag LOCUS_10820 gene glnA 1239 160 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E31 protein_id gnl|my_center|LOCUS_10820 1902 2324 gene locus_tag LOCUS_10830 1902 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2395 2961 gene locus_tag LOCUS_10840 gene efp 2395 2961 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYS4 protein_id gnl|my_center|LOCUS_10840 3037 4497 gene locus_tag LOCUS_10850 gene gapB 3037 4497 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN1 protein_id gnl|my_center|LOCUS_10850 4509 5291 gene locus_tag LOCUS_10860 gene hisF 4509 5291 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGM5 protein_id gnl|my_center|LOCUS_10860 >Feature sequence71 2853 3500 gene locus_tag LOCUS_10870 2853 3500 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LM0 protein_id gnl|my_center|LOCUS_10870 3649 4161 gene locus_tag LOCUS_10880 3649 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 5343 4219 gene locus_tag LOCUS_10890 5343 4219 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764084.1 protein_id gnl|my_center|LOCUS_10890 <6048 5503 gene locus_tag LOCUS_10900 <6048 5503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87XJ9:5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase >Feature sequence72 946 1236 gene locus_tag LOCUS_10910 946 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_10910 1223 1486 gene locus_tag LOCUS_10920 1223 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_10920 1882 2583 gene locus_tag LOCUS_10930 1882 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2633 3262 gene locus_tag LOCUS_10940 2633 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3404 4423 gene locus_tag LOCUS_10950 gene cas1 3404 4423 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72WF5 protein_id gnl|my_center|LOCUS_10950 4436 4729 gene locus_tag LOCUS_10960 gene cas2 4436 4729 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72WF4 protein_id gnl|my_center|LOCUS_10960 4939 5505 gene locus_tag LOCUS_10970 4939 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence73 3549 2605 gene locus_tag LOCUS_10980 gene thrB 3549 2605 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4A7 protein_id gnl|my_center|LOCUS_10980 4719 4072 gene locus_tag LOCUS_10990 4719 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 4750 4908 gene locus_tag LOCUS_11000 4750 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence74 520 305 gene locus_tag LOCUS_11010 520 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1635 958 gene locus_tag LOCUS_11020 1635 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 2047 1745 gene locus_tag LOCUS_11030 2047 1745 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770554.1 protein_id gnl|my_center|LOCUS_11030 2698 2898 gene locus_tag LOCUS_11040 2698 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3344 3069 gene locus_tag LOCUS_11050 3344 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 3694 3341 gene locus_tag LOCUS_11060 3694 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4191 3703 gene locus_tag LOCUS_11070 4191 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 4585 4289 gene locus_tag LOCUS_11080 4585 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence75 1963 1676 gene locus_tag LOCUS_11090 gene groS 1963 1676 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747C8 protein_id gnl|my_center|LOCUS_11090 3600 2272 gene locus_tag LOCUS_11100 3600 2272 CDS product O-antigen export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107240.1 protein_id gnl|my_center|LOCUS_11100 4701 3877 gene locus_tag LOCUS_11110 4701 3877 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence76 <1 2558 gene locus_tag LOCUS_11120 <1 2558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXN2:phosphoribosylformylglycinamidine synthase 4070 2739 gene locus_tag LOCUS_11130 4070 2739 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence77 524 1687 gene locus_tag LOCUS_11140 524 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1735 3312 gene locus_tag LOCUS_11150 gene guaA 1735 3312 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E763 protein_id gnl|my_center|LOCUS_11150 3869 3420 gene locus_tag LOCUS_11160 3869 3420 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035394.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence78 1507 446 gene locus_tag LOCUS_11170 1507 446 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461465.1 protein_id gnl|my_center|LOCUS_11170 2134 1562 gene locus_tag LOCUS_11180 2134 1562 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377215.1 protein_id gnl|my_center|LOCUS_11180 <4297 2280 gene locus_tag LOCUS_11190 <4297 2280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83AR5:primosomal protein N' >Feature sequence79 1204 728 gene locus_tag LOCUS_11200 1204 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1895 1755 gene locus_tag LOCUS_11210 1895 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11210 3198 2110 gene locus_tag LOCUS_11220 3198 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence80 1181 21 gene locus_tag LOCUS_11230 1181 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103756.1 protein_id gnl|my_center|LOCUS_11230 1378 2262 gene locus_tag LOCUS_11240 gene dapA 1378 2262 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW75 protein_id gnl|my_center|LOCUS_11240 2341 2877 gene locus_tag LOCUS_11250 2341 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2961 3683 gene locus_tag LOCUS_11260 gene purC 2961 3683 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI26 protein_id gnl|my_center|LOCUS_11260 >Feature sequence81 2326 767 gene locus_tag LOCUS_11270 gene pgi 2326 767 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDQ7 protein_id gnl|my_center|LOCUS_11270 3318 2428 gene locus_tag LOCUS_11280 gene galU-2 3318 2428 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2W9N8 protein_id gnl|my_center|LOCUS_11280 >Feature sequence82 681 1991 gene locus_tag LOCUS_11290 681 1991 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340990.1 protein_id gnl|my_center|LOCUS_11290 3021 2008 gene locus_tag LOCUS_11300 3021 2008 CDS product cytochrome bd ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528683.1 protein_id gnl|my_center|LOCUS_11300 <3814 3099 gene locus_tag LOCUS_11310 <3814 3099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000887578.1:cytochrome ubiquinol oxidase subunit I >Feature sequence83 1312 308 gene locus_tag LOCUS_11320 gene trpS 1312 308 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH36 protein_id gnl|my_center|LOCUS_11320 2400 1354 gene locus_tag LOCUS_11330 gene prfB 2400 1354 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EN98 protein_id gnl|my_center|LOCUS_11330 <3465 2509 gene locus_tag LOCUS_11340 <3465 2509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUM6:adenylosuccinate synthetase >Feature sequence84 <1 1999 gene locus_tag LOCUS_11350 <1 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HWG0:UvrABC system protein A 1996 2940 gene locus_tag LOCUS_11360 gene rluD 1996 2940 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FII1 protein_id gnl|my_center|LOCUS_11360 3202 3053 gene locus_tag LOCUS_11370 3202 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence85 <1 1120 gene locus_tag LOCUS_11380 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208165.1:ATP-dependent protease 1120 1386 gene locus_tag LOCUS_11390 1120 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11390 >Feature sequence86 891 79 gene locus_tag LOCUS_11400 891 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1728 940 gene locus_tag LOCUS_11410 gene recO 1728 940 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD70 protein_id gnl|my_center|LOCUS_11410 2559 1771 gene locus_tag LOCUS_11420 gene phoB 2559 1771 CDS product phosphate regulon transcriptional regulatory protein PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23620 protein_id gnl|my_center|LOCUS_11420 >Feature sequence87 327 563 gene locus_tag LOCUS_11430 327 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 568 801 gene locus_tag LOCUS_11440 568 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1227 1856 gene locus_tag LOCUS_11450 1227 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence88 145 1041 gene locus_tag LOCUS_11460 145 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1999 1670 gene locus_tag LOCUS_11470 1999 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence89 902 186 gene locus_tag LOCUS_11480 gene tpiA 902 186 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ3 protein_id gnl|my_center|LOCUS_11480 <1684 1099 gene locus_tag LOCUS_11490 <1684 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EAK5:DNA topoisomerase 4 subunit A >Feature sequence90 65 760 gene locus_tag LOCUS_11500 65 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11500