>Feature sequence01 <1 1021 gene locus_tag LOCUS_00010 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533173.1:adhesin 1117 2022 gene locus_tag LOCUS_00020 1117 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3380 2019 gene locus_tag LOCUS_00030 gene atoE 3380 2019 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071598.1 protein_id gnl|my_center|LOCUS_00030 4301 3402 gene locus_tag LOCUS_00040 4301 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072266.1 protein_id gnl|my_center|LOCUS_00040 7822 4349 gene locus_tag LOCUS_00050 gene mfd 7822 4349 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CG9 protein_id gnl|my_center|LOCUS_00050 8942 7830 gene locus_tag LOCUS_00060 gene aroF 8942 7830 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYH8 protein_id gnl|my_center|LOCUS_00060 9148 10398 gene locus_tag LOCUS_00070 9148 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119805.1 protein_id gnl|my_center|LOCUS_00070 10388 11119 gene locus_tag LOCUS_00080 gene lolD 10388 11119 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CV2 protein_id gnl|my_center|LOCUS_00080 11902 11231 gene locus_tag LOCUS_00090 11902 11231 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 protein_id gnl|my_center|LOCUS_00090 12138 14090 gene locus_tag LOCUS_00100 gene comA 12138 14090 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_00100 14106 14732 gene locus_tag LOCUS_00110 14106 14732 CDS product translocation protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_00110 14815 15252 gene locus_tag LOCUS_00120 14815 15252 CDS product biopolymer transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_604208.2 protein_id gnl|my_center|LOCUS_00120 15256 17052 gene locus_tag LOCUS_00130 gene msbA 15256 17052 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D84 protein_id gnl|my_center|LOCUS_00130 17054 18076 gene locus_tag LOCUS_00140 gene lpxK 17054 18076 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUI0 protein_id gnl|my_center|LOCUS_00140 18069 18260 gene locus_tag LOCUS_00150 18069 18260 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0F0 protein_id gnl|my_center|LOCUS_00150 18241 18726 gene locus_tag LOCUS_00160 gene ptpA 18241 18726 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930569.1 protein_id gnl|my_center|LOCUS_00160 19782 18790 gene locus_tag LOCUS_00170 19782 18790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 20880 19918 gene locus_tag LOCUS_00180 20880 19918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21531 21082 gene locus_tag LOCUS_00190 21531 21082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24499 21632 gene locus_tag LOCUS_00200 24499 21632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 24893 25870 gene locus_tag LOCUS_00210 gene rluC 24893 25870 CDS product ribosomal large subunit pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZFU1 protein_id gnl|my_center|LOCUS_00210 25867 26820 gene locus_tag LOCUS_00220 gene sppA 25867 26820 CDS product peptidase S49 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770635.1 protein_id gnl|my_center|LOCUS_00220 27645 27067 gene locus_tag LOCUS_00230 27645 27067 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA09 protein_id gnl|my_center|LOCUS_00230 27729 28274 gene locus_tag LOCUS_00240 27729 28274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_00240 28289 28480 gene locus_tag LOCUS_00250 gene rpmF 28289 28480 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVP9 protein_id gnl|my_center|LOCUS_00250 28467 29531 gene locus_tag LOCUS_00260 gene plsX 28467 29531 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E40 protein_id gnl|my_center|LOCUS_00260 29528 30544 gene locus_tag LOCUS_00270 gene fabH 29528 30544 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBV1 protein_id gnl|my_center|LOCUS_00270 30561 31526 gene locus_tag LOCUS_00280 gene fabD 30561 31526 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH3 protein_id gnl|my_center|LOCUS_00280 31550 32302 gene locus_tag LOCUS_00290 gene fabG 31550 32302 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQH7 protein_id gnl|my_center|LOCUS_00290 32677 32943 gene locus_tag LOCUS_00300 gene acpP 32677 32943 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63447 protein_id gnl|my_center|LOCUS_00300 33028 34269 gene locus_tag LOCUS_00310 33028 34269 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH6 protein_id gnl|my_center|LOCUS_00310 34316 35182 gene locus_tag LOCUS_00320 gene pabC 34316 35182 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 protein_id gnl|my_center|LOCUS_00320 35212 36210 gene locus_tag LOCUS_00330 35212 36210 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592627.1 protein_id gnl|my_center|LOCUS_00330 36203 36856 gene locus_tag LOCUS_00340 gene tmk 36203 36856 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E35 protein_id gnl|my_center|LOCUS_00340 36865 37854 gene locus_tag LOCUS_00350 36865 37854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 37957 38334 gene locus_tag LOCUS_00360 gene pilZ 37957 38334 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_00360 38383 39165 gene locus_tag LOCUS_00370 38383 39165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_00370 40534 39254 gene locus_tag LOCUS_00380 40534 39254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 40823 42451 gene locus_tag LOCUS_00390 40823 42451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 43282 42515 gene locus_tag LOCUS_00400 43282 42515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 44689 43718 gene locus_tag LOCUS_00410 44689 43718 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071719.1 protein_id gnl|my_center|LOCUS_00410 45092 47059 gene locus_tag LOCUS_00420 45092 47059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 47316 48650 gene locus_tag LOCUS_00430 47316 48650 CDS product NAD/FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920454.1 protein_id gnl|my_center|LOCUS_00430 48721 49149 gene locus_tag LOCUS_00440 48721 49149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49833 49303 gene locus_tag LOCUS_00450 49833 49303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 51349 49913 gene locus_tag LOCUS_00460 gene yflS 51349 49913 CDS product putative malate transporter YflS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34726 protein_id gnl|my_center|LOCUS_00460 51676 53256 gene locus_tag LOCUS_00470 gene prfC 51676 53256 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DC7 protein_id gnl|my_center|LOCUS_00470 53289 54140 gene locus_tag LOCUS_00480 53289 54140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_00480 54253 57171 gene locus_tag LOCUS_00490 54253 57171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 58205 57282 gene locus_tag LOCUS_00500 58205 57282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 59719 58271 gene locus_tag LOCUS_00510 59719 58271 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072107.1 protein_id gnl|my_center|LOCUS_00510 62747 59973 gene locus_tag LOCUS_00520 gene valS 62747 59973 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXL2 protein_id gnl|my_center|LOCUS_00520 64248 62761 gene locus_tag LOCUS_00530 gene pepA 64248 62761 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPF3 protein_id gnl|my_center|LOCUS_00530 64577 65731 gene locus_tag LOCUS_00540 64577 65731 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_00540 65728 66801 gene locus_tag LOCUS_00550 65728 66801 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948329.1 protein_id gnl|my_center|LOCUS_00550 67719 66820 gene locus_tag LOCUS_00560 67719 66820 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946035.1 protein_id gnl|my_center|LOCUS_00560 67826 69043 gene locus_tag LOCUS_00570 67826 69043 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946034.1 protein_id gnl|my_center|LOCUS_00570 69978 71264 gene locus_tag LOCUS_00580 69978 71264 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768856.1 protein_id gnl|my_center|LOCUS_00580 71264 72274 gene locus_tag LOCUS_00590 71264 72274 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957843.1 protein_id gnl|my_center|LOCUS_00590 72302 77845 gene locus_tag LOCUS_00600 72302 77845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 77985 79379 gene locus_tag LOCUS_00610 77985 79379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085444.1 protein_id gnl|my_center|LOCUS_00610 79484 81064 gene locus_tag LOCUS_00620 79484 81064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967310.1 protein_id gnl|my_center|LOCUS_00620 81322 81236 gene locus_tag LOCUS_t00010 81322 81236 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 81668 82030 gene locus_tag LOCUS_00630 gene yajC 81668 82030 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552468.1 protein_id gnl|my_center|LOCUS_00630 82071 83933 gene locus_tag LOCUS_00640 gene secD 82071 83933 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D4 protein_id gnl|my_center|LOCUS_00640 83937 84866 gene locus_tag LOCUS_00650 gene secF 83937 84866 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU08 protein_id gnl|my_center|LOCUS_00650 86001 84877 gene locus_tag LOCUS_00660 86001 84877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 86905 86072 gene locus_tag LOCUS_00670 gene suhB 86905 86072 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_00670 87066 87800 gene locus_tag LOCUS_00680 87066 87800 CDS product putative tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44676 protein_id gnl|my_center|LOCUS_00680 87939 88409 gene locus_tag LOCUS_00690 87939 88409 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117915.1 protein_id gnl|my_center|LOCUS_00690 88415 89650 gene locus_tag LOCUS_00700 gene iscS 88415 89650 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ32 protein_id gnl|my_center|LOCUS_00700 89675 90067 gene locus_tag LOCUS_00710 89675 90067 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYX9 protein_id gnl|my_center|LOCUS_00710 90069 90449 gene locus_tag LOCUS_00720 gene iscA 90069 90449 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E782 protein_id gnl|my_center|LOCUS_00720 90439 90984 gene locus_tag LOCUS_00730 gene hscB 90439 90984 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU6 protein_id gnl|my_center|LOCUS_00730 90998 92854 gene locus_tag LOCUS_00740 gene hscA 90998 92854 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU5 protein_id gnl|my_center|LOCUS_00740 92847 93185 gene locus_tag LOCUS_00750 gene fdx 92847 93185 CDS product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417920.1 protein_id gnl|my_center|LOCUS_00750 93185 93385 gene locus_tag LOCUS_00760 93185 93385 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523621.1 protein_id gnl|my_center|LOCUS_00760 93483 93914 gene locus_tag LOCUS_00770 gene ndk 93483 93914 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV92 protein_id gnl|my_center|LOCUS_00770 93925 95097 gene locus_tag LOCUS_00780 gene rlmN 93925 95097 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F911 protein_id gnl|my_center|LOCUS_00780 95115 95924 gene locus_tag LOCUS_00790 95115 95924 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947275.1 protein_id gnl|my_center|LOCUS_00790 95958 96473 gene locus_tag LOCUS_00800 95958 96473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 96716 96444 gene locus_tag LOCUS_00810 96716 96444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 96777 97265 gene locus_tag LOCUS_00820 96777 97265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771746.1 protein_id gnl|my_center|LOCUS_00820 97438 99045 gene locus_tag LOCUS_00830 97438 99045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 100269 99211 gene locus_tag LOCUS_00840 gene htpX 100269 99211 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728V8 protein_id gnl|my_center|LOCUS_00840 100705 102006 gene locus_tag LOCUS_00850 gene hisS 100705 102006 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ45 protein_id gnl|my_center|LOCUS_00850 102017 102700 gene locus_tag LOCUS_00860 102017 102700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770804.1 protein_id gnl|my_center|LOCUS_00860 102693 103895 gene locus_tag LOCUS_00870 gene bamB 102693 103895 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXJ7 protein_id gnl|my_center|LOCUS_00870 103924 105357 gene locus_tag LOCUS_00880 gene engA 103924 105357 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMQ2 protein_id gnl|my_center|LOCUS_00880 106353 105382 gene locus_tag LOCUS_00890 106353 105382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 106410 108863 gene locus_tag LOCUS_00900 106410 108863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 109750 109055 gene locus_tag LOCUS_00910 109750 109055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 110171 109830 gene locus_tag LOCUS_00920 110171 109830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056482.1 protein_id gnl|my_center|LOCUS_00920 111547 110234 gene locus_tag LOCUS_00930 111547 110234 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 protein_id gnl|my_center|LOCUS_00930 112476 111709 gene locus_tag LOCUS_00940 gene gloB 112476 111709 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MG0 protein_id gnl|my_center|LOCUS_00940 112509 113276 gene locus_tag LOCUS_00950 112509 113276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_00950 113266 113709 gene locus_tag LOCUS_00960 gene rnhA 113266 113709 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UU3 protein_id gnl|my_center|LOCUS_00960 113843 114574 gene locus_tag LOCUS_00970 gene dnaQ 113843 114574 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947114.1 protein_id gnl|my_center|LOCUS_00970 114737 115522 gene locus_tag LOCUS_00980 114737 115522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 115763 119857 gene locus_tag LOCUS_00990 115763 119857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 119859 121541 gene locus_tag LOCUS_01000 119859 121541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 123044 121536 gene locus_tag LOCUS_01010 gene nhaD 123044 121536 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_01010 124342 123089 gene locus_tag LOCUS_01020 124342 123089 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946389.1 protein_id gnl|my_center|LOCUS_01020 125189 124380 gene locus_tag LOCUS_01030 125189 124380 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947561.1 protein_id gnl|my_center|LOCUS_01030 125805 125164 gene locus_tag LOCUS_01040 125805 125164 CDS product D-methionine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957386.1 protein_id gnl|my_center|LOCUS_01040 126829 125786 gene locus_tag LOCUS_01050 gene metN1 126829 125786 CDS product methionine import ATP-binding protein MetN 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M41 protein_id gnl|my_center|LOCUS_01050 127155 128579 gene locus_tag LOCUS_01060 127155 128579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 129359 128586 gene locus_tag LOCUS_01070 129359 128586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 132241 130061 gene locus_tag LOCUS_01080 132241 130061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 132536 132739 gene locus_tag LOCUS_01090 132536 132739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 132736 133305 gene locus_tag LOCUS_01100 132736 133305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 134720 133356 gene locus_tag LOCUS_01110 gene xseA 134720 133356 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCU2 protein_id gnl|my_center|LOCUS_01110 134803 136272 gene locus_tag LOCUS_01120 gene guaB 134803 136272 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886X6 protein_id gnl|my_center|LOCUS_01120 136305 137864 gene locus_tag LOCUS_01130 gene guaA 136305 137864 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZX09 protein_id gnl|my_center|LOCUS_01130 137870 138412 gene locus_tag LOCUS_01140 gene tadA 137870 138412 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DS3 protein_id gnl|my_center|LOCUS_01140 138391 142365 gene locus_tag LOCUS_01150 gene purL 138391 142365 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E749 protein_id gnl|my_center|LOCUS_01150 142352 144052 gene locus_tag LOCUS_01160 gene sfcA 142352 144052 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947011.1 protein_id gnl|my_center|LOCUS_01160 144597 144055 gene locus_tag LOCUS_01170 144597 144055 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947309.1 protein_id gnl|my_center|LOCUS_01170 145116 145952 gene locus_tag LOCUS_01180 145116 145952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 145952 146749 gene locus_tag LOCUS_01190 145952 146749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 146753 148060 gene locus_tag LOCUS_01200 gene mgtE 146753 148060 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B32 protein_id gnl|my_center|LOCUS_01200 148097 149488 gene locus_tag LOCUS_01210 gene rimK 148097 149488 CDS product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_01210 149602 151599 gene locus_tag LOCUS_01220 149602 151599 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895490.1 protein_id gnl|my_center|LOCUS_01220 151668 153089 gene locus_tag LOCUS_01230 151668 153089 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022902.1 protein_id gnl|my_center|LOCUS_01230 153434 153093 gene locus_tag LOCUS_01240 153434 153093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 153704 154534 gene locus_tag LOCUS_01250 153704 154534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 154551 155528 gene locus_tag LOCUS_01260 gene cmaX 154551 155528 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098062.1 protein_id gnl|my_center|LOCUS_01260 155597 155866 gene locus_tag LOCUS_01270 155597 155866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 156994 155915 gene locus_tag LOCUS_01280 156994 155915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 161471 156978 gene locus_tag LOCUS_01290 161471 156978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 161771 162865 gene locus_tag LOCUS_01300 161771 162865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 163237 162866 gene locus_tag LOCUS_01310 163237 162866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 163462 164667 gene locus_tag LOCUS_01320 gene yfdZ 163462 164667 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVI1 protein_id gnl|my_center|LOCUS_01320 164654 165985 gene locus_tag LOCUS_01330 gene hom 164654 165985 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29365 protein_id gnl|my_center|LOCUS_01330 166086 167141 gene locus_tag LOCUS_01340 166086 167141 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ16 protein_id gnl|my_center|LOCUS_01340 167188 168177 gene locus_tag LOCUS_01350 167188 168177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 168299 170086 gene locus_tag LOCUS_01360 gene recJ 168299 170086 CDS product single-stranded-DNA-specific exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020281.1 protein_id gnl|my_center|LOCUS_01360 170305 171297 gene locus_tag LOCUS_01370 gene prfB 170305 171297 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A290 protein_id gnl|my_center|LOCUS_01370 171299 172810 gene locus_tag LOCUS_01380 gene lysS 171299 172810 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPL4 protein_id gnl|my_center|LOCUS_01380 173736 172897 gene locus_tag LOCUS_01390 173736 172897 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_01390 175048 173981 gene locus_tag LOCUS_01400 gene ygfZ 175048 173981 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIH8 protein_id gnl|my_center|LOCUS_01400 175171 175791 gene locus_tag LOCUS_01410 175171 175791 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 protein_id gnl|my_center|LOCUS_01410 175824 176090 gene locus_tag LOCUS_01420 175824 176090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPA2 protein_id gnl|my_center|LOCUS_01420 176572 177186 gene locus_tag LOCUS_01430 176572 177186 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LN3 protein_id gnl|my_center|LOCUS_01430 177199 177480 gene locus_tag LOCUS_01440 177199 177480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 177754 179205 gene locus_tag LOCUS_01450 gene mucD 177754 179205 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_01450 179643 181439 gene locus_tag LOCUS_01460 gene lepA 179643 181439 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD74 protein_id gnl|my_center|LOCUS_01460 181443 182240 gene locus_tag LOCUS_01470 gene lepB-1 181443 182240 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUD3 protein_id gnl|my_center|LOCUS_01470 182264 182626 gene locus_tag LOCUS_01480 182264 182626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 182629 183306 gene locus_tag LOCUS_01490 gene rnc 182629 183306 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGF2 protein_id gnl|my_center|LOCUS_01490 183303 184196 gene locus_tag LOCUS_01500 gene era 183303 184196 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51836 protein_id gnl|my_center|LOCUS_01500 184198 184935 gene locus_tag LOCUS_01510 gene recO 184198 184935 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44642 protein_id gnl|my_center|LOCUS_01510 185058 185798 gene locus_tag LOCUS_01520 gene pdxJ 185058 185798 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A794 protein_id gnl|my_center|LOCUS_01520 186083 185874 gene locus_tag LOCUS_01530 186083 185874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 187779 186358 gene locus_tag LOCUS_01540 187779 186358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 189673 188228 gene locus_tag LOCUS_01550 189673 188228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 190917 190048 gene locus_tag LOCUS_01560 190917 190048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 191069 193132 gene locus_tag LOCUS_01570 191069 193132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 193129 194058 gene locus_tag LOCUS_01580 193129 194058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 196931 194076 gene locus_tag LOCUS_01590 gene gacS 196931 194076 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD98 protein_id gnl|my_center|LOCUS_01590 197829 196942 gene locus_tag LOCUS_01600 197829 196942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 198114 198413 gene locus_tag LOCUS_01610 198114 198413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 198432 199703 gene locus_tag LOCUS_01620 gene kynU 198432 199703 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD2 protein_id gnl|my_center|LOCUS_01620 199693 200640 gene locus_tag LOCUS_01630 199693 200640 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_01630 201220 200627 gene locus_tag LOCUS_01640 201220 200627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 202601 201231 gene locus_tag LOCUS_01650 202601 201231 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958644.1 protein_id gnl|my_center|LOCUS_01650 202931 204235 gene locus_tag LOCUS_01660 gene rlmD 202931 204235 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NGX1 protein_id gnl|my_center|LOCUS_01660 204252 206462 gene locus_tag LOCUS_01670 gene relA 204252 206462 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_01670 207237 206521 gene locus_tag LOCUS_01680 207237 206521 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCD0 protein_id gnl|my_center|LOCUS_01680 207349 210048 gene locus_tag LOCUS_01690 gene ppc 207349 210048 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI55 protein_id gnl|my_center|LOCUS_01690 210127 211554 gene locus_tag LOCUS_01700 210127 211554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_01700 211659 212315 gene locus_tag LOCUS_01710 gene adk 211659 212315 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXV4 protein_id gnl|my_center|LOCUS_01710 212325 212693 gene locus_tag LOCUS_01720 212325 212693 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E74 protein_id gnl|my_center|LOCUS_01720 213112 213756 gene locus_tag LOCUS_01730 213112 213756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 213832 214341 gene locus_tag LOCUS_01740 213832 214341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 214450 215214 gene locus_tag LOCUS_01750 gene tsaB 214450 215214 CDS product tRNA threonylcarbamoyladenosine biosynthesis protein TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RD1 protein_id gnl|my_center|LOCUS_01750 215297 216025 gene locus_tag LOCUS_01760 215297 216025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 217838 216663 gene locus_tag LOCUS_01770 gene dapE 217838 216663 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWU0 protein_id gnl|my_center|LOCUS_01770 218664 217831 gene locus_tag LOCUS_01780 gene dapD 218664 217831 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS36 protein_id gnl|my_center|LOCUS_01780 218775 220646 gene locus_tag LOCUS_01790 218775 220646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 221162 220731 gene locus_tag LOCUS_01800 221162 220731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 221832 221218 gene locus_tag LOCUS_01810 gene icmJ 221832 221218 CDS product virulence protein IcmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946204.1 protein_id gnl|my_center|LOCUS_01810 222419 221877 gene locus_tag LOCUS_01820 gene icmC 222419 221877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946202.1 protein_id gnl|my_center|LOCUS_01820 223894 222605 gene locus_tag LOCUS_01830 223894 222605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946690.1 protein_id gnl|my_center|LOCUS_01830 224935 223976 gene locus_tag LOCUS_01840 gene rpoS 224935 223976 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_01840 225300 225512 gene locus_tag LOCUS_01850 225300 225512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01850 225755 225901 gene locus_tag LOCUS_01860 225755 225901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 225876 226880 gene locus_tag LOCUS_01870 225876 226880 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_01870 226935 228098 gene locus_tag LOCUS_01880 226935 228098 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099003.1 protein_id gnl|my_center|LOCUS_01880 228105 229157 gene locus_tag LOCUS_01890 228105 229157 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 protein_id gnl|my_center|LOCUS_01890 229154 229912 gene locus_tag LOCUS_01900 229154 229912 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532420.1 protein_id gnl|my_center|LOCUS_01900 230019 232268 gene locus_tag LOCUS_01910 230019 232268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 232371 233006 gene locus_tag LOCUS_01920 232371 233006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 233475 233056 gene locus_tag LOCUS_01930 233475 233056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 233702 234931 gene locus_tag LOCUS_01940 gene ispG 233702 234931 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VV9 protein_id gnl|my_center|LOCUS_01940 235087 236202 gene locus_tag LOCUS_01950 235087 236202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146490.1 protein_id gnl|my_center|LOCUS_01950 236800 237486 gene locus_tag LOCUS_01960 236800 237486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 237467 238672 gene locus_tag LOCUS_01970 237467 238672 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962920.1 protein_id gnl|my_center|LOCUS_01970 239301 238684 gene locus_tag LOCUS_01980 239301 238684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 242111 239589 gene locus_tag LOCUS_01990 242111 239589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 243340 242276 gene locus_tag LOCUS_02000 gene dinB 243340 242276 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY20 protein_id gnl|my_center|LOCUS_02000 245266 243395 gene locus_tag LOCUS_02010 245266 243395 CDS product HcpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 protein_id gnl|my_center|LOCUS_02010 245374 247326 gene locus_tag LOCUS_02020 245374 247326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 247751 248035 gene locus_tag LOCUS_02030 247751 248035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768280.1 protein_id gnl|my_center|LOCUS_02030 251106 248095 gene locus_tag LOCUS_02040 gene icmB 251106 248095 CDS product virulence protein IcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946205.1 protein_id gnl|my_center|LOCUS_02040 252072 251152 gene locus_tag LOCUS_02050 252072 251152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 253495 252077 gene locus_tag LOCUS_02060 253495 252077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 254670 253498 gene locus_tag LOCUS_02070 254670 253498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 255482 254730 gene locus_tag LOCUS_02080 gene icmL 255482 254730 CDS product type IV secretion system protein IcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946198.1 protein_id gnl|my_center|LOCUS_02080 255889 255623 gene locus_tag LOCUS_02090 gene icmT 255889 255623 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946190.1 protein_id gnl|my_center|LOCUS_02090 257043 255904 gene locus_tag LOCUS_02100 gene dotB 257043 255904 CDS product Dot/Icm secretion system ATPase DotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948376.1 protein_id gnl|my_center|LOCUS_02100 257861 257052 gene locus_tag LOCUS_02110 257861 257052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 258391 257930 gene locus_tag LOCUS_02120 gene dotD 258391 257930 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958345.1 protein_id gnl|my_center|LOCUS_02120 258675 259037 gene locus_tag LOCUS_02130 gene icmS 258675 259037 CDS product IcmS protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946191.1 protein_id gnl|my_center|LOCUS_02130 259098 260258 gene locus_tag LOCUS_02140 gene icmP 259098 260258 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958339.1 protein_id gnl|my_center|LOCUS_02140 260308 262668 gene locus_tag LOCUS_02150 gene icmO 260308 262668 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946195.1 protein_id gnl|my_center|LOCUS_02150 >Feature sequence02 998 549 gene locus_tag LOCUS_02160 998 549 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939136.1 protein_id gnl|my_center|LOCUS_02160 1734 1024 gene locus_tag LOCUS_02170 1734 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 2105 1806 gene locus_tag LOCUS_02180 2105 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 2498 2941 gene locus_tag LOCUS_02190 2498 2941 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWZ8 protein_id gnl|my_center|LOCUS_02190 3020 3463 gene locus_tag LOCUS_02200 3020 3463 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWZ8 protein_id gnl|my_center|LOCUS_02200 3952 3530 gene locus_tag LOCUS_02210 3952 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 4072 4728 gene locus_tag LOCUS_02220 4072 4728 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946560.1 protein_id gnl|my_center|LOCUS_02220 4742 5566 gene locus_tag LOCUS_02230 4742 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_02230 5663 8221 gene locus_tag LOCUS_02240 gene prlC 5663 8221 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074287.1 protein_id gnl|my_center|LOCUS_02240 8877 8293 gene locus_tag LOCUS_02250 8877 8293 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 protein_id gnl|my_center|LOCUS_02250 9098 10282 gene locus_tag LOCUS_02260 9098 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 11355 10435 gene locus_tag LOCUS_02270 11355 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 11977 11438 gene locus_tag LOCUS_02280 11977 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 12871 13119 gene locus_tag LOCUS_02290 12871 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 13454 14569 gene locus_tag LOCUS_02300 13454 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 14624 15757 gene locus_tag LOCUS_02310 14624 15757 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532708.1 protein_id gnl|my_center|LOCUS_02310 17234 15903 gene locus_tag LOCUS_02320 17234 15903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 18163 17417 gene locus_tag LOCUS_02330 gene stp 18163 17417 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287376.1 protein_id gnl|my_center|LOCUS_02330 19271 18114 gene locus_tag LOCUS_02340 19271 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 20106 19444 gene locus_tag LOCUS_02350 20106 19444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 20276 20866 gene locus_tag LOCUS_02360 20276 20866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 22149 20887 gene locus_tag LOCUS_02370 22149 20887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 22373 22735 gene locus_tag LOCUS_02380 22373 22735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 25125 22783 gene locus_tag LOCUS_02390 25125 22783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 26535 25315 gene locus_tag LOCUS_02400 26535 25315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 27061 26591 gene locus_tag LOCUS_02410 27061 26591 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_02410 28099 27233 gene locus_tag LOCUS_02420 gene rpoS 28099 27233 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45684 protein_id gnl|my_center|LOCUS_02420 29005 28193 gene locus_tag LOCUS_02430 29005 28193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455560.1 protein_id gnl|my_center|LOCUS_02430 29492 28989 gene locus_tag LOCUS_02440 29492 28989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704776.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02440 30230 31066 gene locus_tag LOCUS_02450 30230 31066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 32134 31343 gene locus_tag LOCUS_02460 gene surE 32134 31343 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR5 protein_id gnl|my_center|LOCUS_02460 32641 32153 gene locus_tag LOCUS_02470 gene ispF 32641 32153 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E329 protein_id gnl|my_center|LOCUS_02470 33336 32632 gene locus_tag LOCUS_02480 gene ispD 33336 32632 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886M1 protein_id gnl|my_center|LOCUS_02480 33595 33326 gene locus_tag LOCUS_02490 33595 33326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 34878 33592 gene locus_tag LOCUS_02500 gene eno 34878 33592 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTX1 protein_id gnl|my_center|LOCUS_02500 35732 34911 gene locus_tag LOCUS_02510 gene kdsA 35732 34911 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWA3 protein_id gnl|my_center|LOCUS_02510 37376 35751 gene locus_tag LOCUS_02520 gene pyrG 37376 35751 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXZ4 protein_id gnl|my_center|LOCUS_02520 37297 37470 gene locus_tag LOCUS_02530 37297 37470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 38848 37490 gene locus_tag LOCUS_02540 gene tilS 38848 37490 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ9 protein_id gnl|my_center|LOCUS_02540 39791 38841 gene locus_tag LOCUS_02550 gene accA 39791 38841 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BJ8 protein_id gnl|my_center|LOCUS_02550 40110 40364 gene locus_tag LOCUS_02560 40110 40364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947964.1 protein_id gnl|my_center|LOCUS_02560 40464 41354 gene locus_tag LOCUS_02570 40464 41354 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_02570 41354 42136 gene locus_tag LOCUS_02580 41354 42136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 42889 42221 gene locus_tag LOCUS_02590 42889 42221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 43042 43719 gene locus_tag LOCUS_02600 43042 43719 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947958.1 protein_id gnl|my_center|LOCUS_02600 44431 43829 gene locus_tag LOCUS_02610 44431 43829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 45385 44567 gene locus_tag LOCUS_02620 45385 44567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 46651 45467 gene locus_tag LOCUS_02630 gene brnQ 46651 45467 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871918.1 protein_id gnl|my_center|LOCUS_02630 48556 47156 gene locus_tag LOCUS_02640 48556 47156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 49655 48777 gene locus_tag LOCUS_02650 49655 48777 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482898.1 protein_id gnl|my_center|LOCUS_02650 50235 50633 gene locus_tag LOCUS_02660 50235 50633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 51095 52444 gene locus_tag LOCUS_02670 51095 52444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 55363 52697 gene locus_tag LOCUS_02680 55363 52697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 59048 55587 gene locus_tag LOCUS_02690 gene dnaE 59048 55587 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWX2 protein_id gnl|my_center|LOCUS_02690 59649 59086 gene locus_tag LOCUS_02700 gene rnhB 59649 59086 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXY9 protein_id gnl|my_center|LOCUS_02700 60882 59683 gene locus_tag LOCUS_02710 gene lpxB 60882 59683 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG2 protein_id gnl|my_center|LOCUS_02710 61656 60886 gene locus_tag LOCUS_02720 gene lpxA 61656 60886 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY61 protein_id gnl|my_center|LOCUS_02720 62111 61653 gene locus_tag LOCUS_02730 gene fabZ 62111 61653 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY62 protein_id gnl|my_center|LOCUS_02730 63202 62114 gene locus_tag LOCUS_02740 gene lpxD 63202 62114 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DT0 protein_id gnl|my_center|LOCUS_02740 63747 63235 gene locus_tag LOCUS_02750 63747 63235 CDS product chaperone protein skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ME6 protein_id gnl|my_center|LOCUS_02750 66190 63761 gene locus_tag LOCUS_02760 gene bamA 66190 63761 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS0 protein_id gnl|my_center|LOCUS_02760 67232 66438 gene locus_tag LOCUS_02770 67232 66438 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_02770 68429 67383 gene locus_tag LOCUS_02780 68429 67383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 68674 69870 gene locus_tag LOCUS_02790 68674 69870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 71253 69892 gene locus_tag LOCUS_02800 71253 69892 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ME4 protein_id gnl|my_center|LOCUS_02800 72464 71286 gene locus_tag LOCUS_02810 gene dxr 72464 71286 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N7 protein_id gnl|my_center|LOCUS_02810 73319 72489 gene locus_tag LOCUS_02820 gene cdsA-1 73319 72489 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886N8 protein_id gnl|my_center|LOCUS_02820 74080 73298 gene locus_tag LOCUS_02830 gene uppS 74080 73298 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T16 protein_id gnl|my_center|LOCUS_02830 74670 74113 gene locus_tag LOCUS_02840 gene frr 74670 74113 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUT1 protein_id gnl|my_center|LOCUS_02840 75389 74670 gene locus_tag LOCUS_02850 gene pyrH 75389 74670 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS6 protein_id gnl|my_center|LOCUS_02850 76273 75386 gene locus_tag LOCUS_02860 gene tsf 76273 75386 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHX9 protein_id gnl|my_center|LOCUS_02860 77088 76348 gene locus_tag LOCUS_02870 gene rpsB 77088 76348 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O82850 protein_id gnl|my_center|LOCUS_02870 77279 78049 gene locus_tag LOCUS_02880 gene map 77279 78049 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUS3 protein_id gnl|my_center|LOCUS_02880 78046 80727 gene locus_tag LOCUS_02890 gene glnD 78046 80727 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z9H0 protein_id gnl|my_center|LOCUS_02890 82009 81008 gene locus_tag LOCUS_02900 82009 81008 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074147.1 protein_id gnl|my_center|LOCUS_02900 82177 83214 gene locus_tag LOCUS_02910 82177 83214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 83224 83514 gene locus_tag LOCUS_02920 83224 83514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 84400 83519 gene locus_tag LOCUS_02930 84400 83519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 88768 84572 gene locus_tag LOCUS_02940 88768 84572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 90380 88872 gene locus_tag LOCUS_02950 90380 88872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 91722 90487 gene locus_tag LOCUS_02960 91722 90487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 92108 91782 gene locus_tag LOCUS_02970 92108 91782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 92559 92101 gene locus_tag LOCUS_02980 gene icmW 92559 92101 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769558.1 protein_id gnl|my_center|LOCUS_02980 93127 93630 gene locus_tag LOCUS_02990 gene icmV 93127 93630 CDS product intracellular multiplication protein IcmV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948387.1 protein_id gnl|my_center|LOCUS_02990 93632 95809 gene locus_tag LOCUS_03000 gene dotaA 93632 95809 CDS product DotA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958349.1 protein_id gnl|my_center|LOCUS_03000 95844 98015 gene locus_tag LOCUS_03010 95844 98015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 98219 99637 gene locus_tag LOCUS_03020 98219 99637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 102169 99767 gene locus_tag LOCUS_03030 102169 99767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 102969 102214 gene locus_tag LOCUS_03040 102969 102214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 103578 103141 gene locus_tag LOCUS_03050 gene ccmE 103578 103141 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N3 protein_id gnl|my_center|LOCUS_03050 103723 103568 gene locus_tag LOCUS_03060 103723 103568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 104346 103720 gene locus_tag LOCUS_03070 gene ccmC 104346 103720 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946594.1 protein_id gnl|my_center|LOCUS_03070 105137 104466 gene locus_tag LOCUS_03080 gene ccmB 105137 104466 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Z04 protein_id gnl|my_center|LOCUS_03080 105773 105138 gene locus_tag LOCUS_03090 gene ccmA 105773 105138 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MK8 protein_id gnl|my_center|LOCUS_03090 106327 106115 gene locus_tag LOCUS_03100 106327 106115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 107215 106418 gene locus_tag LOCUS_03110 107215 106418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 107833 109038 gene locus_tag LOCUS_03120 107833 109038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 109410 110444 gene locus_tag LOCUS_03130 gene sohB 109410 110444 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261673.1 protein_id gnl|my_center|LOCUS_03130 111215 110505 gene locus_tag LOCUS_03140 111215 110505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 112774 111305 gene locus_tag LOCUS_03150 112774 111305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 113419 112985 gene locus_tag LOCUS_03160 113419 112985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 114379 113435 gene locus_tag LOCUS_03170 114379 113435 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 protein_id gnl|my_center|LOCUS_03170 115131 114385 gene locus_tag LOCUS_03180 gene motC 115131 114385 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_03180 115879 115163 gene locus_tag LOCUS_03190 gene fliA 115879 115163 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI20 protein_id gnl|my_center|LOCUS_03190 116736 115876 gene locus_tag LOCUS_03200 gene fleN 116736 115876 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD64 protein_id gnl|my_center|LOCUS_03200 118030 116696 gene locus_tag LOCUS_03210 118030 116696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 120123 118027 gene locus_tag LOCUS_03220 gene flhA 120123 118027 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_03220 121249 120125 gene locus_tag LOCUS_03230 gene flhB 121249 120125 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_03230 122027 121239 gene locus_tag LOCUS_03240 gene fliR 122027 121239 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3Q3 protein_id gnl|my_center|LOCUS_03240 122301 122032 gene locus_tag LOCUS_03250 gene fliQ 122301 122032 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_03250 123065 122301 gene locus_tag LOCUS_03260 gene fliP 123065 122301 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI13 protein_id gnl|my_center|LOCUS_03260 123354 123058 gene locus_tag LOCUS_03270 123354 123058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 123765 123364 gene locus_tag LOCUS_03280 gene fliN 123765 123364 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51466 protein_id gnl|my_center|LOCUS_03280 124717 123779 gene locus_tag LOCUS_03290 gene fliM 124717 123779 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC2 protein_id gnl|my_center|LOCUS_03290 125329 124721 gene locus_tag LOCUS_03300 125329 124721 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_03300 126856 125474 gene locus_tag LOCUS_03310 126856 125474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 127239 126934 gene locus_tag LOCUS_03320 127239 126934 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_03320 127696 127280 gene locus_tag LOCUS_03330 127696 127280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 129014 127701 gene locus_tag LOCUS_03340 gene fliI 129014 127701 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 protein_id gnl|my_center|LOCUS_03340 129608 129018 gene locus_tag LOCUS_03350 129608 129018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 130612 129608 gene locus_tag LOCUS_03360 gene fliG 130612 129608 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51464 protein_id gnl|my_center|LOCUS_03360 132224 130605 gene locus_tag LOCUS_03370 gene fliF 132224 130605 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUN3 protein_id gnl|my_center|LOCUS_03370 132577 132239 gene locus_tag LOCUS_03380 gene fliE 132577 132239 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB4 protein_id gnl|my_center|LOCUS_03380 133896 132589 gene locus_tag LOCUS_03390 133896 132589 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706626.1 protein_id gnl|my_center|LOCUS_03390 134896 133889 gene locus_tag LOCUS_03400 134896 133889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 136202 135153 gene locus_tag LOCUS_03410 136202 135153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 136670 136374 gene locus_tag LOCUS_03420 136670 136374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 137079 136672 gene locus_tag LOCUS_03430 gene fliS 137079 136672 CDS product B-type flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4N6 protein_id gnl|my_center|LOCUS_03430 138486 137089 gene locus_tag LOCUS_03440 138486 137089 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUV2 protein_id gnl|my_center|LOCUS_03440 138768 138493 gene locus_tag LOCUS_03450 138768 138493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 141115 138848 gene locus_tag LOCUS_03460 141115 138848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 143169 141367 gene locus_tag LOCUS_03470 143169 141367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 145831 143171 gene locus_tag LOCUS_03480 145831 143171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 146167 145844 gene locus_tag LOCUS_03490 146167 145844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 147260 146169 gene locus_tag LOCUS_03500 gene flgI 147260 146169 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM38 protein_id gnl|my_center|LOCUS_03500 148009 147275 gene locus_tag LOCUS_03510 gene flgH 148009 147275 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA1 protein_id gnl|my_center|LOCUS_03510 148804 148019 gene locus_tag LOCUS_03520 gene flgG 148804 148019 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW66 protein_id gnl|my_center|LOCUS_03520 149562 148819 gene locus_tag LOCUS_03530 gene flgF 149562 148819 CDS product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884Z7 protein_id gnl|my_center|LOCUS_03530 151533 149575 gene locus_tag LOCUS_03540 151533 149575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 152221 151547 gene locus_tag LOCUS_03550 gene flgD 152221 151547 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4Q0 protein_id gnl|my_center|LOCUS_03550 152664 152230 gene locus_tag LOCUS_03560 gene flgC 152664 152230 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM44 protein_id gnl|my_center|LOCUS_03560 153062 152667 gene locus_tag LOCUS_03570 gene flgB 153062 152667 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM45 protein_id gnl|my_center|LOCUS_03570 153331 154044 gene locus_tag LOCUS_03580 153331 154044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 154095 154451 gene locus_tag LOCUS_03590 154095 154451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 154470 154934 gene locus_tag LOCUS_03600 154470 154934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 154936 155709 gene locus_tag LOCUS_03610 154936 155709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 156061 155985 gene locus_tag LOCUS_t00020 156061 155985 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 156284 156487 gene locus_tag LOCUS_03620 156284 156487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 156764 156970 gene locus_tag LOCUS_03630 156764 156970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 157587 157033 gene locus_tag LOCUS_03640 157587 157033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 157879 157619 gene locus_tag LOCUS_03650 157879 157619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 158493 158116 gene locus_tag LOCUS_03660 158493 158116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 159076 158723 gene locus_tag LOCUS_03670 159076 158723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 159471 160046 gene locus_tag LOCUS_03680 159471 160046 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943404.1 protein_id gnl|my_center|LOCUS_03680 160525 160049 gene locus_tag LOCUS_03690 160525 160049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 160858 161358 gene locus_tag LOCUS_03700 160858 161358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 161358 161945 gene locus_tag LOCUS_03710 161358 161945 CDS product chorismate--pyruvate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018386.1 protein_id gnl|my_center|LOCUS_03710 162515 162003 gene locus_tag LOCUS_03720 162515 162003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 162865 162653 gene locus_tag LOCUS_03730 162865 162653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 163012 163794 gene locus_tag LOCUS_03740 163012 163794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 164241 163843 gene locus_tag LOCUS_03750 164241 163843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 164318 164854 gene locus_tag LOCUS_03760 gene def 164318 164854 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P934 protein_id gnl|my_center|LOCUS_03760 165593 164928 gene locus_tag LOCUS_03770 165593 164928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 165982 167148 gene locus_tag LOCUS_03780 gene napA 165982 167148 CDS product Na+/H+ antiporter GerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899806.1 protein_id gnl|my_center|LOCUS_03780 167368 168000 gene locus_tag LOCUS_03790 167368 168000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 169826 168048 gene locus_tag LOCUS_03800 169826 168048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 170070 170426 gene locus_tag LOCUS_03810 170070 170426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 171868 170489 gene locus_tag LOCUS_03820 gene dbpA 171868 170489 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814910.1 protein_id gnl|my_center|LOCUS_03820 172681 171992 gene locus_tag LOCUS_03830 172681 171992 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_03830 173500 172739 gene locus_tag LOCUS_03840 173500 172739 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89FX0 protein_id gnl|my_center|LOCUS_03840 174420 173497 gene locus_tag LOCUS_03850 174420 173497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089318.1 protein_id gnl|my_center|LOCUS_03850 174737 175867 gene locus_tag LOCUS_03860 gene acrA 174737 175867 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 protein_id gnl|my_center|LOCUS_03860 175895 179014 gene locus_tag LOCUS_03870 175895 179014 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389804.1 protein_id gnl|my_center|LOCUS_03870 179381 180481 gene locus_tag LOCUS_03880 179381 180481 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701083.1 protein_id gnl|my_center|LOCUS_03880 180596 181078 gene locus_tag LOCUS_03890 180596 181078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 181240 181758 gene locus_tag LOCUS_03900 181240 181758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 182220 181948 gene locus_tag LOCUS_03910 182220 181948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 182701 183168 gene locus_tag LOCUS_03920 182701 183168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 183212 183619 gene locus_tag LOCUS_03930 183212 183619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 183686 184300 gene locus_tag LOCUS_03940 183686 184300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 185102 184338 gene locus_tag LOCUS_03950 185102 184338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_03950 185762 185583 gene locus_tag LOCUS_03960 185762 185583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 186822 186022 gene locus_tag LOCUS_03970 186822 186022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 187246 188745 gene locus_tag LOCUS_03980 187246 188745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 189608 189520 gene locus_tag LOCUS_t00030 189608 189520 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 189694 189621 gene locus_tag LOCUS_t00040 189694 189621 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 189809 189734 gene locus_tag LOCUS_t00050 189809 189734 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 190485 189934 gene locus_tag LOCUS_03990 gene pgsA 190485 189934 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_03990 192380 190614 gene locus_tag LOCUS_04000 gene uvrC 192380 190614 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFV4 protein_id gnl|my_center|LOCUS_04000 193128 192463 gene locus_tag LOCUS_04010 gene uvrY 193128 192463 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706579.1 protein_id gnl|my_center|LOCUS_04010 193356 193443 gene locus_tag LOCUS_t00060 193356 193443 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 193665 194339 gene locus_tag LOCUS_04020 193665 194339 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_04020 195269 194418 gene locus_tag LOCUS_04030 195269 194418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 195446 196099 gene locus_tag LOCUS_04040 195446 196099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 protein_id gnl|my_center|LOCUS_04040 197042 196101 gene locus_tag LOCUS_04050 197042 196101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 197949 197185 gene locus_tag LOCUS_04060 197949 197185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 198187 198588 gene locus_tag LOCUS_04070 198187 198588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 199996 198743 gene locus_tag LOCUS_04080 199996 198743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 201387 200110 gene locus_tag LOCUS_04090 gene serS 201387 200110 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEQ9 protein_id gnl|my_center|LOCUS_04090 202689 201406 gene locus_tag LOCUS_04100 gene rarA 202689 201406 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39918 protein_id gnl|my_center|LOCUS_04100 203338 202697 gene locus_tag LOCUS_04110 gene lolA 203338 202697 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39917 protein_id gnl|my_center|LOCUS_04110 205842 203416 gene locus_tag LOCUS_04120 gene ftsK 205842 203416 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947492.1 protein_id gnl|my_center|LOCUS_04120 205956 206921 gene locus_tag LOCUS_04130 gene trxB 205956 206921 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSS4 protein_id gnl|my_center|LOCUS_04130 206914 207627 gene locus_tag LOCUS_04140 gene aat 206914 207627 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 protein_id gnl|my_center|LOCUS_04140 207843 208103 gene locus_tag LOCUS_04150 gene infA 207843 208103 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLU8 protein_id gnl|my_center|LOCUS_04150 210439 208175 gene locus_tag LOCUS_04160 gene clpA 210439 208175 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_04160 210795 210466 gene locus_tag LOCUS_04170 gene clpS 210795 210466 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P999 protein_id gnl|my_center|LOCUS_04170 211021 211284 gene locus_tag LOCUS_04180 gene cspD 211021 211284 CDS product cold shock domain protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 protein_id gnl|my_center|LOCUS_04180 212922 211663 gene locus_tag LOCUS_04190 gene icd 212922 211663 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_04190 213078 214214 gene locus_tag LOCUS_04200 gene mnmA 213078 214214 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7G9 protein_id gnl|my_center|LOCUS_04200 214251 215627 gene locus_tag LOCUS_04210 gene purB 214251 215627 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44797 protein_id gnl|my_center|LOCUS_04210 217806 215665 gene locus_tag LOCUS_04220 217806 215665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 218102 218704 gene locus_tag LOCUS_04230 218102 218704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04230 220799 219429 gene locus_tag LOCUS_04240 220799 219429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 221297 222445 gene locus_tag LOCUS_04250 221297 222445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 222637 222927 gene locus_tag LOCUS_04260 222637 222927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 223139 225127 gene locus_tag LOCUS_04270 223139 225127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence03 1273 770 gene locus_tag LOCUS_04280 1273 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 2417 1353 gene locus_tag LOCUS_04290 2417 1353 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316351.1 protein_id gnl|my_center|LOCUS_04290 3874 2435 gene locus_tag LOCUS_04300 gene pyk 3874 2435 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AU7 protein_id gnl|my_center|LOCUS_04300 5058 3871 gene locus_tag LOCUS_04310 gene pgk 5058 3871 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AU6 protein_id gnl|my_center|LOCUS_04310 6108 5092 gene locus_tag LOCUS_04320 gene gap 6108 5092 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK56 protein_id gnl|my_center|LOCUS_04320 8127 6130 gene locus_tag LOCUS_04330 gene tktA 8127 6130 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y8 protein_id gnl|my_center|LOCUS_04330 8897 8346 gene locus_tag LOCUS_04340 8897 8346 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_04340 9103 10275 gene locus_tag LOCUS_04350 gene metK 9103 10275 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPS4 protein_id gnl|my_center|LOCUS_04350 10441 11748 gene locus_tag LOCUS_04360 gene ahcY 10441 11748 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTY7 protein_id gnl|my_center|LOCUS_04360 11946 12818 gene locus_tag LOCUS_04370 gene metF 11946 12818 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I687 protein_id gnl|my_center|LOCUS_04370 12891 13613 gene locus_tag LOCUS_04380 12891 13613 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AE1 protein_id gnl|my_center|LOCUS_04380 13952 13608 gene locus_tag LOCUS_04390 13952 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 16140 13945 gene locus_tag LOCUS_04400 16140 13945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 17449 16133 gene locus_tag LOCUS_04410 17449 16133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 17992 17453 gene locus_tag LOCUS_04420 17992 17453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 18164 18952 gene locus_tag LOCUS_04430 18164 18952 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105282.1 protein_id gnl|my_center|LOCUS_04430 19230 19841 gene locus_tag LOCUS_04440 19230 19841 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXZ4 protein_id gnl|my_center|LOCUS_04440 19881 20309 gene locus_tag LOCUS_04450 19881 20309 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMY0 protein_id gnl|my_center|LOCUS_04450 20316 21269 gene locus_tag LOCUS_04460 gene pyrB 20316 21269 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V99 protein_id gnl|my_center|LOCUS_04460 21274 22536 gene locus_tag LOCUS_04470 gene pyrX 21274 22536 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206197.1 protein_id gnl|my_center|LOCUS_04470 22829 22533 gene locus_tag LOCUS_04480 22829 22533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 23940 22906 gene locus_tag LOCUS_04490 gene pilT 23940 22906 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_04490 23962 24651 gene locus_tag LOCUS_04500 23962 24651 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769924.1 protein_id gnl|my_center|LOCUS_04500 24648 25472 gene locus_tag LOCUS_04510 gene proC 24648 25472 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87V92 protein_id gnl|my_center|LOCUS_04510 25480 26061 gene locus_tag LOCUS_04520 25480 26061 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087263.1 protein_id gnl|my_center|LOCUS_04520 26058 26906 gene locus_tag LOCUS_04530 26058 26906 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946217.1 protein_id gnl|my_center|LOCUS_04530 27996 26908 gene locus_tag LOCUS_04540 27996 26908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 28216 28827 gene locus_tag LOCUS_04550 gene yggV 28216 28827 CDS product dITP/XTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MK83 protein_id gnl|my_center|LOCUS_04550 28831 29976 gene locus_tag LOCUS_04560 28831 29976 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_04560 29991 30524 gene locus_tag LOCUS_04570 29991 30524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 30589 30936 gene locus_tag LOCUS_04580 30589 30936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 32725 30881 gene locus_tag LOCUS_04590 gene sac1 32725 30881 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_04590 33671 32979 gene locus_tag LOCUS_04600 gene trmB 33671 32979 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPV4 protein_id gnl|my_center|LOCUS_04600 33816 35717 gene locus_tag LOCUS_04610 33816 35717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 35717 36781 gene locus_tag LOCUS_04620 gene mutY 35717 36781 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073236.1 protein_id gnl|my_center|LOCUS_04620 36830 37063 gene locus_tag LOCUS_04630 36830 37063 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU80 protein_id gnl|my_center|LOCUS_04630 37150 37225 gene locus_tag LOCUS_t00070 37150 37225 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 37392 38129 gene locus_tag LOCUS_04640 37392 38129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 39446 38619 gene locus_tag LOCUS_04650 gene cysQ 39446 38619 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_04650 40032 39436 gene locus_tag LOCUS_04660 gene nudE 40032 39436 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704553.1 protein_id gnl|my_center|LOCUS_04660 40114 40515 gene locus_tag LOCUS_04670 40114 40515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 42134 40512 gene locus_tag LOCUS_04680 42134 40512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 43845 42433 gene locus_tag LOCUS_04690 43845 42433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 44084 45355 gene locus_tag LOCUS_04700 44084 45355 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_04700 45402 48485 gene locus_tag LOCUS_04710 45402 48485 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_04710 49236 48559 gene locus_tag LOCUS_04720 gene bioD 49236 48559 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7Z2 protein_id gnl|my_center|LOCUS_04720 49346 50596 gene locus_tag LOCUS_04730 49346 50596 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640276.1 protein_id gnl|my_center|LOCUS_04730 50998 51504 gene locus_tag LOCUS_04740 50998 51504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 51657 52628 gene locus_tag LOCUS_04750 51657 52628 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089324.1 protein_id gnl|my_center|LOCUS_04750 52849 54852 gene locus_tag LOCUS_04760 gene priA 52849 54852 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR5 protein_id gnl|my_center|LOCUS_04760 54893 55603 gene locus_tag LOCUS_04770 54893 55603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_04770 55632 56177 gene locus_tag LOCUS_04780 gene hslV 55632 56177 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU1 protein_id gnl|my_center|LOCUS_04780 56191 57534 gene locus_tag LOCUS_04790 gene hslU 56191 57534 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNY5 protein_id gnl|my_center|LOCUS_04790 57550 58293 gene locus_tag LOCUS_04800 gene ubiE 57550 58293 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIF2 protein_id gnl|my_center|LOCUS_04800 58293 58883 gene locus_tag LOCUS_04810 58293 58883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 58917 60551 gene locus_tag LOCUS_04820 gene ubiB 58917 60551 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRH7 protein_id gnl|my_center|LOCUS_04820 60767 62938 gene locus_tag LOCUS_04830 60767 62938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 63035 63367 gene locus_tag LOCUS_04840 gene hitA 63035 63367 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022010.1 protein_id gnl|my_center|LOCUS_04840 63395 63562 gene locus_tag LOCUS_04850 63395 63562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 63562 63744 gene locus_tag LOCUS_04860 63562 63744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 63750 64490 gene locus_tag LOCUS_04870 gene tatC 63750 64490 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8V0 protein_id gnl|my_center|LOCUS_04870 65104 64442 gene locus_tag LOCUS_04880 65104 64442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 67201 65579 gene locus_tag LOCUS_04890 67201 65579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 68696 67746 gene locus_tag LOCUS_04900 68696 67746 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA3 protein_id gnl|my_center|LOCUS_04900 69092 69673 gene locus_tag LOCUS_04910 69092 69673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 69773 70873 gene locus_tag LOCUS_04920 69773 70873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_04920 70866 71117 gene locus_tag LOCUS_04930 70866 71117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 71148 72557 gene locus_tag LOCUS_04940 gene glnA 71148 72557 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNJ2 protein_id gnl|my_center|LOCUS_04940 72573 73142 gene locus_tag LOCUS_04950 72573 73142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 75114 73237 gene locus_tag LOCUS_04960 75114 73237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 75597 75178 gene locus_tag LOCUS_04970 75597 75178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 76425 75718 gene locus_tag LOCUS_04980 76425 75718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 76802 76422 gene locus_tag LOCUS_04990 76802 76422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 77217 76792 gene locus_tag LOCUS_05000 77217 76792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 77860 77306 gene locus_tag LOCUS_05010 77860 77306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 78418 77879 gene locus_tag LOCUS_05020 78418 77879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 79719 78526 gene locus_tag LOCUS_05030 gene mshG 79719 78526 CDS product MSHA biogenesis protein MshG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_05030 81460 79709 gene locus_tag LOCUS_05040 81460 79709 CDS product MSHA biogenesis protein MshE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704368.1 protein_id gnl|my_center|LOCUS_05040 82089 81457 gene locus_tag LOCUS_05050 82089 81457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 82669 82091 gene locus_tag LOCUS_05060 82669 82091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 83529 82666 gene locus_tag LOCUS_05070 83529 82666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 83881 84813 gene locus_tag LOCUS_05080 83881 84813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 84951 85412 gene locus_tag LOCUS_05090 gene trmL 84951 85412 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNU7 protein_id gnl|my_center|LOCUS_05090 86120 85443 gene locus_tag LOCUS_05100 86120 85443 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948363.1 protein_id gnl|my_center|LOCUS_05100 87165 86161 gene locus_tag LOCUS_05110 gene gpsA 87165 86161 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKN9 protein_id gnl|my_center|LOCUS_05110 87644 87162 gene locus_tag LOCUS_05120 gene secB 87644 87162 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BI9 protein_id gnl|my_center|LOCUS_05120 88150 87725 gene locus_tag LOCUS_05130 88150 87725 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948012.1 protein_id gnl|my_center|LOCUS_05130 88291 89823 gene locus_tag LOCUS_05140 gene gpmI 88291 89823 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFB1 protein_id gnl|my_center|LOCUS_05140 89833 90999 gene locus_tag LOCUS_05150 89833 90999 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946248.1 protein_id gnl|my_center|LOCUS_05150 91101 92477 gene locus_tag LOCUS_05160 91101 92477 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946247.1 protein_id gnl|my_center|LOCUS_05160 92532 93422 gene locus_tag LOCUS_05170 92532 93422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_05170 94347 93475 gene locus_tag LOCUS_05180 gene rpoH 94347 93475 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS52 protein_id gnl|my_center|LOCUS_05180 96034 94547 gene locus_tag LOCUS_05190 96034 94547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 97514 96255 gene locus_tag LOCUS_05200 97514 96255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 98380 97730 gene locus_tag LOCUS_05210 98380 97730 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_05210 99826 98399 gene locus_tag LOCUS_05220 99826 98399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 100675 100010 gene locus_tag LOCUS_05230 100675 100010 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946333.1 protein_id gnl|my_center|LOCUS_05230 101534 100665 gene locus_tag LOCUS_05240 101534 100665 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262002.1 protein_id gnl|my_center|LOCUS_05240 101713 102039 gene locus_tag LOCUS_05250 gene trxA 101713 102039 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X2T1 protein_id gnl|my_center|LOCUS_05250 102335 103594 gene locus_tag LOCUS_05260 gene rho 102335 103594 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A296 protein_id gnl|my_center|LOCUS_05260 103694 105160 gene locus_tag LOCUS_05270 gene ubiD 103694 105160 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ5 protein_id gnl|my_center|LOCUS_05270 105165 105890 gene locus_tag LOCUS_05280 gene ubiB 105165 105890 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948617.1 protein_id gnl|my_center|LOCUS_05280 106206 105892 gene locus_tag LOCUS_05290 106206 105892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 107450 106509 gene locus_tag LOCUS_05300 107450 106509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 108540 107566 gene locus_tag LOCUS_05310 108540 107566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 109636 108887 gene locus_tag LOCUS_05320 109636 108887 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796345.1 protein_id gnl|my_center|LOCUS_05320 110882 109647 gene locus_tag LOCUS_05330 gene hemY 110882 109647 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948436.1 protein_id gnl|my_center|LOCUS_05330 112249 110879 gene locus_tag LOCUS_05340 112249 110879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 113107 112376 gene locus_tag LOCUS_05350 113107 112376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 113913 113164 gene locus_tag LOCUS_05360 113913 113164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 114810 114058 gene locus_tag LOCUS_05370 gene algR 114810 114058 CDS product positive alginate biosynthesis regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26275 protein_id gnl|my_center|LOCUS_05370 115954 114881 gene locus_tag LOCUS_05380 gene algZ 115954 114881 CDS product alginate biosynthesis protein AlgZ/FimS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_05380 116734 116054 gene locus_tag LOCUS_05390 116734 116054 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_05390 116954 118213 gene locus_tag LOCUS_05400 gene lysA 116954 118213 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H4 protein_id gnl|my_center|LOCUS_05400 118260 119126 gene locus_tag LOCUS_05410 gene dapF 118260 119126 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFI1 protein_id gnl|my_center|LOCUS_05410 119450 119749 gene locus_tag LOCUS_05420 119450 119749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 120316 120786 gene locus_tag LOCUS_05430 gene algQ 120316 120786 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707403.1 protein_id gnl|my_center|LOCUS_05430 121112 120789 gene locus_tag LOCUS_05440 gene fdxA 121112 120789 CDS product ferredoxin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY07 protein_id gnl|my_center|LOCUS_05440 121319 122191 gene locus_tag LOCUS_05450 121319 122191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 122845 122267 gene locus_tag LOCUS_05460 122845 122267 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957690.1 protein_id gnl|my_center|LOCUS_05460 123810 122842 gene locus_tag LOCUS_05470 123810 122842 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478829.1 protein_id gnl|my_center|LOCUS_05470 124506 124168 gene locus_tag LOCUS_05480 gene glnK 124506 124168 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_05480 124579 124851 gene locus_tag LOCUS_05490 124579 124851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 125340 124855 gene locus_tag LOCUS_05500 125340 124855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947813.1 protein_id gnl|my_center|LOCUS_05500 125647 127629 gene locus_tag LOCUS_05510 125647 127629 CDS product potassium efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195204.1 protein_id gnl|my_center|LOCUS_05510 127695 129212 gene locus_tag LOCUS_05520 gene yifB 127695 129212 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208165.1 protein_id gnl|my_center|LOCUS_05520 129738 129322 gene locus_tag LOCUS_05530 129738 129322 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367640.1 protein_id gnl|my_center|LOCUS_05530 129838 129914 gene locus_tag LOCUS_t00080 129838 129914 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 130197 129916 gene locus_tag LOCUS_05540 130197 129916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 130880 130239 gene locus_tag LOCUS_05550 130880 130239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_05550 131008 131859 gene locus_tag LOCUS_05560 gene dam 131008 131859 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2G2 protein_id gnl|my_center|LOCUS_05560 132634 131882 gene locus_tag LOCUS_05570 gene dsbA 132634 131882 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ88 protein_id gnl|my_center|LOCUS_05570 133289 132660 gene locus_tag LOCUS_05580 133289 132660 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 protein_id gnl|my_center|LOCUS_05580 133467 134060 gene locus_tag LOCUS_05590 gene engB 133467 134060 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AV6 protein_id gnl|my_center|LOCUS_05590 136990 134306 gene locus_tag LOCUS_05600 gene polI 136990 134306 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958446.1 protein_id gnl|my_center|LOCUS_05600 137026 138009 gene locus_tag LOCUS_05610 gene thrB 137026 138009 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AP1 protein_id gnl|my_center|LOCUS_05610 139059 137983 gene locus_tag LOCUS_05620 139059 137983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 141402 139189 gene locus_tag LOCUS_05630 gene uvrD 141402 139189 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y7I2 protein_id gnl|my_center|LOCUS_05630 142664 141405 gene locus_tag LOCUS_05640 142664 141405 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947065.1 protein_id gnl|my_center|LOCUS_05640 142845 144158 gene locus_tag LOCUS_05650 gene hmgA 142845 144158 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDA2 protein_id gnl|my_center|LOCUS_05650 144683 144288 gene locus_tag LOCUS_05660 144683 144288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 145443 144781 gene locus_tag LOCUS_05670 145443 144781 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_05670 147275 145443 gene locus_tag LOCUS_05680 gene glmS 147275 145443 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT25 protein_id gnl|my_center|LOCUS_05680 148713 147289 gene locus_tag LOCUS_05690 gene glmU 148713 147289 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JTC3 protein_id gnl|my_center|LOCUS_05690 149275 148847 gene locus_tag LOCUS_05700 gene atpC 149275 148847 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT21 protein_id gnl|my_center|LOCUS_05700 150703 149291 gene locus_tag LOCUS_05710 gene atpD 150703 149291 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43715 protein_id gnl|my_center|LOCUS_05710 151623 150748 gene locus_tag LOCUS_05720 gene atpG 151623 150748 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNH4 protein_id gnl|my_center|LOCUS_05720 153194 151629 gene locus_tag LOCUS_05730 gene atpA2 153194 151629 CDS product ATP synthase subunit alpha 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR99 protein_id gnl|my_center|LOCUS_05730 153764 153225 gene locus_tag LOCUS_05740 gene atpH 153764 153225 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TT1 protein_id gnl|my_center|LOCUS_05740 154240 153770 gene locus_tag LOCUS_05750 gene atpF 154240 153770 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNH1 protein_id gnl|my_center|LOCUS_05750 154550 154263 gene locus_tag LOCUS_05760 gene atpE 154550 154263 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR96 protein_id gnl|my_center|LOCUS_05760 155367 154594 gene locus_tag LOCUS_05770 gene atpB 155367 154594 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AG1 protein_id gnl|my_center|LOCUS_05770 155989 156861 gene locus_tag LOCUS_05780 gene moeW 155989 156861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412005.1 protein_id gnl|my_center|LOCUS_05780 157320 157000 gene locus_tag LOCUS_05790 157320 157000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 158315 157401 gene locus_tag LOCUS_05800 158315 157401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 159323 158400 gene locus_tag LOCUS_05810 159323 158400 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315951.1 protein_id gnl|my_center|LOCUS_05810 160177 159356 gene locus_tag LOCUS_05820 gene soj 160177 159356 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958543.1 protein_id gnl|my_center|LOCUS_05820 160840 160214 gene locus_tag LOCUS_05830 gene rsmG 160840 160214 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B0 protein_id gnl|my_center|LOCUS_05830 162812 160833 gene locus_tag LOCUS_05840 gene mnmG 162812 160833 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94613 protein_id gnl|my_center|LOCUS_05840 164154 162814 gene locus_tag LOCUS_05850 gene mnmE 164154 162814 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JT87 protein_id gnl|my_center|LOCUS_05850 165861 164155 gene locus_tag LOCUS_05860 gene yidC 165861 164155 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TS1 protein_id gnl|my_center|LOCUS_05860 166109 165879 gene locus_tag LOCUS_05870 166109 165879 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HC88 protein_id gnl|my_center|LOCUS_05870 166459 166073 gene locus_tag LOCUS_05880 166459 166073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 167755 169155 gene locus_tag LOCUS_05890 gene dnaA 167755 169155 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEC3 protein_id gnl|my_center|LOCUS_05890 169216 170364 gene locus_tag LOCUS_05900 gene dnaN 169216 170364 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7C4 protein_id gnl|my_center|LOCUS_05900 170367 171476 gene locus_tag LOCUS_05910 gene recF 170367 171476 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEE8 protein_id gnl|my_center|LOCUS_05910 171940 174357 gene locus_tag LOCUS_05920 gene gyrB 171940 174357 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZK5 protein_id gnl|my_center|LOCUS_05920 174630 175400 gene locus_tag LOCUS_05930 174630 175400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 176040 175474 gene locus_tag LOCUS_05940 176040 175474 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA9 protein_id gnl|my_center|LOCUS_05940 178139 176058 gene locus_tag LOCUS_05950 gene glyS 178139 176058 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I7B8 protein_id gnl|my_center|LOCUS_05950 179047 178136 gene locus_tag LOCUS_05960 gene glyQ 179047 178136 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUF8 protein_id gnl|my_center|LOCUS_05960 180557 179148 gene locus_tag LOCUS_05970 gene trkH 180557 179148 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_05970 181981 180605 gene locus_tag LOCUS_05980 gene trkA 181981 180605 CDS product potassium transporter inner membrane associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_05980 183313 182003 gene locus_tag LOCUS_05990 183313 182003 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500T1 protein_id gnl|my_center|LOCUS_05990 184254 183310 gene locus_tag LOCUS_06000 gene fmt 184254 183310 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVU4 protein_id gnl|my_center|LOCUS_06000 184760 184257 gene locus_tag LOCUS_06010 gene def 184760 184257 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5P6 protein_id gnl|my_center|LOCUS_06010 184992 185984 gene locus_tag LOCUS_06020 184992 185984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_06020 186047 187261 gene locus_tag LOCUS_06030 186047 187261 CDS product DNA protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461424.1 protein_id gnl|my_center|LOCUS_06030 187276 187752 gene locus_tag LOCUS_06040 gene smg 187276 187752 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKK6 protein_id gnl|my_center|LOCUS_06040 187784 190099 gene locus_tag LOCUS_06050 gene topA 187784 190099 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AA5 protein_id gnl|my_center|LOCUS_06050 190377 191006 gene locus_tag LOCUS_06060 gene tsaC 190377 191006 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE2 protein_id gnl|my_center|LOCUS_06060 191003 191953 gene locus_tag LOCUS_06070 gene hemF 191003 191953 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43898 protein_id gnl|my_center|LOCUS_06070 192253 193074 gene locus_tag LOCUS_06080 gene aroE 192253 193074 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6F7 protein_id gnl|my_center|LOCUS_06080 193078 193407 gene locus_tag LOCUS_06090 193078 193407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 193442 194149 gene locus_tag LOCUS_06100 193442 194149 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926759.1 protein_id gnl|my_center|LOCUS_06100 194676 194146 gene locus_tag LOCUS_06110 194676 194146 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_06110 196072 194723 gene locus_tag LOCUS_06120 gene gor 196072 194723 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817382.1 protein_id gnl|my_center|LOCUS_06120 196166 198208 gene locus_tag LOCUS_06130 196166 198208 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070205.1 protein_id gnl|my_center|LOCUS_06130 198374 198709 gene locus_tag LOCUS_06140 198374 198709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 198969 198748 gene locus_tag LOCUS_06150 198969 198748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence04 225 440 gene locus_tag LOCUS_06160 225 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 1031 447 gene locus_tag LOCUS_06170 1031 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 1917 1132 gene locus_tag LOCUS_06180 1917 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 2037 3326 gene locus_tag LOCUS_06190 gene kdtA 2037 3326 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891562.1 protein_id gnl|my_center|LOCUS_06190 4681 3374 gene locus_tag LOCUS_06200 4681 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_06200 5356 4697 gene locus_tag LOCUS_06210 gene pcm 5356 4697 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_06210 5514 6140 gene locus_tag LOCUS_06220 5514 6140 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457144.1 protein_id gnl|my_center|LOCUS_06220 6215 8110 gene locus_tag LOCUS_06230 gene parE 6215 8110 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F84 protein_id gnl|my_center|LOCUS_06230 8121 10376 gene locus_tag LOCUS_06240 gene parC 8121 10376 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRH6 protein_id gnl|my_center|LOCUS_06240 11087 10407 gene locus_tag LOCUS_06250 11087 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 12915 11188 gene locus_tag LOCUS_06260 12915 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266488.1 protein_id gnl|my_center|LOCUS_06260 13151 14104 gene locus_tag LOCUS_06270 13151 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 15128 14106 gene locus_tag LOCUS_06280 15128 14106 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940544.1 protein_id gnl|my_center|LOCUS_06280 15178 15747 gene locus_tag LOCUS_06290 gene efp 15178 15747 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR4 protein_id gnl|my_center|LOCUS_06290 15744 16709 gene locus_tag LOCUS_06300 15744 16709 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AR3 protein_id gnl|my_center|LOCUS_06300 17428 16727 gene locus_tag LOCUS_06310 17428 16727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 17842 18108 gene locus_tag LOCUS_06320 17842 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 19437 18505 gene locus_tag LOCUS_06330 gene rsgA 19437 18505 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2C1 protein_id gnl|my_center|LOCUS_06330 19550 20116 gene locus_tag LOCUS_06340 gene orn 19550 20116 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMS7 protein_id gnl|my_center|LOCUS_06340 20127 21665 gene locus_tag LOCUS_06350 gene nnr 20127 21665 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_06350 21662 22132 gene locus_tag LOCUS_06360 gene yjeE 21662 22132 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262729.1 protein_id gnl|my_center|LOCUS_06360 22113 23441 gene locus_tag LOCUS_06370 22113 23441 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763015.1 protein_id gnl|my_center|LOCUS_06370 23458 25164 gene locus_tag LOCUS_06380 gene mutL 23458 25164 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYY2 protein_id gnl|my_center|LOCUS_06380 25268 26236 gene locus_tag LOCUS_06390 25268 26236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 27686 26238 gene locus_tag LOCUS_06400 27686 26238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 27833 28747 gene locus_tag LOCUS_06410 gene miaA 27833 28747 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGS0 protein_id gnl|my_center|LOCUS_06410 29658 30290 gene locus_tag LOCUS_06420 29658 30290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 30498 30761 gene locus_tag LOCUS_06430 gene hfq 30498 30761 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIW2 protein_id gnl|my_center|LOCUS_06430 30971 32266 gene locus_tag LOCUS_06440 gene hflX 30971 32266 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUM1 protein_id gnl|my_center|LOCUS_06440 32356 33564 gene locus_tag LOCUS_06450 gene hflK 32356 33564 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946232.1 protein_id gnl|my_center|LOCUS_06450 33564 34487 gene locus_tag LOCUS_06460 gene hflC 33564 34487 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ66 protein_id gnl|my_center|LOCUS_06460 34554 34766 gene locus_tag LOCUS_06470 34554 34766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 34779 36065 gene locus_tag LOCUS_06480 gene purA 34779 36065 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNX8 protein_id gnl|my_center|LOCUS_06480 36095 38359 gene locus_tag LOCUS_06490 gene vacB 36095 38359 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VK1 protein_id gnl|my_center|LOCUS_06490 38352 39092 gene locus_tag LOCUS_06500 gene rlmB 38352 39092 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG8 protein_id gnl|my_center|LOCUS_06500 39352 42051 gene locus_tag LOCUS_06510 39352 42051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 42246 42599 gene locus_tag LOCUS_06520 gene rpsF 42246 42599 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZ29 protein_id gnl|my_center|LOCUS_06520 42611 42856 gene locus_tag LOCUS_06530 gene rpsR 42611 42856 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NG00 protein_id gnl|my_center|LOCUS_06530 42969 43421 gene locus_tag LOCUS_06540 gene rplI 42969 43421 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHV2 protein_id gnl|my_center|LOCUS_06540 43535 44944 gene locus_tag LOCUS_06550 gene dnaB 43535 44944 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUN3 protein_id gnl|my_center|LOCUS_06550 44937 46019 gene locus_tag LOCUS_06560 gene alr-2 44937 46019 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL98 protein_id gnl|my_center|LOCUS_06560 47752 46046 gene locus_tag LOCUS_06570 47752 46046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 47989 50028 gene locus_tag LOCUS_06580 47989 50028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 51431 50025 gene locus_tag LOCUS_06590 51431 50025 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37034 protein_id gnl|my_center|LOCUS_06590 51755 52189 gene locus_tag LOCUS_06600 51755 52189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 52235 52768 gene locus_tag LOCUS_06610 52235 52768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 54512 52995 gene locus_tag LOCUS_06620 54512 52995 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MH7 protein_id gnl|my_center|LOCUS_06620 54569 55633 gene locus_tag LOCUS_06630 54569 55633 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_06630 57261 55846 gene locus_tag LOCUS_06640 57261 55846 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948529.1 protein_id gnl|my_center|LOCUS_06640 57852 57310 gene locus_tag LOCUS_06650 57852 57310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 58084 58971 gene locus_tag LOCUS_06660 gene dapA 58084 58971 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI24 protein_id gnl|my_center|LOCUS_06660 58974 59231 gene locus_tag LOCUS_06670 58974 59231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 59264 59980 gene locus_tag LOCUS_06680 gene purC 59264 59980 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W0 protein_id gnl|my_center|LOCUS_06680 63150 60028 gene locus_tag LOCUS_06690 63150 60028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 64989 63205 gene locus_tag LOCUS_06700 64989 63205 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389852.1 protein_id gnl|my_center|LOCUS_06700 65989 65138 gene locus_tag LOCUS_06710 gene mscS 65989 65138 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_06710 67550 66381 gene locus_tag LOCUS_06720 gene metC 67550 66381 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83A83 protein_id gnl|my_center|LOCUS_06720 68916 67540 gene locus_tag LOCUS_06730 68916 67540 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403878.1 protein_id gnl|my_center|LOCUS_06730 70529 69201 gene locus_tag LOCUS_06740 70529 69201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 71972 70650 gene locus_tag LOCUS_06750 71972 70650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 73120 72035 gene locus_tag LOCUS_06760 73120 72035 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227915.1 protein_id gnl|my_center|LOCUS_06760 74532 73108 gene locus_tag LOCUS_06770 74532 73108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 74655 75581 gene locus_tag LOCUS_06780 74655 75581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 75728 77626 gene locus_tag LOCUS_06790 gene ccmF 75728 77626 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N2 protein_id gnl|my_center|LOCUS_06790 77613 78221 gene locus_tag LOCUS_06800 gene dsbE 77613 78221 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3N1 protein_id gnl|my_center|LOCUS_06800 78218 78622 gene locus_tag LOCUS_06810 gene cycL 78218 78622 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037371.1 protein_id gnl|my_center|LOCUS_06810 78624 79682 gene locus_tag LOCUS_06820 78624 79682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 80327 79728 gene locus_tag LOCUS_06830 80327 79728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 81020 80328 gene locus_tag LOCUS_06840 81020 80328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 81247 81924 gene locus_tag LOCUS_06850 81247 81924 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948196.1 protein_id gnl|my_center|LOCUS_06850 81950 82690 gene locus_tag LOCUS_06860 81950 82690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 83959 82679 gene locus_tag LOCUS_06870 83959 82679 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_06870 84732 83956 gene locus_tag LOCUS_06880 84732 83956 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_06880 84842 86221 gene locus_tag LOCUS_06890 gene ffh 84842 86221 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYH2 protein_id gnl|my_center|LOCUS_06890 86773 86405 gene locus_tag LOCUS_06900 86773 86405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 86856 87074 gene locus_tag LOCUS_06910 86856 87074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 87686 87946 gene locus_tag LOCUS_06920 gene rpsP 87686 87946 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYH3 protein_id gnl|my_center|LOCUS_06920 87977 88498 gene locus_tag LOCUS_06930 gene rimM 87977 88498 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG24 protein_id gnl|my_center|LOCUS_06930 88498 89247 gene locus_tag LOCUS_06940 gene trmD 88498 89247 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPE4 protein_id gnl|my_center|LOCUS_06940 89265 89654 gene locus_tag LOCUS_06950 gene rplS 89265 89654 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUF7 protein_id gnl|my_center|LOCUS_06950 89608 90117 gene locus_tag LOCUS_06960 gene ogt 89608 90117 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957577.1 protein_id gnl|my_center|LOCUS_06960 90132 90896 gene locus_tag LOCUS_06970 gene dsbC 90132 90896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 protein_id gnl|my_center|LOCUS_06970 91234 91497 gene locus_tag LOCUS_06980 91234 91497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 92706 91636 gene locus_tag LOCUS_06990 92706 91636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 94491 92845 gene locus_tag LOCUS_07000 94491 92845 CDS product electron-transferring-flavoprotein dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388018.1 protein_id gnl|my_center|LOCUS_07000 94603 95355 gene locus_tag LOCUS_07010 gene etfB 94603 95355 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946657.1 protein_id gnl|my_center|LOCUS_07010 95358 96302 gene locus_tag LOCUS_07020 gene etfA 95358 96302 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189890.1 protein_id gnl|my_center|LOCUS_07020 96789 96319 gene locus_tag LOCUS_07030 96789 96319 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947335.1 protein_id gnl|my_center|LOCUS_07030 97455 96814 gene locus_tag LOCUS_07040 gene maiA 97455 96814 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071821.1 protein_id gnl|my_center|LOCUS_07040 98581 97595 gene locus_tag LOCUS_07050 98581 97595 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947988.1 protein_id gnl|my_center|LOCUS_07050 99699 98593 gene locus_tag LOCUS_07060 gene hpd 99699 98593 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I576 protein_id gnl|my_center|LOCUS_07060 99894 101117 gene locus_tag LOCUS_07070 99894 101117 CDS product tryptophan/tyrosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946392.1 protein_id gnl|my_center|LOCUS_07070 101199 102314 gene locus_tag LOCUS_07080 gene hisC 101199 102314 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_07080 102311 102658 gene locus_tag LOCUS_07090 102311 102658 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU09 protein_id gnl|my_center|LOCUS_07090 102714 102911 gene locus_tag LOCUS_07100 102714 102911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 103003 104199 gene locus_tag LOCUS_07110 103003 104199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 105002 104214 gene locus_tag LOCUS_07120 gene phhA 105002 104214 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43334 protein_id gnl|my_center|LOCUS_07120 105163 105585 gene locus_tag LOCUS_07130 105163 105585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 106378 105722 gene locus_tag LOCUS_07140 gene liuG 106378 105722 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071998.1 protein_id gnl|my_center|LOCUS_07140 107090 106389 gene locus_tag LOCUS_07150 gene liuF 107090 106389 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071999.1 protein_id gnl|my_center|LOCUS_07150 107996 107106 gene locus_tag LOCUS_07160 gene mvaB 107996 107106 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104166.1 protein_id gnl|my_center|LOCUS_07160 110040 108019 gene locus_tag LOCUS_07170 gene accC2 110040 108019 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206448.1 protein_id gnl|my_center|LOCUS_07170 110828 110037 gene locus_tag LOCUS_07180 110828 110037 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947554.1 protein_id gnl|my_center|LOCUS_07180 112432 110825 gene locus_tag LOCUS_07190 gene liuB 112432 110825 CDS product methylcrotonyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100387.1 protein_id gnl|my_center|LOCUS_07190 113645 112449 gene locus_tag LOCUS_07200 gene atoB 113645 112449 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947551.1 protein_id gnl|my_center|LOCUS_07200 114833 113667 gene locus_tag LOCUS_07210 114833 113667 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947550.1 protein_id gnl|my_center|LOCUS_07210 115046 115801 gene locus_tag LOCUS_07220 115046 115801 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090570.1 protein_id gnl|my_center|LOCUS_07220 116096 116356 gene locus_tag LOCUS_07230 116096 116356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 118726 117584 gene locus_tag LOCUS_07240 118726 117584 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090001.1 protein_id gnl|my_center|LOCUS_07240 119200 118970 gene locus_tag LOCUS_07250 119200 118970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 119443 120522 gene locus_tag LOCUS_07260 119443 120522 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947287.1 protein_id gnl|my_center|LOCUS_07260 120519 121496 gene locus_tag LOCUS_07270 120519 121496 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947288.1 protein_id gnl|my_center|LOCUS_07270 121497 122600 gene locus_tag LOCUS_07280 121497 122600 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV80 protein_id gnl|my_center|LOCUS_07280 123138 122665 gene locus_tag LOCUS_07290 123138 122665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946402.1 protein_id gnl|my_center|LOCUS_07290 123273 123575 gene locus_tag LOCUS_07300 123273 123575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 125147 123990 gene locus_tag LOCUS_07310 125147 123990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 126242 125310 gene locus_tag LOCUS_07320 126242 125310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 126568 126756 gene locus_tag LOCUS_07330 126568 126756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 127026 128243 gene locus_tag LOCUS_07340 127026 128243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 128371 131607 gene locus_tag LOCUS_07350 128371 131607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 132139 133953 gene locus_tag LOCUS_07360 132139 133953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 134506 135684 gene locus_tag LOCUS_07370 134506 135684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 135760 135990 gene locus_tag LOCUS_07380 135760 135990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 136793 136065 gene locus_tag LOCUS_07390 136793 136065 CDS product high-affinity branched-chain amino acid transport ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYV1 protein_id gnl|my_center|LOCUS_07390 137693 136818 gene locus_tag LOCUS_07400 137693 136818 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095566.1 protein_id gnl|my_center|LOCUS_07400 138976 137690 gene locus_tag LOCUS_07410 gene livM 138976 137690 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096032.1 protein_id gnl|my_center|LOCUS_07410 139893 138976 gene locus_tag LOCUS_07420 139893 138976 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095571.1 protein_id gnl|my_center|LOCUS_07420 141226 140096 gene locus_tag LOCUS_07430 141226 140096 CDS product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099985.1 protein_id gnl|my_center|LOCUS_07430 141863 141267 gene locus_tag LOCUS_07440 141863 141267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 142104 143024 gene locus_tag LOCUS_07450 142104 143024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_07450 143024 143794 gene locus_tag LOCUS_07460 143024 143794 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I032 protein_id gnl|my_center|LOCUS_07460 143828 144658 gene locus_tag LOCUS_07470 143828 144658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 145401 144655 gene locus_tag LOCUS_07480 145401 144655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 145616 148423 gene locus_tag LOCUS_07490 145616 148423 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457669.1 protein_id gnl|my_center|LOCUS_07490 148895 148428 gene locus_tag LOCUS_07500 148895 148428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 148941 150308 gene locus_tag LOCUS_07510 gene radA 148941 150308 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WB3 protein_id gnl|my_center|LOCUS_07510 150738 152459 gene locus_tag LOCUS_07520 150738 152459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_07520 152885 154933 gene locus_tag LOCUS_07530 152885 154933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335531.1 protein_id gnl|my_center|LOCUS_07530 157116 154930 gene locus_tag LOCUS_07540 157116 154930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 159069 157390 gene locus_tag LOCUS_07550 gene yjjK 159069 157390 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022793.1 protein_id gnl|my_center|LOCUS_07550 159221 160483 gene locus_tag LOCUS_07560 gene glyA 159221 160483 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXK6 protein_id gnl|my_center|LOCUS_07560 160505 160975 gene locus_tag LOCUS_07570 gene nrdR 160505 160975 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BT4 protein_id gnl|my_center|LOCUS_07570 160975 162171 gene locus_tag LOCUS_07580 gene ribD 160975 162171 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4I5 protein_id gnl|my_center|LOCUS_07580 162181 163323 gene locus_tag LOCUS_07590 gene ribB 162181 163323 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG9 protein_id gnl|my_center|LOCUS_07590 163343 163822 gene locus_tag LOCUS_07600 gene ribH 163343 163822 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMY3 protein_id gnl|my_center|LOCUS_07600 163815 164279 gene locus_tag LOCUS_07610 gene nusB 163815 164279 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWX6 protein_id gnl|my_center|LOCUS_07610 165099 164359 gene locus_tag LOCUS_07620 165099 164359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 165580 165182 gene locus_tag LOCUS_07630 165580 165182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence05 <1 9077 gene locus_tag LOCUS_07640 <1 9077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706509.1:structural toxin protein RtxA 9734 9081 gene locus_tag LOCUS_07650 9734 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 9999 10373 gene locus_tag LOCUS_07660 9999 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 10442 11080 gene locus_tag LOCUS_07670 10442 11080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 11225 12955 gene locus_tag LOCUS_07680 11225 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 14255 13206 gene locus_tag LOCUS_07690 14255 13206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 14388 15113 gene locus_tag LOCUS_07700 14388 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 15118 16503 gene locus_tag LOCUS_07710 15118 16503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 18769 16520 gene locus_tag LOCUS_07720 18769 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 18950 19306 gene locus_tag LOCUS_07730 18950 19306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 20216 19596 gene locus_tag LOCUS_07740 20216 19596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 20215 21144 gene locus_tag LOCUS_07750 20215 21144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 21903 21175 gene locus_tag LOCUS_07760 21903 21175 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096510.1 protein_id gnl|my_center|LOCUS_07760 23336 22344 gene locus_tag LOCUS_07770 23336 22344 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074147.1 protein_id gnl|my_center|LOCUS_07770 24813 23908 gene locus_tag LOCUS_07780 24813 23908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 26519 25665 gene locus_tag LOCUS_07790 gene murI 26519 25665 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E11 protein_id gnl|my_center|LOCUS_07790 27415 26534 gene locus_tag LOCUS_07800 27415 26534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 28465 27419 gene locus_tag LOCUS_07810 28465 27419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 28816 28472 gene locus_tag LOCUS_07820 28816 28472 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUH5 protein_id gnl|my_center|LOCUS_07820 29429 28809 gene locus_tag LOCUS_07830 29429 28809 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106559.1 protein_id gnl|my_center|LOCUS_07830 29613 30905 gene locus_tag LOCUS_07840 29613 30905 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884263.1 protein_id gnl|my_center|LOCUS_07840 30991 31641 gene locus_tag LOCUS_07850 30991 31641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 31849 31661 gene locus_tag LOCUS_07860 31849 31661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091551.1 protein_id gnl|my_center|LOCUS_07860 32301 32053 gene locus_tag LOCUS_07870 32301 32053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 33371 32367 gene locus_tag LOCUS_07880 33371 32367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 34145 33603 gene locus_tag LOCUS_07890 34145 33603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 34571 34203 gene locus_tag LOCUS_07900 34571 34203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 34981 34733 gene locus_tag LOCUS_07910 34981 34733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 36236 35136 gene locus_tag LOCUS_07920 36236 35136 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035306.1 protein_id gnl|my_center|LOCUS_07920 36928 36359 gene locus_tag LOCUS_07930 36928 36359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 37298 37062 gene locus_tag LOCUS_07940 37298 37062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 37521 38048 gene locus_tag LOCUS_07950 37521 38048 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902263.1 protein_id gnl|my_center|LOCUS_07950 38142 39053 gene locus_tag LOCUS_07960 38142 39053 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245058.1 protein_id gnl|my_center|LOCUS_07960 39953 39057 gene locus_tag LOCUS_07970 39953 39057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948164.1 protein_id gnl|my_center|LOCUS_07970 40736 39972 gene locus_tag LOCUS_07980 40736 39972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 41105 40854 gene locus_tag LOCUS_07990 41105 40854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 42467 41256 gene locus_tag LOCUS_08000 42467 41256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 42591 43424 gene locus_tag LOCUS_08010 42591 43424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 43503 43429 gene locus_tag LOCUS_t00090 43503 43429 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 43811 43638 gene locus_tag LOCUS_08020 43811 43638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 43929 44351 gene locus_tag LOCUS_08030 gene pilE 43929 44351 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947632.1 protein_id gnl|my_center|LOCUS_08030 44403 46343 gene locus_tag LOCUS_08040 44403 46343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 46333 47274 gene locus_tag LOCUS_08050 46333 47274 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_08050 47264 48205 gene locus_tag LOCUS_08060 47264 48205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 48289 50010 gene locus_tag LOCUS_08070 gene pilB 48289 50010 CDS product type 4 fimbrial assembly protein PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22608 protein_id gnl|my_center|LOCUS_08070 50048 51280 gene locus_tag LOCUS_08080 gene pilC 50048 51280 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079343.1 protein_id gnl|my_center|LOCUS_08080 51376 52179 gene locus_tag LOCUS_08090 gene pilD 51376 52179 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJP8 protein_id gnl|my_center|LOCUS_08090 52176 52787 gene locus_tag LOCUS_08100 gene coaE 52176 52787 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CF11 protein_id gnl|my_center|LOCUS_08100 52892 53662 gene locus_tag LOCUS_08110 gene zapD 52892 53662 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QL1 protein_id gnl|my_center|LOCUS_08110 53659 53877 gene locus_tag LOCUS_08120 53659 53877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 53908 54231 gene locus_tag LOCUS_08130 53908 54231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 54633 54250 gene locus_tag LOCUS_08140 54633 54250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 55116 54643 gene locus_tag LOCUS_08150 55116 54643 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 protein_id gnl|my_center|LOCUS_08150 56242 55109 gene locus_tag LOCUS_08160 56242 55109 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035306.1 protein_id gnl|my_center|LOCUS_08160 56678 57151 gene locus_tag LOCUS_08170 56678 57151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 60345 57226 gene locus_tag LOCUS_08180 60345 57226 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_08180 61436 60351 gene locus_tag LOCUS_08190 61436 60351 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_08190 61727 62047 gene locus_tag LOCUS_08200 61727 62047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 62087 62359 gene locus_tag LOCUS_08210 62087 62359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 62855 62400 gene locus_tag LOCUS_08220 62855 62400 CDS product 7,8-dihydro-8-oxoguanine-triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707574.1 protein_id gnl|my_center|LOCUS_08220 65511 62794 gene locus_tag LOCUS_08230 gene secA 65511 62794 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q5 protein_id gnl|my_center|LOCUS_08230 66654 65713 gene locus_tag LOCUS_08240 66654 65713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 66806 67300 gene locus_tag LOCUS_08250 66806 67300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 67333 68196 gene locus_tag LOCUS_08260 67333 68196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 68447 68265 gene locus_tag LOCUS_08270 68447 68265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 69465 68578 gene locus_tag LOCUS_08280 gene ybbO 69465 68578 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_08280 70355 69477 gene locus_tag LOCUS_08290 70355 69477 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947409.1 protein_id gnl|my_center|LOCUS_08290 71411 70482 gene locus_tag LOCUS_08300 gene lpxC 71411 70482 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F11 protein_id gnl|my_center|LOCUS_08300 72632 71481 gene locus_tag LOCUS_08310 gene ftsZ 72632 71481 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPW8 protein_id gnl|my_center|LOCUS_08310 73958 72723 gene locus_tag LOCUS_08320 gene ftsA 73958 72723 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY9 protein_id gnl|my_center|LOCUS_08320 74890 74096 gene locus_tag LOCUS_08330 gene ftsQ 74890 74096 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY8 protein_id gnl|my_center|LOCUS_08330 75926 74901 gene locus_tag LOCUS_08340 gene ddlB 75926 74901 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KHC6 protein_id gnl|my_center|LOCUS_08340 76909 75926 gene locus_tag LOCUS_08350 gene murB 76909 75926 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA6 protein_id gnl|my_center|LOCUS_08350 78319 76913 gene locus_tag LOCUS_08360 gene murC 78319 76913 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX1 protein_id gnl|my_center|LOCUS_08360 79451 78321 gene locus_tag LOCUS_08370 gene murG 79451 78321 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY5 protein_id gnl|my_center|LOCUS_08370 80649 79465 gene locus_tag LOCUS_08380 gene ftsW 80649 79465 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA4 protein_id gnl|my_center|LOCUS_08380 82012 80642 gene locus_tag LOCUS_08390 gene murD 82012 80642 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSA3 protein_id gnl|my_center|LOCUS_08390 83277 82195 gene locus_tag LOCUS_08400 gene mraY 83277 82195 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WY2 protein_id gnl|my_center|LOCUS_08400 84657 83287 gene locus_tag LOCUS_08410 gene murF 84657 83287 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F27 protein_id gnl|my_center|LOCUS_08410 86180 84666 gene locus_tag LOCUS_08420 gene murE 86180 84666 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F28 protein_id gnl|my_center|LOCUS_08420 87873 86182 gene locus_tag LOCUS_08430 gene pbpB 87873 86182 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957390.1 protein_id gnl|my_center|LOCUS_08430 88184 87870 gene locus_tag LOCUS_08440 88184 87870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 89192 88215 gene locus_tag LOCUS_08450 gene rsmH 89192 88215 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIF7 protein_id gnl|my_center|LOCUS_08450 89710 89189 gene locus_tag LOCUS_08460 gene mraZ 89710 89189 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F36 protein_id gnl|my_center|LOCUS_08460 92041 90638 gene locus_tag LOCUS_08470 92041 90638 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946389.1 protein_id gnl|my_center|LOCUS_08470 93360 92077 gene locus_tag LOCUS_08480 93360 92077 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIN0 protein_id gnl|my_center|LOCUS_08480 94315 93461 gene locus_tag LOCUS_08490 gene rsmI 94315 93461 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820W0 protein_id gnl|my_center|LOCUS_08490 94350 96233 gene locus_tag LOCUS_08500 94350 96233 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948679.1 protein_id gnl|my_center|LOCUS_08500 96474 96728 gene locus_tag LOCUS_08510 96474 96728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 96824 98695 gene locus_tag LOCUS_08520 96824 98695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 99036 99215 gene locus_tag LOCUS_08530 99036 99215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 99988 99227 gene locus_tag LOCUS_08540 99988 99227 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_08540 101557 100151 gene locus_tag LOCUS_08550 101557 100151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 102777 101677 gene locus_tag LOCUS_08560 102777 101677 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948494.1 protein_id gnl|my_center|LOCUS_08560 103651 102827 gene locus_tag LOCUS_08570 103651 102827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 103967 103638 gene locus_tag LOCUS_08580 103967 103638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 107919 104179 gene locus_tag LOCUS_08590 107919 104179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 109429 108263 gene locus_tag LOCUS_08600 109429 108263 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708833.1 protein_id gnl|my_center|LOCUS_08600 110289 109636 gene locus_tag LOCUS_08610 110289 109636 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_08610 111576 110302 gene locus_tag LOCUS_08620 gene murA 111576 110302 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX85 protein_id gnl|my_center|LOCUS_08620 113681 111831 gene locus_tag LOCUS_08630 113681 111831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 113983 113687 gene locus_tag LOCUS_08640 113983 113687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 114519 113986 gene locus_tag LOCUS_08650 114519 113986 CDS product signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_08650 115191 114694 gene locus_tag LOCUS_08660 115191 114694 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313587.1 protein_id gnl|my_center|LOCUS_08660 115976 115191 gene locus_tag LOCUS_08670 gene yrbE 115976 115191 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261188.1 protein_id gnl|my_center|LOCUS_08670 116785 115979 gene locus_tag LOCUS_08680 116785 115979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094343.1 protein_id gnl|my_center|LOCUS_08680 116971 117933 gene locus_tag LOCUS_08690 116971 117933 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_08690 117979 118956 gene locus_tag LOCUS_08700 117979 118956 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX92 protein_id gnl|my_center|LOCUS_08700 118964 119557 gene locus_tag LOCUS_08710 118964 119557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 119538 120086 gene locus_tag LOCUS_08720 119538 120086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 120083 120811 gene locus_tag LOCUS_08730 120083 120811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094355.1 protein_id gnl|my_center|LOCUS_08730 120891 122339 gene locus_tag LOCUS_08740 gene rpoN 120891 122339 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE5 protein_id gnl|my_center|LOCUS_08740 122358 122666 gene locus_tag LOCUS_08750 gene yhbH 122358 122666 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073700.1 protein_id gnl|my_center|LOCUS_08750 122744 123226 gene locus_tag LOCUS_08760 gene ptsN 122744 123226 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162484.1 protein_id gnl|my_center|LOCUS_08760 123213 124073 gene locus_tag LOCUS_08770 123213 124073 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6F255 protein_id gnl|my_center|LOCUS_08770 124319 125173 gene locus_tag LOCUS_08780 124319 125173 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVV3 protein_id gnl|my_center|LOCUS_08780 125170 125604 gene locus_tag LOCUS_08790 125170 125604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_08790 125601 125870 gene locus_tag LOCUS_08800 gene ptsH 125601 125870 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_08800 125870 127171 gene locus_tag LOCUS_08810 125870 127171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 127185 128129 gene locus_tag LOCUS_08820 127185 128129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 128460 128215 gene locus_tag LOCUS_08830 128460 128215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 128848 129060 gene locus_tag LOCUS_08840 128848 129060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 131495 129273 gene locus_tag LOCUS_08850 131495 129273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 131980 131462 gene locus_tag LOCUS_08860 131980 131462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 133678 132149 gene locus_tag LOCUS_08870 133678 132149 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020819.1 protein_id gnl|my_center|LOCUS_08870 134475 133765 gene locus_tag LOCUS_08880 134475 133765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140332.1 protein_id gnl|my_center|LOCUS_08880 135261 134497 gene locus_tag LOCUS_08890 135261 134497 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073860.1 protein_id gnl|my_center|LOCUS_08890 136463 135291 gene locus_tag LOCUS_08900 gene oprO 136463 135291 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_08900 137947 136592 gene locus_tag LOCUS_08910 gene pmbA 137947 136592 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112740.1 protein_id gnl|my_center|LOCUS_08910 139410 137962 gene locus_tag LOCUS_08920 gene tldD 139410 137962 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261176.1 protein_id gnl|my_center|LOCUS_08920 140262 139423 gene locus_tag LOCUS_08930 140262 139423 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_08930 143816 140259 gene locus_tag LOCUS_08940 143816 140259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 145333 143816 gene locus_tag LOCUS_08950 gene cafA 145333 143816 CDS product axial filament protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_08950 146394 145345 gene locus_tag LOCUS_08960 gene envB 146394 145345 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228205.1 protein_id gnl|my_center|LOCUS_08960 146624 146923 gene locus_tag LOCUS_08970 gene gatC 146624 146923 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WS0 protein_id gnl|my_center|LOCUS_08970 146954 148408 gene locus_tag LOCUS_08980 gene gatA 146954 148408 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BM9 protein_id gnl|my_center|LOCUS_08980 148426 149877 gene locus_tag LOCUS_08990 gene gatB 148426 149877 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WR8 protein_id gnl|my_center|LOCUS_08990 150064 151326 gene locus_tag LOCUS_09000 150064 151326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 151331 152401 gene locus_tag LOCUS_09010 151331 152401 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089975.1 protein_id gnl|my_center|LOCUS_09010 153234 152398 gene locus_tag LOCUS_09020 gene prmC 153234 152398 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT28 protein_id gnl|my_center|LOCUS_09020 154327 153242 gene locus_tag LOCUS_09030 gene prfA 154327 153242 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NIA8 protein_id gnl|my_center|LOCUS_09030 155598 154330 gene locus_tag LOCUS_09040 gene hemA 155598 154330 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMZ9 protein_id gnl|my_center|LOCUS_09040 155741 157432 gene locus_tag LOCUS_09050 155741 157432 CDS product TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42810 protein_id gnl|my_center|LOCUS_09050 158248 157568 gene locus_tag LOCUS_09060 158248 157568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947424.1 protein_id gnl|my_center|LOCUS_09060 159216 158482 gene locus_tag LOCUS_09070 159216 158482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 159540 160088 gene locus_tag LOCUS_09080 gene lolB 159540 160088 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C4 protein_id gnl|my_center|LOCUS_09080 160153 160983 gene locus_tag LOCUS_09090 gene ispE 160153 160983 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RN7 protein_id gnl|my_center|LOCUS_09090 160988 161062 gene locus_tag LOCUS_t00100 160988 161062 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 161090 162040 gene locus_tag LOCUS_09100 gene prs 161090 162040 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFG6 protein_id gnl|my_center|LOCUS_09100 162124 162795 gene locus_tag LOCUS_09110 gene rplY 162124 162795 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS67 protein_id gnl|my_center|LOCUS_09110 162815 163399 gene locus_tag LOCUS_09120 gene pth 162815 163399 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVC3 protein_id gnl|my_center|LOCUS_09120 163419 164504 gene locus_tag LOCUS_09130 gene ychF 163419 164504 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44681 protein_id gnl|my_center|LOCUS_09130 164614 164690 gene locus_tag LOCUS_t00110 164614 164690 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 736 188 gene locus_tag LOCUS_09140 736 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2455 854 gene locus_tag LOCUS_09150 gene tlcA 2455 854 CDS product ADP,ATP carrier protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z8J2 protein_id gnl|my_center|LOCUS_09150 4343 2940 gene locus_tag LOCUS_09160 4343 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 5148 4357 gene locus_tag LOCUS_09170 5148 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 6771 5218 gene locus_tag LOCUS_09180 6771 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 7397 6771 gene locus_tag LOCUS_09190 7397 6771 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_09190 10141 7397 gene locus_tag LOCUS_09200 10141 7397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 11543 10167 gene locus_tag LOCUS_09210 11543 10167 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942585.1 protein_id gnl|my_center|LOCUS_09210 13675 11561 gene locus_tag LOCUS_09220 13675 11561 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942586.1 protein_id gnl|my_center|LOCUS_09220 15150 13747 gene locus_tag LOCUS_09230 15150 13747 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_09230 16995 15436 gene locus_tag LOCUS_09240 16995 15436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05979 protein_id gnl|my_center|LOCUS_09240 17821 17381 gene locus_tag LOCUS_09250 17821 17381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 18966 17929 gene locus_tag LOCUS_09260 18966 17929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 18983 19381 gene locus_tag LOCUS_09270 18983 19381 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR89 protein_id gnl|my_center|LOCUS_09270 19443 20030 gene locus_tag LOCUS_09280 gene gmhA 19443 20030 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVZ0 protein_id gnl|my_center|LOCUS_09280 20027 20629 gene locus_tag LOCUS_09290 20027 20629 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070669.1 protein_id gnl|my_center|LOCUS_09290 20645 22036 gene locus_tag LOCUS_09300 gene dld 20645 22036 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_09300 22039 22554 gene locus_tag LOCUS_09310 22039 22554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 23076 22570 gene locus_tag LOCUS_09320 23076 22570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 24462 23407 gene locus_tag LOCUS_09330 24462 23407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 25071 24634 gene locus_tag LOCUS_09340 gene sspB 25071 24634 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958412.1 protein_id gnl|my_center|LOCUS_09340 25703 25068 gene locus_tag LOCUS_09350 gene sspA 25703 25068 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707594.1 protein_id gnl|my_center|LOCUS_09350 26527 25718 gene locus_tag LOCUS_09360 26527 25718 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_09360 27744 26527 gene locus_tag LOCUS_09370 27744 26527 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY5 protein_id gnl|my_center|LOCUS_09370 28332 27748 gene locus_tag LOCUS_09380 28332 27748 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY4 protein_id gnl|my_center|LOCUS_09380 29414 28578 gene locus_tag LOCUS_09390 gene yebA 29414 28578 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206191.1 protein_id gnl|my_center|LOCUS_09390 29606 30856 gene locus_tag LOCUS_09400 29606 30856 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_09400 31463 30945 gene locus_tag LOCUS_09410 31463 30945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 31755 32408 gene locus_tag LOCUS_09420 31755 32408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_09420 33099 32479 gene locus_tag LOCUS_09430 33099 32479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 33248 33862 gene locus_tag LOCUS_09440 gene ribC 33248 33862 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072298.1 protein_id gnl|my_center|LOCUS_09440 34418 33954 gene locus_tag LOCUS_09450 gene rpsI 34418 33954 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32BA9 protein_id gnl|my_center|LOCUS_09450 34882 34439 gene locus_tag LOCUS_09460 gene rplM 34882 34439 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS12 protein_id gnl|my_center|LOCUS_09460 35316 35008 gene locus_tag LOCUS_09470 35316 35008 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_09470 35447 36649 gene locus_tag LOCUS_09480 gene glcF 35447 36649 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJ95 protein_id gnl|my_center|LOCUS_09480 36728 37282 gene locus_tag LOCUS_09490 36728 37282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 37387 38418 gene locus_tag LOCUS_09500 37387 38418 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_09500 40800 38476 gene locus_tag LOCUS_09510 gene feoB 40800 38476 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AW2 protein_id gnl|my_center|LOCUS_09510 41029 40748 gene locus_tag LOCUS_09520 gene feoA1 41029 40748 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722680.1 protein_id gnl|my_center|LOCUS_09520 41459 41226 gene locus_tag LOCUS_09530 41459 41226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 42852 41560 gene locus_tag LOCUS_09540 42852 41560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 43298 42924 gene locus_tag LOCUS_09550 43298 42924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 43631 43332 gene locus_tag LOCUS_09560 43631 43332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802742.1 protein_id gnl|my_center|LOCUS_09560 44607 43639 gene locus_tag LOCUS_09570 gene cbpA 44607 43639 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CJ2 protein_id gnl|my_center|LOCUS_09570 44772 45773 gene locus_tag LOCUS_09580 44772 45773 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946219.1 protein_id gnl|my_center|LOCUS_09580 48417 45871 gene locus_tag LOCUS_09590 48417 45871 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085447.1 protein_id gnl|my_center|LOCUS_09590 48974 49942 gene locus_tag LOCUS_09600 48974 49942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 49939 50637 gene locus_tag LOCUS_09610 49939 50637 CDS product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016437.1 protein_id gnl|my_center|LOCUS_09610 50705 51208 gene locus_tag LOCUS_09620 50705 51208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770294.1 protein_id gnl|my_center|LOCUS_09620 51350 52792 gene locus_tag LOCUS_09630 51350 52792 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266449.1 protein_id gnl|my_center|LOCUS_09630 53026 53640 gene locus_tag LOCUS_09640 53026 53640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 54398 53661 gene locus_tag LOCUS_09650 54398 53661 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185757.1 protein_id gnl|my_center|LOCUS_09650 55317 54391 gene locus_tag LOCUS_09660 55317 54391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036226.1 protein_id gnl|my_center|LOCUS_09660 55605 55530 gene locus_tag LOCUS_t00120 55605 55530 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 55843 55768 gene locus_tag LOCUS_t00130 55843 55768 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 55944 55869 gene locus_tag LOCUS_t00140 55944 55869 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 57398 56001 gene locus_tag LOCUS_09670 gene gltX1 57398 56001 CDS product glutamate--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EV3 protein_id gnl|my_center|LOCUS_09670 57569 58378 gene locus_tag LOCUS_09680 57569 58378 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_09680 59716 58445 gene locus_tag LOCUS_09690 59716 58445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 59865 60026 gene locus_tag LOCUS_09700 59865 60026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 62276 60168 gene locus_tag LOCUS_09710 62276 60168 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074382.1 protein_id gnl|my_center|LOCUS_09710 63493 62276 gene locus_tag LOCUS_09720 63493 62276 CDS product toxin secretion, membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074383.1 protein_id gnl|my_center|LOCUS_09720 64014 63631 gene locus_tag LOCUS_09730 64014 63631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 65289 64018 gene locus_tag LOCUS_09740 65289 64018 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946389.1 protein_id gnl|my_center|LOCUS_09740 67439 65490 gene locus_tag LOCUS_09750 67439 65490 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946565.1 protein_id gnl|my_center|LOCUS_09750 68138 67464 gene locus_tag LOCUS_09760 68138 67464 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 protein_id gnl|my_center|LOCUS_09760 69700 68276 gene locus_tag LOCUS_09770 gene aggA 69700 68276 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073979.1 protein_id gnl|my_center|LOCUS_09770 70770 70093 gene locus_tag LOCUS_09780 70770 70093 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003319664.1 protein_id gnl|my_center|LOCUS_09780 72110 70773 gene locus_tag LOCUS_09790 72110 70773 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947246.1 protein_id gnl|my_center|LOCUS_09790 74485 72122 gene locus_tag LOCUS_09800 74485 72122 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706513.1 protein_id gnl|my_center|LOCUS_09800 75009 74497 gene locus_tag LOCUS_09810 75009 74497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 76193 75006 gene locus_tag LOCUS_09820 76193 75006 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407019.1 protein_id gnl|my_center|LOCUS_09820 77016 76306 gene locus_tag LOCUS_09830 77016 76306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 77816 77088 gene locus_tag LOCUS_09840 gene vacJ 77816 77088 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947571.1 protein_id gnl|my_center|LOCUS_09840 79524 78052 gene locus_tag LOCUS_09850 gene oprO 79524 78052 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_09850 83867 79743 gene locus_tag LOCUS_09860 83867 79743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 84783 83974 gene locus_tag LOCUS_09870 84783 83974 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947112.1 protein_id gnl|my_center|LOCUS_09870 86593 84803 gene locus_tag LOCUS_09880 86593 84803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 87005 86610 gene locus_tag LOCUS_09890 87005 86610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 87871 86981 gene locus_tag LOCUS_09900 87871 86981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 88352 87969 gene locus_tag LOCUS_09910 88352 87969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 92239 88382 gene locus_tag LOCUS_09920 gene hrpA 92239 88382 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072251.1 protein_id gnl|my_center|LOCUS_09920 94032 92248 gene locus_tag LOCUS_09930 94032 92248 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212594.1 protein_id gnl|my_center|LOCUS_09930 95510 94029 gene locus_tag LOCUS_09940 gene glpK1 95510 94029 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_09940 95608 97137 gene locus_tag LOCUS_09950 gene glpD 95608 97137 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207451.1 protein_id gnl|my_center|LOCUS_09950 97875 97096 gene locus_tag LOCUS_09960 97875 97096 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333392.1 protein_id gnl|my_center|LOCUS_09960 99067 97892 gene locus_tag LOCUS_09970 99067 97892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 99705 99064 gene locus_tag LOCUS_09980 99705 99064 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476350.1 protein_id gnl|my_center|LOCUS_09980 100819 99698 gene locus_tag LOCUS_09990 100819 99698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 102356 100923 gene locus_tag LOCUS_10000 102356 100923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 103846 102422 gene locus_tag LOCUS_10010 103846 102422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114368.1 protein_id gnl|my_center|LOCUS_10010 104449 105381 gene locus_tag LOCUS_10020 104449 105381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 107868 105397 gene locus_tag LOCUS_10030 107868 105397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 108262 109533 gene locus_tag LOCUS_10040 108262 109533 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946287.1 protein_id gnl|my_center|LOCUS_10040 109538 110833 gene locus_tag LOCUS_10050 109538 110833 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947844.1 protein_id gnl|my_center|LOCUS_10050 110833 111345 gene locus_tag LOCUS_10060 110833 111345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 111357 112781 gene locus_tag LOCUS_10070 111357 112781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 112829 113737 gene locus_tag LOCUS_10080 112829 113737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 114221 113874 gene locus_tag LOCUS_10090 114221 113874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 114407 114784 gene locus_tag LOCUS_10100 114407 114784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 114979 116100 gene locus_tag LOCUS_10110 114979 116100 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_10110 116102 116617 gene locus_tag LOCUS_10120 116102 116617 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389062.1 protein_id gnl|my_center|LOCUS_10120 116789 117550 gene locus_tag LOCUS_10130 116789 117550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 119234 117681 gene locus_tag LOCUS_10140 gene yhcX 119234 117681 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_10140 122678 119571 gene locus_tag LOCUS_10150 122678 119571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 124205 122706 gene locus_tag LOCUS_10160 124205 122706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 124597 124343 gene locus_tag LOCUS_10170 124597 124343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 124682 125335 gene locus_tag LOCUS_10180 124682 125335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 125332 126483 gene locus_tag LOCUS_10190 125332 126483 CDS product 8-amino-7-ketopelargonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MKM2 protein_id gnl|my_center|LOCUS_10190 126868 126452 gene locus_tag LOCUS_10200 126868 126452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 128787 127027 gene locus_tag LOCUS_10210 128787 127027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141384.1 protein_id gnl|my_center|LOCUS_10210 130366 128996 gene locus_tag LOCUS_10220 130366 128996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 130819 130586 gene locus_tag LOCUS_10230 130819 130586 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521369.1 protein_id gnl|my_center|LOCUS_10230 131381 130830 gene locus_tag LOCUS_10240 131381 130830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 131645 131827 gene locus_tag LOCUS_10250 131645 131827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 132016 133173 gene locus_tag LOCUS_10260 132016 133173 CDS product XyeB family radical SAM/SPASM peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816128.1 protein_id gnl|my_center|LOCUS_10260 133191 134081 gene locus_tag LOCUS_10270 133191 134081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 134676 134083 gene locus_tag LOCUS_10280 134676 134083 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_10280 135728 134742 gene locus_tag LOCUS_10290 135728 134742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_10290 137180 135753 gene locus_tag LOCUS_10300 137180 135753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_10300 139048 137177 gene locus_tag LOCUS_10310 139048 137177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 139143 142475 gene locus_tag LOCUS_10320 139143 142475 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105234.1 protein_id gnl|my_center|LOCUS_10320 142616 143158 gene locus_tag LOCUS_10330 142616 143158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106026.1 protein_id gnl|my_center|LOCUS_10330 143151 144038 gene locus_tag LOCUS_10340 143151 144038 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068063.1 protein_id gnl|my_center|LOCUS_10340 <150672 144391 gene locus_tag LOCUS_10350 <150672 144391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533173.1:adhesin >Feature sequence07 903 163 gene locus_tag LOCUS_10360 903 163 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE6 protein_id gnl|my_center|LOCUS_10360 1840 827 gene locus_tag LOCUS_10370 gene rluD 1840 827 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU17 protein_id gnl|my_center|LOCUS_10370 3540 2095 gene locus_tag LOCUS_10380 3540 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3908 4675 gene locus_tag LOCUS_10390 3908 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 4707 6413 gene locus_tag LOCUS_10400 gene proS 4707 6413 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I502 protein_id gnl|my_center|LOCUS_10400 7063 6548 gene locus_tag LOCUS_10410 7063 6548 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176628.1 protein_id gnl|my_center|LOCUS_10410 7456 7184 gene locus_tag LOCUS_10420 gene acyP 7456 7184 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AB0 protein_id gnl|my_center|LOCUS_10420 7569 7928 gene locus_tag LOCUS_10430 gene yfgD 7569 7928 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL01 protein_id gnl|my_center|LOCUS_10430 8229 8828 gene locus_tag LOCUS_10440 8229 8828 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958310.1 protein_id gnl|my_center|LOCUS_10440 8967 9263 gene locus_tag LOCUS_10450 8967 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 9445 9765 gene locus_tag LOCUS_10460 9445 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 9950 9762 gene locus_tag LOCUS_10470 9950 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 9949 10386 gene locus_tag LOCUS_10480 9949 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 10442 10849 gene locus_tag LOCUS_10490 10442 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 11034 11465 gene locus_tag LOCUS_10500 11034 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 11717 12223 gene locus_tag LOCUS_10510 11717 12223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 12229 15147 gene locus_tag LOCUS_10520 12229 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 15149 17296 gene locus_tag LOCUS_10530 15149 17296 CDS product GGDEF domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941699.1 protein_id gnl|my_center|LOCUS_10530 17990 17298 gene locus_tag LOCUS_10540 17990 17298 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381589.1 protein_id gnl|my_center|LOCUS_10540 19103 18015 gene locus_tag LOCUS_10550 19103 18015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706622.1 protein_id gnl|my_center|LOCUS_10550 19188 20228 gene locus_tag LOCUS_10560 gene purM 19188 20228 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43848 protein_id gnl|my_center|LOCUS_10560 20206 20919 gene locus_tag LOCUS_10570 gene purN 20206 20919 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AY9 protein_id gnl|my_center|LOCUS_10570 20916 21671 gene locus_tag LOCUS_10580 20916 21671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086061.1 protein_id gnl|my_center|LOCUS_10580 21741 22007 gene locus_tag LOCUS_10590 21741 22007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 22625 22059 gene locus_tag LOCUS_10600 gene dcd 22625 22059 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XN2 protein_id gnl|my_center|LOCUS_10600 23767 22679 gene locus_tag LOCUS_10610 23767 22679 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W88 protein_id gnl|my_center|LOCUS_10610 23865 25937 gene locus_tag LOCUS_10620 gene metG 23865 25937 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRJ9 protein_id gnl|my_center|LOCUS_10620 25944 26597 gene locus_tag LOCUS_10630 25944 26597 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948567.1 protein_id gnl|my_center|LOCUS_10630 26607 27263 gene locus_tag LOCUS_10640 gene nth 26607 27263 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRK1 protein_id gnl|my_center|LOCUS_10640 27256 27684 gene locus_tag LOCUS_10650 27256 27684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543933.1 protein_id gnl|my_center|LOCUS_10650 28059 30914 gene locus_tag LOCUS_10660 28059 30914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 30993 31547 gene locus_tag LOCUS_10670 30993 31547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 32794 31841 gene locus_tag LOCUS_10680 32794 31841 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070524.1 protein_id gnl|my_center|LOCUS_10680 36602 32919 gene locus_tag LOCUS_10690 36602 32919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 37567 36734 gene locus_tag LOCUS_10700 37567 36734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104269.1 protein_id gnl|my_center|LOCUS_10700 37668 38702 gene locus_tag LOCUS_10710 gene pyrC 37668 38702 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B17 protein_id gnl|my_center|LOCUS_10710 38699 39298 gene locus_tag LOCUS_10720 gene rnt 38699 39298 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B16 protein_id gnl|my_center|LOCUS_10720 40196 39591 gene locus_tag LOCUS_10730 gene tsaA 40196 39591 CDS product alkyl hydroperoxide reductase subunit AhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072695.1 protein_id gnl|my_center|LOCUS_10730 40623 40273 gene locus_tag LOCUS_10740 gene grxD 40623 40273 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED84 protein_id gnl|my_center|LOCUS_10740 40810 41391 gene locus_tag LOCUS_10750 gene sodB 40810 41391 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87X27 protein_id gnl|my_center|LOCUS_10750 41522 42685 gene locus_tag LOCUS_10760 gene argD 41522 42685 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRB4 protein_id gnl|my_center|LOCUS_10760 42965 46414 gene locus_tag LOCUS_10770 42965 46414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 47623 46460 gene locus_tag LOCUS_10780 47623 46460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 49701 47785 gene locus_tag LOCUS_10790 49701 47785 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_10790 50609 49896 gene locus_tag LOCUS_10800 50609 49896 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022855.1 protein_id gnl|my_center|LOCUS_10800 52960 50630 gene locus_tag LOCUS_10810 gene metE 52960 50630 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57703 protein_id gnl|my_center|LOCUS_10810 53566 54129 gene locus_tag LOCUS_10820 53566 54129 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227517.1 protein_id gnl|my_center|LOCUS_10820 54454 57309 gene locus_tag LOCUS_10830 gene nrdA 54454 57309 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL9 protein_id gnl|my_center|LOCUS_10830 57355 58458 gene locus_tag LOCUS_10840 gene nrdB 57355 58458 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUL8 protein_id gnl|my_center|LOCUS_10840 58566 59180 gene locus_tag LOCUS_10850 58566 59180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948424.1 protein_id gnl|my_center|LOCUS_10850 59286 60827 gene locus_tag LOCUS_10860 59286 60827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_820157.2 protein_id gnl|my_center|LOCUS_10860 60830 62236 gene locus_tag LOCUS_10870 60830 62236 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649908.1 protein_id gnl|my_center|LOCUS_10870 62233 62952 gene locus_tag LOCUS_10880 62233 62952 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590223.1 protein_id gnl|my_center|LOCUS_10880 63201 62998 gene locus_tag LOCUS_10890 63201 62998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 63481 63329 gene locus_tag LOCUS_10900 63481 63329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 63661 63978 gene locus_tag LOCUS_10910 63661 63978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 65220 64054 gene locus_tag LOCUS_10920 65220 64054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754218.1 protein_id gnl|my_center|LOCUS_10920 65404 70353 gene locus_tag LOCUS_10930 65404 70353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 71823 70429 gene locus_tag LOCUS_10940 71823 70429 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_10940 73179 71914 gene locus_tag LOCUS_10950 73179 71914 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958306.1 protein_id gnl|my_center|LOCUS_10950 73451 75193 gene locus_tag LOCUS_10960 73451 75193 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945882.1 protein_id gnl|my_center|LOCUS_10960 75196 76506 gene locus_tag LOCUS_10970 75196 76506 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945883.1 protein_id gnl|my_center|LOCUS_10970 76506 78269 gene locus_tag LOCUS_10980 76506 78269 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039154.1 protein_id gnl|my_center|LOCUS_10980 78918 81245 gene locus_tag LOCUS_10990 78918 81245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 82179 81250 gene locus_tag LOCUS_11000 82179 81250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 82392 82189 gene locus_tag LOCUS_11010 82392 82189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 86960 82398 gene locus_tag LOCUS_11020 86960 82398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 88281 87271 gene locus_tag LOCUS_11030 gene rpoS 88281 87271 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51804 protein_id gnl|my_center|LOCUS_11030 88775 88311 gene locus_tag LOCUS_11040 88775 88311 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037789.1 protein_id gnl|my_center|LOCUS_11040 89025 91736 gene locus_tag LOCUS_11050 89025 91736 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNJ0 protein_id gnl|my_center|LOCUS_11050 91859 93250 gene locus_tag LOCUS_11060 gene fumC 91859 93250 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAI9 protein_id gnl|my_center|LOCUS_11060 94369 93317 gene locus_tag LOCUS_11070 gene pleD 94369 93317 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377275.1 protein_id gnl|my_center|LOCUS_11070 94579 95475 gene locus_tag LOCUS_11080 94579 95475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 95533 96888 gene locus_tag LOCUS_11090 95533 96888 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_11090 96890 98281 gene locus_tag LOCUS_11100 96890 98281 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_11100 98278 99426 gene locus_tag LOCUS_11110 98278 99426 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_11110 100710 99406 gene locus_tag LOCUS_11120 100710 99406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 101426 101983 gene locus_tag LOCUS_11130 101426 101983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11130 102892 101969 gene locus_tag LOCUS_11140 102892 101969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_11140 103655 102876 gene locus_tag LOCUS_11150 103655 102876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886998.1 protein_id gnl|my_center|LOCUS_11150 104965 104555 gene locus_tag LOCUS_11160 104965 104555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 105365 104979 gene locus_tag LOCUS_11170 105365 104979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 105743 105667 gene locus_tag LOCUS_t00150 105743 105667 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 106122 105799 gene locus_tag LOCUS_11180 gene ihfA 106122 105799 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMM4 protein_id gnl|my_center|LOCUS_11180 108543 106126 gene locus_tag LOCUS_11190 gene pheT 108543 106126 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUG2 protein_id gnl|my_center|LOCUS_11190 109568 108546 gene locus_tag LOCUS_11200 gene pheS 109568 108546 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0A3 protein_id gnl|my_center|LOCUS_11200 109994 109638 gene locus_tag LOCUS_11210 gene rplT 109994 109638 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER6 protein_id gnl|my_center|LOCUS_11210 110223 110008 gene locus_tag LOCUS_11220 gene rpmI 110223 110008 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZDW7 protein_id gnl|my_center|LOCUS_11220 110654 110235 gene locus_tag LOCUS_11230 gene infC 110654 110235 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ61 protein_id gnl|my_center|LOCUS_11230 112729 110822 gene locus_tag LOCUS_11240 gene thrS 112729 110822 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS05 protein_id gnl|my_center|LOCUS_11240 112993 113823 gene locus_tag LOCUS_11250 112993 113823 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_11250 113916 114332 gene locus_tag LOCUS_11260 113916 114332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 114858 115148 gene locus_tag LOCUS_11270 114858 115148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 116443 115145 gene locus_tag LOCUS_11280 116443 115145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 117189 116629 gene locus_tag LOCUS_11290 117189 116629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 117386 117631 gene locus_tag LOCUS_11300 117386 117631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 117952 118875 gene locus_tag LOCUS_11310 117952 118875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 120363 118960 gene locus_tag LOCUS_11320 gene nhaA 120363 118960 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTY3 protein_id gnl|my_center|LOCUS_11320 121021 120635 gene locus_tag LOCUS_11330 121021 120635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 123187 121076 gene locus_tag LOCUS_11340 123187 121076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 123495 123328 gene locus_tag LOCUS_11350 123495 123328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 124210 124437 gene locus_tag LOCUS_11360 124210 124437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 124468 125358 gene locus_tag LOCUS_11370 124468 125358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 127186 125495 gene locus_tag LOCUS_11380 127186 125495 CDS product GGDEF domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070885.1 protein_id gnl|my_center|LOCUS_11380 127708 127250 gene locus_tag LOCUS_11390 gene rcp1 127708 127250 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_11390 129410 127674 gene locus_tag LOCUS_11400 129410 127674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 129997 130824 gene locus_tag LOCUS_11410 129997 130824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 133855 130862 gene locus_tag LOCUS_11420 133855 130862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 134545 134946 gene locus_tag LOCUS_11430 134545 134946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 135654 135142 gene locus_tag LOCUS_11440 135654 135142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 136373 135813 gene locus_tag LOCUS_11450 136373 135813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022440.1 protein_id gnl|my_center|LOCUS_11450 136852 136992 gene locus_tag LOCUS_11460 136852 136992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 137270 137761 gene locus_tag LOCUS_11470 137270 137761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11470 141169 138161 gene locus_tag LOCUS_11480 141169 138161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence08 255 521 gene locus_tag LOCUS_11490 255 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1319 483 gene locus_tag LOCUS_11500 1319 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1744 1929 gene locus_tag LOCUS_11510 1744 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2239 1937 gene locus_tag LOCUS_11520 2239 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2208 2744 gene locus_tag LOCUS_11530 2208 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4006 2900 gene locus_tag LOCUS_11540 gene fic 4006 2900 CDS product adenosine monophosphate-protein transferase SoFic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9K5 protein_id gnl|my_center|LOCUS_11540 4381 5037 gene locus_tag LOCUS_11550 4381 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 5203 5763 gene locus_tag LOCUS_11560 5203 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 6685 6500 gene locus_tag LOCUS_11570 6685 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 7303 7037 gene locus_tag LOCUS_11580 7303 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 7613 7335 gene locus_tag LOCUS_11590 7613 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 8004 8399 gene locus_tag LOCUS_11600 8004 8399 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933794.1 protein_id gnl|my_center|LOCUS_11600 9490 8516 gene locus_tag LOCUS_11610 gene pip 9490 8516 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLP4 protein_id gnl|my_center|LOCUS_11610 10922 9942 gene locus_tag LOCUS_11620 10922 9942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 13474 11141 gene locus_tag LOCUS_11630 13474 11141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 13971 15578 gene locus_tag LOCUS_11640 13971 15578 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_11640 16518 15754 gene locus_tag LOCUS_11650 16518 15754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 17163 16735 gene locus_tag LOCUS_11660 17163 16735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 17895 18575 gene locus_tag LOCUS_11670 17895 18575 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 protein_id gnl|my_center|LOCUS_11670 19506 21797 gene locus_tag LOCUS_11680 19506 21797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 23058 21868 gene locus_tag LOCUS_11690 23058 21868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 23727 23191 gene locus_tag LOCUS_11700 23727 23191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 23946 24191 gene locus_tag LOCUS_11710 23946 24191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 25153 25413 gene locus_tag LOCUS_11720 25153 25413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 25870 26895 gene locus_tag LOCUS_11730 25870 26895 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071843.1 protein_id gnl|my_center|LOCUS_11730 27198 27692 gene locus_tag LOCUS_11740 27198 27692 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263295.1 protein_id gnl|my_center|LOCUS_11740 28092 27736 gene locus_tag LOCUS_11750 28092 27736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 29581 28145 gene locus_tag LOCUS_11760 gene phrB 29581 28145 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958052.1 protein_id gnl|my_center|LOCUS_11760 29679 30626 gene locus_tag LOCUS_11770 29679 30626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_11770 30959 31972 gene locus_tag LOCUS_11780 30959 31972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 32225 32506 gene locus_tag LOCUS_11790 32225 32506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 32663 33754 gene locus_tag LOCUS_11800 32663 33754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_11800 34163 33765 gene locus_tag LOCUS_11810 34163 33765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 34908 34177 gene locus_tag LOCUS_11820 34908 34177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 36212 35064 gene locus_tag LOCUS_11830 36212 35064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 36420 37529 gene locus_tag LOCUS_11840 36420 37529 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND11 protein_id gnl|my_center|LOCUS_11840 37678 38427 gene locus_tag LOCUS_11850 37678 38427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 39114 38503 gene locus_tag LOCUS_11860 39114 38503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 40663 39356 gene locus_tag LOCUS_11870 40663 39356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 42023 40902 gene locus_tag LOCUS_11880 42023 40902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 42117 42557 gene locus_tag LOCUS_11890 42117 42557 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_11890 43259 42663 gene locus_tag LOCUS_11900 43259 42663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 44982 43327 gene locus_tag LOCUS_11910 44982 43327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 45806 45027 gene locus_tag LOCUS_11920 gene cysZ 45806 45027 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NPU9 protein_id gnl|my_center|LOCUS_11920 45963 47240 gene locus_tag LOCUS_11930 45963 47240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 48068 47469 gene locus_tag LOCUS_11940 48068 47469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 48452 48745 gene locus_tag LOCUS_11950 48452 48745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 51123 48808 gene locus_tag LOCUS_11960 51123 48808 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266280.1 protein_id gnl|my_center|LOCUS_11960 51786 51289 gene locus_tag LOCUS_11970 51786 51289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 52032 53030 gene locus_tag LOCUS_11980 52032 53030 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709218.1 protein_id gnl|my_center|LOCUS_11980 54913 53003 gene locus_tag LOCUS_11990 54913 53003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_11990 55330 57432 gene locus_tag LOCUS_12000 55330 57432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 58021 57419 gene locus_tag LOCUS_12010 58021 57419 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772856.1 protein_id gnl|my_center|LOCUS_12010 59021 58209 gene locus_tag LOCUS_12020 gene uppP 59021 58209 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUJ4 protein_id gnl|my_center|LOCUS_12020 59568 59056 gene locus_tag LOCUS_12030 59568 59056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 59872 60843 gene locus_tag LOCUS_12040 59872 60843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 60882 61124 gene locus_tag LOCUS_12050 60882 61124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 61179 61370 gene locus_tag LOCUS_12060 61179 61370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 61553 61798 gene locus_tag LOCUS_12070 gene rpmE 61553 61798 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F513 protein_id gnl|my_center|LOCUS_12070 61837 63147 gene locus_tag LOCUS_12080 61837 63147 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266374.1 protein_id gnl|my_center|LOCUS_12080 63175 64131 gene locus_tag LOCUS_12090 gene mdh 63175 64131 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHC8 protein_id gnl|my_center|LOCUS_12090 66641 64197 gene locus_tag LOCUS_12100 gene ponA 66641 64197 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_12100 66928 67992 gene locus_tag LOCUS_12110 gene pilM 66928 67992 CDS product type 4 fimbrial biogenesis protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110888.1 protein_id gnl|my_center|LOCUS_12110 67989 68561 gene locus_tag LOCUS_12120 gene pilN 67989 68561 CDS product pilus assembly protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_12120 68551 69183 gene locus_tag LOCUS_12130 gene pilO 68551 69183 CDS product type 4 fimbrial biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_12130 69176 69706 gene locus_tag LOCUS_12140 69176 69706 CDS product pilus biosynthesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706967.1 protein_id gnl|my_center|LOCUS_12140 69723 71852 gene locus_tag LOCUS_12150 gene pilQ 69723 71852 CDS product pilus assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946666.1 protein_id gnl|my_center|LOCUS_12150 72045 72581 gene locus_tag LOCUS_12160 gene aroK 72045 72581 CDS product shikimate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJF7 protein_id gnl|my_center|LOCUS_12160 72594 73700 gene locus_tag LOCUS_12170 gene aroB 72594 73700 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32AK1 protein_id gnl|my_center|LOCUS_12170 73718 75154 gene locus_tag LOCUS_12180 73718 75154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 75359 76453 gene locus_tag LOCUS_12190 gene hemE 75359 76453 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZD8 protein_id gnl|my_center|LOCUS_12190 76467 76964 gene locus_tag LOCUS_12200 gene coaD 76467 76964 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6D1 protein_id gnl|my_center|LOCUS_12200 76995 78692 gene locus_tag LOCUS_12210 76995 78692 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946295.1 protein_id gnl|my_center|LOCUS_12210 80086 78743 gene locus_tag LOCUS_12220 80086 78743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 80410 80252 gene locus_tag LOCUS_12230 80410 80252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 80646 80425 gene locus_tag LOCUS_12240 gene rpmB 80646 80425 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWY1 protein_id gnl|my_center|LOCUS_12240 80841 82079 gene locus_tag LOCUS_12250 gene coaBC 80841 82079 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_12250 82057 82515 gene locus_tag LOCUS_12260 gene dut 82057 82515 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZJP5 protein_id gnl|my_center|LOCUS_12260 82556 83986 gene locus_tag LOCUS_12270 gene algC 82556 83986 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26276 protein_id gnl|my_center|LOCUS_12270 84002 84703 gene locus_tag LOCUS_12280 gene deoC 84002 84703 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FC3 protein_id gnl|my_center|LOCUS_12280 85371 84715 gene locus_tag LOCUS_12290 85371 84715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 86044 85394 gene locus_tag LOCUS_12300 gene pyrE 86044 85394 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BD7 protein_id gnl|my_center|LOCUS_12300 86150 86926 gene locus_tag LOCUS_12310 gene xth 86150 86926 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_12310 87795 87079 gene locus_tag LOCUS_12320 gene rph 87795 87079 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L4 protein_id gnl|my_center|LOCUS_12320 88124 88993 gene locus_tag LOCUS_12330 88124 88993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208998.1 protein_id gnl|my_center|LOCUS_12330 88997 89608 gene locus_tag LOCUS_12340 gene gmk 88997 89608 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTZ8 protein_id gnl|my_center|LOCUS_12340 89626 89841 gene locus_tag LOCUS_12350 89626 89841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 89844 91967 gene locus_tag LOCUS_12360 gene spoT 89844 91967 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769571.1 protein_id gnl|my_center|LOCUS_12360 91971 94082 gene locus_tag LOCUS_12370 gene recG 91971 94082 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTX5 protein_id gnl|my_center|LOCUS_12370 94120 95040 gene locus_tag LOCUS_12380 94120 95040 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J04 protein_id gnl|my_center|LOCUS_12380 95056 96261 gene locus_tag LOCUS_12390 gene rocD 95056 96261 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89RB7 protein_id gnl|my_center|LOCUS_12390 96282 97208 gene locus_tag LOCUS_12400 gene yetK 96282 97208 CDS product putative transporter YetK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31540 protein_id gnl|my_center|LOCUS_12400 97208 98095 gene locus_tag LOCUS_12410 gene ubiA 97208 98095 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRU3 protein_id gnl|my_center|LOCUS_12410 99052 98063 gene locus_tag LOCUS_12420 gene znuA 99052 98063 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816521.1 protein_id gnl|my_center|LOCUS_12420 99145 99909 gene locus_tag LOCUS_12430 gene znuC 99145 99909 CDS product zinc import ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UN0 protein_id gnl|my_center|LOCUS_12430 99902 100708 gene locus_tag LOCUS_12440 gene znuB 99902 100708 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969555.1 protein_id gnl|my_center|LOCUS_12440 100802 102211 gene locus_tag LOCUS_12450 100802 102211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 102514 103392 gene locus_tag LOCUS_12460 102514 103392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 103431 104042 gene locus_tag LOCUS_12470 103431 104042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 104257 105021 gene locus_tag LOCUS_12480 104257 105021 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 protein_id gnl|my_center|LOCUS_12480 105745 105080 gene locus_tag LOCUS_12490 105745 105080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 105868 106068 gene locus_tag LOCUS_12500 105868 106068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 106078 107052 gene locus_tag LOCUS_12510 106078 107052 CDS product ATP-grasp ribosomal peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028637.1 protein_id gnl|my_center|LOCUS_12510 107139 108077 gene locus_tag LOCUS_12520 107139 108077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 108610 108074 gene locus_tag LOCUS_12530 gene def 108610 108074 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5G7 protein_id gnl|my_center|LOCUS_12530 108967 109359 gene locus_tag LOCUS_12540 108967 109359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 109987 109424 gene locus_tag LOCUS_12550 109987 109424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 110741 110100 gene locus_tag LOCUS_12560 gene senC 110741 110100 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074211.1 protein_id gnl|my_center|LOCUS_12560 111646 110747 gene locus_tag LOCUS_12570 gene cyoE 111646 110747 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG0 protein_id gnl|my_center|LOCUS_12570 112665 111649 gene locus_tag LOCUS_12580 gene ctaA 112665 111649 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_12580 113295 112681 gene locus_tag LOCUS_12590 113295 112681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 114044 113292 gene locus_tag LOCUS_12600 114044 113292 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87IR5 protein_id gnl|my_center|LOCUS_12600 115155 114274 gene locus_tag LOCUS_12610 115155 114274 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948580.1 protein_id gnl|my_center|LOCUS_12610 115690 115142 gene locus_tag LOCUS_12620 gene ctaG 115690 115142 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_12620 117307 115712 gene locus_tag LOCUS_12630 gene coxA 117307 115712 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I726 protein_id gnl|my_center|LOCUS_12630 118524 117385 gene locus_tag LOCUS_12640 gene coxB 118524 117385 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I727 protein_id gnl|my_center|LOCUS_12640 120286 118829 gene locus_tag LOCUS_12650 120286 118829 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403891.1 protein_id gnl|my_center|LOCUS_12650 121120 120302 gene locus_tag LOCUS_12660 gene apaH 121120 120302 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U7 protein_id gnl|my_center|LOCUS_12660 121554 121174 gene locus_tag LOCUS_12670 gene apaG 121554 121174 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62674 protein_id gnl|my_center|LOCUS_12670 121923 122435 gene locus_tag LOCUS_12680 121923 122435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 122478 122831 gene locus_tag LOCUS_12690 gene dgkA 122478 122831 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRU1 protein_id gnl|my_center|LOCUS_12690 123610 122834 gene locus_tag LOCUS_12700 gene rsmA 123610 122834 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E865 protein_id gnl|my_center|LOCUS_12700 124598 123618 gene locus_tag LOCUS_12710 gene pdxA 124598 123618 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS1 protein_id gnl|my_center|LOCUS_12710 125903 124623 gene locus_tag LOCUS_12720 gene surA 125903 124623 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5U3 protein_id gnl|my_center|LOCUS_12720 128542 126062 gene locus_tag LOCUS_12730 gene lptD 128542 126062 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYR4 protein_id gnl|my_center|LOCUS_12730 128735 129766 gene locus_tag LOCUS_12740 128735 129766 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958577.1 protein_id gnl|my_center|LOCUS_12740 129769 130461 gene locus_tag LOCUS_12750 129769 130461 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269129.1 protein_id gnl|my_center|LOCUS_12750 130516 131262 gene locus_tag LOCUS_12760 gene djlA 130516 131262 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45885 protein_id gnl|my_center|LOCUS_12760 131671 131255 gene locus_tag LOCUS_12770 131671 131255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 132382 131801 gene locus_tag LOCUS_12780 132382 131801 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227517.1 protein_id gnl|my_center|LOCUS_12780 132613 133176 gene locus_tag LOCUS_12790 132613 133176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence09 229 2793 gene locus_tag LOCUS_12800 gene clpB 229 2793 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUP3 protein_id gnl|my_center|LOCUS_12800 3124 2813 gene locus_tag LOCUS_12810 3124 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 3294 4121 gene locus_tag LOCUS_12820 3294 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040174.1 protein_id gnl|my_center|LOCUS_12820 4322 4615 gene locus_tag LOCUS_12830 4322 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4991 7510 gene locus_tag LOCUS_12840 4991 7510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 8274 7516 gene locus_tag LOCUS_12850 gene lpxH 8274 7516 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EFY6 protein_id gnl|my_center|LOCUS_12850 8761 8261 gene locus_tag LOCUS_12860 gene ppiB 8761 8261 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG23 protein_id gnl|my_center|LOCUS_12860 8924 10318 gene locus_tag LOCUS_12870 gene cysS 8924 10318 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U7 protein_id gnl|my_center|LOCUS_12870 10324 10761 gene locus_tag LOCUS_12880 gene dtd 10324 10761 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6M6 protein_id gnl|my_center|LOCUS_12880 12747 11074 gene locus_tag LOCUS_12890 gene glnS 12747 11074 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVP0 protein_id gnl|my_center|LOCUS_12890 13190 13816 gene locus_tag LOCUS_12900 13190 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 14309 13851 gene locus_tag LOCUS_12910 14309 13851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 14598 14290 gene locus_tag LOCUS_12920 14598 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 14758 15573 gene locus_tag LOCUS_12930 gene pssA 14758 15573 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_12930 15605 17119 gene locus_tag LOCUS_12940 gene leuA 15605 17119 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 protein_id gnl|my_center|LOCUS_12940 17411 19126 gene locus_tag LOCUS_12950 17411 19126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 19265 20149 gene locus_tag LOCUS_12960 19265 20149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 20182 21156 gene locus_tag LOCUS_12970 gene hutG 20182 21156 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXM2 protein_id gnl|my_center|LOCUS_12970 21153 22394 gene locus_tag LOCUS_12980 gene hutI 21153 22394 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU91 protein_id gnl|my_center|LOCUS_12980 22378 24057 gene locus_tag LOCUS_12990 gene hutU 22378 24057 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSQ3 protein_id gnl|my_center|LOCUS_12990 24071 25600 gene locus_tag LOCUS_13000 gene hutH 24071 25600 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVR0 protein_id gnl|my_center|LOCUS_13000 25615 25890 gene locus_tag LOCUS_13010 25615 25890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 26162 25974 gene locus_tag LOCUS_13020 26162 25974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 26594 26343 gene locus_tag LOCUS_13030 26594 26343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 26928 26716 gene locus_tag LOCUS_13040 26928 26716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 27348 27956 gene locus_tag LOCUS_13050 gene nfuA 27348 27956 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_13050 27976 28161 gene locus_tag LOCUS_13060 27976 28161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 28274 30805 gene locus_tag LOCUS_13070 28274 30805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 31197 30808 gene locus_tag LOCUS_13080 31197 30808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 31308 34829 gene locus_tag LOCUS_13090 gene smc 31308 34829 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVF8 protein_id gnl|my_center|LOCUS_13090 34874 35581 gene locus_tag LOCUS_13100 34874 35581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 35735 37771 gene locus_tag LOCUS_13110 gene ligA 35735 37771 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DZ6 protein_id gnl|my_center|LOCUS_13110 37773 38207 gene locus_tag LOCUS_13120 37773 38207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 38740 38213 gene locus_tag LOCUS_13130 38740 38213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 39030 41156 gene locus_tag LOCUS_13140 39030 41156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 42695 41214 gene locus_tag LOCUS_13150 42695 41214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 45863 42744 gene locus_tag LOCUS_13160 45863 42744 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_13160 46827 45874 gene locus_tag LOCUS_13170 46827 45874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 46718 46936 gene locus_tag LOCUS_13180 46718 46936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 47023 47616 gene locus_tag LOCUS_13190 47023 47616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 47753 48688 gene locus_tag LOCUS_13200 gene prmB 47753 48688 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MM8 protein_id gnl|my_center|LOCUS_13200 48692 49786 gene locus_tag LOCUS_13210 gene aroC 48692 49786 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43875 protein_id gnl|my_center|LOCUS_13210 49816 50013 gene locus_tag LOCUS_13220 49816 50013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 50013 51494 gene locus_tag LOCUS_13230 gene leuC 50013 51494 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA3 protein_id gnl|my_center|LOCUS_13230 51494 52141 gene locus_tag LOCUS_13240 gene leuD 51494 52141 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F8T3 protein_id gnl|my_center|LOCUS_13240 52150 53241 gene locus_tag LOCUS_13250 gene leuB 52150 53241 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51375 protein_id gnl|my_center|LOCUS_13250 53238 54260 gene locus_tag LOCUS_13260 gene asd 53238 54260 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT63 protein_id gnl|my_center|LOCUS_13260 54314 56671 gene locus_tag LOCUS_13270 gene fimV 54314 56671 CDS product motility protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_13270 57175 58923 gene locus_tag LOCUS_13280 57175 58923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 59153 59863 gene locus_tag LOCUS_13290 gene truA 59153 59863 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4AAX9 protein_id gnl|my_center|LOCUS_13290 59847 60914 gene locus_tag LOCUS_13300 59847 60914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 61000 61938 gene locus_tag LOCUS_13310 gene accD 61000 61938 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTA3 protein_id gnl|my_center|LOCUS_13310 61967 63220 gene locus_tag LOCUS_13320 gene folC 61967 63220 CDS product diaminohydroxyphosphoribosylaminopyrimidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957872.1 protein_id gnl|my_center|LOCUS_13320 63241 63981 gene locus_tag LOCUS_13330 63241 63981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 63990 64592 gene locus_tag LOCUS_13340 63990 64592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 64617 66134 gene locus_tag LOCUS_13350 gene purF 64617 66134 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_13350 66197 69064 gene locus_tag LOCUS_13360 66197 69064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 69924 69073 gene locus_tag LOCUS_13370 gene folD 69924 69073 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJY7 protein_id gnl|my_center|LOCUS_13370 70257 70333 gene locus_tag LOCUS_t00160 70257 70333 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 70397 70473 gene locus_tag LOCUS_t00170 70397 70473 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 70478 70553 gene locus_tag LOCUS_t00180 70478 70553 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 70745 70829 gene locus_tag LOCUS_t00190 70745 70829 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 70931 72223 gene locus_tag LOCUS_13380 gene tig 70931 72223 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44837 protein_id gnl|my_center|LOCUS_13380 72255 72896 gene locus_tag LOCUS_13390 gene clpP 72255 72896 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM7 protein_id gnl|my_center|LOCUS_13390 73010 74299 gene locus_tag LOCUS_13400 gene clpX 73010 74299 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2U0 protein_id gnl|my_center|LOCUS_13400 74465 76903 gene locus_tag LOCUS_13410 gene lon 74465 76903 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z8V0 protein_id gnl|my_center|LOCUS_13410 77114 77464 gene locus_tag LOCUS_13420 gene hupB 77114 77464 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05384 protein_id gnl|my_center|LOCUS_13420 77679 77754 gene locus_tag LOCUS_t00200 77679 77754 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 77761 77837 gene locus_tag LOCUS_t00210 77761 77837 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 77933 79843 gene locus_tag LOCUS_13430 gene ppiD 77933 79843 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG15 protein_id gnl|my_center|LOCUS_13430 79988 81004 gene locus_tag LOCUS_13440 79988 81004 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 protein_id gnl|my_center|LOCUS_13440 81033 84053 gene locus_tag LOCUS_13450 81033 84053 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 protein_id gnl|my_center|LOCUS_13450 84168 84656 gene locus_tag LOCUS_13460 84168 84656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 84814 85872 gene locus_tag LOCUS_13470 84814 85872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 86972 86043 gene locus_tag LOCUS_13480 86972 86043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 87661 86957 gene locus_tag LOCUS_13490 87661 86957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 88216 88608 gene locus_tag LOCUS_13500 88216 88608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 89233 88625 gene locus_tag LOCUS_13510 89233 88625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 90195 89494 gene locus_tag LOCUS_13520 90195 89494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 91032 90250 gene locus_tag LOCUS_13530 91032 90250 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVM0 protein_id gnl|my_center|LOCUS_13530 91218 93443 gene locus_tag LOCUS_13540 gene hbpA 91218 93443 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946694.1 protein_id gnl|my_center|LOCUS_13540 93449 94426 gene locus_tag LOCUS_13550 gene oppB 93449 94426 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_13550 94436 95836 gene locus_tag LOCUS_13560 gene oppC 94436 95836 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958494.1 protein_id gnl|my_center|LOCUS_13560 95833 97908 gene locus_tag LOCUS_13570 gene dppF 95833 97908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946429.1 protein_id gnl|my_center|LOCUS_13570 97954 98715 gene locus_tag LOCUS_13580 97954 98715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 98748 99185 gene locus_tag LOCUS_13590 98748 99185 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948553.1 protein_id gnl|my_center|LOCUS_13590 100285 99233 gene locus_tag LOCUS_13600 100285 99233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 101702 100932 gene locus_tag LOCUS_13610 gene ugpQ 101702 100932 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947983.1 protein_id gnl|my_center|LOCUS_13610 101643 101840 gene locus_tag LOCUS_13620 101643 101840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 101983 104646 gene locus_tag LOCUS_13630 101983 104646 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947978.1 protein_id gnl|my_center|LOCUS_13630 104648 107992 gene locus_tag LOCUS_13640 104648 107992 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_13640 108006 108905 gene locus_tag LOCUS_13650 108006 108905 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_13650 109755 109156 gene locus_tag LOCUS_13660 109755 109156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 109937 111364 gene locus_tag LOCUS_13670 109937 111364 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_13670 111509 112903 gene locus_tag LOCUS_13680 111509 112903 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37034 protein_id gnl|my_center|LOCUS_13680 112999 113886 gene locus_tag LOCUS_13690 gene prpB 112999 113886 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT8 protein_id gnl|my_center|LOCUS_13690 113876 115009 gene locus_tag LOCUS_13700 113876 115009 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVB0 protein_id gnl|my_center|LOCUS_13700 115177 116598 gene locus_tag LOCUS_13710 gene prpD 115177 116598 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706120.1 protein_id gnl|my_center|LOCUS_13710 116769 117671 gene locus_tag LOCUS_13720 116769 117671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 118494 117673 gene locus_tag LOCUS_13730 118494 117673 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVB2 protein_id gnl|my_center|LOCUS_13730 118568 120946 gene locus_tag LOCUS_13740 gene ppsA 118568 120946 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q883Q8 protein_id gnl|my_center|LOCUS_13740 >Feature sequence10 397 1878 gene locus_tag LOCUS_13750 gene putP 397 1878 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103073.1 protein_id gnl|my_center|LOCUS_13750 1893 5045 gene locus_tag LOCUS_13760 gene putA 1893 5045 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUU6 protein_id gnl|my_center|LOCUS_13760 5363 5049 gene locus_tag LOCUS_13770 5363 5049 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807389.1 protein_id gnl|my_center|LOCUS_13770 5591 6475 gene locus_tag LOCUS_13780 5591 6475 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890699.1 protein_id gnl|my_center|LOCUS_13780 6963 8729 gene locus_tag LOCUS_13790 6963 8729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 8806 10656 gene locus_tag LOCUS_13800 8806 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 12239 10662 gene locus_tag LOCUS_13810 12239 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05979 protein_id gnl|my_center|LOCUS_13810 12477 12860 gene locus_tag LOCUS_13820 12477 12860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 14379 12865 gene locus_tag LOCUS_13830 14379 12865 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948187.1 protein_id gnl|my_center|LOCUS_13830 15465 14467 gene locus_tag LOCUS_13840 15465 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 15660 16829 gene locus_tag LOCUS_13850 15660 16829 CDS product sodium:hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_13850 16938 18293 gene locus_tag LOCUS_13860 gene sda-2 16938 18293 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946527.1 protein_id gnl|my_center|LOCUS_13860 18311 18961 gene locus_tag LOCUS_13870 18311 18961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 19795 19070 gene locus_tag LOCUS_13880 gene mip 19795 19070 CDS product outer membrane protein MIP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXE0 protein_id gnl|my_center|LOCUS_13880 20018 21301 gene locus_tag LOCUS_13890 gene ampG 20018 21301 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167629.1 protein_id gnl|my_center|LOCUS_13890 21693 23606 gene locus_tag LOCUS_13900 21693 23606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 26159 23799 gene locus_tag LOCUS_13910 26159 23799 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637884.2 protein_id gnl|my_center|LOCUS_13910 26241 27314 gene locus_tag LOCUS_13920 26241 27314 CDS product peptidase T4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088424.1 protein_id gnl|my_center|LOCUS_13920 27419 28390 gene locus_tag LOCUS_13930 27419 28390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 28475 29296 gene locus_tag LOCUS_13940 28475 29296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 protein_id gnl|my_center|LOCUS_13940 30374 29502 gene locus_tag LOCUS_13950 30374 29502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 32157 30820 gene locus_tag LOCUS_13960 32157 30820 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921831.1 protein_id gnl|my_center|LOCUS_13960 33278 32517 gene locus_tag LOCUS_13970 33278 32517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 33469 33777 gene locus_tag LOCUS_13980 33469 33777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 34279 35565 gene locus_tag LOCUS_13990 34279 35565 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 protein_id gnl|my_center|LOCUS_13990 35562 36593 gene locus_tag LOCUS_14000 35562 36593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 36619 39762 gene locus_tag LOCUS_14010 36619 39762 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_14010 41577 40024 gene locus_tag LOCUS_14020 41577 40024 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948499.1 protein_id gnl|my_center|LOCUS_14020 42769 41570 gene locus_tag LOCUS_14030 42769 41570 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRR9 protein_id gnl|my_center|LOCUS_14030 44776 42851 gene locus_tag LOCUS_14040 44776 42851 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192719.1 protein_id gnl|my_center|LOCUS_14040 45017 47665 gene locus_tag LOCUS_14050 gene pepN 45017 47665 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104725.1 protein_id gnl|my_center|LOCUS_14050 47691 47915 gene locus_tag LOCUS_14060 47691 47915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 48033 49679 gene locus_tag LOCUS_14070 48033 49679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 49772 50797 gene locus_tag LOCUS_14080 gene hemH 49772 50797 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 protein_id gnl|my_center|LOCUS_14080 50878 52305 gene locus_tag LOCUS_14090 50878 52305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 52318 53337 gene locus_tag LOCUS_14100 52318 53337 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 protein_id gnl|my_center|LOCUS_14100 54281 53403 gene locus_tag LOCUS_14110 54281 53403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 55467 54316 gene locus_tag LOCUS_14120 55467 54316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880602.1 protein_id gnl|my_center|LOCUS_14120 55753 60645 gene locus_tag LOCUS_14130 55753 60645 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947310.1 protein_id gnl|my_center|LOCUS_14130 60635 61654 gene locus_tag LOCUS_14140 gene pyrD 60635 61654 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5B6 protein_id gnl|my_center|LOCUS_14140 61692 62609 gene locus_tag LOCUS_14150 61692 62609 CDS product exported phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553932.1 protein_id gnl|my_center|LOCUS_14150 63099 65663 gene locus_tag LOCUS_14160 63099 65663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 66321 65911 gene locus_tag LOCUS_14170 66321 65911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 67275 66400 gene locus_tag LOCUS_14180 67275 66400 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266403.1 protein_id gnl|my_center|LOCUS_14180 67615 67379 gene locus_tag LOCUS_14190 67615 67379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 67976 69856 gene locus_tag LOCUS_14200 gene korA 67976 69856 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_14200 69858 70868 gene locus_tag LOCUS_14210 gene korB 69858 70868 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946683.1 protein_id gnl|my_center|LOCUS_14210 70956 71222 gene locus_tag LOCUS_14220 70956 71222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 71749 71213 gene locus_tag LOCUS_14230 71749 71213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 73724 71805 gene locus_tag LOCUS_14240 73724 71805 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_14240 74153 74731 gene locus_tag LOCUS_14250 gene trpG 74153 74731 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_14250 74842 75018 gene locus_tag LOCUS_14260 74842 75018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 75655 75026 gene locus_tag LOCUS_14270 gene lexA 75655 75026 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMF4 protein_id gnl|my_center|LOCUS_14270 76220 75915 gene locus_tag LOCUS_14280 76220 75915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 76474 78789 gene locus_tag LOCUS_14290 76474 78789 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_14290 78752 79531 gene locus_tag LOCUS_14300 78752 79531 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_14300 79534 81180 gene locus_tag LOCUS_14310 79534 81180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 81366 83861 gene locus_tag LOCUS_14320 81366 83861 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462399.1 protein_id gnl|my_center|LOCUS_14320 83807 85123 gene locus_tag LOCUS_14330 83807 85123 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947326.1 protein_id gnl|my_center|LOCUS_14330 85138 87174 gene locus_tag LOCUS_14340 gene yfcX 85138 87174 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957672.1 protein_id gnl|my_center|LOCUS_14340 87368 89719 gene locus_tag LOCUS_14350 gene fadB 87368 89719 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037143.1 protein_id gnl|my_center|LOCUS_14350 89737 90936 gene locus_tag LOCUS_14360 89737 90936 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537877.1 protein_id gnl|my_center|LOCUS_14360 91266 92684 gene locus_tag LOCUS_14370 91266 92684 CDS product fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_14370 92870 93523 gene locus_tag LOCUS_14380 92870 93523 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227517.1 protein_id gnl|my_center|LOCUS_14380 94010 93585 gene locus_tag LOCUS_14390 94010 93585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 94100 94594 gene locus_tag LOCUS_14400 94100 94594 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_14400 94601 95641 gene locus_tag LOCUS_14410 gene nagZ 94601 95641 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SA0 protein_id gnl|my_center|LOCUS_14410 95660 96751 gene locus_tag LOCUS_14420 95660 96751 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957990.1 protein_id gnl|my_center|LOCUS_14420 96778 97347 gene locus_tag LOCUS_14430 96778 97347 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957989.1 protein_id gnl|my_center|LOCUS_14430 97340 98065 gene locus_tag LOCUS_14440 97340 98065 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK1 protein_id gnl|my_center|LOCUS_14440 98917 98342 gene locus_tag LOCUS_14450 98917 98342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 100885 99041 gene locus_tag LOCUS_14460 100885 99041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 101875 100895 gene locus_tag LOCUS_14470 101875 100895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 102046 103911 gene locus_tag LOCUS_14480 102046 103911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence11 <1 1665 gene locus_tag LOCUS_14490 <1 1665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402900.1:T9SS C-terminal target domain-containing protein 2862 1858 gene locus_tag LOCUS_14500 2862 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 2993 3685 gene locus_tag LOCUS_14510 2993 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 3814 4302 gene locus_tag LOCUS_14520 3814 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 4532 4798 gene locus_tag LOCUS_14530 4532 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 5265 4810 gene locus_tag LOCUS_14540 5265 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 5492 5295 gene locus_tag LOCUS_14550 5492 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 5947 7140 gene locus_tag LOCUS_14560 5947 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 7292 10549 gene locus_tag LOCUS_14570 7292 10549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 11415 10546 gene locus_tag LOCUS_14580 11415 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_14580 12149 11427 gene locus_tag LOCUS_14590 12149 11427 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391327.1 protein_id gnl|my_center|LOCUS_14590 12491 13132 gene locus_tag LOCUS_14600 gene pdxH 12491 13132 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY37 protein_id gnl|my_center|LOCUS_14600 13298 13531 gene locus_tag LOCUS_14610 13298 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 14025 13582 gene locus_tag LOCUS_14620 14025 13582 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948556.1 protein_id gnl|my_center|LOCUS_14620 14272 16560 gene locus_tag LOCUS_14630 14272 16560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 16638 17027 gene locus_tag LOCUS_14640 16638 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 18135 17017 gene locus_tag LOCUS_14650 18135 17017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146490.1 protein_id gnl|my_center|LOCUS_14650 19644 18271 gene locus_tag LOCUS_14660 19644 18271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973435.1 protein_id gnl|my_center|LOCUS_14660 21595 19661 gene locus_tag LOCUS_14670 21595 19661 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489375.1 protein_id gnl|my_center|LOCUS_14670 22232 21633 gene locus_tag LOCUS_14680 22232 21633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106328.1 protein_id gnl|my_center|LOCUS_14680 22811 22470 gene locus_tag LOCUS_14690 22811 22470 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I69 protein_id gnl|my_center|LOCUS_14690 23641 22811 gene locus_tag LOCUS_14700 23641 22811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_14700 25028 23652 gene locus_tag LOCUS_14710 25028 23652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 25244 25783 gene locus_tag LOCUS_14720 25244 25783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 25959 27011 gene locus_tag LOCUS_14730 25959 27011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 27172 28497 gene locus_tag LOCUS_14740 27172 28497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 28605 29558 gene locus_tag LOCUS_14750 28605 29558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 30195 29569 gene locus_tag LOCUS_14760 30195 29569 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F14 protein_id gnl|my_center|LOCUS_14760 30532 30275 gene locus_tag LOCUS_14770 30532 30275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 32222 30693 gene locus_tag LOCUS_14780 32222 30693 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_14780 32404 34614 gene locus_tag LOCUS_14790 32404 34614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 34784 35431 gene locus_tag LOCUS_14800 34784 35431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 35858 35487 gene locus_tag LOCUS_14810 35858 35487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 36187 37872 gene locus_tag LOCUS_14820 36187 37872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 37878 39581 gene locus_tag LOCUS_14830 37878 39581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 39685 40488 gene locus_tag LOCUS_14840 39685 40488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 40513 40683 gene locus_tag LOCUS_14850 40513 40683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 41553 40720 gene locus_tag LOCUS_14860 41553 40720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 42288 41578 gene locus_tag LOCUS_14870 42288 41578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 42622 43566 gene locus_tag LOCUS_14880 42622 43566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 44544 43633 gene locus_tag LOCUS_14890 44544 43633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 45349 44897 gene locus_tag LOCUS_14900 45349 44897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 45683 47005 gene locus_tag LOCUS_14910 45683 47005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 47199 48092 gene locus_tag LOCUS_14920 gene tehB 47199 48092 CDS product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948235.1 protein_id gnl|my_center|LOCUS_14920 48132 48986 gene locus_tag LOCUS_14930 48132 48986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_14930 49170 50396 gene locus_tag LOCUS_14940 49170 50396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 50462 51460 gene locus_tag LOCUS_14950 50462 51460 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121074.1 protein_id gnl|my_center|LOCUS_14950 51691 52641 gene locus_tag LOCUS_14960 gene hemC 51691 52641 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKN2 protein_id gnl|my_center|LOCUS_14960 52743 53558 gene locus_tag LOCUS_14970 52743 53558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 53945 56110 gene locus_tag LOCUS_14980 53945 56110 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EP48 protein_id gnl|my_center|LOCUS_14980 57093 56209 gene locus_tag LOCUS_14990 gene msrA 57093 56209 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRH4 protein_id gnl|my_center|LOCUS_14990 57439 57248 gene locus_tag LOCUS_15000 57439 57248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15000 58620 57799 gene locus_tag LOCUS_15010 58620 57799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971039.1 protein_id gnl|my_center|LOCUS_15010 58768 59649 gene locus_tag LOCUS_15020 58768 59649 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028306.1 protein_id gnl|my_center|LOCUS_15020 59646 60638 gene locus_tag LOCUS_15030 59646 60638 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_15030 60886 62052 gene locus_tag LOCUS_15040 60886 62052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 64550 62166 gene locus_tag LOCUS_15050 64550 62166 CDS product UPF0753 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYZ0 protein_id gnl|my_center|LOCUS_15050 67947 67054 gene locus_tag LOCUS_15060 67947 67054 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_15060 68203 69441 gene locus_tag LOCUS_15070 68203 69441 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073248.1 protein_id gnl|my_center|LOCUS_15070 69438 70190 gene locus_tag LOCUS_15080 69438 70190 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263588.1 protein_id gnl|my_center|LOCUS_15080 70187 71362 gene locus_tag LOCUS_15090 gene cfaS 70187 71362 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 protein_id gnl|my_center|LOCUS_15090 71672 71493 gene locus_tag LOCUS_15100 71672 71493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 71879 72637 gene locus_tag LOCUS_15110 71879 72637 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945962.1 protein_id gnl|my_center|LOCUS_15110 72909 77369 gene locus_tag LOCUS_15120 72909 77369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 78633 77932 gene locus_tag LOCUS_15130 78633 77932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 79457 78780 gene locus_tag LOCUS_15140 79457 78780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 79846 80823 gene locus_tag LOCUS_15150 79846 80823 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E005 protein_id gnl|my_center|LOCUS_15150 80918 81553 gene locus_tag LOCUS_15160 80918 81553 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_15160 81746 82441 gene locus_tag LOCUS_15170 81746 82441 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPH7 protein_id gnl|my_center|LOCUS_15170 82507 83103 gene locus_tag LOCUS_15180 82507 83103 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 protein_id gnl|my_center|LOCUS_15180 83240 84169 gene locus_tag LOCUS_15190 83240 84169 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922180.1 protein_id gnl|my_center|LOCUS_15190 84335 85006 gene locus_tag LOCUS_15200 84335 85006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 85305 85766 gene locus_tag LOCUS_15210 gene purE 85305 85766 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32JL3 protein_id gnl|my_center|LOCUS_15210 85750 86790 gene locus_tag LOCUS_15220 gene purK 85750 86790 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKY0 protein_id gnl|my_center|LOCUS_15220 87564 87034 gene locus_tag LOCUS_15230 87564 87034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 88105 87806 gene locus_tag LOCUS_15240 88105 87806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 88808 88359 gene locus_tag LOCUS_15250 88808 88359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946474.1 protein_id gnl|my_center|LOCUS_15250 89125 90474 gene locus_tag LOCUS_15260 89125 90474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 90743 91756 gene locus_tag LOCUS_15270 90743 91756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 92171 93367 gene locus_tag LOCUS_15280 92171 93367 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957762.1 protein_id gnl|my_center|LOCUS_15280 93377 94408 gene locus_tag LOCUS_15290 93377 94408 CDS product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59650 protein_id gnl|my_center|LOCUS_15290 94411 95331 gene locus_tag LOCUS_15300 94411 95331 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_15300 95633 96319 gene locus_tag LOCUS_15310 95633 96319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085111.1 protein_id gnl|my_center|LOCUS_15310 96724 96542 gene locus_tag LOCUS_15320 96724 96542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 97033 96848 gene locus_tag LOCUS_15330 97033 96848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 97242 98984 gene locus_tag LOCUS_15340 97242 98984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 100184 99960 gene locus_tag LOCUS_15350 100184 99960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence12 1693 491 gene locus_tag LOCUS_15360 gene tyrS 1693 491 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY07 protein_id gnl|my_center|LOCUS_15360 1902 3416 gene locus_tag LOCUS_15370 1902 3416 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401947.1 protein_id gnl|my_center|LOCUS_15370 3435 4544 gene locus_tag LOCUS_15380 gene anmK 3435 4544 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB5 protein_id gnl|my_center|LOCUS_15380 4990 4616 gene locus_tag LOCUS_15390 gene erpA 4990 4616 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNY6 protein_id gnl|my_center|LOCUS_15390 5908 5054 gene locus_tag LOCUS_15400 5908 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 6020 6325 gene locus_tag LOCUS_15410 6020 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 6567 6400 gene locus_tag LOCUS_15420 6567 6400 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVA5 protein_id gnl|my_center|LOCUS_15420 6727 8019 gene locus_tag LOCUS_15430 gene hemL 6727 8019 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNA0 protein_id gnl|my_center|LOCUS_15430 8042 9562 gene locus_tag LOCUS_15440 8042 9562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266666.1 protein_id gnl|my_center|LOCUS_15440 10355 9573 gene locus_tag LOCUS_15450 gene sfsA 10355 9573 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LV9 protein_id gnl|my_center|LOCUS_15450 10829 11314 gene locus_tag LOCUS_15460 gene dksA 10829 11314 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP03 protein_id gnl|my_center|LOCUS_15460 11295 12005 gene locus_tag LOCUS_15470 11295 12005 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531138.1 protein_id gnl|my_center|LOCUS_15470 12099 12404 gene locus_tag LOCUS_15480 12099 12404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 12949 12407 gene locus_tag LOCUS_15490 12949 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 15055 13103 gene locus_tag LOCUS_15500 gene acsA2 15055 13103 CDS product acetyl-coenzyme A synthetase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV66 protein_id gnl|my_center|LOCUS_15500 15409 15702 gene locus_tag LOCUS_15510 15409 15702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 17929 15785 gene locus_tag LOCUS_15520 17929 15785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 19277 17919 gene locus_tag LOCUS_15530 gene pcnB 19277 17919 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVA2 protein_id gnl|my_center|LOCUS_15530 19627 20604 gene locus_tag LOCUS_15540 19627 20604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 21536 20601 gene locus_tag LOCUS_15550 21536 20601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 22135 21575 gene locus_tag LOCUS_15560 gene sodC 22135 21575 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFF9 protein_id gnl|my_center|LOCUS_15560 24385 22376 gene locus_tag LOCUS_15570 24385 22376 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_15570 24630 25178 gene locus_tag LOCUS_15580 gene ppa 24630 25178 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZB98 protein_id gnl|my_center|LOCUS_15580 25750 26415 gene locus_tag LOCUS_15590 gene ypdP 25750 26415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882868.1 protein_id gnl|my_center|LOCUS_15590 26408 27580 gene locus_tag LOCUS_15600 gene tgt 26408 27580 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z8W5 protein_id gnl|my_center|LOCUS_15600 29017 28004 gene locus_tag LOCUS_15610 29017 28004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 29416 29341 gene locus_tag LOCUS_t00220 29416 29341 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 30290 29484 gene locus_tag LOCUS_15620 30290 29484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 31837 30680 gene locus_tag LOCUS_15630 31837 30680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 32473 31934 gene locus_tag LOCUS_15640 gene excC 32473 31934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393299.1 protein_id gnl|my_center|LOCUS_15640 33887 32499 gene locus_tag LOCUS_15650 gene tolB 33887 32499 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZV69 protein_id gnl|my_center|LOCUS_15650 34837 33884 gene locus_tag LOCUS_15660 gene tolA 34837 33884 CDS product protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947301.1 protein_id gnl|my_center|LOCUS_15660 35338 34880 gene locus_tag LOCUS_15670 gene tolR 35338 34880 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947302.1 protein_id gnl|my_center|LOCUS_15670 36066 35347 gene locus_tag LOCUS_15680 gene tolQ 36066 35347 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50598 protein_id gnl|my_center|LOCUS_15680 36526 36056 gene locus_tag LOCUS_15690 36526 36056 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814639.1 protein_id gnl|my_center|LOCUS_15690 37647 36610 gene locus_tag LOCUS_15700 gene ruvB 37647 36610 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA2 protein_id gnl|my_center|LOCUS_15700 38246 37644 gene locus_tag LOCUS_15710 gene ruvA 38246 37644 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWL2 protein_id gnl|my_center|LOCUS_15710 38755 38243 gene locus_tag LOCUS_15720 gene ruvC 38755 38243 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEF1 protein_id gnl|my_center|LOCUS_15720 39533 38790 gene locus_tag LOCUS_15730 gene pmpR 39533 38790 CDS product transcriptional regulatory protein PmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51423 protein_id gnl|my_center|LOCUS_15730 40098 39664 gene locus_tag LOCUS_15740 gene ntpA 40098 39664 CDS product NUDIX pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211203.1 protein_id gnl|my_center|LOCUS_15740 41911 40109 gene locus_tag LOCUS_15750 gene aspS 41911 40109 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVG2 protein_id gnl|my_center|LOCUS_15750 42202 41963 gene locus_tag LOCUS_15760 42202 41963 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772089.1 protein_id gnl|my_center|LOCUS_15760 42817 44412 gene locus_tag LOCUS_15770 42817 44412 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_15770 44409 45764 gene locus_tag LOCUS_15780 gene pilR 44409 45764 CDS product type 4 fimbriae expression regulatory protein PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00934 protein_id gnl|my_center|LOCUS_15780 45748 46251 gene locus_tag LOCUS_15790 45748 46251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 46379 46867 gene locus_tag LOCUS_15800 46379 46867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 46999 47598 gene locus_tag LOCUS_15810 46999 47598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 47595 48395 gene locus_tag LOCUS_15820 47595 48395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 48408 48947 gene locus_tag LOCUS_15830 48408 48947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 48956 52804 gene locus_tag LOCUS_15840 48956 52804 CDS product pilus biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_15840 52823 53191 gene locus_tag LOCUS_15850 52823 53191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 53204 53623 gene locus_tag LOCUS_15860 gene pilE3 53204 53623 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946364.1 protein_id gnl|my_center|LOCUS_15860 54623 53625 gene locus_tag LOCUS_15870 gene ispH 54623 53625 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG42 protein_id gnl|my_center|LOCUS_15870 55143 54604 gene locus_tag LOCUS_15880 gene lspA 55143 54604 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y7N8 protein_id gnl|my_center|LOCUS_15880 57970 55136 gene locus_tag LOCUS_15890 gene ileS 57970 55136 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S90 protein_id gnl|my_center|LOCUS_15890 58976 58017 gene locus_tag LOCUS_15900 gene ribF 58976 58017 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM3 protein_id gnl|my_center|LOCUS_15900 60560 59007 gene locus_tag LOCUS_15910 gene mviN 60560 59007 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS84 protein_id gnl|my_center|LOCUS_15910 60659 60922 gene locus_tag LOCUS_15920 gene rpsT 60659 60922 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBH9 protein_id gnl|my_center|LOCUS_15920 61963 60923 gene locus_tag LOCUS_15930 gene obg 61963 60923 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QM0 protein_id gnl|my_center|LOCUS_15930 62372 62085 gene locus_tag LOCUS_15940 gene rpmA 62372 62085 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS69 protein_id gnl|my_center|LOCUS_15940 62734 62402 gene locus_tag LOCUS_15950 gene rplU 62734 62402 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDR4 protein_id gnl|my_center|LOCUS_15950 63049 64011 gene locus_tag LOCUS_15960 gene ispB 63049 64011 CDS product octaprenyl-diphosphate synthase IspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073452.1 protein_id gnl|my_center|LOCUS_15960 64271 65200 gene locus_tag LOCUS_15970 64271 65200 CDS product S-adenosylmethionine/S-adenosylhomocysteine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84584 protein_id gnl|my_center|LOCUS_15970 68351 65223 gene locus_tag LOCUS_15980 68351 65223 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709359.1 protein_id gnl|my_center|LOCUS_15980 69643 68369 gene locus_tag LOCUS_15990 gene acrE 69643 68369 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976146.1 protein_id gnl|my_center|LOCUS_15990 69806 70999 gene locus_tag LOCUS_16000 69806 70999 CDS product DegQ protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_16000 71085 71498 gene locus_tag LOCUS_16010 71085 71498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 73367 71508 gene locus_tag LOCUS_16020 73367 71508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 74694 73534 gene locus_tag LOCUS_16030 gene gcdH 74694 73534 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948280.1 protein_id gnl|my_center|LOCUS_16030 76915 74636 gene locus_tag LOCUS_16040 76915 74636 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948281.1 protein_id gnl|my_center|LOCUS_16040 77740 77069 gene locus_tag LOCUS_16050 gene rpe 77740 77069 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC9 protein_id gnl|my_center|LOCUS_16050 >Feature sequence13 2529 3257 gene locus_tag LOCUS_16060 2529 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 4325 3315 gene locus_tag LOCUS_16070 4325 3315 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480025.1 protein_id gnl|my_center|LOCUS_16070 5516 4416 gene locus_tag LOCUS_16080 5516 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 6228 8270 gene locus_tag LOCUS_16090 6228 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 8254 9717 gene locus_tag LOCUS_16100 8254 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 9937 10779 gene locus_tag LOCUS_16110 gene ttcA 9937 10779 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXN3 protein_id gnl|my_center|LOCUS_16110 10795 12453 gene locus_tag LOCUS_16120 10795 12453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_820157.2 protein_id gnl|my_center|LOCUS_16120 13033 12533 gene locus_tag LOCUS_16130 13033 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 15076 13316 gene locus_tag LOCUS_16140 15076 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 15576 19526 gene locus_tag LOCUS_16150 15576 19526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 20348 19620 gene locus_tag LOCUS_16160 20348 19620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 20715 20329 gene locus_tag LOCUS_16170 20715 20329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 21360 21109 gene locus_tag LOCUS_16180 21360 21109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 22687 21407 gene locus_tag LOCUS_16190 22687 21407 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_16190 23160 22684 gene locus_tag LOCUS_16200 23160 22684 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_16200 23758 23165 gene locus_tag LOCUS_16210 gene fabA 23758 23165 CDS product beta-hydroxydecanoyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770369.1 protein_id gnl|my_center|LOCUS_16210 24742 23762 gene locus_tag LOCUS_16220 24742 23762 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772652.1 protein_id gnl|my_center|LOCUS_16220 25676 24735 gene locus_tag LOCUS_16230 25676 24735 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_16230 26626 25904 gene locus_tag LOCUS_16240 26626 25904 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705765.1 protein_id gnl|my_center|LOCUS_16240 28149 26884 gene locus_tag LOCUS_16250 gene uraA 28149 26884 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938325.1 protein_id gnl|my_center|LOCUS_16250 29083 28421 gene locus_tag LOCUS_16260 29083 28421 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_16260 30544 29147 gene locus_tag LOCUS_16270 30544 29147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770886.1 protein_id gnl|my_center|LOCUS_16270 31114 30563 gene locus_tag LOCUS_16280 31114 30563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 32000 31323 gene locus_tag LOCUS_16290 32000 31323 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948199.1 protein_id gnl|my_center|LOCUS_16290 32126 32575 gene locus_tag LOCUS_16300 32126 32575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 32722 33267 gene locus_tag LOCUS_16310 32722 33267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 33327 33935 gene locus_tag LOCUS_16320 33327 33935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 34264 33944 gene locus_tag LOCUS_16330 34264 33944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 34568 35011 gene locus_tag LOCUS_16340 34568 35011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 35571 35170 gene locus_tag LOCUS_16350 35571 35170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 35717 37477 gene locus_tag LOCUS_16360 gene argS 35717 37477 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKN4 protein_id gnl|my_center|LOCUS_16360 37689 40004 gene locus_tag LOCUS_16370 37689 40004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 40150 41931 gene locus_tag LOCUS_16380 40150 41931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 42675 41941 gene locus_tag LOCUS_16390 42675 41941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 44676 42790 gene locus_tag LOCUS_16400 44676 42790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 44769 45434 gene locus_tag LOCUS_16410 44769 45434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_16410 45521 46096 gene locus_tag LOCUS_16420 45521 46096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 47617 46118 gene locus_tag LOCUS_16430 47617 46118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 47854 48087 gene locus_tag LOCUS_16440 47854 48087 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006870829.1 protein_id gnl|my_center|LOCUS_16440 48089 48400 gene locus_tag LOCUS_16450 48089 48400 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948073.1 protein_id gnl|my_center|LOCUS_16450 48393 49328 gene locus_tag LOCUS_16460 48393 49328 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948074.1 protein_id gnl|my_center|LOCUS_16460 49954 49418 gene locus_tag LOCUS_16470 49954 49418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 50225 49971 gene locus_tag LOCUS_16480 50225 49971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 50725 50339 gene locus_tag LOCUS_16490 gene ychJ 50725 50339 CDS product preprotein translocase SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947613.1 protein_id gnl|my_center|LOCUS_16490 52865 52041 gene locus_tag LOCUS_16500 52865 52041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 53651 52908 gene locus_tag LOCUS_16510 53651 52908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 54818 53661 gene locus_tag LOCUS_16520 54818 53661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 55027 55971 gene locus_tag LOCUS_16530 55027 55971 CDS product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083255.1 protein_id gnl|my_center|LOCUS_16530 56688 56011 gene locus_tag LOCUS_16540 56688 56011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 57467 56685 gene locus_tag LOCUS_16550 gene kdsB 57467 56685 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385423.1 protein_id gnl|my_center|LOCUS_16550 57792 57517 gene locus_tag LOCUS_16560 57792 57517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 58621 57929 gene locus_tag LOCUS_16570 gene enhA.4 58621 57929 CDS product enhanced entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958031.1 protein_id gnl|my_center|LOCUS_16570 58813 59217 gene locus_tag LOCUS_16580 gene pilE 58813 59217 CDS product type 4 fimbrial biogenesis protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094721.1 protein_id gnl|my_center|LOCUS_16580 59341 59697 gene locus_tag LOCUS_16590 59341 59697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 59700 60086 gene locus_tag LOCUS_16600 59700 60086 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367486.1 protein_id gnl|my_center|LOCUS_16600 60407 61606 gene locus_tag LOCUS_16610 60407 61606 CDS product putative hexose phosphate transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84548 protein_id gnl|my_center|LOCUS_16610 61640 62185 gene locus_tag LOCUS_16620 61640 62185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 62269 62481 gene locus_tag LOCUS_16630 62269 62481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 62417 62797 gene locus_tag LOCUS_16640 62417 62797 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337611.1 protein_id gnl|my_center|LOCUS_16640 63103 64524 gene locus_tag LOCUS_16650 63103 64524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 64764 65498 gene locus_tag LOCUS_16660 64764 65498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 66714 65509 gene locus_tag LOCUS_16670 66714 65509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 66838 68322 gene locus_tag LOCUS_16680 66838 68322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731144.1 protein_id gnl|my_center|LOCUS_16680 68319 69350 gene locus_tag LOCUS_16690 68319 69350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 69358 69828 gene locus_tag LOCUS_16700 69358 69828 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947703.1 protein_id gnl|my_center|LOCUS_16700 70398 69865 gene locus_tag LOCUS_16710 gene def1 70398 69865 CDS product peptide deformylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CV9 protein_id gnl|my_center|LOCUS_16710 70802 73384 gene locus_tag LOCUS_16720 70802 73384 CDS product cell division protein FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142643.1 protein_id gnl|my_center|LOCUS_16720 73381 73842 gene locus_tag LOCUS_16730 73381 73842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence14 552 2144 gene locus_tag LOCUS_16740 gene tlcA 552 2144 CDS product ADP,ATP carrier protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84068 protein_id gnl|my_center|LOCUS_16740 2662 3825 gene locus_tag LOCUS_16750 2662 3825 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_16750 3818 4723 gene locus_tag LOCUS_16760 3818 4723 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_16760 4665 5750 gene locus_tag LOCUS_16770 4665 5750 CDS product peptidoglycan bridge formation protein FemAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_16770 5747 6934 gene locus_tag LOCUS_16780 5747 6934 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_16780 6948 8474 gene locus_tag LOCUS_16790 6948 8474 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_16790 8480 9622 gene locus_tag LOCUS_16800 8480 9622 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_16800 9610 11538 gene locus_tag LOCUS_16810 9610 11538 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_16810 11510 12724 gene locus_tag LOCUS_16820 11510 12724 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942493.1 protein_id gnl|my_center|LOCUS_16820 12721 13821 gene locus_tag LOCUS_16830 12721 13821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 13814 15163 gene locus_tag LOCUS_16840 13814 15163 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_16840 15176 16654 gene locus_tag LOCUS_16850 15176 16654 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391093.1 protein_id gnl|my_center|LOCUS_16850 16651 17601 gene locus_tag LOCUS_16860 16651 17601 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_16860 17598 18146 gene locus_tag LOCUS_16870 17598 18146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 18140 19015 gene locus_tag LOCUS_16880 18140 19015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 19012 20319 gene locus_tag LOCUS_16890 19012 20319 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_16890 20306 21037 gene locus_tag LOCUS_16900 20306 21037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 21041 22018 gene locus_tag LOCUS_16910 21041 22018 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_16910 22100 23857 gene locus_tag LOCUS_16920 gene abcT3 22100 23857 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947008.1 protein_id gnl|my_center|LOCUS_16920 25335 23923 gene locus_tag LOCUS_16930 25335 23923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 26306 25587 gene locus_tag LOCUS_16940 26306 25587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957581.1 protein_id gnl|my_center|LOCUS_16940 27620 26358 gene locus_tag LOCUS_16950 27620 26358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 29046 27745 gene locus_tag LOCUS_16960 29046 27745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 29266 30021 gene locus_tag LOCUS_16970 29266 30021 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947177.1 protein_id gnl|my_center|LOCUS_16970 30152 31315 gene locus_tag LOCUS_16980 30152 31315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 32153 31458 gene locus_tag LOCUS_16990 32153 31458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 34272 32410 gene locus_tag LOCUS_17000 gene asnB 34272 32410 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_17000 35393 34269 gene locus_tag LOCUS_17010 35393 34269 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942603.1 protein_id gnl|my_center|LOCUS_17010 35977 35390 gene locus_tag LOCUS_17020 35977 35390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 36101 37216 gene locus_tag LOCUS_17030 gene ald 36101 37216 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX09 protein_id gnl|my_center|LOCUS_17030 37314 37559 gene locus_tag LOCUS_17040 37314 37559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 38780 37755 gene locus_tag LOCUS_17050 gene galE 38780 37755 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544967.1 protein_id gnl|my_center|LOCUS_17050 40193 38907 gene locus_tag LOCUS_17060 gene gltA 40193 38907 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884A2 protein_id gnl|my_center|LOCUS_17060 40603 40986 gene locus_tag LOCUS_17070 gene sdhC 40603 40986 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946275.1 protein_id gnl|my_center|LOCUS_17070 40986 41321 gene locus_tag LOCUS_17080 gene sdhD 40986 41321 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y3J8 protein_id gnl|my_center|LOCUS_17080 41322 43088 gene locus_tag LOCUS_17090 gene sdhA 41322 43088 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY43 protein_id gnl|my_center|LOCUS_17090 43103 43807 gene locus_tag LOCUS_17100 gene sdhB 43103 43807 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087410.1 protein_id gnl|my_center|LOCUS_17100 44029 46884 gene locus_tag LOCUS_17110 gene sucA 44029 46884 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769626.1 protein_id gnl|my_center|LOCUS_17110 47054 48232 gene locus_tag LOCUS_17120 gene sucB 47054 48232 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY40 protein_id gnl|my_center|LOCUS_17120 48256 49419 gene locus_tag LOCUS_17130 gene sucC 48256 49419 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZY39 protein_id gnl|my_center|LOCUS_17130 49422 50294 gene locus_tag LOCUS_17140 49422 50294 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJL0 protein_id gnl|my_center|LOCUS_17140 53481 50671 gene locus_tag LOCUS_17150 53481 50671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 54561 53803 gene locus_tag LOCUS_17160 54561 53803 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_17160 54992 54714 gene locus_tag LOCUS_17170 54992 54714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 55573 55022 gene locus_tag LOCUS_17180 55573 55022 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVZ5 protein_id gnl|my_center|LOCUS_17180 55656 56264 gene locus_tag LOCUS_17190 55656 56264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 protein_id gnl|my_center|LOCUS_17190 56294 57529 gene locus_tag LOCUS_17200 gene trpS 56294 57529 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947173.1 protein_id gnl|my_center|LOCUS_17200 57519 58337 gene locus_tag LOCUS_17210 57519 58337 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L9 protein_id gnl|my_center|LOCUS_17210 58327 59721 gene locus_tag LOCUS_17220 58327 59721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 59675 60676 gene locus_tag LOCUS_17230 59675 60676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 63937 60911 gene locus_tag LOCUS_17240 63937 60911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 65102 64197 gene locus_tag LOCUS_17250 65102 64197 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268567.1 protein_id gnl|my_center|LOCUS_17250 65944 65192 gene locus_tag LOCUS_17260 gene yciK 65944 65192 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208030.1 protein_id gnl|my_center|LOCUS_17260 66236 65997 gene locus_tag LOCUS_17270 66236 65997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 66601 66368 gene locus_tag LOCUS_17280 66601 66368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 67293 68387 gene locus_tag LOCUS_17290 67293 68387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 68586 69425 gene locus_tag LOCUS_17300 68586 69425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 71670 69439 gene locus_tag LOCUS_17310 71670 69439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence15 6180 5932 gene locus_tag LOCUS_17320 6180 5932 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198264.1 protein_id gnl|my_center|LOCUS_17320 6961 6206 gene locus_tag LOCUS_17330 6961 6206 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198263.1 protein_id gnl|my_center|LOCUS_17330 7731 6958 gene locus_tag LOCUS_17340 gene pksH 7731 6958 CDS product putative polyketide biosynthesis enoyl-CoA hydratase PksH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40805 protein_id gnl|my_center|LOCUS_17340 8995 7733 gene locus_tag LOCUS_17350 8995 7733 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524093.1 protein_id gnl|my_center|LOCUS_17350 10229 9006 gene locus_tag LOCUS_17360 gene pksF 10229 9006 CDS product polyketide biosynthesis malonyl-ACP decarboxylase PksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40804 protein_id gnl|my_center|LOCUS_17360 11637 10240 gene locus_tag LOCUS_17370 11637 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 11908 12801 gene locus_tag LOCUS_17380 11908 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 13656 12796 gene locus_tag LOCUS_17390 gene accD 13656 12796 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZA7 protein_id gnl|my_center|LOCUS_17390 14522 13668 gene locus_tag LOCUS_17400 gene pksC 14522 13668 CDS product polyketide biosynthesis malonyl CoA-acyl carrier protein transacylase PksC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34825 protein_id gnl|my_center|LOCUS_17400 15244 14552 gene locus_tag LOCUS_17410 15244 14552 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 protein_id gnl|my_center|LOCUS_17410 16333 15500 gene locus_tag LOCUS_17420 16333 15500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 16911 17078 gene locus_tag LOCUS_17430 16911 17078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 17172 18794 gene locus_tag LOCUS_17440 17172 18794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 19170 19415 gene locus_tag LOCUS_17450 19170 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17450 19415 19840 gene locus_tag LOCUS_17460 19415 19840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17460 19958 19797 gene locus_tag LOCUS_17470 19958 19797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 20917 20186 gene locus_tag LOCUS_17480 20917 20186 CDS product phosphopantetheine-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957443.1 protein_id gnl|my_center|LOCUS_17480 21741 21409 gene locus_tag LOCUS_17490 21741 21409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 22057 22653 gene locus_tag LOCUS_17500 22057 22653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 23947 22955 gene locus_tag LOCUS_17510 23947 22955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 24437 24087 gene locus_tag LOCUS_17520 24437 24087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 24919 25239 gene locus_tag LOCUS_17530 24919 25239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 25349 26005 gene locus_tag LOCUS_17540 gene tpm 25349 26005 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ86 protein_id gnl|my_center|LOCUS_17540 26930 27766 gene locus_tag LOCUS_17550 26930 27766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020451.1 protein_id gnl|my_center|LOCUS_17550 27769 29037 gene locus_tag LOCUS_17560 27769 29037 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947065.1 protein_id gnl|my_center|LOCUS_17560 29089 29883 gene locus_tag LOCUS_17570 29089 29883 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_17570 30191 29973 gene locus_tag LOCUS_17580 30191 29973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 30740 30363 gene locus_tag LOCUS_17590 30740 30363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 30900 32306 gene locus_tag LOCUS_17600 30900 32306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 32444 32806 gene locus_tag LOCUS_17610 32444 32806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120341.1 protein_id gnl|my_center|LOCUS_17610 34600 32858 gene locus_tag LOCUS_17620 34600 32858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 36574 35282 gene locus_tag LOCUS_17630 36574 35282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 36830 37447 gene locus_tag LOCUS_17640 36830 37447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 38566 37472 gene locus_tag LOCUS_17650 38566 37472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 39593 38724 gene locus_tag LOCUS_17660 39593 38724 CDS product aminoglycoside 6-adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947862.1 protein_id gnl|my_center|LOCUS_17660 41917 39749 gene locus_tag LOCUS_17670 41917 39749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 43970 42306 gene locus_tag LOCUS_17680 43970 42306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 44781 44062 gene locus_tag LOCUS_17690 44781 44062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 45633 44863 gene locus_tag LOCUS_17700 45633 44863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 46475 45726 gene locus_tag LOCUS_17710 gene yvdD 46475 45726 CDS product LOG family protein YvdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06986 protein_id gnl|my_center|LOCUS_17710 46760 47992 gene locus_tag LOCUS_17720 46760 47992 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958074.1 protein_id gnl|my_center|LOCUS_17720 48280 48059 gene locus_tag LOCUS_17730 48280 48059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 49356 48505 gene locus_tag LOCUS_17740 49356 48505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942018.1 protein_id gnl|my_center|LOCUS_17740 49981 49346 gene locus_tag LOCUS_17750 49981 49346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_17750 50127 50582 gene locus_tag LOCUS_17760 50127 50582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 52200 50620 gene locus_tag LOCUS_17770 52200 50620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 54161 52485 gene locus_tag LOCUS_17780 54161 52485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 54478 55785 gene locus_tag LOCUS_17790 gene miaB 54478 55785 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57163 protein_id gnl|my_center|LOCUS_17790 55982 56965 gene locus_tag LOCUS_17800 55982 56965 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_17800 56962 57414 gene locus_tag LOCUS_17810 gene ybeY 56962 57414 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTE2 protein_id gnl|my_center|LOCUS_17810 57407 58252 gene locus_tag LOCUS_17820 gene corC 57407 58252 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957666.1 protein_id gnl|my_center|LOCUS_17820 58332 59909 gene locus_tag LOCUS_17830 gene lnt 58332 59909 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VX7 protein_id gnl|my_center|LOCUS_17830 60291 60094 gene locus_tag LOCUS_17840 60291 60094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 60419 62890 gene locus_tag LOCUS_17850 gene leuS 60419 62890 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DY1 protein_id gnl|my_center|LOCUS_17850 62893 63405 gene locus_tag LOCUS_17860 62893 63405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 63413 64426 gene locus_tag LOCUS_17870 gene holA 63413 64426 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810253.1 protein_id gnl|my_center|LOCUS_17870 64548 64895 gene locus_tag LOCUS_17880 gene rsfS 64548 64895 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX22 protein_id gnl|my_center|LOCUS_17880 64895 65365 gene locus_tag LOCUS_17890 gene rlmH 64895 65365 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX23 protein_id gnl|my_center|LOCUS_17890 67073 65379 gene locus_tag LOCUS_17900 67073 65379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 67906 67298 gene locus_tag LOCUS_17910 67906 67298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 68494 68057 gene locus_tag LOCUS_17920 68494 68057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence16 814 206 gene locus_tag LOCUS_17930 gene ubiX 814 206 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SV7 protein_id gnl|my_center|LOCUS_17930 2367 979 gene locus_tag LOCUS_17940 gene mpl 2367 979 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP37 protein_id gnl|my_center|LOCUS_17940 2807 2379 gene locus_tag LOCUS_17950 2807 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 3010 4263 gene locus_tag LOCUS_17960 gene pfp 3010 4263 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZU94 protein_id gnl|my_center|LOCUS_17960 4827 4432 gene locus_tag LOCUS_17970 4827 4432 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252975.1 protein_id gnl|my_center|LOCUS_17970 5686 4853 gene locus_tag LOCUS_17980 5686 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 5890 8913 gene locus_tag LOCUS_17990 5890 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 11096 8976 gene locus_tag LOCUS_18000 gene pnp 11096 8976 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KND9 protein_id gnl|my_center|LOCUS_18000 11407 11138 gene locus_tag LOCUS_18010 gene rpsO 11407 11138 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MC70 protein_id gnl|my_center|LOCUS_18010 12493 11582 gene locus_tag LOCUS_18020 gene truB 12493 11582 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4AAX7 protein_id gnl|my_center|LOCUS_18020 12940 12539 gene locus_tag LOCUS_18030 gene rbfA 12940 12539 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WQ6 protein_id gnl|my_center|LOCUS_18030 15562 12962 gene locus_tag LOCUS_18040 gene infB 15562 12962 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRV4 protein_id gnl|my_center|LOCUS_18040 17101 15584 gene locus_tag LOCUS_18050 gene nusA 17101 15584 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNR1 protein_id gnl|my_center|LOCUS_18050 17582 17091 gene locus_tag LOCUS_18060 gene rimP 17582 17091 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV53 protein_id gnl|my_center|LOCUS_18060 17899 17823 gene locus_tag LOCUS_t00230 17899 17823 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 19471 18029 gene locus_tag LOCUS_18070 gene nuoN 19471 18029 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRV1 protein_id gnl|my_center|LOCUS_18070 21026 19488 gene locus_tag LOCUS_18080 gene nuoM 21026 19488 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_18080 22916 21036 gene locus_tag LOCUS_18090 gene nuoL 22916 21036 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948467.1 protein_id gnl|my_center|LOCUS_18090 23322 23017 gene locus_tag LOCUS_18100 gene nuoK 23322 23017 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IP5 protein_id gnl|my_center|LOCUS_18100 23966 23319 gene locus_tag LOCUS_18110 gene nuoJ 23966 23319 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_18110 24410 23979 gene locus_tag LOCUS_18120 gene nuoI 24410 23979 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU6 protein_id gnl|my_center|LOCUS_18120 25511 24480 gene locus_tag LOCUS_18130 gene nuoH 25511 24480 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU5 protein_id gnl|my_center|LOCUS_18130 27911 25515 gene locus_tag LOCUS_18140 gene nuoG 27911 25515 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BR1 protein_id gnl|my_center|LOCUS_18140 29202 27913 gene locus_tag LOCUS_18150 gene nuoF 29202 27913 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948473.1 protein_id gnl|my_center|LOCUS_18150 29717 29205 gene locus_tag LOCUS_18160 29717 29205 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_18160 30970 29717 gene locus_tag LOCUS_18170 gene nuoD 30970 29717 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRU1 protein_id gnl|my_center|LOCUS_18170 31643 30972 gene locus_tag LOCUS_18180 gene nuoC 31643 30972 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ7 protein_id gnl|my_center|LOCUS_18180 32116 31640 gene locus_tag LOCUS_18190 gene nuoB 32116 31640 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZQ4 protein_id gnl|my_center|LOCUS_18190 32472 32116 gene locus_tag LOCUS_18200 gene nuoA 32472 32116 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BQ5 protein_id gnl|my_center|LOCUS_18200 33029 32945 gene locus_tag LOCUS_t00240 33029 32945 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 33420 33052 gene locus_tag LOCUS_18210 gene secG 33420 33052 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948479.1 protein_id gnl|my_center|LOCUS_18210 34289 33513 gene locus_tag LOCUS_18220 gene tpiA 34289 33513 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL9 protein_id gnl|my_center|LOCUS_18220 34594 35610 gene locus_tag LOCUS_18230 34594 35610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 36974 35616 gene locus_tag LOCUS_18240 gene glmM 36974 35616 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_18240 37827 36961 gene locus_tag LOCUS_18250 gene folP 37827 36961 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7M1 protein_id gnl|my_center|LOCUS_18250 39842 37869 gene locus_tag LOCUS_18260 gene ftsH 39842 37869 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRT2 protein_id gnl|my_center|LOCUS_18260 40689 40051 gene locus_tag LOCUS_18270 gene rlmE 40689 40051 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95454 protein_id gnl|my_center|LOCUS_18270 40757 41029 gene locus_tag LOCUS_18280 gene yhbY 40757 41029 CDS product RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AGK4 protein_id gnl|my_center|LOCUS_18280 41092 41271 gene locus_tag LOCUS_18290 41092 41271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 41779 41315 gene locus_tag LOCUS_18300 gene greA 41779 41315 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNF4 protein_id gnl|my_center|LOCUS_18300 45038 41799 gene locus_tag LOCUS_18310 gene carB 45038 41799 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C50 protein_id gnl|my_center|LOCUS_18310 46221 45040 gene locus_tag LOCUS_18320 gene carA 46221 45040 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPH8 protein_id gnl|my_center|LOCUS_18320 47760 46324 gene locus_tag LOCUS_18330 47760 46324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 47929 48660 gene locus_tag LOCUS_18340 47929 48660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 49866 48640 gene locus_tag LOCUS_18350 49866 48640 CDS product O-antigen biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946558.1 protein_id gnl|my_center|LOCUS_18350 50982 49921 gene locus_tag LOCUS_18360 gene wbmF 50982 49921 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807093.1 protein_id gnl|my_center|LOCUS_18360 51962 51018 gene locus_tag LOCUS_18370 gene wbmH 51962 51018 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807090.1 protein_id gnl|my_center|LOCUS_18370 53947 52004 gene locus_tag LOCUS_18380 gene wbmI 53947 52004 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807086.1 protein_id gnl|my_center|LOCUS_18380 55342 53993 gene locus_tag LOCUS_18390 55342 53993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 55600 56331 gene locus_tag LOCUS_18400 55600 56331 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461001.1 protein_id gnl|my_center|LOCUS_18400 56324 57664 gene locus_tag LOCUS_18410 gene tagH 56324 57664 CDS product teichoic acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_18410 57648 58517 gene locus_tag LOCUS_18420 57648 58517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 58537 59220 gene locus_tag LOCUS_18430 58537 59220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 59237 60016 gene locus_tag LOCUS_18440 59237 60016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 60020 61669 gene locus_tag LOCUS_18450 60020 61669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 61701 62798 gene locus_tag LOCUS_18460 61701 62798 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_18460 62853 63914 gene locus_tag LOCUS_18470 gene wlbA 62853 63914 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927319.1 protein_id gnl|my_center|LOCUS_18470 63936 64520 gene locus_tag LOCUS_18480 gene wbpD 63936 64520 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208045.1 protein_id gnl|my_center|LOCUS_18480 64537 65883 gene locus_tag LOCUS_18490 64537 65883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence17 3230 1131 gene locus_tag LOCUS_18500 3230 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 4135 3248 gene locus_tag LOCUS_18510 4135 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 4475 4182 gene locus_tag LOCUS_18520 gene ihfB 4475 4182 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z3 protein_id gnl|my_center|LOCUS_18520 4725 5675 gene locus_tag LOCUS_18530 gene rpoS 4725 5675 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR8 protein_id gnl|my_center|LOCUS_18530 5956 5741 gene locus_tag LOCUS_18540 5956 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 6056 6310 gene locus_tag LOCUS_18550 6056 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 7289 6618 gene locus_tag LOCUS_18560 7289 6618 CDS product phosphate transport regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073546.1 protein_id gnl|my_center|LOCUS_18560 8211 7423 gene locus_tag LOCUS_18570 8211 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 9052 8225 gene locus_tag LOCUS_18580 9052 8225 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_18580 9346 9089 gene locus_tag LOCUS_18590 9346 9089 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946406.1 protein_id gnl|my_center|LOCUS_18590 9439 10095 gene locus_tag LOCUS_18600 gene coq7 9439 10095 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZI2 protein_id gnl|my_center|LOCUS_18600 12507 10837 gene locus_tag LOCUS_18610 gene groL 12507 10837 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42385 protein_id gnl|my_center|LOCUS_18610 12857 12564 gene locus_tag LOCUS_18620 gene groS 12857 12564 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19422 protein_id gnl|my_center|LOCUS_18620 13167 14828 gene locus_tag LOCUS_18630 13167 14828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 14993 15358 gene locus_tag LOCUS_18640 14993 15358 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036362.1 protein_id gnl|my_center|LOCUS_18640 15772 15452 gene locus_tag LOCUS_18650 gene cutA 15772 15452 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7SIA8 protein_id gnl|my_center|LOCUS_18650 15861 17753 gene locus_tag LOCUS_18660 gene dsbD 15861 17753 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946423.1 protein_id gnl|my_center|LOCUS_18660 17893 18324 gene locus_tag LOCUS_18670 gene aroQ 17893 18324 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYA8 protein_id gnl|my_center|LOCUS_18670 18370 18834 gene locus_tag LOCUS_18680 gene accB 18370 18834 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163113.1 protein_id gnl|my_center|LOCUS_18680 18840 20180 gene locus_tag LOCUS_18690 gene accC 18840 20180 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43873 protein_id gnl|my_center|LOCUS_18690 20183 21061 gene locus_tag LOCUS_18700 gene prmA 20183 21061 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNJ1 protein_id gnl|my_center|LOCUS_18700 21073 22089 gene locus_tag LOCUS_18710 gene dusB 21073 22089 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WL87 protein_id gnl|my_center|LOCUS_18710 22108 22371 gene locus_tag LOCUS_18720 22108 22371 CDS product putative Fis-like DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD37 protein_id gnl|my_center|LOCUS_18720 22384 23964 gene locus_tag LOCUS_18730 gene purH 22384 23964 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAR3 protein_id gnl|my_center|LOCUS_18730 24000 25301 gene locus_tag LOCUS_18740 gene purD 24000 25301 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KS8 protein_id gnl|my_center|LOCUS_18740 25310 26134 gene locus_tag LOCUS_18750 gene mutM 25310 26134 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NPE1 protein_id gnl|my_center|LOCUS_18750 26815 26180 gene locus_tag LOCUS_18760 26815 26180 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017028.1 protein_id gnl|my_center|LOCUS_18760 28436 26916 gene locus_tag LOCUS_18770 28436 26916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 28996 28514 gene locus_tag LOCUS_18780 gene dfrA 28996 28514 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJC6 protein_id gnl|my_center|LOCUS_18780 29801 29007 gene locus_tag LOCUS_18790 gene thyA 29801 29007 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F1 protein_id gnl|my_center|LOCUS_18790 30618 29812 gene locus_tag LOCUS_18800 gene lgt 30618 29812 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRL2 protein_id gnl|my_center|LOCUS_18800 31485 30679 gene locus_tag LOCUS_18810 31485 30679 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX2 protein_id gnl|my_center|LOCUS_18810 33762 31492 gene locus_tag LOCUS_18820 gene ptsP 33762 31492 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382074.1 protein_id gnl|my_center|LOCUS_18820 34358 33849 gene locus_tag LOCUS_18830 gene rppH 34358 33849 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4P2 protein_id gnl|my_center|LOCUS_18830 35497 34766 gene locus_tag LOCUS_18840 35497 34766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 36386 35619 gene locus_tag LOCUS_18850 36386 35619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 38014 36560 gene locus_tag LOCUS_18860 gene gcvPB 38014 36560 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B09 protein_id gnl|my_center|LOCUS_18860 39400 38036 gene locus_tag LOCUS_18870 gene gcvPA 39400 38036 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83B08 protein_id gnl|my_center|LOCUS_18870 39803 39411 gene locus_tag LOCUS_18880 gene gcvH 39803 39411 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_18880 40939 39824 gene locus_tag LOCUS_18890 gene gcvT 40939 39824 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHP0 protein_id gnl|my_center|LOCUS_18890 42215 41022 gene locus_tag LOCUS_18900 gene visC 42215 41022 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021488.1 protein_id gnl|my_center|LOCUS_18900 43385 42219 gene locus_tag LOCUS_18910 gene ubiH 43385 42219 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_18910 44701 43400 gene locus_tag LOCUS_18920 gene pepP 44701 43400 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_18920 45320 44727 gene locus_tag LOCUS_18930 45320 44727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 45655 46083 gene locus_tag LOCUS_18940 45655 46083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 46452 46889 gene locus_tag LOCUS_18950 46452 46889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 47075 47374 gene locus_tag LOCUS_18960 47075 47374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 47581 48045 gene locus_tag LOCUS_18970 47581 48045 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_18970 48179 48841 gene locus_tag LOCUS_18980 gene rpiA 48179 48841 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G1 protein_id gnl|my_center|LOCUS_18980 48856 49485 gene locus_tag LOCUS_18990 gene tdk 48856 49485 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXU5 protein_id gnl|my_center|LOCUS_18990 50123 49539 gene locus_tag LOCUS_19000 50123 49539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546603.1 protein_id gnl|my_center|LOCUS_19000 51156 50137 gene locus_tag LOCUS_19010 51156 50137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 53648 51165 gene locus_tag LOCUS_19020 gene ybbP 53648 51165 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072830.1 protein_id gnl|my_center|LOCUS_19020 54313 53645 gene locus_tag LOCUS_19030 54313 53645 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 protein_id gnl|my_center|LOCUS_19030 54312 54989 gene locus_tag LOCUS_19040 gene tesA 54312 54989 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036014.1 protein_id gnl|my_center|LOCUS_19040 55941 56269 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcaagctagagcaaaagaacaagcgagagctgagg >Feature sequence18 1224 166 gene locus_tag LOCUS_19050 1224 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1372 2184 gene locus_tag LOCUS_19060 1372 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 3092 2277 gene locus_tag LOCUS_19070 gene folE2 3092 2277 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JF5 protein_id gnl|my_center|LOCUS_19070 5018 3102 gene locus_tag LOCUS_19080 gene dxs 5018 3102 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KGU7 protein_id gnl|my_center|LOCUS_19080 5896 5018 gene locus_tag LOCUS_19090 5896 5018 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568619.1 protein_id gnl|my_center|LOCUS_19090 6155 5937 gene locus_tag LOCUS_19100 6155 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 6706 6491 gene locus_tag LOCUS_19110 6706 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 6594 7688 gene locus_tag LOCUS_19120 6594 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 7798 9360 gene locus_tag LOCUS_19130 7798 9360 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 protein_id gnl|my_center|LOCUS_19130 9450 10466 gene locus_tag LOCUS_19140 9450 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087510.1 protein_id gnl|my_center|LOCUS_19140 11156 10542 gene locus_tag LOCUS_19150 gene satA 11156 10542 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071891.1 protein_id gnl|my_center|LOCUS_19150 11315 12073 gene locus_tag LOCUS_19160 11315 12073 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_19160 12080 13156 gene locus_tag LOCUS_19170 gene motB 12080 13156 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460634.1 protein_id gnl|my_center|LOCUS_19170 13288 13935 gene locus_tag LOCUS_19180 13288 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 14048 14788 gene locus_tag LOCUS_19190 14048 14788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021565.1 protein_id gnl|my_center|LOCUS_19190 14788 15021 gene locus_tag LOCUS_19200 14788 15021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 15066 15719 gene locus_tag LOCUS_19210 gene upp 15066 15719 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q831G0 protein_id gnl|my_center|LOCUS_19210 17305 15716 gene locus_tag LOCUS_19220 gene pbpB 17305 15716 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957390.1 protein_id gnl|my_center|LOCUS_19220 17459 17770 gene locus_tag LOCUS_19230 17459 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 17785 18177 gene locus_tag LOCUS_19240 17785 18177 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705756.1 protein_id gnl|my_center|LOCUS_19240 20176 18278 gene locus_tag LOCUS_19250 20176 18278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770433.1 protein_id gnl|my_center|LOCUS_19250 21065 20193 gene locus_tag LOCUS_19260 gene rbsK 21065 20193 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKN5 protein_id gnl|my_center|LOCUS_19260 21283 22791 gene locus_tag LOCUS_19270 gene xanB 21283 22791 CDS product xanthan biosynthesis protein XanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7J3 protein_id gnl|my_center|LOCUS_19270 23058 24296 gene locus_tag LOCUS_19280 23058 24296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 25011 25934 gene locus_tag LOCUS_19290 25011 25934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 26506 26108 gene locus_tag LOCUS_19300 26506 26108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 27595 27955 gene locus_tag LOCUS_tm00010 27595 27955 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 27993 28166 gene locus_tag LOCUS_19310 27993 28166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 29463 28156 gene locus_tag LOCUS_19320 29463 28156 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174384.1 protein_id gnl|my_center|LOCUS_19320 29717 29466 gene locus_tag LOCUS_19330 29717 29466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 30418 30230 gene locus_tag LOCUS_19340 30418 30230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 34027 30449 gene locus_tag LOCUS_19350 34027 30449 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602654.1 protein_id gnl|my_center|LOCUS_19350 34478 35470 gene locus_tag LOCUS_19360 34478 35470 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074147.1 protein_id gnl|my_center|LOCUS_19360 37001 36738 gene locus_tag LOCUS_19370 37001 36738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 37596 37375 gene locus_tag LOCUS_19380 37596 37375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 38333 38100 gene locus_tag LOCUS_19390 38333 38100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 38618 39724 gene locus_tag LOCUS_19400 38618 39724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 39861 41681 gene locus_tag LOCUS_19410 39861 41681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 42864 41683 gene locus_tag LOCUS_19420 42864 41683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 43174 44745 gene locus_tag LOCUS_19430 43174 44745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 45247 44780 gene locus_tag LOCUS_19440 gene smpB 45247 44780 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRP1 protein_id gnl|my_center|LOCUS_19440 45357 45803 gene locus_tag LOCUS_19450 gene yfjG 45357 45803 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 protein_id gnl|my_center|LOCUS_19450 45793 46101 gene locus_tag LOCUS_19460 45793 46101 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI82 protein_id gnl|my_center|LOCUS_19460 46463 46098 gene locus_tag LOCUS_19470 46463 46098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 46677 47108 gene locus_tag LOCUS_19480 gene fur 46677 47108 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence19 251 505 gene locus_tag LOCUS_19490 251 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 639 992 gene locus_tag LOCUS_19500 639 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 1965 1066 gene locus_tag LOCUS_19510 1965 1066 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972748.1 protein_id gnl|my_center|LOCUS_19510 2309 3073 gene locus_tag LOCUS_19520 2309 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 3339 5336 gene locus_tag LOCUS_19530 3339 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 5888 5349 gene locus_tag LOCUS_19540 5888 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 6198 6761 gene locus_tag LOCUS_19550 6198 6761 CDS product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142227.1 protein_id gnl|my_center|LOCUS_19550 7059 6853 gene locus_tag LOCUS_19560 gene cspG 7059 6853 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 protein_id gnl|my_center|LOCUS_19560 8059 7490 gene locus_tag LOCUS_19570 8059 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 8311 9420 gene locus_tag LOCUS_19580 8311 9420 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_19580 10505 11023 gene locus_tag LOCUS_19590 10505 11023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19590 11283 11684 gene locus_tag LOCUS_19600 11283 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 11734 12057 gene locus_tag LOCUS_19610 11734 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 12257 13093 gene locus_tag LOCUS_19620 12257 13093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 14057 13215 gene locus_tag LOCUS_19630 14057 13215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 15335 16435 gene locus_tag LOCUS_19640 15335 16435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 16990 16544 gene locus_tag LOCUS_19650 16990 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 17290 17859 gene locus_tag LOCUS_19660 gene lemA 17290 17859 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209691.1 protein_id gnl|my_center|LOCUS_19660 17881 19779 gene locus_tag LOCUS_19670 17881 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869266.1 protein_id gnl|my_center|LOCUS_19670 20296 21870 gene locus_tag LOCUS_19680 gene tlcA 20296 21870 CDS product ADP,ATP carrier protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84068 protein_id gnl|my_center|LOCUS_19680 22201 23643 gene locus_tag LOCUS_19690 22201 23643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 23999 24499 gene locus_tag LOCUS_19700 23999 24499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 24847 26118 gene locus_tag LOCUS_19710 gene rocG 24847 26118 CDS product catabolic NAD-specific glutamate dehydrogenase RocG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39633 protein_id gnl|my_center|LOCUS_19710 26200 27558 gene locus_tag LOCUS_19720 26200 27558 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7W9 protein_id gnl|my_center|LOCUS_19720 27559 28584 gene locus_tag LOCUS_19730 27559 28584 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 protein_id gnl|my_center|LOCUS_19730 28932 29666 gene locus_tag LOCUS_19740 28932 29666 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945820.1 protein_id gnl|my_center|LOCUS_19740 30198 29737 gene locus_tag LOCUS_19750 30198 29737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 30562 30275 gene locus_tag LOCUS_19760 30562 30275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_003858627.1 protein_id gnl|my_center|LOCUS_19760 31173 32312 gene locus_tag LOCUS_19770 31173 32312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 32505 33590 gene locus_tag LOCUS_19780 32505 33590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 33628 34188 gene locus_tag LOCUS_19790 33628 34188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_19790 34744 35622 gene locus_tag LOCUS_19800 34744 35622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 36935 35634 gene locus_tag LOCUS_19810 36935 35634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 37720 37211 gene locus_tag LOCUS_19820 37720 37211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 38257 37733 gene locus_tag LOCUS_19830 38257 37733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 38372 39247 gene locus_tag LOCUS_19840 gene rbcR 38372 39247 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 protein_id gnl|my_center|LOCUS_19840 39259 39810 gene locus_tag LOCUS_19850 gene kptA 39259 39810 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HH75 protein_id gnl|my_center|LOCUS_19850 40053 41141 gene locus_tag LOCUS_19860 40053 41141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 41131 41472 gene locus_tag LOCUS_19870 41131 41472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 42266 41511 gene locus_tag LOCUS_19880 42266 41511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 42631 45339 gene locus_tag LOCUS_19890 42631 45339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence20 498 1679 gene locus_tag LOCUS_19900 498 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2335 1676 gene locus_tag LOCUS_19910 gene gph 2335 1676 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_19910 3183 2353 gene locus_tag LOCUS_19920 gene ubiG 3183 2353 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820B5 protein_id gnl|my_center|LOCUS_19920 3295 5997 gene locus_tag LOCUS_19930 gene gyrA 3295 5997 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVM3 protein_id gnl|my_center|LOCUS_19930 6239 7324 gene locus_tag LOCUS_19940 gene serC 6239 7324 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81BC0 protein_id gnl|my_center|LOCUS_19940 7400 8749 gene locus_tag LOCUS_19950 gene aroA 7400 8749 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E11 protein_id gnl|my_center|LOCUS_19950 8750 9436 gene locus_tag LOCUS_19960 gene cmk 8750 9436 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH9 protein_id gnl|my_center|LOCUS_19960 9559 11265 gene locus_tag LOCUS_19970 gene rpsA 9559 11265 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMI7 protein_id gnl|my_center|LOCUS_19970 11601 11873 gene locus_tag LOCUS_19980 11601 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 11891 13060 gene locus_tag LOCUS_19990 gene lapB 11891 13060 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E07 protein_id gnl|my_center|LOCUS_19990 13169 13900 gene locus_tag LOCUS_20000 gene pyrF 13169 13900 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVL5 protein_id gnl|my_center|LOCUS_20000 13887 14936 gene locus_tag LOCUS_20010 13887 14936 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946499.1 protein_id gnl|my_center|LOCUS_20010 15294 17201 gene locus_tag LOCUS_20020 15294 17201 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946701.1 protein_id gnl|my_center|LOCUS_20020 17226 18119 gene locus_tag LOCUS_20030 17226 18119 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA14 protein_id gnl|my_center|LOCUS_20030 18237 18707 gene locus_tag LOCUS_20040 18237 18707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 18724 19539 gene locus_tag LOCUS_20050 18724 19539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 20519 19581 gene locus_tag LOCUS_20060 20519 19581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141888.1 protein_id gnl|my_center|LOCUS_20060 22068 20698 gene locus_tag LOCUS_20070 22068 20698 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958618.1 protein_id gnl|my_center|LOCUS_20070 24228 22078 gene locus_tag LOCUS_20080 gene rtxB 24228 22078 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263952.1 protein_id gnl|my_center|LOCUS_20080 25828 24236 gene locus_tag LOCUS_20090 25828 24236 CDS product toxin ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073843.1 protein_id gnl|my_center|LOCUS_20090 25713 26000 gene locus_tag LOCUS_20100 25713 26000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 26224 27816 gene locus_tag LOCUS_20110 26224 27816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 29119 27875 gene locus_tag LOCUS_20120 29119 27875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 29593 29252 gene locus_tag LOCUS_20130 29593 29252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 30039 29620 gene locus_tag LOCUS_20140 30039 29620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20140 31217 30054 gene locus_tag LOCUS_20150 31217 30054 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_20150 32736 31195 gene locus_tag LOCUS_20160 32736 31195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 33194 33529 gene locus_tag LOCUS_20170 33194 33529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 33970 33895 gene locus_tag LOCUS_t00250 33970 33895 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 35240 34062 gene locus_tag LOCUS_20180 gene aspC 35240 34062 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_20180 35326 37374 gene locus_tag LOCUS_20190 gene uvrB 35326 37374 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83E18 protein_id gnl|my_center|LOCUS_20190 37462 37536 gene locus_tag LOCUS_t00260 37462 37536 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 37698 37880 gene locus_tag LOCUS_20200 37698 37880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 >Feature sequence21 294 1799 gene locus_tag LOCUS_20210 294 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2109 1816 gene locus_tag LOCUS_20220 2109 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2247 7928 gene locus_tag LOCUS_20230 2247 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 8426 7956 gene locus_tag LOCUS_20240 8426 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946130.1 protein_id gnl|my_center|LOCUS_20240 8777 8487 gene locus_tag LOCUS_20250 8777 8487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 10283 8808 gene locus_tag LOCUS_20260 gene glsF 10283 8808 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_20260 10461 11048 gene locus_tag LOCUS_20270 10461 11048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 23778 11110 gene locus_tag LOCUS_20280 23778 11110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 24128 24814 gene locus_tag LOCUS_20290 gene com1 24128 24814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947567.1 protein_id gnl|my_center|LOCUS_20290 29451 24841 gene locus_tag LOCUS_20300 29451 24841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 30500 29646 gene locus_tag LOCUS_20310 30500 29646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 30830 30513 gene locus_tag LOCUS_20320 30830 30513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 30920 32218 gene locus_tag LOCUS_20330 30920 32218 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_20330 32208 33149 gene locus_tag LOCUS_20340 gene gshB 32208 33149 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZ65 protein_id gnl|my_center|LOCUS_20340 33449 33165 gene locus_tag LOCUS_20350 33449 33165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 35485 33467 gene locus_tag LOCUS_20360 35485 33467 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707122.1 protein_id gnl|my_center|LOCUS_20360 35585 36145 gene locus_tag LOCUS_20370 35585 36145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 36135 37091 gene locus_tag LOCUS_20380 36135 37091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence22 428 102 gene locus_tag LOCUS_20390 428 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2096 699 gene locus_tag LOCUS_20400 2096 699 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946153.1 protein_id gnl|my_center|LOCUS_20400 2199 3287 gene locus_tag LOCUS_20410 2199 3287 CDS product L-lysine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947080.1 protein_id gnl|my_center|LOCUS_20410 3403 4932 gene locus_tag LOCUS_20420 3403 4932 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_20420 4974 6656 gene locus_tag LOCUS_20430 gene fadD 4974 6656 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZES9 protein_id gnl|my_center|LOCUS_20430 7205 6762 gene locus_tag LOCUS_20440 7205 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 8029 7202 gene locus_tag LOCUS_20450 gene minD 8029 7202 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE13 protein_id gnl|my_center|LOCUS_20450 8842 8066 gene locus_tag LOCUS_20460 gene minC 8842 8066 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW11 protein_id gnl|my_center|LOCUS_20460 9028 11103 gene locus_tag LOCUS_20470 9028 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 11312 12316 gene locus_tag LOCUS_20480 11312 12316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 12919 12344 gene locus_tag LOCUS_20490 12919 12344 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948431.1 protein_id gnl|my_center|LOCUS_20490 15505 13007 gene locus_tag LOCUS_20500 gene fadE 15505 13007 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705468.1 protein_id gnl|my_center|LOCUS_20500 15744 17213 gene locus_tag LOCUS_20510 15744 17213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 22496 17220 gene locus_tag LOCUS_20520 22496 17220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 22745 24787 gene locus_tag LOCUS_20530 22745 24787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 25796 24789 gene locus_tag LOCUS_20540 gene add 25796 24789 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 protein_id gnl|my_center|LOCUS_20540 28425 25810 gene locus_tag LOCUS_20550 gene mutS 28425 25810 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CQ2 protein_id gnl|my_center|LOCUS_20550 28572 29678 gene locus_tag LOCUS_20560 gene recA 28572 29678 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CQ4 protein_id gnl|my_center|LOCUS_20560 29696 30169 gene locus_tag LOCUS_20570 gene recX 29696 30169 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37860 protein_id gnl|my_center|LOCUS_20570 30251 32848 gene locus_tag LOCUS_20580 gene alaS 30251 32848 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UBU3 protein_id gnl|my_center|LOCUS_20580 32972 34174 gene locus_tag LOCUS_20590 32972 34174 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQI5 protein_id gnl|my_center|LOCUS_20590 34248 34457 gene locus_tag LOCUS_20600 gene csrA 34248 34457 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUH3 protein_id gnl|my_center|LOCUS_20600 34577 34669 gene locus_tag LOCUS_t00270 34577 34669 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 35016 35092 gene locus_tag LOCUS_t00280 35016 35092 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 148 663 gene locus_tag LOCUS_20610 148 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 918 2180 gene locus_tag LOCUS_20620 918 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 3313 2261 gene locus_tag LOCUS_20630 3313 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 5001 3409 gene locus_tag LOCUS_20640 5001 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 5272 6285 gene locus_tag LOCUS_20650 gene lipA 5272 6285 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXI6 protein_id gnl|my_center|LOCUS_20650 6578 6324 gene locus_tag LOCUS_20660 6578 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 8184 10643 gene locus_tag LOCUS_20670 8184 10643 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947290.1 protein_id gnl|my_center|LOCUS_20670 11475 10600 gene locus_tag LOCUS_20680 11475 10600 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_20680 11590 12330 gene locus_tag LOCUS_20690 11590 12330 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461720.1 protein_id gnl|my_center|LOCUS_20690 12399 13466 gene locus_tag LOCUS_20700 12399 13466 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_20700 13988 13518 gene locus_tag LOCUS_20710 13988 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 14434 16491 gene locus_tag LOCUS_20720 gene dsbD 14434 16491 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_224981.1 protein_id gnl|my_center|LOCUS_20720 16506 17126 gene locus_tag LOCUS_20730 16506 17126 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_20730 17774 17127 gene locus_tag LOCUS_20740 17774 17127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 20480 18159 gene locus_tag LOCUS_20750 20480 18159 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947290.1 protein_id gnl|my_center|LOCUS_20750 21752 20544 gene locus_tag LOCUS_20760 21752 20544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 22233 21772 gene locus_tag LOCUS_20770 22233 21772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 22646 22230 gene locus_tag LOCUS_20780 22646 22230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 23197 22643 gene locus_tag LOCUS_20790 23197 22643 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_20790 23622 23254 gene locus_tag LOCUS_20800 23622 23254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 23759 26542 gene locus_tag LOCUS_20810 23759 26542 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958545.1 protein_id gnl|my_center|LOCUS_20810 27707 26637 gene locus_tag LOCUS_20820 27707 26637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 28728 27721 gene locus_tag LOCUS_20830 28728 27721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 28906 30159 gene locus_tag LOCUS_20840 28906 30159 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268576.1 protein_id gnl|my_center|LOCUS_20840 30827 30207 gene locus_tag LOCUS_20850 30827 30207 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466562.1 protein_id gnl|my_center|LOCUS_20850 31085 32482 gene locus_tag LOCUS_20860 gene asnS 31085 32482 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT80 protein_id gnl|my_center|LOCUS_20860 >Feature sequence24 1689 1486 gene locus_tag LOCUS_20870 1689 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 1919 2437 gene locus_tag LOCUS_20880 1919 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2448 2654 gene locus_tag LOCUS_20890 2448 2654 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262957.1 protein_id gnl|my_center|LOCUS_20890 3083 2862 gene locus_tag LOCUS_20900 3083 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 4357 4695 gene locus_tag LOCUS_20910 4357 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 5173 4739 gene locus_tag LOCUS_20920 5173 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 5839 5186 gene locus_tag LOCUS_20930 5839 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 6415 7677 gene locus_tag LOCUS_20940 6415 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 7690 7884 gene locus_tag LOCUS_20950 7690 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 8281 8478 gene locus_tag LOCUS_20960 8281 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 8480 8788 gene locus_tag LOCUS_20970 8480 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 8788 9081 gene locus_tag LOCUS_20980 8788 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 9078 11462 gene locus_tag LOCUS_20990 9078 11462 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920277.1 protein_id gnl|my_center|LOCUS_20990 11452 12165 gene locus_tag LOCUS_21000 11452 12165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 12313 13305 gene locus_tag LOCUS_21010 gene virB6 12313 13305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946982.1 protein_id gnl|my_center|LOCUS_21010 13307 13999 gene locus_tag LOCUS_21020 13307 13999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 14011 14772 gene locus_tag LOCUS_21030 14011 14772 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264001.1 protein_id gnl|my_center|LOCUS_21030 14769 15773 gene locus_tag LOCUS_21040 14769 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 15770 16765 gene locus_tag LOCUS_21050 15770 16765 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920281.1 protein_id gnl|my_center|LOCUS_21050 16768 18444 gene locus_tag LOCUS_21060 16768 18444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 18510 21197 gene locus_tag LOCUS_21070 18510 21197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 21190 22299 gene locus_tag LOCUS_21080 21190 22299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 22451 23443 gene locus_tag LOCUS_21090 22451 23443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 23633 24862 gene locus_tag LOCUS_21100 23633 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 25312 24911 gene locus_tag LOCUS_21110 25312 24911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 25892 25599 gene locus_tag LOCUS_21120 25892 25599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 26160 29366 gene locus_tag LOCUS_21130 26160 29366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 29771 29541 gene locus_tag LOCUS_21140 29771 29541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 29901 30497 gene locus_tag LOCUS_21150 29901 30497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 30866 31006 gene locus_tag LOCUS_21160 30866 31006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 31928 31137 gene locus_tag LOCUS_21170 gene blaA 31928 31137 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIK2 protein_id gnl|my_center|LOCUS_21170 32325 31930 gene locus_tag LOCUS_21180 32325 31930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 32568 32903 gene locus_tag LOCUS_21190 32568 32903 CDS product bacteriophage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205297.1 protein_id gnl|my_center|LOCUS_21190 32896 33204 gene locus_tag LOCUS_21200 32896 33204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence25 414 127 gene locus_tag LOCUS_21210 414 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 690 614 gene locus_tag LOCUS_t00290 690 614 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2638 767 gene locus_tag LOCUS_21220 gene rpoD 2638 767 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGI7 protein_id gnl|my_center|LOCUS_21220 4573 2810 gene locus_tag LOCUS_21230 gene dnaG 4573 2810 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A59 protein_id gnl|my_center|LOCUS_21230 5142 4690 gene locus_tag LOCUS_21240 5142 4690 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_21240 5476 5189 gene locus_tag LOCUS_21250 5476 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 5752 6762 gene locus_tag LOCUS_21260 gene tsaD 5752 6762 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQW9 protein_id gnl|my_center|LOCUS_21260 7400 6792 gene locus_tag LOCUS_21270 gene plsY 7400 6792 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFU6 protein_id gnl|my_center|LOCUS_21270 7527 7886 gene locus_tag LOCUS_21280 7527 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 7876 9036 gene locus_tag LOCUS_21290 7876 9036 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_21290 10333 9086 gene locus_tag LOCUS_21300 gene cca 10333 9086 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW05 protein_id gnl|my_center|LOCUS_21300 10845 10318 gene locus_tag LOCUS_21310 10845 10318 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF77 protein_id gnl|my_center|LOCUS_21310 12299 10890 gene locus_tag LOCUS_21320 12299 10890 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_21320 13646 12312 gene locus_tag LOCUS_21330 13646 12312 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_21330 13809 15035 gene locus_tag LOCUS_21340 13809 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 15079 15780 gene locus_tag LOCUS_21350 gene ftsE 15079 15780 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769957.1 protein_id gnl|my_center|LOCUS_21350 15773 16795 gene locus_tag LOCUS_21360 gene ftsX 15773 16795 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83AI1 protein_id gnl|my_center|LOCUS_21360 16829 18040 gene locus_tag LOCUS_21370 16829 18040 CDS product tryptophan/tyrosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946392.1 protein_id gnl|my_center|LOCUS_21370 18075 18686 gene locus_tag LOCUS_21380 18075 18686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 18756 19202 gene locus_tag LOCUS_21390 18756 19202 CDS product glyoxalase/bleomycin resistance protein/dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527755.1 protein_id gnl|my_center|LOCUS_21390 19248 20012 gene locus_tag LOCUS_21400 19248 20012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 20713 20036 gene locus_tag LOCUS_21410 20713 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 22273 20804 gene locus_tag LOCUS_21420 22273 20804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 23179 22397 gene locus_tag LOCUS_21430 23179 22397 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918217.1 protein_id gnl|my_center|LOCUS_21430 23571 23236 gene locus_tag LOCUS_21440 23571 23236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 25029 23572 gene locus_tag LOCUS_21450 25029 23572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 25628 25080 gene locus_tag LOCUS_21460 25628 25080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 25874 26902 gene locus_tag LOCUS_21470 gene bioB 25874 26902 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM71 protein_id gnl|my_center|LOCUS_21470 26892 27731 gene locus_tag LOCUS_21480 gene bioC 26892 27731 CDS product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZT34 protein_id gnl|my_center|LOCUS_21480 29398 27776 gene locus_tag LOCUS_21490 29398 27776 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence26 491 162 gene locus_tag LOCUS_21500 491 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 7012 458 gene locus_tag LOCUS_21510 7012 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 7394 8524 gene locus_tag LOCUS_21520 7394 8524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 10267 8828 gene locus_tag LOCUS_21530 10267 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 10607 12055 gene locus_tag LOCUS_21540 10607 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 12940 12149 gene locus_tag LOCUS_21550 12940 12149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476068.1 protein_id gnl|my_center|LOCUS_21550 13447 13217 gene locus_tag LOCUS_21560 13447 13217 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359683.1 protein_id gnl|my_center|LOCUS_21560 13755 14141 gene locus_tag LOCUS_21570 13755 14141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 14652 14323 gene locus_tag LOCUS_21580 14652 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 14807 15310 gene locus_tag LOCUS_21590 14807 15310 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095427.1 protein_id gnl|my_center|LOCUS_21590 15964 15743 gene locus_tag LOCUS_21600 15964 15743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 16564 16151 gene locus_tag LOCUS_21610 16564 16151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 18999 16834 gene locus_tag LOCUS_21620 18999 16834 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EP48 protein_id gnl|my_center|LOCUS_21620 21829 19076 gene locus_tag LOCUS_21630 gene traA 21829 19076 CDS product Ti-type conjugative transfer relaxase TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946973.1 protein_id gnl|my_center|LOCUS_21630 22072 22290 gene locus_tag LOCUS_21640 22072 22290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 22274 22570 gene locus_tag LOCUS_21650 22274 22570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 22479 22997 gene locus_tag LOCUS_21660 22479 22997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 23222 23028 gene locus_tag LOCUS_21670 23222 23028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 24140 23262 gene locus_tag LOCUS_21680 24140 23262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 25152 24142 gene locus_tag LOCUS_21690 25152 24142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 26312 25146 gene locus_tag LOCUS_21700 gene sopA 26312 25146 CDS product protein SopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62557 protein_id gnl|my_center|LOCUS_21700 >Feature sequence27 234 707 gene locus_tag LOCUS_21710 234 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1154 699 gene locus_tag LOCUS_21720 1154 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2100 1162 gene locus_tag LOCUS_21730 gene kka 2100 1162 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972041.1 protein_id gnl|my_center|LOCUS_21730 2196 2546 gene locus_tag LOCUS_21740 2196 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 3791 2598 gene locus_tag LOCUS_21750 3791 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 4101 5189 gene locus_tag LOCUS_21760 4101 5189 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533906.1 protein_id gnl|my_center|LOCUS_21760 5853 5203 gene locus_tag LOCUS_21770 5853 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 7216 5855 gene locus_tag LOCUS_21780 7216 5855 CDS product proline permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_224682.1 protein_id gnl|my_center|LOCUS_21780 8311 7565 gene locus_tag LOCUS_21790 8311 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 8489 8905 gene locus_tag LOCUS_21800 8489 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 10264 8951 gene locus_tag LOCUS_21810 gene pqsH 10264 8951 CDS product 2-heptyl-3-hydroxy-4(1H)-quinolone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q0 protein_id gnl|my_center|LOCUS_21810 10448 12085 gene locus_tag LOCUS_21820 10448 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 13192 12188 gene locus_tag LOCUS_21830 13192 12188 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256567.1 protein_id gnl|my_center|LOCUS_21830 14064 13210 gene locus_tag LOCUS_21840 14064 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 15908 14064 gene locus_tag LOCUS_21850 15908 14064 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230338.1 protein_id gnl|my_center|LOCUS_21850 16262 17689 gene locus_tag LOCUS_21860 16262 17689 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457381.1 protein_id gnl|my_center|LOCUS_21860 17704 18318 gene locus_tag LOCUS_21870 gene ccoO 17704 18318 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261904.1 protein_id gnl|my_center|LOCUS_21870 18315 18488 gene locus_tag LOCUS_21880 18315 18488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 18481 19392 gene locus_tag LOCUS_21890 gene ccoP 18481 19392 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEL8 protein_id gnl|my_center|LOCUS_21890 20019 20798 gene locus_tag LOCUS_21900 20019 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 20803 21000 gene locus_tag LOCUS_21910 20803 21000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 21068 23482 gene locus_tag LOCUS_21920 21068 23482 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361687.1 protein_id gnl|my_center|LOCUS_21920 23499 23684 gene locus_tag LOCUS_21930 23499 23684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087273.1 protein_id gnl|my_center|LOCUS_21930 23674 24375 gene locus_tag LOCUS_21940 23674 24375 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268429.1 protein_id gnl|my_center|LOCUS_21940 24560 25717 gene locus_tag LOCUS_21950 24560 25717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 25896 26921 gene locus_tag LOCUS_21960 25896 26921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence28 <1 5585 gene locus_tag LOCUS_21970 <1 5585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P40872:polyketide synthase PksM 6769 5606 gene locus_tag LOCUS_21980 6769 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_21980 7222 6971 gene locus_tag LOCUS_21990 7222 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 8013 7735 gene locus_tag LOCUS_22000 8013 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 8825 8172 gene locus_tag LOCUS_22010 8825 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 8995 16992 gene locus_tag LOCUS_22020 8995 16992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 17049 18224 gene locus_tag LOCUS_22030 17049 18224 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886352.1 protein_id gnl|my_center|LOCUS_22030 21425 18315 gene locus_tag LOCUS_22040 21425 18315 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389804.1 protein_id gnl|my_center|LOCUS_22040 22556 21429 gene locus_tag LOCUS_22050 22556 21429 CDS product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545408.1 protein_id gnl|my_center|LOCUS_22050 23232 23432 gene locus_tag LOCUS_22060 23232 23432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 23555 23854 gene locus_tag LOCUS_22070 23555 23854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112569.1 protein_id gnl|my_center|LOCUS_22070 24085 24225 gene locus_tag LOCUS_22080 24085 24225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence29 1569 550 gene locus_tag LOCUS_22090 1569 550 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886238.1 protein_id gnl|my_center|LOCUS_22090 3024 1582 gene locus_tag LOCUS_22100 3024 1582 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598577.1 protein_id gnl|my_center|LOCUS_22100 3507 3136 gene locus_tag LOCUS_22110 3507 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 4498 3512 gene locus_tag LOCUS_22120 4498 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 5929 4706 gene locus_tag LOCUS_22130 5929 4706 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948218.1 protein_id gnl|my_center|LOCUS_22130 6228 7040 gene locus_tag LOCUS_22140 6228 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 7285 8580 gene locus_tag LOCUS_22150 7285 8580 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873658.1 protein_id gnl|my_center|LOCUS_22150 9309 8707 gene locus_tag LOCUS_22160 9309 8707 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_22160 9551 11086 gene locus_tag LOCUS_22170 9551 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 11660 11109 gene locus_tag LOCUS_22180 11660 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 11791 12540 gene locus_tag LOCUS_22190 gene adk 11791 12540 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24323 protein_id gnl|my_center|LOCUS_22190 13427 12603 gene locus_tag LOCUS_22200 13427 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 13406 13570 gene locus_tag LOCUS_22210 13406 13570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 13596 13793 gene locus_tag LOCUS_22220 13596 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 13735 13893 gene locus_tag LOCUS_22230 13735 13893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 15554 13941 gene locus_tag LOCUS_22240 15554 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 15982 17421 gene locus_tag LOCUS_22250 gene rhlE 15982 17421 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAV8 protein_id gnl|my_center|LOCUS_22250 18929 17505 gene locus_tag LOCUS_22260 18929 17505 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_22260 20569 18917 gene locus_tag LOCUS_22270 20569 18917 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_22270 20804 22066 gene locus_tag LOCUS_22280 20804 22066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 22473 22123 gene locus_tag LOCUS_22290 22473 22123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence30 1175 156 gene locus_tag LOCUS_22300 1175 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2145 1402 gene locus_tag LOCUS_22310 2145 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 4189 2333 gene locus_tag LOCUS_22320 4189 2333 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368616.1 protein_id gnl|my_center|LOCUS_22320 6422 4200 gene locus_tag LOCUS_22330 6422 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113491.1 protein_id gnl|my_center|LOCUS_22330 7348 6635 gene locus_tag LOCUS_22340 7348 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036264.1 protein_id gnl|my_center|LOCUS_22340 7853 7329 gene locus_tag LOCUS_22350 7853 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036263.1 protein_id gnl|my_center|LOCUS_22350 9235 8189 gene locus_tag LOCUS_22360 9235 8189 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931304.1 protein_id gnl|my_center|LOCUS_22360 9926 9744 gene locus_tag LOCUS_22370 9926 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 10297 10091 gene locus_tag LOCUS_22380 10297 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 11044 10313 gene locus_tag LOCUS_22390 11044 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 11988 11044 gene locus_tag LOCUS_22400 11988 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 12726 12013 gene locus_tag LOCUS_22410 12726 12013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 13688 12729 gene locus_tag LOCUS_22420 13688 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 14595 14311 gene locus_tag LOCUS_22430 14595 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 15112 16245 gene locus_tag LOCUS_22440 15112 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 17141 16521 gene locus_tag LOCUS_22450 17141 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 17072 17485 gene locus_tag LOCUS_22460 17072 17485 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073406.1 protein_id gnl|my_center|LOCUS_22460 17500 18069 gene locus_tag LOCUS_22470 17500 18069 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197907.1 protein_id gnl|my_center|LOCUS_22470 18596 18309 gene locus_tag LOCUS_22480 18596 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 18744 18538 gene locus_tag LOCUS_22490 18744 18538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 19208 20551 gene locus_tag LOCUS_22500 19208 20551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 20912 20709 gene locus_tag LOCUS_22510 20912 20709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 21136 20912 gene locus_tag LOCUS_22520 21136 20912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 21879 21652 gene locus_tag LOCUS_22530 21879 21652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 22092 21934 gene locus_tag LOCUS_22540 22092 21934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence31 289 4035 gene locus_tag LOCUS_22550 289 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 4692 4042 gene locus_tag LOCUS_22560 gene lipB 4692 4042 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVC9 protein_id gnl|my_center|LOCUS_22560 4977 4705 gene locus_tag LOCUS_22570 4977 4705 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNA0 protein_id gnl|my_center|LOCUS_22570 6098 4977 gene locus_tag LOCUS_22580 6098 4977 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947238.1 protein_id gnl|my_center|LOCUS_22580 7166 6312 gene locus_tag LOCUS_22590 7166 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_22590 8175 7174 gene locus_tag LOCUS_22600 8175 7174 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947593.1 protein_id gnl|my_center|LOCUS_22600 8447 8947 gene locus_tag LOCUS_22610 8447 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 9175 9654 gene locus_tag LOCUS_22620 9175 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 10126 9725 gene locus_tag LOCUS_22630 10126 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 10621 12375 gene locus_tag LOCUS_22640 10621 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 13301 12384 gene locus_tag LOCUS_22650 13301 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22650 13979 13434 gene locus_tag LOCUS_22660 13979 13434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 14108 14569 gene locus_tag LOCUS_22670 14108 14569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_22670 14740 16560 gene locus_tag LOCUS_22680 gene typA 14740 16560 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_22680 17498 16638 gene locus_tag LOCUS_22690 17498 16638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 18166 17588 gene locus_tag LOCUS_22700 18166 17588 CDS product paraquat-inducible membrane protein PqiA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074296.1 protein_id gnl|my_center|LOCUS_22700 19602 18274 gene locus_tag LOCUS_22710 19602 18274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence32 568 1386 gene locus_tag LOCUS_22720 568 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 3377 1461 gene locus_tag LOCUS_22730 3377 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 5076 3661 gene locus_tag LOCUS_22740 gene lpdA 5076 3661 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJN7 protein_id gnl|my_center|LOCUS_22740 6774 5092 gene locus_tag LOCUS_22750 gene aceF 6774 5092 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEX3 protein_id gnl|my_center|LOCUS_22750 9453 6793 gene locus_tag LOCUS_22760 gene aceE 9453 6793 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVD6 protein_id gnl|my_center|LOCUS_22760 10074 9508 gene locus_tag LOCUS_22770 10074 9508 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567318.1 protein_id gnl|my_center|LOCUS_22770 10301 10849 gene locus_tag LOCUS_22780 10301 10849 CDS product aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105246.1 protein_id gnl|my_center|LOCUS_22780 11330 10872 gene locus_tag LOCUS_22790 11330 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 13486 11474 gene locus_tag LOCUS_22800 13486 11474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 14375 13809 gene locus_tag LOCUS_22810 14375 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 16213 14993 gene locus_tag LOCUS_22820 16213 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 16705 17598 gene locus_tag LOCUS_22830 16705 17598 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707863.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence33 837 169 gene locus_tag LOCUS_22840 837 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 4427 1392 gene locus_tag LOCUS_22850 4427 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 5703 4651 gene locus_tag LOCUS_22860 5703 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 6721 5840 gene locus_tag LOCUS_22870 6721 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 8280 6937 gene locus_tag LOCUS_22880 8280 6937 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTF6 protein_id gnl|my_center|LOCUS_22880 8794 8579 gene locus_tag LOCUS_22890 8794 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 10202 9159 gene locus_tag LOCUS_22900 10202 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461870.1 protein_id gnl|my_center|LOCUS_22900 10527 10213 gene locus_tag LOCUS_22910 10527 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 10861 10992 gene locus_tag LOCUS_22920 10861 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 12465 11122 gene locus_tag LOCUS_22930 12465 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_22930 12888 12469 gene locus_tag LOCUS_22940 12888 12469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 15272 12885 gene locus_tag LOCUS_22950 15272 12885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205278.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence34 1101 151 gene locus_tag LOCUS_22960 gene hldD 1101 151 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQV3 protein_id gnl|my_center|LOCUS_22960 2546 1098 gene locus_tag LOCUS_22970 gene hldE 2546 1098 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05074 protein_id gnl|my_center|LOCUS_22970 3306 2605 gene locus_tag LOCUS_22980 3306 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 4120 3272 gene locus_tag LOCUS_22990 4120 3272 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657976.1 protein_id gnl|my_center|LOCUS_22990 5352 4117 gene locus_tag LOCUS_23000 5352 4117 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958356.1 protein_id gnl|my_center|LOCUS_23000 6421 5345 gene locus_tag LOCUS_23010 6421 5345 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266460.1 protein_id gnl|my_center|LOCUS_23010 7449 6424 gene locus_tag LOCUS_23020 7449 6424 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266459.1 protein_id gnl|my_center|LOCUS_23020 7666 7463 gene locus_tag LOCUS_23030 7666 7463 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958359.1 protein_id gnl|my_center|LOCUS_23030 8833 7904 gene locus_tag LOCUS_23040 gene ilvE 8833 7904 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188924.1 protein_id gnl|my_center|LOCUS_23040 11861 9006 gene locus_tag LOCUS_23050 gene glnE 11861 9006 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF4 protein_id gnl|my_center|LOCUS_23050 12319 11867 gene locus_tag LOCUS_23060 12319 11867 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090474.1 protein_id gnl|my_center|LOCUS_23060 13239 12322 gene locus_tag LOCUS_23070 13239 12322 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888774.1 protein_id gnl|my_center|LOCUS_23070 13467 14648 gene locus_tag LOCUS_23080 13467 14648 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400837.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence35 1904 474 gene locus_tag LOCUS_23090 1904 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2605 1961 gene locus_tag LOCUS_23100 2605 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 2832 3617 gene locus_tag LOCUS_23110 2832 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 3843 3634 gene locus_tag LOCUS_23120 3843 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 5980 4103 gene locus_tag LOCUS_23130 5980 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 6897 5977 gene locus_tag LOCUS_23140 6897 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 7093 6878 gene locus_tag LOCUS_23150 7093 6878 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209920.1 protein_id gnl|my_center|LOCUS_23150 9078 7555 gene locus_tag LOCUS_23160 9078 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_23160 9758 11098 gene locus_tag LOCUS_23170 9758 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 11709 11113 gene locus_tag LOCUS_23180 11709 11113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 12595 11645 gene locus_tag LOCUS_23190 12595 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702827.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence36 2445 244 gene locus_tag LOCUS_23200 2445 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3301 2492 gene locus_tag LOCUS_23210 3301 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 4038 3298 gene locus_tag LOCUS_23220 4038 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357807.1 protein_id gnl|my_center|LOCUS_23220 5522 4038 gene locus_tag LOCUS_23230 5522 4038 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880885.1 protein_id gnl|my_center|LOCUS_23230 5797 6015 gene locus_tag LOCUS_23240 5797 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 6362 8626 gene locus_tag LOCUS_23250 6362 8626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 8709 10511 gene locus_tag LOCUS_23260 8709 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 10511 10981 gene locus_tag LOCUS_23270 10511 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 12274 11048 gene locus_tag LOCUS_23280 12274 11048 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946961.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence37 1627 230 gene locus_tag LOCUS_23290 gene nhaA 1627 230 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26076 protein_id gnl|my_center|LOCUS_23290 2128 1661 gene locus_tag LOCUS_23300 gene guaD 2128 1661 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34598 protein_id gnl|my_center|LOCUS_23300 3161 2196 gene locus_tag LOCUS_23310 gene glsA 3161 2196 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYX0 protein_id gnl|my_center|LOCUS_23310 3702 3259 gene locus_tag LOCUS_23320 3702 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 4567 3863 gene locus_tag LOCUS_23330 gene ung 4567 3863 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M915 protein_id gnl|my_center|LOCUS_23330 5938 4637 gene locus_tag LOCUS_23340 5938 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 6053 6694 gene locus_tag LOCUS_23350 gene mutH 6053 6694 CDS product DNA mismatch repair protein MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG28 protein_id gnl|my_center|LOCUS_23350 7502 6600 gene locus_tag LOCUS_23360 7502 6600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 7983 7450 gene locus_tag LOCUS_23370 7983 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 8379 9578 gene locus_tag LOCUS_23380 8379 9578 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83FC6 protein_id gnl|my_center|LOCUS_23380 9710 9883 gene locus_tag LOCUS_23390 9710 9883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence38 733 119 gene locus_tag LOCUS_23400 733 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23400 1649 942 gene locus_tag LOCUS_23410 1649 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2799 1675 gene locus_tag LOCUS_23420 gene dnaJ 2799 1675 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HV44 protein_id gnl|my_center|LOCUS_23420 4885 2945 gene locus_tag LOCUS_23430 gene dnaK 4885 2945 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87712 protein_id gnl|my_center|LOCUS_23430 5649 5002 gene locus_tag LOCUS_23440 gene grpE 5649 5002 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RX5 protein_id gnl|my_center|LOCUS_23440 6782 5742 gene locus_tag LOCUS_23450 gene hrcA 6782 5742 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAL1 protein_id gnl|my_center|LOCUS_23450 7009 7887 gene locus_tag LOCUS_23460 gene nadK 7009 7887 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YK2 protein_id gnl|my_center|LOCUS_23460 7912 9597 gene locus_tag LOCUS_23470 7912 9597 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNP5 protein_id gnl|my_center|LOCUS_23470 >Feature sequence39 1358 309 gene locus_tag LOCUS_23480 1358 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 1896 2363 gene locus_tag LOCUS_23490 1896 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 3414 7577 gene locus_tag LOCUS_23500 3414 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 7782 7958 gene locus_tag LOCUS_23510 7782 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 8555 9346 gene locus_tag LOCUS_23520 8555 9346 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071191.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23520 >Feature sequence40 351 2186 gene locus_tag LOCUS_23530 351 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 2652 2404 gene locus_tag LOCUS_23540 2652 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 3266 4213 gene locus_tag LOCUS_23550 3266 4213 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_23550 4504 4887 gene locus_tag LOCUS_23560 4504 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 4887 5276 gene locus_tag LOCUS_23570 4887 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 5866 5249 gene locus_tag LOCUS_23580 5866 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 6150 6013 gene locus_tag LOCUS_23590 6150 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23590 >Feature sequence41 882 487 gene locus_tag LOCUS_23600 882 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948162.1 protein_id gnl|my_center|LOCUS_23600 2402 1560 gene locus_tag LOCUS_23610 2402 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 3116 5128 gene locus_tag LOCUS_23620 3116 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 6289 5180 gene locus_tag LOCUS_23630 6289 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence42 834 196 gene locus_tag LOCUS_23640 834 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2469 1126 gene locus_tag LOCUS_23650 2469 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_23650 2928 3812 gene locus_tag LOCUS_23660 2928 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 5672 3966 gene locus_tag LOCUS_23670 5672 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence43 527 231 gene locus_tag LOCUS_23680 527 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 2703 694 gene locus_tag LOCUS_23690 2703 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 4574 3189 gene locus_tag LOCUS_23700 4574 3189 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119251.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence44 83 499 gene locus_tag LOCUS_23710 83 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 499 912 gene locus_tag LOCUS_23720 499 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 2501 888 gene locus_tag LOCUS_23730 2501 888 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105416.1 protein_id gnl|my_center|LOCUS_23730 2915 3673 gene locus_tag LOCUS_23740 2915 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence45 1605 595 gene locus_tag LOCUS_23750 1605 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2742 2002 gene locus_tag LOCUS_23760 2742 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence46 >Feature sequence47 705 229 gene locus_tag LOCUS_23770 705 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 1681 761 gene locus_tag LOCUS_23780 1681 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084728.1 protein_id gnl|my_center|LOCUS_23780 2364 1678 gene locus_tag LOCUS_23790 2364 1678 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_23790 >Feature sequence48 411 848 gene locus_tag LOCUS_23800 411 848 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 protein_id gnl|my_center|LOCUS_23800 1231 1671 gene locus_tag LOCUS_23810 1231 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810