COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..26349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1026..3311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(3552..5819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 note possible pseudo, frameshifted CDS complement(5906..11941) product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266335.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 12277..13623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(14483..15901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637910.2 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 16191..18317 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBL0 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene katE CDS 18347..18955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(19105..20100) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(20150..21619) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W82 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene argH CDS 21669..22865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 22862..23611 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038604.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene algR CDS complement(23626..23856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 23741..24025 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 sequence002 source 1..22340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1247..3742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 4048..6639 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SR9 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene mutS CDS 6698..9751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 9753..10016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(10035..11243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 11720..12547 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 12586..13425 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524730.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 13810..15615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(15668..16432) product putative outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AB80 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(16600..17424) product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTE2 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene uppP2 CDS 17836..18117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 18265..19533 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(19599..20966) product outer membrane efflux lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204730.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 note possible pseudo, internal stop codon CDS complement(21083..22339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 sequence003 source 1..21548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204914.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(715..1014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 1239..2804 product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVA8 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 2900..3751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522631.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(3778..4644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(4721..5794) product magnesium transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202565.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 5951..6865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089666.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 7195..8328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(8406..10001) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524162.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(10208..11233) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105224.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(11362..12414) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P955 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene purM CDS 12590..13288 product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196484.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 13361..14080 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194213.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 14135..15721 product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R52 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene pcnB CDS 15718..16227 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065009.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene folK CDS complement(16280..17257) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931671.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(17434..18504) product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 18703..19680 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(19665..20390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(20412..20894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 sequence004 source 1..20982 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..541 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194871.1:guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase locus_tag LOCUS_00480 CDS complement(586..1146) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WLJ0 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene greB tRNA complement(1227..1303) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA complement(1483..1559) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(1599..2603) product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R42 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene hrcA CDS 2632..3525 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R41 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene nadK CDS 3528..5204 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVX5 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 5194..6057 product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XL1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 6659..6940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(7162..9129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 10123..11859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 11856..12392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(12345..12671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 12696..13259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 tRNA 13290..13366 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 13413..14384 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XL8 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene prs CDS 14559..15191 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FC2 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene rplY CDS 15305..15916 product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K029 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene pth CDS complement(16008..16262) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195247.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 16436..17398 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 17402..18331 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 18532..19575 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 19572..20456 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 sequence005 source 1..19943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..595 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092092.1:ABC transporter ATP-binding protein locus_tag LOCUS_00680 CDS 849..2471 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930332.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene tar CDS complement(2554..3297) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(3369..4664) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RI3 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene pyrX CDS complement(4878..5840) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I89 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene pyrB CDS complement(5843..6364) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene pyrR CDS complement(6361..6828) product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I87 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(6825..7424) product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RH9 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 7446..8918 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(9058..15201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(15247..17529) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266434.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(17551..18003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(18094..18459) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(18459..18821) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 gene pilG sequence006 source 1..19631 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(234..1064) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786103.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 1470..2771 product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243976.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 2957..3388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(3413..4204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 4337..5623 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(5678..6661) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529133.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 6805..8007 product muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 gene catB CDS 8071..9006 product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113307.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene catA CDS 9122..10486 product 3-phenylpropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 10483..10971 product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366457.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 10990..12012 product toluate 1,2-dioxygenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109537.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene xylZ CDS 12027..12803 product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525022.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene benD CDS 12865..14235 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206209.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene benK CDS 14330..15142 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084070.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene pcaD CDS 15373..16887 product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188420.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 17069..18223 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937886.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(18316..19470) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 sequence007 source 1..19206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 998..2950 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS complement(3051..4067) product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVH4 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene acdS CDS 4240..4755 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184509.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(4768..5682) product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526255.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(5792..6970) product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 7256..7735 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 7788..8252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 8255..9211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 9292..10347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550375.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 10492..10944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(11255..12148) product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(12323..13495) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9Z5 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene tgt CDS 13615..14079 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809299.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(14269..14655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(14926..16149) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(16146..16472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(16649..18721) product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGW8 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene rep sequence008 source 1..18995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(316..1104) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(1198..2295) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930437.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(2332..3228) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFM6 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene dapA CDS complement(3259..3813) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192474.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(3885..4064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(4061..5251) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 5406..7388 product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WLB9 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene parE CDS 7404..8267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 8278..10635 product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W23 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene parC CDS complement(10707..11165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197479.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 11511..13955 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene comA CDS 14043..15500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 15553..16512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391136.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(16587..16934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(16969..17889) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706654.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 18010..18975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 sequence009 source 1..18217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(530..1777) product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815636.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(1805..2605) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808069.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(2667..3845) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040775.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene ivd CDS 4217..4450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 4558..5742 product putative lipid-transfer protein Ltp1/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701131.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 5777..6220 product UPF0336 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L0M4 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 6231..6647 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034360.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene maoC CDS 6710..7537 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 7569..8750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936116.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 8761..9903 product pimeloyl-CoA dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090541.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 9890..10027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 10123..10911 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808012.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 10896..11582 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHH3 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 11611..13032 product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 13032..14201 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728068.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(14229..16196) product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404558.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene acs CDS 16292..16963 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531138.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 sequence010 source 1..17863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(858..1871) product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707765.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene galE-2 CDS 2399..5209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene pelA CDS 5169..9068 product pellicle/biofilm biosynthesis protein PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113951.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene pelB CDS 9101..9652 product pellicle/biofilm biosynthesis outer membrane protein PelC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091288.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene pelC CDS 9667..11043 product pellicle/biofilm biosynthesis protein PelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene pelD CDS 11036..12052 product pellicle/biofilm biosynthesis protein PelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113953.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene pelE CDS 12052..13590 product pellicle/biofilm biosynthesis glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113954.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene pelF CDS 13592..14965 product pellicle/biofilm biosynthesis Wzx-like polysaccharide transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene pelG CDS 15229..16254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(16345..17088) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE4 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene hisA CDS complement(17145..17813) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE3 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene hisH sequence011 source 1..17845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..855 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9K0B0:ribosomal large subunit pseudouridine synthase D locus_tag LOCUS_01610 CDS 996..1712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 1705..3132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 3216..3641 product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UT6 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene ndk CDS 3729..4850 product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9H4 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene rlmN CDS 4876..5709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 5702..6640 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037147.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 6637..7929 product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JW4 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene ispG CDS 7973..9304 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UT2 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene hisS CDS 9321..10007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 10004..11173 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UT0 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene bamB CDS 11187..12533 product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WDT1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene der CDS 12682..12933 product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0L1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene hfq CDS 13009..14157 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63US7 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene hflX CDS 14280..15557 product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene hflK CDS 15567..16472 product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWL9 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene hflC CDS 16608..17771 product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JX4 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene hisZ sequence012 source 1..17528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 891..1361 product elongation factor GreAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404212.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 1620..1853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 1964..2527 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531226.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 2940..4199 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039905.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene dadA3 CDS complement(4271..4450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 4766..6358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 7065..7460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 7457..12622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 12780..13934 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(13999..15153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(15147..15479) product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141375.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(15692..17233) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930332.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene tar sequence013 source 1..17218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1094 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031687.1:alpha/beta hydrolase locus_tag LOCUS_01900 CDS complement(1099..1836) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(1905..3554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(3527..4645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(4642..6330) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268710.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(6327..7454) product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104885.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(7598..7816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 8138..9724 product binding-protein-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065033.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(9851..10174) product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKX4 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(10241..11200) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(11395..12819) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039542.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(12977..13258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 13841..14191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 14240..14809 product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(14863..15204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 15454..15588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 16060..16377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(16478..16903) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 sequence014 source 1..17138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1105..2358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073461.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 2386..3792 product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198857.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene dbpA CDS 4040..5014 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931485.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 5230..5994 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268245.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 6116..7129 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 7133..7960 product 2-pyrone-4,6-dicarboxylate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 8075..8530 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QX1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene dtd CDS complement(8586..11552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(11549..13507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 13627..14052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(14125..14865) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFQ6 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(15034..15567) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919635.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(15557..16900) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082986.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 sequence015 source 1..17082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(397..1785) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533498.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene gspE CDS complement(1845..4349) product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208195.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene xcpQ CDS complement(4480..5256) product general secretory pathway protein GspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525775.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene gspN CDS complement(5372..5911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(5908..7182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(7230..8243) product general secretion pathway protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204164.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene gspK CDS complement(8240..8983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(8984..9349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(9346..9807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(9874..10326) product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene gspG CDS 10493..10825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(10909..11505) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193433.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(11502..12314) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSL8 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene cobS CDS complement(12387..13949) product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0I4 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene ilvA CDS 14334..14783 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(14877..15494) product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD67 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene coq7 CDS 15822..16886 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523784.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 sequence016 source 1..17014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(618..1085) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 1162..1806 product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 1966..2601 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530121.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 2686..3084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 3263..3469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 3556..3981 product copper-containing oxidoreductase signal peptide protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_384693.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 3978..4535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 4532..4897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 4950..5957 product peptidase S58 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 6032..7354 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(7411..9792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(9856..11517) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814257.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 11764..13545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 14041..15675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 tRNA 15865..15941 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(16263..16338) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 misc_feature complement(16399..>17014) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MHA2:peptidylprolyl isomerase locus_tag LOCUS_02530 sequence017 source 1..16164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2030..3937) product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(4128..5084) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338699.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(5119..6210) product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1M7 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 6380..6949 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928921.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 7088..8338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064316.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 8423..10513 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0F7 transl_table 11 codon_start 1 locus_tag LOCUS_02590 gene metG CDS complement(10619..11260) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(11500..12024) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539909.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 12067..12273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193782.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 12359..13219 product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W96 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 13356..14945 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WLQ0 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene nadB CDS 14942..15577 product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P3 transl_table 11 codon_start 1 locus_tag LOCUS_02650 gene queE CDS 15645..16019 product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A3P4 transl_table 11 codon_start 1 locus_tag LOCUS_02660 sequence018 source 1..15341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1205..2659 product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKN7 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene zwf CDS complement(2748..3278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(3433..3885) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707273.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(3882..4856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(4982..6043) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194906.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(6061..6930) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(6920..7798) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314048.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(7940..9058) product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56652 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene lamB CDS complement(9140..10390) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 10547..11275 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 11357..12754 product two-component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(12785..13792) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W00 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene tal CDS 13904..14749 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 misc_feature complement(14802..>15341) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931174.1:MFS transporter locus_tag LOCUS_02800 sequence019 source 1..15307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..732 product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194152.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 872..1297 product barnase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204129.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 1276..1485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(1858..2658) product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P928 transl_table 11 codon_start 1 locus_tag LOCUS_02840 gene ksgA CDS complement(2753..4177) product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8E6 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene surA CDS complement(4190..6658) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU13 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene lptD CDS 6786..7853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540965.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS 7933..8676 product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QR8 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS 8851..9981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_253022.2 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 10086..10832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(10842..12302) product two-component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(12401..13075) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 13541..14035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(14142..15077) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931188.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 sequence020 source 1..15028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(695..1303) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZF7 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene clpP CDS complement(1427..2737) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V42 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene tig tRNA complement(2813..2899) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(3004..6177) product resistance-nodulation-cell division efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092464.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(6186..7253) product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975225.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 7694..8596 product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810490.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 8868..10268 product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009940681.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene sdaB CDS 10384..11280 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807491.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 11373..12212 product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 12212..13555 product amine oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 13897..15018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 sequence021 source 1..14967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1053..1421) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(1468..2139) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(2151..3092) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1F6 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene rluC CDS 3743..6796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 7078..7854 product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MLK1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 7901..8797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638775.2 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS 8859..9707 product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MP8 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene queF CDS complement(9714..11276) product aerotaxis sensor receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526156.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(11515..12903) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197322.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(12931..13083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 note possible pseudo, internal stop codon CDS complement(13266..14567) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNH1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene dinB sequence022 source 1..14833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1090..1773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530955.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(1775..2542) product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XT0 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 2558..2779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(2884..3765) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815738.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene coIII CDS complement(3822..4034) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815740.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(4031..4648) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(4780..6414) product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WH63 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene coxA CDS complement(6445..7614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(8265..9161) product malonyl-[acyl-carrier protein] O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS50 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene bioC CDS 9388..9930 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103309.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(9969..10958) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(10970..11854) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185119.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(11920..13116) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524520.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS complement(13173..13898) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(13900..14670) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821323.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 sequence023 source 1..14813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 542..970 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814554.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(994..1548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(1697..2185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096359.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(2309..3085) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(3131..3961) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(4269..5468) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537877.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(5481..5993) product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(6148..8571) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189629.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(8638..9048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521667.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(9129..10925) product acyl-CoA dehydrogenase oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526128.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(10930..11628) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(12016..12675) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene slmA CDS complement(12943..14391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 sequence024 source 1..14729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1463 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RU59:DNA helicase locus_tag LOCUS_03440 CDS 1527..2288 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803832.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 2552..4393 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E191 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 4418..5368 product FRG domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 5368..5787 product FosX/FosE/FosI family fosfomycin resistance thiol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529521.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(5873..7000) product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 7161..8609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(8803..9702) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(9842..10438) product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267649.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(10496..11623) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931392.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 12231..12611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889155.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 12716..13321 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 13314..14090 product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766026.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 14302..14553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 sequence025 source 1..14514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1395 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196212.1:methyl-accepting chemotaxis protein locus_tag LOCUS_03580 CDS complement(1483..2190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 note possible pseudo, internal stop codon, frameshifted CDS complement(2187..2594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 note possible pseudo, internal stop codon, frameshifted CDS complement(2685..3824) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(3939..4922) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089104.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 5034..5957 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807817.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 6197..6508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 6613..6969 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63J95 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene fbp CDS complement(7071..7556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(7678..9777) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(9770..10123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(10179..12569) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEN6 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene ppsA CDS 12763..13584 product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JE0 transl_table 11 codon_start 1 locus_tag LOCUS_03700 misc_feature complement(13805..>14514) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003315309.1:alkyl hydroperoxide reductase subunit F locus_tag LOCUS_03710 sequence026 source 1..14381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1080..1865) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(1932..2522) product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X71 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(2595..4736) product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIJ5 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene glyS CDS complement(4925..5830) product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X69 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene glyQ CDS 6074..7993 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385247.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(8133..9356) product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene fabB CDS complement(9353..9874) product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCW9 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene fabA CDS complement(10061..11686) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WH00 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene cutE CDS complement(11686..12561) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene corC CDS complement(12679..13317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(13641..14123) product leucine-responsive regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039087.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene oppI sequence027 source 1..14375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1006..1983) product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J39 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene accA CDS complement(2071..2745) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(2791..4167) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J37 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene cysS CDS 4383..5465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 5592..6920 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 6917..7498 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VX98 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene ppiB CDS 7520..8047 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WER4 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene ppiB CDS 8231..9010 product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WF79 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene lpxH CDS 9064..9894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(10016..12676) product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WB09 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 12780..13253 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930202.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 misc_feature complement(13201..>14375) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921004.1:methionine gamma-lyase locus_tag LOCUS_03940 sequence028 source 1..14277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 790..2034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(2317..3372) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549948.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 3473..3637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 3806..4450 product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(4510..5139) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene dctR CDS complement(5213..5980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 note possible pseudo, frameshifted CDS complement(7250..8071) product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522140.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(8068..12336) product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550020.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 sequence029 source 1..14275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..571 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706453.1:ABC transporter substrate-binding protein locus_tag LOCUS_04030 CDS 568..1761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 1677..3077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(3348..5063) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205706.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(5293..6546) product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5N5 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene glcF CDS complement(6598..7410) product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(7421..8542) product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene glcE CDS complement(8734..10257) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPE9 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene amt CDS complement(10289..10651) product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(10671..11402) product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811028.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 11628..12884 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 note possible pseudo, internal stop codon CDS 12888..13163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 note possible pseudo, internal stop codon CDS complement(13339..14076) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 sequence030 source 1..13933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 786..1643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(1655..3127) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 3205..3687 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188566.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 3689..4324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(4439..5842) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVA1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(5976..6173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(6262..6699) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388338.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(6752..6994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(7022..7423) product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123521.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(7517..8710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(8707..12024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(12021..12779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 sequence031 source 1..13849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..555 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185551.1:acyl-CoA dehydrogenase locus_tag LOCUS_04280 CDS 580..1695 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(1804..2745) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(2818..3375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637786.2 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 3599..4648 product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WI2 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 4759..7635 product isoleucine--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WI3 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene ileS1 CDS 7636..8145 product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HL3 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene lspA CDS 8548..10203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(10248..11081) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(11078..12061) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186471.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene qor-1 CDS 12156..13055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390650.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 misc_feature complement(13156..>13849) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705454.1:diguanylate phosphodiesterase locus_tag LOCUS_04390 sequence032 source 1..13757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198058.1:chaperone protein locus_tag LOCUS_04400 CDS complement(692..1633) product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PU7 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene rsmI CDS 1633..2034 product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPY4 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 2160..2759 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A0Y6 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene gmhA CDS 2759..3415 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(3558..4472) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(4571..5707) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene pilT-2 CDS complement(5774..6409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(6476..7519) product twitching mobility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24559 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene pilT CDS 7558..8286 product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(8303..9373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112603.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 9517..10653 product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 10690..12015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552069.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(12093..12818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810365.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(12802..13164) product murein hydrolase transporter LrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 misc_feature complement(13174..>13757) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194074.1:FAD-binding protein locus_tag LOCUS_04550 sequence033 source 1..13736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..1797) product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XV0 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(1853..2122) product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene ptsH CDS complement(2091..2540) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(2656..3216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553811.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 3447..3950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198028.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(4073..4528) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 4720..5391 product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813013.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 5722..6165 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(6598..7104) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064337.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(7217..7486) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5T6 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene rpsQ CDS complement(7496..7690) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA62 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene rpmC CDS complement(7707..8123) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9M9 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene rplP CDS complement(8126..9007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(9022..9354) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q16 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene rplV CDS complement(9364..9642) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBE3 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene rpsS CDS complement(9653..10477) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA56 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene rplB CDS complement(10480..10794) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTD1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene rplW CDS complement(10791..11411) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GK6 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene rplD CDS complement(11411..12085) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GK5 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene rplC CDS complement(12287..12598) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GK4 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene rpsJ misc_feature complement(12624..>13736) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_109822.1:elongation factor Tu locus_tag LOCUS_04760 sequence034 source 1..13647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..4151 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929669.1:DUF490 domain-containing protein locus_tag LOCUS_04770 tRNA 4206..4280 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 4459..5676 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 5858..6394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 6398..6724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 6721..6960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 6957..9407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 9404..10132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 10136..10780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 10677..10901 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(11245..12126) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921297.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(12301..13404) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZH5 transl_table 11 codon_start 1 locus_tag LOCUS_04870 sequence035 source 1..13401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2265 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013087340.1:conjugative transfer protein locus_tag LOCUS_04880 CDS 2307..2651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 2662..3537 product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087217.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 3547..4995 product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene traH CDS 5005..7788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(8369..8704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(8860..9588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(9778..10527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(10725..11111) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LE8 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene panD CDS complement(11137..12144) product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MW9 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene bioB CDS complement(12189..12974) product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089114.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 sequence036 source 1..13202 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(183..938) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GU2 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene zapD CDS complement(1028..1642) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MNE9 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene coaE CDS complement(1643..2095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(2527..3744) product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 gene pilC CDS complement(3773..5437) product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208227.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene pilB CDS complement(5794..6369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 6415..6573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 6931..7242 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZX4 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene rplU CDS 7258..7515 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FD28 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene rpmA CDS 7766..8836 product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QM0 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene obg CDS 8903..10042 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GV5 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene proB CDS complement(10236..10928) product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QM4 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene rppH CDS 11020..12762 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QM5 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene proS sequence037 source 1..13166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1262..3160 product NAD 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44569 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(3262..4926) product amino oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108817.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(4929..5921) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(5939..9670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(9792..11363) product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene speE1 CDS complement(11474..11695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 sequence038 source 1..13036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3910..5019) product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZP2 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene aroG CDS complement(5068..5571) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037713.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(5710..7398) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM59 transl_table 11 codon_start 1 locus_tag LOCUS_05200 gene leuA CDS complement(7755..9662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(9659..10201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(10205..12217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(12533..12922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 sequence039 source 1..12956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..1914) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114382.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(2062..2550) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 2720..6295 product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 6786..7061 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene yajC CDS 7171..9057 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJ05 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene secD CDS 9069..10022 product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R02 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene secF CDS 10040..12373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 misc_feature complement(12428..>12956) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929874.1:DNA processing protein DprA locus_tag LOCUS_05320 sequence040 source 1..12784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(363..1274) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083786.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(1264..4644) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104865.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 4849..6126 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767480.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 6217..7131 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104864.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 7159..8364 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104863.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 tRNA complement(8218..8294) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 8382..9125 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 9145..9834 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083792.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 9886..11118 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008540630.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 11135..11485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104861.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 11659..12705 product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VS2 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene amiE sequence041 source 1..12621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3799 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704393.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_05430 CDS 3824..4954 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(5009..5944) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene suhB CDS 6094..6912 product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WG86 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene trmJ CDS 6946..7725 product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene cysE CDS complement(7808..8164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(8257..8865) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522377.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene mogA CDS complement(8858..9523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189393.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 9588..11021 product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188997.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene pmbA CDS complement(11169..12257) product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 sequence042 source 1..12519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 492..1172 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930532.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene tesA CDS complement(1283..1462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(1521..2336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709090.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(2514..3752) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191808.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene metC CDS complement(3794..4336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(4333..4602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 4653..6224 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 6304..7080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 7088..7933 product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748E8 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene flhG CDS 8064..8837 product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBG2 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(8909..9796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083635.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(9863..10417) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(10471..11172) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 11279..12217 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 sequence043 source 1..12341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 37..1752 product single-stranded-DNA-specific exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene recJ CDS 1840..2703 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 2729..3364 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 3474..4142 product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192745.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 4182..5480 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3Z4 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene trpS CDS 5658..6710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121674.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 6870..7541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 7788..9461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 9489..10166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 note possible pseudo, frameshifted CDS 10220..11818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 note possible pseudo, internal stop codon, frameshifted CDS complement(11832..12188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 sequence044 source 1..12286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 296..1579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 1591..2871 product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4Q6 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene sbcD CDS complement(2971..5298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(5339..6304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817418.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(6301..6702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158289.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS 6903..9386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(9438..9746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 10288..10500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(10595..11107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 11234..11464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(11435..11659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 sequence045 source 1..12281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1005..2036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(2040..3005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(3017..3631) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418930.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(3826..4221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(4279..5799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(6136..6882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(7188..8105) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929571.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene parB CDS complement(8141..8689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(8715..9515) product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205314.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(9531..10145) product leucine efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P76249 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene leuE CDS complement(10160..11059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(11065..11664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 sequence046 source 1..12278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 1552..2094 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P934 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene def CDS complement(2321..4912) product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JC2 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene glnD CDS complement(5052..5867) product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T11 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene map CDS 6003..10010 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MDT0 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene purL CDS 10324..11307 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 11464..12072 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 sequence047 source 1..12235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..691 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477064.1:transcriptional regulator locus_tag LOCUS_06080 CDS complement(841..1644) product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083449.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(1763..2113) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066942.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(2115..3329) product sulfite oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970225.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 3622..4785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(4823..6139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(6248..7192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(7391..7921) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267564.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(8207..8620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 8731..9372 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186572.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 9517..9891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 9953..10327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS complement(10438..10992) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene iscR CDS 11137..12045 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 sequence048 source 1..12156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(185..907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(904..1485) product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NM1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 1582..1974 product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243700.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene pcaC-2 CDS complement(1981..2526) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191840.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 2650..3357 product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065123.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 3390..4031 product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813726.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 4121..5386 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 5517..6572 product methionine import ATP-binding protein MetN 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M41 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene metN1 CDS 6578..7243 product D-methionine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189862.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene metI CDS 7513..8139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(8161..9897) product efflux pump/antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528518.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 10142..11233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931476.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 sequence049 source 1..12089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2106..2942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(3212..4315) product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAE3 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene wecB CDS complement(4497..7754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(7758..9140) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(9130..9948) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888F0 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(9948..10493) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene rfbC-1 CDS complement(10493..11389) product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU22 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene rmlA CDS complement(11456..12088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 sequence050 source 1..11978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2111..3634 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035359.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene aldA CDS complement(3631..3918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 3884..4849 product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene adhB note possible pseudo, internal stop codon CDS 4868..5038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 note possible pseudo, internal stop codon CDS 5043..5468 product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 5674..6141 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072708.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene yciA CDS complement(6192..7184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815276.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(7181..8176) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815277.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(8305..9201) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931157.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(9263..10093) product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QR1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene pyrF CDS complement(10217..11413) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WLV8 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene pgk CDS complement(11596..11931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189842.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 sequence051 source 1..11961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(576..2003) product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YV9 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene mnmE CDS complement(2126..3829) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YW1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene yidC CDS complement(4116..4604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(4668..4802) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P686 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene rpmH CDS 5223..6698 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9S5 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene dnaA CDS 6841..7959 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WI70 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene dnaN CDS 8136..10751 product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHD0 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene gyrB CDS complement(10814..11479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 sequence052 source 1..11957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(670..1407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(1407..4499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(4496..5389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(5386..7968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(7965..11246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 sequence053 source 1..11839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 209..730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 740..1825 product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204043.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene ntrB CDS 2146..3762 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192209.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene ntrC CDS 3977..4954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(5073..5852) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926539.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 6179..7513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(7565..8707) product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525274.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 note possible pseudo, frameshifted CDS complement(8682..9044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(9247..9750) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QVS0 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene folA CDS complement(9774..10388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(10505..11359) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MD47 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene thyA sequence054 source 1..11631 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..1038 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene hbdA CDS 1313..1777 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083561.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 1858..2274 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035519.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene ohr CDS 2416..3186 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 3183..4613 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088428.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 4710..5801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 5851..6906 product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YG6 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene srkA CDS 7161..7943 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193573.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(7865..8149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 8231..11116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 sequence055 source 1..11578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 218..685 product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202935.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene ptsN CDS 737..1693 product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XL0 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene hprK CDS complement(1746..2162) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene fur CDS 2260..2826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 2948..3793 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QT3 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene dapB CDS 3808..4530 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 4527..4955 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194258.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 5197..7890 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4C3 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene leuS CDS 7893..8396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(8503..9468) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8S4 transl_table 11 codon_start 1 locus_tag LOCUS_06970 sequence056 source 1..11520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(702..1892) product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537778.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene nolF CDS complement(1889..2590) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 2755..3291 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene msrA CDS 3464..3949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 3946..4662 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418445.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 4668..5903 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 5969..6220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 6289..6909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 6975..7439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 7721..9823 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931283.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(9862..10263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(10342..11316) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814318.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 sequence057 source 1..11492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1107..1880) product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(1877..2479) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JD8 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene rnhB CDS complement(2490..3647) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T25 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene lpxB CDS complement(3658..4446) product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIM2 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene lpxA CDS complement(4459..4899) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JD5 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene fabZ CDS complement(4916..5896) product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEE0 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene lpxD CDS complement(5918..6430) product outer membrane protein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(6430..8727) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T20 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene bamA CDS complement(8751..10133) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T19 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(10159..11337) product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T18 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene dxr CDS complement(11334..11492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 sequence058 source 1..11448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(903..1334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193088.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(1479..2423) product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338974.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(2445..2816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 2943..3863 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(3850..4911) product phenol hydroxylase P5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ2 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene mphP CDS complement(4919..5275) product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132745.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene mphO CDS complement(5272..6816) product phenol 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene mphN CDS complement(6841..7110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(7125..8120) product phenol hydroxylase P1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7WTJ6 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene mphL CDS complement(8167..8367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 8709..10388 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206221.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene mphR CDS 10397..11155 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886716.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 sequence059 source 1..11381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1265 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196600.1:long-chain-fatty-acid--CoA ligase locus_tag LOCUS_07330 CDS 1444..2004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 2262..4331 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064497.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(4249..4971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(4983..6476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS complement(6571..9117) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257792.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(9299..9718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815546.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(9715..10830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 sequence060 source 1..11302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(1099..1521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141048.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(1518..1796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(1891..3024) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083692.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 tRNA complement(3188..3263) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(3276..4283) product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P237 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene fbp CDS complement(4298..7027) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522336.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene pepN CDS complement(7011..7694) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931708.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(7753..8655) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ35 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene prfB note possible pseudo, frameshifted CDS complement(9125..10027) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 10279..11181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 sequence061 source 1..11200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 247..1563 product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(2034..3242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(3555..5339) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 5550..5900 product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3J5 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(6038..6574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 6672..7463 product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 7682..8908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(8936..10750) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039964.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 sequence062 source 1..11172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2361..3458) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(3775..4938) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305421.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(5202..6506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(6503..7255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(7285..7860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(7857..8138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(8307..9020) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZS10 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 9877..10140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 sequence063 source 1..11090 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 929..2707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 2704..3939 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 4334..6643 product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197904.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene maeB-2 CDS complement(6731..7087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 7596..8606 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383350.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS 8687..9511 product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971357.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 9536..10303 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 sequence064 source 1..10984 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 219..1331 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R43 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene hemH CDS 1506..4037 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(4101..4805) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393975.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(4805..5554) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088973.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(5554..6549) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(6605..7498) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391054.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(7521..8690) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039303.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(8759..9571) product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086319.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 misc_feature complement(9632..>10984) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086318.1:4-chlorobenzoate--CoA ligase locus_tag LOCUS_07820 sequence065 source 1..10846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 66..689 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P170 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene cheZ CDS 799..1959 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930321.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene flhB CDS 1956..4040 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene flhA CDS 4037..5578 product flagellar biosynthesis regulator FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525693.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene flhF CDS 5571..6368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 6375..7091 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PT1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene fliA CDS complement(7273..7656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(7696..8016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(8108..8833) product flagellar basal body P-ring biosynthesis protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_104793.2 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene flgA CDS 9133..9597 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YB8 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 9626..10030 product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN75 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene flgC CDS 10058..10714 product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGR6 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene flgD sequence066 source 1..10837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(10..1803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(1857..2519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(2520..2834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 3278..3847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(3932..4996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(5279..6283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(6270..7907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(7974..8321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS complement(8318..8539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(8573..9154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 9644..10429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 sequence067 source 1..10796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3517 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105302.1:nitrate reductase subunit alpha locus_tag LOCUS_08060 CDS 3538..5061 product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene narH CDS 5216..5917 product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971854.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene narJ CDS 5914..6645 product respiratory nitrate reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528383.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene narI CDS 6674..7609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 7627..8301 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBR7 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene cynT sequence068 source 1..10749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 103..507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(1102..2835) product acetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639396.2 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene actP CDS complement(2832..3140) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039127.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 3579..5240 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 5389..5568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(5664..5936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 note possible pseudo, internal stop codon CDS complement(5940..6776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08180 sequence069 source 1..10720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(35..2917) product helicase SNF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(3183..3434) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UW6 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene moaD CDS complement(3431..4681) product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267455.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(4678..5235) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene mobB CDS complement(5428..6873) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23669 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene thrC CDS complement(6893..7207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(7281..8621) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFW9 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene hom CDS complement(8714..9949) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 10096..10473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198835.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 sequence070 source 1..10719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 310..1473 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92S71 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 2361..3056 product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD86 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene pcp CDS complement(3124..3828) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521496.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 4201..5163 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811091.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 5292..5801 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811089.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 5816..7108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039977.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 7257..7655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 7787..8554 product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UC7 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 8587..9399 product UPF0317 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UC6 transl_table 11 codon_start 1 locus_tag LOCUS_08360 sequence071 source 1..10699 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(967..2244) product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926811.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(2241..2687) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930891.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(2816..3787) product periplasmic substrate-binding transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039499.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 4123..4587 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815987.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(4668..5462) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092883.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(5485..6426) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(6479..7426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039423.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 7389..7682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(7667..9367) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 9511..10293 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 sequence072 source 1..10502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 258..929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527196.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(963..2750) product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IG3 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene msbA CDS 3148..4362 product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RA8 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene tolB CDS 4407..4946 product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186227.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 4946..5728 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 5740..6549 product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 tRNA 6598..6673 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 6819..8036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(8014..8313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(8704..9171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(9712..10146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 sequence073 source 1..10479 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 385..1077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200216.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 1273..2247 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P954 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene xerC CDS complement(2294..2815) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199265.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene cheW-2 CDS 2974..4218 product ribosomal RNA large subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FYN3 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene rlmI CDS 4359..5468 product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199061.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 5636..6397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 6446..8218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 8292..8855 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P967 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene hslV CDS 8950..10275 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62F00 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene hslU sequence074 source 1..10437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(649..1416) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 1942..2370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 2429..2734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040743.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(2807..3367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811971.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(3469..4848) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QU6 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene purB CDS 4997..5614 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene gst-1 CDS 5737..6441 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974959.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 6627..7244 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706104.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 7288..8568 product dehydroascorbate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706103.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 8632..9636 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 9806..10249 product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKQ7 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene aroQ-1 sequence075 source 1..10392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(659..1162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(1159..1599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS complement(1551..1838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(1914..2867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461894.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(2999..4771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946767.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(4930..7263) product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083526.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(7267..7518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(7603..7896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(7948..8616) product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090714.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(8914..9387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(9478..9819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 sequence076 source 1..10382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 599..2494 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DU1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene dxs CDS 2836..3918 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567739.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 4061..5140 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567739.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(5336..5590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(5648..7417) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812634.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(7436..8053) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807402.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(8235..9362) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812659.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS 9413..10150 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 sequence077 source 1..10339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(318..1688) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V83 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene glmM CDS complement(1699..2490) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8I8 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene folP CDS complement(2614..4533) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6X4 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene ftsH CDS complement(4758..5420) product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62L80 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene rlmE CDS 5453..5926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 5931..6680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(6757..7227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(7238..7714) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V89 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene greA misc_feature complement(7908..>10339) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P2C7:carbamoyl-phosphate synthase (glutamine-hydrolyzing) locus_tag LOCUS_09060 sequence078 source 1..10338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(77..1048) product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V7S8 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene ribD CDS complement(1240..1692) product pilus biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266587.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(1714..5430) product type IV pilus biogenesis factor PilY1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM8 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene pilY1 CDS complement(5516..6298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(6320..7189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(7290..7835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(7937..8512) product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704647.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(8503..8913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(9154..9450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 9693..9959 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VN8 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene rpsO sequence079 source 1..10300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1130..2035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065020.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 2044..2685 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220465.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(2728..3705) product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN0 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene queG CDS 3799..4311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 note possible pseudo, internal stop codon, frameshifted CDS 4308..5753 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(5823..7019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(6974..7405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 7701..7943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(8016..8714) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098139.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 sequence080 source 1..10191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(423..3383) product putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_277100.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(3388..3924) product invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 4170..4547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 4528..4863 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 4878..5237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 5234..5629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 5653..5979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 6011..6217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 note possible pseudo, frameshifted CDS complement(6483..9062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(9180..10136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 sequence081 source 1..10150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1171..3201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 note possible pseudo, internal stop codon, frameshifted CDS complement(3202..4086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 note possible pseudo, internal stop codon CDS complement(4100..5197) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(5223..6332) product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHV4 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene serC-1 CDS complement(6440..9172) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIT4 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene gyrA CDS 9330..9977 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene ompA sequence082 source 1..10144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..787 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388721.1:carbon monoxide dehydrogenase locus_tag LOCUS_09420 CDS 800..1594 product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337815.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 1924..2835 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088409.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 2832..4100 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388724.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 4144..4773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 4804..5868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525879.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(5873..6562) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037430.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene gstA CDS complement(6697..7449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(7472..8161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 8294..8665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 8769..9563 product cyclohexadienyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195836.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene pheC sequence083 source 1..9957 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 601..1068 product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VT4 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene rlmH CDS 1169..1795 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62II4 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 1815..3314 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene cafA CDS 3498..4736 product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(4844..5842) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900518.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 6035..7081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(7120..8124) product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108412.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(8121..9059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 misc_feature complement(9056..>9957) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P55634:putative integrase/recombinase y4rA locus_tag LOCUS_09610 sequence084 source 1..9873 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(134..210) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(232..624) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q38 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene rplQ CDS complement(715..1707) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GN1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene rpoA CDS complement(1820..2443) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GN0 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene rpsD CDS complement(2535..2939) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q35 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene rpsK CDS complement(2958..3323) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GM8 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene rpsM CDS complement(3598..4917) product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9N8 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene secY CDS complement(4942..5373) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GM4 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene rplO CDS complement(5384..5566) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q29 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene rpmD CDS complement(5580..6098) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q28 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene rpsE CDS complement(6116..6481) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q27 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene rplR CDS complement(6493..7008) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GM0 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene rplF CDS complement(7051..7446) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GL9 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene rpsH CDS complement(7467..7772) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GL8 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene rpsN CDS complement(7781..8320) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q23 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene rplE CDS complement(8330..8650) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P641 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene rplX CDS complement(8660..9028) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q21 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene rplN misc_feature complement(9223..>9873) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931050.1:glycerol-3-phosphate dehydrogenase locus_tag LOCUS_09780 sequence085 source 1..9683 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 221..544 product HesB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550200.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 648..1166 product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SN4 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene hscB CDS 1232..3094 product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IZ5 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene hscA CDS 3118..3456 product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812453.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene fdx CDS 3456..4172 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene dnaQ tRNA 4204..4278 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 4326..4400 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 4669..5640 product acetylpolyamine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529811.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 5686..6792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 6979..7281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 7320..7715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 7712..8035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(8143..9234) product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTR9 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene pyrD sequence086 source 1..9659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1368 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62HS0:urease subunit alpha locus_tag LOCUS_09900 CDS 1448..2137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 2148..2858 product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RL1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene ureF CDS 2909..3568 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8U6 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene ureG CDS complement(3634..5562) product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7J4 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene glmS CDS 5701..6192 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064827.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(6222..7001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS complement(7162..8580) product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAY5 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene glmU CDS complement(8751..9506) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709037.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 sequence087 source 1..9608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1098..3974 product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene sucA CDS 4023..5291 product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHD8 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene sucB CDS 5410..6837 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9N2 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene odhL CDS 6957..8054 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193214.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 8051..8755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 misc_feature complement(8940..>9608) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058076.1:serine/threonine phosphatase locus_tag LOCUS_10040 sequence088 source 1..9578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 224..1747 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529357.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 1920..3122 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083709.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 3392..4192 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083708.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 4189..4920 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083707.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 5012..5995 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083706.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 6148..7215 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083705.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 7255..9444 product D-(-)-3-hydroxybutyrate oligomer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RF6 transl_table 11 codon_start 1 locus_tag LOCUS_10110 sequence089 source 1..9574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(167..634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(721..1896) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811748.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(1950..2327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(2527..4050) product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036454.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene mmsA CDS 4218..5117 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208095.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 gene mauR CDS complement(5154..6872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 misc_feature complement(7744..>9574) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004531442.1:ABC transporter ATP-binding protein locus_tag LOCUS_10180 sequence090 source 1..9566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1043 product heme biosynthesis operon protein HemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704440.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1058..2338 product porphyrin biosynthesis-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526333.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 2626..3258 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 3348..3917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202184.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 3995..4570 product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691360.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 4709..5332 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(5493..6461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(6526..7485) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene gcvA CDS 7668..8864 product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002055095.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene gcdH sequence091 source 1..9518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1255 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203832.1:peptidase locus_tag LOCUS_10280 CDS 1778..3481 product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S94 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene lepA CDS 3481..4455 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S95 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene lepB CDS 4495..4860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 4939..5547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 5619..6581 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S97 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene era CDS 6698..7462 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S98 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene recO CDS 7459..8241 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEG8 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene pdxJ CDS 8306..8728 product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWV9 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene acpS sequence092 source 1..9446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 958..1242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(2288..3337) product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2B1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene gcp CDS complement(3430..4593) product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064075.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 4810..5436 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 gene nasT CDS 5912..7156 product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096248.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(7239..7463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 7408..8172 product nitrate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 8266..9081 product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096250.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 sequence093 source 1..9423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(181..600) product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PI1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene atpC CDS complement(673..2079) product ATP synthase subunit beta 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PI0 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene atpD1 CDS complement(2113..2979) product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FR6 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene atpG CDS complement(2998..4551) product ATP synthase subunit alpha 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PH8 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene atpA1 CDS complement(4596..5138) product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FR8 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene atpH CDS complement(5148..5618) product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PH6 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene atpF CDS complement(5654..5923) product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MB61 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene atpE CDS complement(5985..6863) product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DD64 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene atpB CDS complement(6883..7356) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524510.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 7633..7950 product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBU7 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 7954..8649 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6N4 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene lipB sequence094 source 1..9422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(257..1087) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198065.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1180..1785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(1911..3071) product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q58 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(3139..3504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 note possible pseudo, internal stop codon CDS complement(3523..4287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 note possible pseudo, internal stop codon CDS complement(4373..4750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(4773..6911) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266377.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(6908..7453) product type 4 fimbrial biogenesis protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene pilP CDS complement(7450..8136) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262702.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene pilO CDS complement(8133..8570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 misc_feature complement(8756..>9422) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105329.1:pilus assembly protein PilM locus_tag LOCUS_10670 sequence095 source 1..9419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 160..1317 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 1332..2309 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 2452..3243 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808066.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 3258..4451 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389759.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 4498..5280 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23966 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene menB CDS 5311..6465 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085913.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 6477..7652 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 7669..9033 product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 sequence096 source 1..9384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..1269) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1452..2498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524668.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(2786..3655) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(3689..5194) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812393.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(5351..6544) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(6825..7409) product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817748.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(7406..8533) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62F07 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene metX CDS complement(8700..9266) product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207928.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 sequence097 source 1..9372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(947..2236) product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKF0 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene ftsW CDS complement(2236..4188) product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QJ5 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene murD CDS complement(4185..5363) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QJ4 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene mraY CDS complement(5407..6828) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QJ3 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene murF CDS complement(6819..8348) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WL43 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene murE misc_feature complement(8345..>9372) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004532007.1:peptidoglycan synthetase FtsI locus_tag LOCUS_10890 sequence098 source 1..9319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..563 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082876.1:type VI secretion protein locus_tag LOCUS_10900 CDS complement(564..1019) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 1258..3561 product membrane transport ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063722.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 3890..4582 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(4618..5229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 5486..5839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 6006..7331 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204477.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene czcC CDS 7334..8926 product cobalt-zinc-cadmium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551660.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene czcB sequence099 source 1..9282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..903 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113883.1:CoA transferase locus_tag LOCUS_10980 CDS 1124..1891 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1878..3806 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 3810..4697 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104319.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 4701..5774 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 5785..6591 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 6668..7912 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 8280..9077 product 2-hydroxycyclohexane-1-carbonyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 sequence100 source 1..9275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..780 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036210.1:membrane protein locus_tag LOCUS_11060 CDS 928..3033 product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZX3 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene tgpA CDS 3148..4134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(4180..5442) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204051.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 5619..6014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(6116..7324) product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(7324..8118) product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 misc_feature complement(8115..>9275) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545350.1:secretion protein HlyD locus_tag LOCUS_11130 sequence101 source 1..9268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(278..1240) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(2244..2891) product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369399.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(2884..3117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(3179..4051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(4767..5693) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089933.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 6040..7200 product D-nopaline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891452.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene noxB CDS 7441..8838 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886766.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene ooxA sequence102 source 1..9225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(214..1701) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLW9 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1805..2101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(2230..4836) product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UW2 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene clpB CDS complement(5035..5511) product molybdopterin converting factor subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene moaE CDS complement(5508..5696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 5838..6092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 6108..6479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(6570..7952) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QM8 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene ffh CDS 8059..8856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538773.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 sequence103 source 1..9126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(56..343) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184704.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 704..1549 product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8N2 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene apaH CDS complement(1613..2653) product thiamine biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461458.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(2664..3071) product cytochrome c-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521401.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 3395..3652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 3674..5596 product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205031.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene nosZ CDS 5826..8447 product membrane linked regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205030.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 sequence104 source 1..8996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(183..839) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIF6 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene dsbA CDS complement(919..1584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1597..3306) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Y06 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene argS CDS 3591..3974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(4066..4512) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(4690..6054) product C4-dicarboxylate transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5J5 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene dctA CDS 6292..8958 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038446.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 sequence105 source 1..8996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(949..1446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 note possible pseudo, frameshifted CDS complement(1449..2927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(2957..4162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090651.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(4204..4638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(4635..4829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(4882..5928) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039704.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene livM CDS complement(5928..6800) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088705.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(6800..8668) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 sequence106 source 1..8897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(446..964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(961..2100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 2156..2680 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(2760..3266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(3473..3919) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WI6 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene dut CDS complement(4031..5245) product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186216.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene coaBC CDS 5349..7007 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA80 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene pyrG CDS 7019..7876 product 2-dehydro-3-deoxyphosphooctonate aldolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SP9 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene kdsA1 CDS 7881..8171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065135.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 sequence107 source 1..8891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..929) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B5 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 1268..1612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(1718..3397) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 3595..4782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 4786..5682 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038701.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 5682..6659 product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807132.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 6678..7382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(7419..7931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 8397..8615 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704042.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 sequence108 source 1..8798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..532) product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197812.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene creA CDS complement(529..3108) product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928938.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene cphA CDS complement(3186..5420) product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene cphA CDS 5809..8097 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 8111..8626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928936.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 sequence109 source 1..8785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..819 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390885.1:GGDEF domain-containing protein locus_tag LOCUS_11750 CDS complement(715..1104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1943..2497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 2848..3909 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N8U5 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene rdgC CDS complement(3998..5116) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527614.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 tRNA 4903..5001 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(5256..6422) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene acadL CDS complement(6484..7671) product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064006.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 7959..8666 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815507.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 sequence110 source 1..8774 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 497..1456 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039293.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene ygjT CDS 1469..1630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1643..2194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(2259..3227) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929877.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(3320..3577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(3604..5256) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(5285..6244) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185661.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 6360..7196 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(7209..8531) product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223825.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene metY sequence111 source 1..8748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 199..1122 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063906.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(1129..2919) product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941191.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(2989..4119) product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HM0 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene nadA CDS complement(4116..4964) product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185611.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene nadC CDS complement(5074..6387) product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene fahA CDS complement(6410..6946) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085118.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(6980..7180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(7191..8747) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 sequence112 source 1..8727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..540 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731544.1:ABC transporter permease locus_tag LOCUS_12000 CDS 543..1349 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731543.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 1342..1812 product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene fucU CDS 1826..3067 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970632.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene frcR CDS complement(3309..4043) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(4111..5739) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7B0 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene prfC CDS 6061..7497 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M7Y2 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene acyH CDS 7724..8725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 sequence113 source 1..8693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1252..2391) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R47 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene dnaJ CDS complement(2498..4435) product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HD5 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene dnaK CDS complement(4532..5083) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HD3 transl_table 11 codon_start 1 locus_tag LOCUS_12100 gene grpE CDS 5346..5723 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JQ9 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene rpsF CDS 5739..6029 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67673 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene priB CDS 6047..6328 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VV91 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene rpsR CDS 6341..6793 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JR2 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene rplI CDS 6965..8386 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VV94 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene dnaB sequence114 source 1..8685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 430..2145 product glutathione-regulated potassium-efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706148.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 2142..2639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 2656..3582 product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152113.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 3607..4758 product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene degP CDS complement(5003..5176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 5096..5899 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038906.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(6156..6710) product putative methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(6813..7721) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268628.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 misc_feature complement(7783..>8685) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092916.1:glutathione S-transferase locus_tag LOCUS_12240 sequence115 source 1..8628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(336..1745) product nitrite extrusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene narK CDS complement(1768..3057) product nitrite extrusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524713.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(3393..4109) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225188.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(4106..6127) product nitrate/nitrite sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 6169..7077 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 7164..8012 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XJ7 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene purU sequence116 source 1..8614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(34..303) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097216.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(530..3265) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550945.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene metH1 CDS complement(3434..3898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525507.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 3969..4910 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099119.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 5041..5952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(6017..7228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(7302..8414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 sequence117 source 1..8608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..889 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550337.1:MATE family efflux transporter locus_tag LOCUS_12380 CDS complement(881..2206) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197666.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene phoR CDS complement(2371..3078) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192125.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene phoB CDS complement(3094..3798) product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V78 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(3808..4593) product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEW2 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene pstB CDS complement(4609..5490) product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V80 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene pstA CDS complement(5487..6413) product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJU4 transl_table 11 codon_start 1 locus_tag LOCUS_12440 gene pstC CDS complement(6580..7620) product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ25 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene pstS sequence118 source 1..8579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1109..1657) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038685.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1654..3378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(3554..4447) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367601.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(4545..5786) product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z883 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene clsB CDS complement(5783..6547) product endonuclease/exonuclease/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(6745..7662) product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5G2 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene cysK CDS complement(7835..8437) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 sequence119 source 1..8504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(216..443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(507..698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(716..1693) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(1706..2746) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X5J8 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene mhpE CDS complement(2760..3674) product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQH3 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene mhpF CDS complement(3707..4510) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(4507..5097) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(5123..5911) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(5931..6716) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393278.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(6740..7606) product 2,6-dioxo-6-phenylhexa-3-enoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257237.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 misc_feature complement(7876..>8504) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257240.1:aldehyde dehydrogenase locus_tag LOCUS_12630 sequence120 source 1..8498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(26..1186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(1375..5421) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 5617..6963 product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WG94 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene argA CDS complement(7024..7911) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 sequence121 source 1..8485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..988) product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSX7 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene fliP CDS complement(1330..1776) product flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184995.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene fliN CDS complement(1766..2770) product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene fliM CDS complement(2789..3370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(3552..4748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(4804..5268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(5289..6683) product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene fliI CDS complement(6673..7413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(7400..8395) product flagellar motor switch protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene fliG sequence122 source 1..8469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1787 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527789.1:molybdopterin containing oxidoreductase locus_tag LOCUS_12770 CDS complement(1918..2598) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195593.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(2715..4058) product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(4076..4993) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092132.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 5125..6147 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(6369..7385) product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536264.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 7501..8289 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936086.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 sequence123 source 1..8340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(658..2040) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEM3 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene radA CDS 2145..2996 product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064543.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene hpaI CDS 3056..4033 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196629.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene panE-2 CDS 4107..4715 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706154.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(4785..6365) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814273.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(6440..7057) product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726966.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS 7125..8015 product chromosome replication initiation inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038078.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 sequence124 source 1..8197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1381..2418) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(2443..2865) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814643.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(2875..3579) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 gene tolQ CDS complement(3576..3992) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(4012..5196) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKV4 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene aspB CDS complement(5322..5888) product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P705 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene nusB CDS complement(5885..6349) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RP5 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene ribH CDS complement(6352..7473) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009921779.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene ribB CDS complement(7770..8060) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523182.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 sequence125 source 1..8182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 814..1302 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1280..2287) product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072824.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 2701..3615 product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(3691..4839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(4991..6499) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272364.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(6647..6871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 misc_feature complement(6917..>8182) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VZC3:dihydrolipoyl dehydrogenase locus_tag LOCUS_13070 sequence126 source 1..8181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(715..1044) product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1041..1283) product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706289.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1362..1973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 2353..2778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 2775..4181 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117912.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 4174..4449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 4471..5316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 5486..5914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 5943..6224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 6227..6688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 6685..8034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 sequence127 source 1..8175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(654..1739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1850..3043) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(3094..4899) product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MX7 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene aceK CDS complement(4953..5612) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFU2 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(5641..6831) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene ivd CDS complement(6861..7244) product thioesterase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(7367..7762) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929528.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 sequence128 source 1..8147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(508..1002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(1189..3354) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083165.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(3416..4006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(4009..5238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(5271..6017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(6161..6940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 sequence129 source 1..8122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(801..2021) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S63 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene pncB CDS complement(2237..2722) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(2719..3657) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 3861..4409 product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(4847..7177) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(7197..7751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 sequence130 source 1..8038 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 287..865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(897..2000) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene nemA CDS complement(2250..2855) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083981.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 gene attY CDS complement(2968..3828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(4019..4279) product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813217.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(4347..4943) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339016.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 5166..7142 product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FS8 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene mnmG CDS 7139..7825 product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P664 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene gidB sequence131 source 1..7979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1259..5992) product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204155.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene gltB CDS complement(6173..6877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 sequence132 source 1..7972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 409..1887 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene ppx CDS 1938..2438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(2561..3022) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534876.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(3033..5114) product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6W9 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene ppk CDS complement(5240..6325) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(6322..7200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(7200..7577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 sequence133 source 1..7968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(374..1417) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene mreB CDS 1636..1935 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MR5 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene gatC CDS 1932..3437 product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YJ9 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene gatA CDS 3547..4995 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSN3 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene gatB CDS complement(5102..5800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(5806..6504) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PB11 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene pyrE CDS 6515..7318 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene xth-1 sequence134 source 1..7882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(396..2498) product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GK2 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene fusA2 CDS complement(2647..3120) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q07 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene rpsG CDS complement(3295..3672) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MC93 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene rpsL CDS complement(3839..5086) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064727.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(5146..5799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(5872..6231) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(6242..7339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522938.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(7361..7792) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930898.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 sequence135 source 1..7863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(47..1453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(1663..3573) product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNV1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene kefC CDS 3762..4400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096365.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 4532..5152 product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 5254..5718 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(5803..6120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 6352..7299 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143867.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(7306..7800) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGP0 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene trmL sequence136 source 1..7855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 292..825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(865..1341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(1486..2478) product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SQ3 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(2520..3044) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 3165..3938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202011.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 4024..5292 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 5458..6741 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941810.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(6840..7739) product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJP8 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene xerD sequence137 source 1..7839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 893..982 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 1224..4121 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TI8 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene valS CDS 4219..5106 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKA0 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene galU-1 CDS complement(5239..5472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(5472..6041) product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526805.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(6270..7172) product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S15 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene cysM tRNA 7214..7298 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 sequence138 source 1..7769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(259..1398) product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204184.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 1632..3635 product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268217.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 3654..6089 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 6047..6385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 note possible pseudo, frameshifted CDS 6556..7701 product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene metY sequence139 source 1..7762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(340..1434) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QG1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene ychF CDS complement(1664..2893) product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112947.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene serA CDS 3163..4470 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039943.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene ugpB CDS 4605..5486 product glycerol-3-phosphate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811262.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene ugpA CDS 5488..6339 product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYN3 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene ugpE CDS 6400..7404 product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P081 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene ugpC sequence140 source 1..7762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 236..1252 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 1316..2266 product 2-pyrone-4,6-dicarboxylate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086620.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 2268..2711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 2717..3580 product protocatechuate 4,5-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036040.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene pcaH CDS 3606..4553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 4632..5654 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405120.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 5903..7021 product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405859.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 sequence141 source 1..7739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 173..1405 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1474..2427 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 2432..3757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 3760..4545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 4549..5244 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 5452..7551 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192524.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 sequence142 source 1..7738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(353..1276) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114165.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 1383..2384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065172.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 2388..3578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523585.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(3756..5714) product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene ggt CDS 6149..6937 product methionine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815192.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(7125..7736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 sequence143 source 1..7701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(561..1016) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1053..1358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1366..2859) product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIP4 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene nuoN CDS complement(2887..4365) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930038.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene nuoM CDS complement(4379..6412) product NADH dehydrogenase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene nuoL CDS complement(6444..6752) product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IP5 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene nuoK CDS complement(6749..7417) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene nuoJ sequence144 source 1..7692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..1334) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTF2 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 1431..2642 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 2687..3787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 4007..4261 product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(4342..6711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523967.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 sequence145 source 1..7653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1655..3736 product ribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194277.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 3733..4593 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567783.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 4677..5528 product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKS1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene aroE CDS 5583..6317 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QP9 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene mtgA CDS complement(6366..7343) product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 sequence146 source 1..7643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(892..1878) product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEM0 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene dusA CDS 2192..2779 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(2867..3319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812808.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 3488..4627 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818337.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(4776..5411) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926795.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 sequence147 source 1..7568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 535..1644 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PC60 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene anmK CDS complement(1670..2035) product putative iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HB8 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene erpA CDS complement(2095..2493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(2622..3290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(3447..3839) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QW4 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene rpsI CDS complement(3852..4283) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QW3 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene rplM CDS complement(4480..6417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 6660..7547 product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3L3 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene rlmJ sequence148 source 1..7558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(742..1641) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 1929..3473 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970547.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 3473..4648 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538083.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 4726..5952 product aspartate aminotransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58350 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene aatB sequence149 source 1..7531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(440..844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(929..1432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 1671..2873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112500.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 2926..3396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(3747..4649) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 4866..6116 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204962.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 6154..7341 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114014.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 sequence150 source 1..7509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1909 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807207.1:transglycosylase locus_tag LOCUS_14620 CDS 2045..2641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(2730..3704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(3762..5450) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527788.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene fadD CDS 5688..6611 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706129.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(6601..7443) product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene phhA sequence151 source 1..7499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1323..3779 product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195264.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene nirB-1 CDS 3851..4234 product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936225.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 sequence152 source 1..7460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 91..2298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(2390..2512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(2512..2955) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931062.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(2976..3611) product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJA6 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene queE CDS complement(3608..4312) product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MS6 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene queC CDS complement(4317..5384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(5381..6676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(6673..7008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 sequence153 source 1..7431 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(407..1567) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035837.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene uptC CDS complement(1664..2497) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL35 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene dapD CDS complement(2503..3708) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009970787.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 3876..5363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(5451..6113) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541633.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 misc_feature complement(6146..>7431) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185678.1:esterase locus_tag LOCUS_14830 sequence154 source 1..7423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(315..692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(704..1897) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930376.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene fdhC CDS complement(1910..2149) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812666.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(2146..2775) product formate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene fdhB CDS complement(2786..5773) product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812670.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene fdhA CDS complement(5770..5988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(6138..6767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930374.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 misc_feature complement(6764..>7423) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926386.1:4Fe-4S ferredoxin locus_tag LOCUS_14910 sequence155 source 1..7392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 21..127 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS 237..980 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKL0 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene rsuA CDS 1142..2020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815413.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 2033..2830 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040657.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 2870..3883 product C-5 sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815411.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 3985..4824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533957.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 4830..5651 product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 5819..7234 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SK2 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene glnA sequence156 source 1..7375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..799 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QH5 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(880..1257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 1436..2149 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(2174..2761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 3135..4634 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186866.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene trpE CDS 4631..4966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 4975..5547 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene trpG CDS 5594..6625 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DC9 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene trpD CDS 6633..6776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 sequence157 source 1..7368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(505..1278) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811721.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1305..2057) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930601.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(2089..2865) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039874.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(2941..4671) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MIU2 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene hutU CDS complement(4713..6275) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF87 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene hutH CDS complement(6364..7080) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266355.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 sequence158 source 1..7361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 192..1463 product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339198.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene abc1 CDS complement(1555..2220) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 2332..3186 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204064.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 3187..3429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 3434..4033 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225722.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 4055..5242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 5477..7282 product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 sequence159 source 1..7328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..1034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1188..2201) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526811.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(2315..3322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064844.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(3403..4653) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526008.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(4650..5486) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389895.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(5491..6624) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 sequence160 source 1..7280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2038 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016374.1:type III restriction endonuclease subunit R locus_tag LOCUS_15270 CDS complement(2122..2970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(3264..5279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(5318..6886) product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUA5 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene opgG sequence161 source 1..7247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 403..1098 product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812732.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 1232..1783 product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS complement(2065..4500) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205765.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(4597..6657) product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JB9 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene ligA sequence162 source 1..7217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(941..1891) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DV9 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene thrB CDS complement(2005..2364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(2469..2888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 3031..5829 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930273.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene polA CDS 5889..7091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 sequence163 source 1..7197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1407..1877) product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 2115..3224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(3305..4060) product molybdenum-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097517.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 4266..4934 product molybdate-binding periplasmic protein ModA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113613.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene modA CDS 5017..5697 product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808339.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene modC CDS 5700..6812 product molybdenum import ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q881C1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene modC sequence164 source 1..7192 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(436..837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225719.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(843..2012) product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(2073..2558) product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808064.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(2697..4211) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(4226..5098) product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene bpoB CDS complement(5287..6009) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416945.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(6085..6786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098789.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 sequence165 source 1..7165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 118..1290 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112534.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 1287..1700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931351.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 1704..2861 product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 2893..3813 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 3827..4684 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040692.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 4730..5533 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807958.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 5659..6825 product putative acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702800.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 sequence166 source 1..7119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 269..778 product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205264.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 tRNA 829..904 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(939..1247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 1280..2263 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814565.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 2393..5152 product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GT8 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene secA CDS 5250..6479 product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GT9 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene argJ sequence167 source 1..7079 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(763..1977) product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 2071..3024 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 2996..3415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 3494..3808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(3887..4069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 4542..5594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(5686..6465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 sequence168 source 1..7066 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 152..376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809188.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 540..848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 851..2821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(3004..6177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(6250..7062) product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X6T6 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene truC sequence169 source 1..7039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3032 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011974276.1:multidrug efflux RND transporter permease subunit locus_tag LOCUS_15770 CDS 3129..4622 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925807.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 4863..6299 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 6361..6726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 sequence170 source 1..7031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 735..1187 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1212..3458) product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037035.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene pdeA CDS 3559..4656 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KU7 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene aroC CDS 4680..5888 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 5885..6946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 sequence171 source 1..6941 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1033..1770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207434.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1813..2586) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039134.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(2583..2984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 3116..5173 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064313.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene tktA CDS 5198..6397 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZW51 transl_table 11 codon_start 1 locus_tag LOCUS_15900 sequence172 source 1..6938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 180..1136 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189905.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 1153..1680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189390.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(1832..2347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(2425..3840) product outer membrane protein OprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51487 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene oprM misc_feature complement(3824..>6938) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709990.1:multidrug efflux RND transporter permease subunit locus_tag LOCUS_15950 sequence173 source 1..6887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 154..241 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(346..1512) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708380.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(1527..2768) product PLP-dependent lyase/thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532462.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(2822..4075) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 4191..4658 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(4730..5137) product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535495.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 sequence174 source 1..6874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(502..1398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526454.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(1428..1865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(1862..2431) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204054.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 2719..4500 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP8 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene ilvI CDS 4640..5131 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene ilvH CDS 5182..6198 product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IM0 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene ilvC sequence175 source 1..6854 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1404 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62KK9:translation initiation factor IF-2 locus_tag LOCUS_16070 CDS 1429..1809 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TP9 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene rbfA CDS 1806..2813 product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KL1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene truB CDS 2810..4633 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193111.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene typA CDS 4755..5630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087083.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 5627..6724 product 3-hydroxyisobutyryl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199465.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 sequence176 source 1..6830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..570 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815008.1:ABC transporter ATP-binding protein locus_tag LOCUS_16130 CDS 813..1874 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526891.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 2034..2525 product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIW4 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 2573..3202 product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WM5 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene plsY CDS complement(3246..4271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(4278..4928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(4979..5464) product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M78 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 5534..6607 product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M77 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene murB sequence177 source 1..6774 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 650..1720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(1768..2460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(2544..2999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(3032..3973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037665.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(4082..4867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816759.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(4881..5456) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084991.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 5735..6301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765561.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 sequence178 source 1..6772 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 681..3608 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226785.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene acnA CDS 3699..4937 product salicylate hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088337.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene nah CDS complement(5003..6196) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563408.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 sequence179 source 1..6766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1206 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968695.1:integrase locus_tag LOCUS_16310 CDS 1262..1762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(2676..2987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 tRNA complement(3066..3142) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(3178..3606) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812822.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(3707..4051) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TM8 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene ihfA CDS complement(4061..6511) product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TM7 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene pheT sequence180 source 1..6759 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(220..909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002345174.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 1110..2021 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010432103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(2050..3678) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene nirN CDS complement(3668..4891) product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene nirJ CDS complement(4894..5376) product protein NirH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95415 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene nirH CDS complement(5357..5863) product protein NirG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P95414 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene nirG misc_feature complement(5850..>6759) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903402.1:heme biosynthesis protein note possible pseudo, frameshifted locus_tag LOCUS_16430 sequence181 source 1..6734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 760..1656 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090656.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 1709..2785 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090655.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 2782..3630 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090654.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 3627..4424 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090653.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 4539..6395 product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 sequence182 source 1..6727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 515..1966 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene cht1 CDS 2057..2362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 2372..2992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547165.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 3038..4852 product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X93 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene aspS CDS 4965..5789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 5823..6317 product NUDIX pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene ntpA CDS complement(6362..6727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 sequence183 source 1..6724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(137..277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(427..870) product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530565.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS 979..3486 product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766952.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 3486..3623 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810379.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 3688..5127 product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212595.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene fixN CDS 5146..5778 product cbb3-type cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087318.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene ccoO2 CDS 5793..5930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 sequence184 source 1..6715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(826..1713) product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYS6 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene kynA CDS complement(1732..3069) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I235 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene kynU CDS complement(3159..3752) product kynurenine formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MHU5 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene kynB CDS 4213..5106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196566.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 5201..6355 product chromate resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205325.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene chrA CDS 6381..6635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 note possible pseudo, frameshifted sequence185 source 1..6668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..575 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040012.1:ABC transporter ATP-binding protein locus_tag LOCUS_16710 CDS 579..1652 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810943.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 1649..2545 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810946.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 2538..3059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 note possible pseudo, internal stop codon CDS 3111..3350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 note possible pseudo, internal stop codon CDS 3363..3671 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810949.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 3861..5594 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810951.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 sequence186 source 1..6656 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 423..992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 1204..2202 product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCF9 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene dusB CDS 2199..2432 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene fis CDS 2526..4145 product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HA6 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene purH CDS 4179..4709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(4914..5840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 sequence187 source 1..6647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 252..1061 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337372.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 1058..3070 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 3067..3954 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256971.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 3958..5010 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene livM CDS 5077..6306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 sequence188 source 1..6618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2033 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114936.1:ferric-mycobactin receptor FemA locus_tag LOCUS_16890 CDS 2226..2702 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAT4 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene brf CDS complement(2948..4807) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6E0 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene ilvD CDS complement(4993..5235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 5349..5654 product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00099 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene nirM CDS complement(5784..6248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228841.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 sequence189 source 1..6600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(319..1080) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815983.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(1140..1733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550823.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1782..3230) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929820.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(3329..4036) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 4414..4938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107722.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 misc_feature complement(5387..>6600) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P5M6:K(+)-insensitive pyrophosphate-energized proton pump locus_tag LOCUS_17000 sequence190 source 1..6574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..1167 product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191991.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1379..2035) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEN6 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene adK CDS complement(2186..3028) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WL5 transl_table 11 codon_start 1 locus_tag LOCUS_17030 gene kdsB CDS complement(3025..3207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(3244..4353) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8X0 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene lpxK CDS complement(4359..4799) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(4812..5477) product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064089.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 sequence191 source 1..6568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(973..1290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1430..1822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1889..2053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(2463..3779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 3951..4583 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(4734..5108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(5222..5971) product molybdopterin biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 misc_feature complement(6059..>6568) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929911.1:peptidase S41 locus_tag LOCUS_17150 sequence192 source 1..6556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(179..2770) product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5Y8 transl_table 11 codon_start 1 locus_tag LOCUS_17160 gene acnB CDS complement(2859..3437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(3511..4527) product lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188261.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(4712..5698) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PEN4 transl_table 11 codon_start 1 locus_tag LOCUS_17190 gene mdH sequence193 source 1..6550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(425..1138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1135..1875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(1902..2951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(2963..3406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(3503..3991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(4090..5853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 5822..6100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 sequence194 source 1..6507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 235..903 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 900..1793 product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYH7 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1710..2033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 2159..3859 product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203969.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene phaC CDS 3951..5129 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene phbA CDS 5329..6066 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene phbB-1 sequence195 source 1..6506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 720..917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 981..2660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 2699..3484 product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266992.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 3616..4887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 4891..6111 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388011.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 sequence196 source 1..6502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..589 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204227.1:methyl-accepting chemotaxis protein locus_tag LOCUS_17380 CDS 894..1475 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811244.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 1712..2716 product sulfate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522973.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene sbp CDS 2741..3610 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942000.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene cysU CDS 3607..4509 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205087.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene cysW CDS 4522..5646 product sulfate/thiosulfate import ATP-binding protein CysA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3I8 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene cysA CDS 5791..6324 product disulfide bond formation protein B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21482 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene dsbB1 sequence197 source 1..6426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(863..1453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(1667..2167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(2381..2647) product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9M8 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene minE CDS complement(2651..3466) product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKR1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene minD CDS complement(3512..4267) product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RS4 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene minC CDS complement(4404..5285) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 5338..6261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530905.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 sequence198 source 1..6399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(630..1358) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201495.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1355..2257) product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267624.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(2409..3275) product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(3316..3942) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929605.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(3949..5130) product 2-aminoadipate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037008.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene avtA CDS complement(5179..6084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064436.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 sequence199 source 1..6392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2263 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63TF9:alanine--tRNA ligase locus_tag LOCUS_17580 CDS 2470..3189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 3343..3780 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFV2 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene uspA CDS complement(4000..4983) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809384.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(5151..6335) product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 sequence200 source 1..6238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..1660) product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8F0 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 1797..3242 product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KND4 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene fumC CDS complement(3293..3892) product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63NC6 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 4082..6076 product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63NC4 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene acsA sequence201 source 1..6233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3153 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZZ46:bifunctional protein PutA locus_tag LOCUS_17670 CDS complement(3255..4325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088230.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 4228..4443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 4440..4850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267515.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(5031..6230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17710 sequence202 source 1..6177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1050 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000980724.1:transcription accessory protein locus_tag LOCUS_17720 CDS 1134..1961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 2010..3212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(3251..4387) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192588.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 4473..5342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 sequence203 source 1..6165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(854..1444) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU73 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 1833..5357 product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T05 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene smc sequence204 source 1..6158 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(400..1092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 note possible pseudo, frameshifted CDS complement(1176..1976) product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXN2 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene surE CDS 2178..3152 product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889510.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 3249..4775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 sequence205 source 1..6150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..1078) product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W73 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene hemC CDS 1217..4006 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W75 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene ppc misc_feature complement(4067..>6150) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265609.1:GGDEF domain-containing protein locus_tag LOCUS_17850 sequence206 source 1..6129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(333..998) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212452.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 1244..2626 product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P554 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene hemN CDS 2644..3381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 3731..5020 product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461085.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 sequence207 source 1..6120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1119..1619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(1651..1899) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071089.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(2092..2997) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818676.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 3083..4459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063958.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 4456..4842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810633.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 4891..5883 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089798.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 sequence208 source 1..6113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1335 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943246.1:general secretory pathway protein GspE locus_tag LOCUS_17960 CDS complement(1342..2064) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920654.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 2413..3354 product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551610.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 3384..4391 product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 4479..5603 product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204194.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(5736..6035) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888273.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 sequence209 source 1..6091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..860 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096246.1:transcriptional regulator locus_tag LOCUS_18020 CDS 1098..1910 product formate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085585.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 2003..3736 product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 3960..4946 product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI98 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene corA CDS complement(5137..5886) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIR1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 sequence210 source 1..6065 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(670..1218) product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PR3 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene flhC CDS complement(1276..1620) product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XCE8 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene flhD CDS complement(1834..2733) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930841.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(2833..3744) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(3922..5061) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 5314..5610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 sequence211 source 1..6049 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(381..1625) product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(1694..2893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(2908..4041) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene uptC CDS complement(4222..5565) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8C3 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene gdhA sequence212 source 1..6046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1509..5255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187804.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 misc_feature complement(5524..>6046) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004186399.1:serine-tRNA(Ala) deacylase AlaX locus_tag LOCUS_18180 sequence213 source 1..6020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(666..1154) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814615.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1297..3096) product secretion pathway ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096276.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(3165..3929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(3933..4526) product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204944.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(4629..5462) product TatD related DNase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527360.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 misc_feature complement(5481..>6020) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62J04:lipoprotein-releasing system ATP-binding protein LolD locus_tag LOCUS_18240 sequence214 source 1..6000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..1444) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(1525..2343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 2515..3468 product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS 3680..4804 product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R35 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene aroG CDS 4959..5270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 misc_feature complement(5382..>6000) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5F8G0:UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase locus_tag LOCUS_18300 sequence215 source 1..5970 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(128..568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 792..1676 product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(2247..2582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 2551..2745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 2760..3134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 3234..5105 product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095196.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 tRNA complement(5290..5366) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 misc_feature complement(5394..>5970) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198410.1:enoyl-CoA hydratase locus_tag LOCUS_18370 sequence216 source 1..5943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 315..2297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533594.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 2834..4081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 4071..5195 product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FV3 transl_table 11 codon_start 1 locus_tag LOCUS_18400 sequence217 source 1..5928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 624..1253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(1392..1751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 1633..2874 product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815035.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 sequence218 source 1..5883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1938 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_600130.1:adenine-specific DNA methylase locus_tag LOCUS_18450 CDS 1935..4457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 sequence219 source 1..5848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 138..878 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WE23 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene aat CDS 889..1632 product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62K46 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene ate CDS 1756..2493 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(2547..3668) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195933.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(3784..5322) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene leuA sequence220 source 1..5846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..845 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038937.1:sporulation protein locus_tag LOCUS_18520 CDS 870..1364 product bacteriocin production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188369.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 1437..2942 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2B4 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene purF CDS 3039..4451 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J82 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene gltX tRNA 4514..4589 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 4614..4689 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 4740..4816 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 4911..5189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(5278..5526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 sequence221 source 1..5806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 203..1000 product amino acid ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817462.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 1172..1825 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063820.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 1857..2609 product polar amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063819.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 2844..3662 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 3659..4441 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 4473..4961 product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204152.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 4958..5755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 sequence222 source 1..5783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 427..1362 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482188.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(1575..2831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(2865..3161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(3282..3728) product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(3921..4133) product 30S ribosomal protein S21 B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DT5 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene rpsU2 sequence223 source 1..5776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..918 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63TF6:glutamine--tRNA ligase locus_tag LOCUS_18700 CDS 918..1799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404288.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 1837..2550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020083.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 2553..3092 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 3223..3456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 3453..3746 product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 3859..4170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 4768..5238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 5216..5758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18780 sequence224 source 1..5771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1660..2559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 2556..3194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 3191..4357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 sequence225 source 1..5760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4175..4552) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GJ6 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene rplL CDS complement(4595..5101) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q01 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene rplJ sequence226 source 1..5743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1853..2719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 3023..4267 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBH6 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene glyA CDS 4285..4734 product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I17 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene nrdR misc_feature complement(4903..>5743) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206722.1:bifunctional metallophosphatase/5'-nucleotidase locus_tag LOCUS_18870 sequence227 source 1..5722 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1278..2705) product copper resistance-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 note possible pseudo, frameshifted CDS complement(2705..3040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 3204..3887 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098784.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene copR CDS 3890..5299 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211179.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 sequence228 source 1..5721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 742..1626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 1674..2435 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726855.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 2437..3843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814854.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(3949..4746) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888042.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 misc_feature complement(4917..>5721) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089117.1:acyl-CoA dehydrogenase locus_tag LOCUS_18960 sequence229 source 1..5714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 71..550 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T71 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene ispF CDS complement(596..1777) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770220.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(1970..2410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 2584..3198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 3307..3726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 3793..4164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(4279..4947) product ribosomal large subunit pseudouridine synthase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX48 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene rluE CDS complement(4973..5095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 sequence230 source 1..5712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(15..815) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ03 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene comL CDS 969..4529 product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VX8 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene dnaE CDS 4772..5017 product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WJ1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene clpS sequence231 source 1..5710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..3236) product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XJ5 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene uvrA CDS 3382..4647 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806952.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 4800..5354 product single-stranded DNA-binding protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2F7 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene ssb sequence232 source 1..5710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(609..2264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040117.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(2418..2672) product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UV5 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene rpmE2 CDS complement(2833..4095) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MKD1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene rho CDS complement(4347..4679) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ3 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene trx-2 sequence233 source 1..5702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 412..1887 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040493.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(2057..2698) product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705819.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 2842..3744 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083769.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(3802..5040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 sequence234 source 1..5699 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(510..1034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369584.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(1149..1775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 tRNA complement(1789..1880) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(2029..2104) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA complement(2236..2309) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA complement(2364..2439) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(2523..4895) product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WF10 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene lon misc_feature complement(5077..>5699) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62JK8:ATP-dependent Clp protease ATP-binding subunit ClpX locus_tag LOCUS_19220 sequence235 source 1..5686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 353..1273 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 1329..2492 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 2618..3667 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene add CDS complement(3677..4045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 4271..5365 product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 sequence236 source 1..5680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 526..945 product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811999.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 1076..2128 product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene idiA CDS 2257..3015 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812901.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(3630..4769) product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207409.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene ybhR misc_feature complement(4771..>5680) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001881390.1:multidrug ABC transporter permease locus_tag LOCUS_19330 sequence237 source 1..5663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(574..1461) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930839.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 1651..2472 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903534.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 2466..3341 product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene phnD CDS 3338..4138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 4156..5127 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223743.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 sequence238 source 1..5653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(131..1528) product tricarballylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704752.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(1635..2576) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704753.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 3028..4278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 4325..5482 product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7U359 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene mnmA sequence239 source 1..5646 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(598..1974) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(1971..2258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(2255..3370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114955.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(3402..4337) product 4-hydroxyproline 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I476 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(4375..5292) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 sequence240 source 1..5639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 459..1529 product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q66X92 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene recA CDS 1721..2179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(2225..3157) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A8H5 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene argC CDS 3364..4524 product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1Q0 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene sucC CDS 4540..5436 product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WW1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene sucD sequence241 source 1..5636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..850 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188924.1:branched chain amino acid aminotransferase locus_tag LOCUS_19530 CDS 853..1059 product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197553.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 1135..1983 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 1996..2772 product LPS biosynthesis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 3439..4026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 4019..4753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 misc_feature complement(4750..>5636) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056237.1:transposase locus_tag LOCUS_19590 sequence242 source 1..5601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(679..1392) product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63KI8 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 1414..1995 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F7F4 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene purN CDS complement(2037..2591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2841..3104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 3184..5037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 sequence243 source 1..5600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(383..1384) product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268755.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(1467..2066) product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524614.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(2133..2765) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW35 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene sigE CDS complement(3519..4763) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJC8 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene fabF CDS complement(4811..5050) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LT9 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene acpP CDS complement(5154..5600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 sequence244 source 1..5572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 245..1648 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222025.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene gatA CDS complement(1762..3171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(3182..3487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 3506..4099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 4126..5478 product tetratricopeptide repeat protein 38 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038934.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 sequence245 source 1..5564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(755..1315) product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JC7 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene frr CDS complement(1359..2081) product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JC6 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene pyrH CDS complement(2135..3061) product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JC5 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene tsf CDS complement(3170..3922) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T12 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene rpsB CDS 4096..5442 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063875.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 sequence246 source 1..5534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(272..628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(625..3207) product conjugal transfer protein TraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331477.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene traC CDS complement(3215..3880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(3877..4656) product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207679.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene dsbC misc_feature complement(4691..>5534) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013087198.1:conjugal transfer protein TraB locus_tag LOCUS_19850 sequence247 source 1..5521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1356..1781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 1985..2179 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 2257..2460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 3032..3268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(3404..4327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(4349..4837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 sequence248 source 1..5511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(533..1978) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW85 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene sbcB CDS 2310..3674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS complement(3700..5046) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(5043..5510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 sequence249 source 1..5484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(612..1211) product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW25 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 1210..1788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 1890..2072 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDY3 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene rpmF CDS 2177..3229 product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PEG2 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene plsX CDS 3229..4206 product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LU2 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene fabH CDS 4257..5201 product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK48 transl_table 11 codon_start 1 locus_tag LOCUS_20010 gene fabD-1 sequence250 source 1..5477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..937 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105254.1:nitrate reductase locus_tag LOCUS_20020 CDS complement(996..1847) product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088646.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 gene thiD CDS 2204..3289 product thiamine biosynthesis oxidoreductase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205267.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 gene thiO CDS 3286..3483 product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199938.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 3498..4310 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q73 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene thiG CDS 4303..5208 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205266.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene thiE sequence251 source 1..5468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(157..660) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086317.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(657..1472) product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086316.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene cutM CDS complement(1469..4474) product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene cutL CDS complement(4622..5137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20110 sequence252 source 1..5380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(445..1236) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(1587..3272) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(3332..3841) product molybdenum cofactor biosynthesis protein MoeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188105.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(4010..4642) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808006.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 misc_feature complement(4748..>5380) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P23966:1,4-dihydroxy-2-naphthoyl-CoA synthase locus_tag LOCUS_20160 sequence253 source 1..5359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 237..614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(658..1047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(1161..2105) product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(2130..3362) product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene gspF CDS complement(3541..4578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 4782..5267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 sequence254 source 1..5329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 130..1188 product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970739.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(1177..1791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(1890..4541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 4764..5195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 sequence255 source 1..5329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1052..1141) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(1197..2312) product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F6 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene selU CDS complement(2312..3427) product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889F7 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene selD CDS complement(3516..4838) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RS1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene serS CDS complement(4871..5329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 sequence256 source 1..5324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..736 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889212.1:ABC transporter substrate-binding protein locus_tag LOCUS_20310 CDS 733..1791 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 1788..2630 product cobalamin/Fe3+-siderophore ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226864.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 2620..3189 product cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(3263..4150) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528481.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(4220..4603) product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW19 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene crcB CDS complement(4689..5069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 sequence257 source 1..5314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..738 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205106.1:MFS transporter locus_tag LOCUS_20380 CDS complement(755..2041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(2045..2764) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(2920..4293) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 4392..5177 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930369.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 sequence258 source 1..5307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1810 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267676.1:bifunctional diguanylate cyclase/phosphodiesterase locus_tag LOCUS_20430 CDS complement(1927..2766) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192042.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 2838..4166 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(4564..5070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 sequence259 source 1..5305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..923 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63XS7:protoheme IX farnesyltransferase locus_tag LOCUS_20470 CDS 1016..1537 product photosynthetic protein synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(1613..2620) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807415.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(2808..3749) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XN5 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene rpoH CDS complement(3835..4254) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001056.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 sequence260 source 1..5300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2807..3688) product Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194630.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 3814..4947 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815378.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 sequence261 source 1..5300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(811..2037) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267114.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 2223..3065 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083249.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 3233..4399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114754.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 4540..5094 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGI5 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene efp sequence262 source 1..5294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1468 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103281.1:ligand-gated channel locus_tag LOCUS_20580 CDS 1471..2088 product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552342.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 2362..2997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 3021..4391 product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038178.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene cobB CDS 4388..4993 product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene cobP sequence263 source 1..5287 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 276..1250 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 1391..1999 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974960.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 2002..3282 product dehydroascorbate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888317.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 misc_feature complement(3472..>5287) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6PBM5:D-lactate dehydrogenase locus_tag LOCUS_20660 sequence264 source 1..5279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1311 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003118645.1:helicase locus_tag LOCUS_20670 CDS 1504..2097 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KK7 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene rimP CDS 2178..3665 product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TP7 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene nusA sequence265 source 1..5278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 469..3942 product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEK2 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene mfd CDS 3979..4635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 4734..4919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 sequence266 source 1..5250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..512 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811464.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 543..1034 product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 1048..1554 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 1580..2656 product sodium bile acid symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266245.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(2761..2979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(3056..4390) product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268234.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(4486..5139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 note possible pseudo, frameshifted sequence267 source 1..5250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1547..2683) product NAD-dependent 4-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039242.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene gbd CDS 2798..3757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064273.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 3782..4846 product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004204527.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene metH2 sequence268 source 1..5239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(207..2048) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207765.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene deaD CDS complement(2349..3512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205727.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(3551..5077) product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085758.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 sequence269 source 1..5214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(14..493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(520..1551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(1563..2360) product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YB24 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene phnC CDS complement(2448..3389) product phosphonates-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016927.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(3440..4168) product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309142.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene phnF sequence270 source 1..5199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 270..938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 935..1717 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195214.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 1785..3407 product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XK7 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene rpoN CDS 3506..4795 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194083.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 sequence271 source 1..5167 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..1430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20950 note possible pseudo, internal stop codon CDS complement(1548..1862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS complement(2193..3026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207827.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 3266..4129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002233833.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(4230..4427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20990 sequence272 source 1..5163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(407..1762) product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene nuoF CDS complement(1759..2250) product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene nuoE CDS complement(2247..3500) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN8 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene nuoD CDS complement(3527..4135) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN7 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene nuoC CDS complement(4146..4625) product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN6 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene nuoB1 CDS complement(4651..5037) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VN3 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene nuoA tRNA complement(5079..5163) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 sequence273 source 1..5144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2032 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WE40:ribonuclease R locus_tag LOCUS_21060 CDS complement(2113..3660) product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFE2 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(3757..4983) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IXK6 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene dadA sequence274 source 1..5132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2582..3136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(3317..4006) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105111.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(4117..4620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 sequence275 source 1..5129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(420..2138) product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268311.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2135..2617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 misc_feature complement(2617..>5129) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268309.1:monovalent cation/H+ antiporter subunit A locus_tag LOCUS_21140 sequence276 source 1..5125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1230..2066) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(2285..3613) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807259.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(3814..4890) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807261.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 sequence277 source 1..5115 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..567 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525749.1:cyclohexadienyl dehydratase locus_tag LOCUS_21180 CDS 570..1298 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200384.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(1395..2006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 2302..2664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 2920..3567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 3586..4596 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 sequence278 source 1..5114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..566 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYE9:enoyl-[acyl-carrier-protein] reductase [NADH] locus_tag LOCUS_21240 CDS 786..2222 product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524980.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 2235..3452 product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89PM2 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene ackA CDS complement(3493..4653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 sequence279 source 1..5109 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(14..658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(633..821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(839..1147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(1249..2001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(1998..2216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(2222..2668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2673..2975) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(2975..3955) product minor capsid protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339609.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 4030..5088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 sequence280 source 1..5104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 645..1148 product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WV5 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene moaC CDS complement(1286..1996) product fimb protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688173.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(2131..2640) product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947632.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene pilE CDS complement(2872..3669) product cAMP phosphodiesterase class-II:metallo-beta-lactamase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(3713..5104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 sequence281 source 1..5097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1172 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_638169.2:endoproteinase ArgC locus_tag LOCUS_21420 CDS 1209..2267 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9N4 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene ruvB CDS 2363..3601 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056368.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 3612..4850 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963567.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 sequence282 source 1..5096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..1391) product 3-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231036.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(1391..2104) product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVC9 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 2229..2693 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WH1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 2693..3688 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HM8 transl_table 11 codon_start 1 locus_tag LOCUS_21490 gene ispH2 CDS complement(3781..4476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 sequence283 source 1..5096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 93..737 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186084.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(771..2294) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390936.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(2326..2991) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085905.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(2991..3803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 3852..4496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(4670..5095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 sequence284 source 1..5089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..841) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(920..2350) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267796.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(2431..2622) product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6Z2 transl_table 11 codon_start 1 locus_tag LOCUS_21590 misc_feature complement(3381..>5089) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VT71:malate synthase G locus_tag LOCUS_21600 sequence285 source 1..5086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 245..1135 product phytanoyl-CoA dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 1150..1764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169060.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 1842..3131 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SI0 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene hutI CDS 3128..4510 product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197961.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene hutF sequence286 source 1..5083 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(491..1738) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186023.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(1912..2514) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HZ7 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(2692..3420) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HZ8 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene rph CDS complement(3506..4408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(4494..5081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 sequence287 source 1..5071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1602..2624 product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869721.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 2657..3079 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973766.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 sequence288 source 1..5058 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(783..1763) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YR6 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene fmt CDS complement(1854..2297) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203512.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(2405..2914) product peptide deformylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS88 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene def2 CDS 3116..4312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 sequence289 source 1..5047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 597..2051 product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA8 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene fliD CDS 2228..2653 product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTY6 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene fliS CDS 2656..2955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(3061..3372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 sequence290 source 1..5041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(314..1483) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(1467..2105) product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205235.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(2112..2726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(2863..3831) product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62EN9 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene ttcA CDS complement(3836..4237) product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU55 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene folB CDS complement(4234..4647) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene folB sequence291 source 1..5025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 828..1001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 1034..1786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 1928..2107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(2077..2277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(2361..2633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(2630..3508) product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene pecR CDS complement(3505..4368) product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene pecR misc_feature complement(4380..>5025) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815953.1:methylcrotonoyl-CoA carboxylase locus_tag LOCUS_21940 sequence292 source 1..5024 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(912..1562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(1606..2394) product PP2C phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(2410..4758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 4772..4999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21980 sequence293 source 1..5021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1976 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037122.1:c-di-GMP phosphodiesterase A locus_tag LOCUS_21990 CDS 2033..2245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 2242..3120 product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 3117..4079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 sequence294 source 1..5010 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(338..1189) product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IX5 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene folD CDS complement(1375..2001) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193928.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(1998..4583) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205155.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 sequence295 source 1..5006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 125..385 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene grx3 CDS 513..974 product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XU4 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene secB CDS 1053..2075 product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9F5 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene gpsA CDS complement(2373..3617) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGZ1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene lysA CDS 3763..4740 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103034.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene lysR sequence296 source 1..4998 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1068..1847 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(1873..3339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 3471..4391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141764.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 4388..4561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 sequence297 source 1..4997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 1403..1921 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705794.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 1974..2543 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(2530..3507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064800.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(3550..4731) product tricarballylate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811143.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 gene citB sequence298 source 1..4968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 492..845 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184362.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 1011..1391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(1775..3181) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089642.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(3178..3684) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390043.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(3717..4883) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037790.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 sequence299 source 1..4964 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 346..2058 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390495.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(2114..2686) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9H3 transl_table 11 codon_start 1 locus_tag LOCUS_22260 gene dcd CDS complement(2807..3283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(3562..4866) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189962.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene guaD sequence300 source 1..4953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 280..3354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 3360..4289 product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene cas1 CDS 4347..4646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 repeat_region 4717..4950 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtctagatcactgggatatgcgcactggccggaac sequence301 source 1..4943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 662..1834 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene mrdB CDS 1965..2312 product UPF0339 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAL4 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 2373..3857 product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931196.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 misc_feature complement(3885..>4943) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086825.1:O-succinylbenzoic acid--CoA ligase locus_tag LOCUS_22350 sequence302 source 1..4940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(588..1499) product binding-protein-dependent permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039165.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(1592..3214) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085661.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(3231..4448) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820761.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 sequence303 source 1..4924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..846 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WHR8:pyruvate kinase locus_tag LOCUS_22390 CDS complement(868..1632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 1693..2394 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene pmrA CDS 2391..3779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 sequence304 source 1..4921 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 504..1364 product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W97 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene panC CDS complement(1615..2586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(3012..4472) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073936.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 gene hsdM sequence305 source 1..4917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 531..1481 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266700.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(1582..2175) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400935.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 2320..3687 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263439.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 3689..4657 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707257.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 sequence306 source 1..4908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 425..1411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811386.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 1741..2247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(2703..3767) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WA9 transl_table 11 codon_start 1 locus_tag LOCUS_22520 gene cobT CDS complement(3864..4625) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 sequence307 source 1..4899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(514..2043) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196632.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(2049..2780) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199523.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene ompR CDS 3011..3739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268908.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(3767..4090) product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035340.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene trxA misc_feature complement(4217..>4899) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812683.1:molybdopterin molybdenumtransferase MoeA locus_tag LOCUS_22580 sequence308 source 1..4895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2289..4778) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJJ5 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene uvrD sequence309 source 1..4855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 161..784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(800..1045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 1180..1524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 1728..2225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 2367..2894 product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942768.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 3411..3773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 3805..4104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 4119..4685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 sequence310 source 1..4827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..1326) product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YC3 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene cca CDS 1398..1853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(1884..2567) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925693.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 2925..4133 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103404.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(4159..4731) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGG4 transl_table 11 codon_start 1 locus_tag LOCUS_22720 sequence311 source 1..4804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(499..1980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(1983..3203) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881030.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 3585..4187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 note possible pseudo, frameshifted sequence312 source 1..4799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 450..956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(1038..1292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(1289..2797) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707906.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 3025..3174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(3209..4654) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113267.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene creC sequence313 source 1..4798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(104..757) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(754..1773) product UPF0176 protein R02887 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LX6 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 1834..3438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(3463..3636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 note possible pseudo, frameshifted CDS complement(3602..4327) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970248.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 note possible pseudo, frameshifted CDS 4546..4749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 sequence314 source 1..4790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 153..314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 419..889 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ12 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene arsC-2 CDS complement(890..1558) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 1655..2833 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266146.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 2826..3137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 3148..4071 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206797.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene hmgCl sequence315 source 1..4765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1010 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105294.1:HPr kinase locus_tag LOCUS_22930 CDS 1007..1717 product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194988.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 1752..2549 product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63KE1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene hyi CDS complement(2565..3446) product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813954.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(3545..4606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 sequence316 source 1..4760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(385..1665) product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62H23 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene proA CDS 1731..2015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(2382..3749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112975.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 misc_feature complement(3749..>4760) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194041.1:DNA polymerase III subunit delta locus_tag LOCUS_23010 sequence317 source 1..4751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 444..1433 product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHT1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 gene cobD CDS complement(1495..2442) product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S39 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene rsgA CDS complement(2461..2802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(2806..4107) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555861.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 4202..4723 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M61 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene orn sequence318 source 1..4748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(89..2338) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810200.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene brfB CDS complement(2367..2612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(2609..3811) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269198.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 sequence319 source 1..4728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 169..723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 720..938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 1035..1388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(1393..2493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 sequence320 source 1..4719 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1345..2478) product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207152.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 2620..3108 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378342.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(3165..3995) product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198742.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene cobA-2 misc_feature complement(4008..>4719) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195270.1:DNA-binding protein YbiB locus_tag LOCUS_23170 sequence321 source 1..4712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(800..1132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 1755..2258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 2251..3195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 3307..4170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 sequence322 source 1..4688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1091..2248 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIG6 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene tyrS CDS complement(2271..2651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23230 note possible pseudo, frameshifted CDS complement(2702..3448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(3509..4504) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815402.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 sequence323 source 1..4681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(958..1755) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QK0 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene ftsQ CDS complement(1752..2738) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUQ5 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene ddl CDS complement(2735..4168) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8Q6 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene murC sequence324 source 1..4678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(545..1975) product nitric oxide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59647 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene norB CDS complement(2024..2449) product nitric oxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q59646 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene norC CDS 2750..3271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene norE CDS 3294..3566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 3731..4621 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YI7 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene argB sequence325 source 1..4641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 1209..1442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(1567..2244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(2418..3353) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P473 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene argF CDS complement(3376..4572) product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P173 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene argD sequence326 source 1..4630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 218..1330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 1327..1896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 note possible pseudo, frameshifted CDS 2014..3138 product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035306.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 3146..3682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 3679..4107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 4118..4594 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920736.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 sequence327 source 1..4626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(560..919) product type IV fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene pilZ CDS complement(922..1953) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192693.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene holB CDS complement(1950..2627) product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JN9 transl_table 11 codon_start 1 locus_tag LOCUS_23470 gene tmk CDS complement(2696..3652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811737.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 sequence328 source 1..4597 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(342..3008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 3329..4402 product (p)ppGpp synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706810.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 sequence329 source 1..4593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..970 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EXP6:cobalt-precorrin-5B C(1)-methyltransferase locus_tag LOCUS_23510 CDS 967..2307 product precorrin-6Y-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 2304..3146 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392605.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 3143..3937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 3974..4411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 sequence330 source 1..4589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(388..1497) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(1494..1910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(1900..2334) product toxin-antitoxin system antidote Mnt family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(2345..3379) product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(3453..4589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 sequence331 source 1..4568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 147..767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(806..1843) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638865.2 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(1888..2637) product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HT7 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene trmB CDS complement(2634..3635) product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VY0 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene gluQ misc_feature complement(3650..>4568) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122223.1:deoxyribodipyrimidine photo-lyase locus_tag LOCUS_23650 sequence332 source 1..4558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(182..1222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 1454..1699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(1807..2853) product glycine betaine/proline betaine-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AFM2 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene proX CDS complement(2985..4244) product glycine/betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390229.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 sequence333 source 1..4528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2283..2687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(2739..4064) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815181.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 sequence334 source 1..4523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1106 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_635553.2:ferripyoverdine receptor locus_tag LOCUS_23720 CDS 1307..2578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039020.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 misc_feature complement(2597..>4523) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113216.1:bifunctional diguanylate cyclase/phosphodiesterase locus_tag LOCUS_23740 sequence335 source 1..4512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 374..3817 product two-component system sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104152.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 sequence336 source 1..4503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 634..3639 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 3636..3872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 sequence337 source 1..4493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(215..2452) product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909024.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene icd2 CDS complement(2623..3339) product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389029.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(3329..3520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931260.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(3619..4491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 sequence338 source 1..4482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 342..659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 659..1981 product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817431.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 2024..2188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 2366..2836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS 2878..3216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 3541..3711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23870 sequence339 source 1..4467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence340 source 1..4457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 227..661 product succinate dehydrogenase cytochrome b-556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536542.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene sdhC CDS 678..1091 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187439.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 gene sdhD CDS 1114..2922 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2W976 transl_table 11 codon_start 1 locus_tag LOCUS_23900 gene sdhA CDS 2948..3652 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAZ6 transl_table 11 codon_start 1 locus_tag LOCUS_23910 gene sdhB-1 CDS 3671..3991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23920 sequence341 source 1..4457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 624..872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 872..2143 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204477.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 gene czcC CDS 2140..3744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23950 sequence342 source 1..4429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 231..902 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967039.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 915..1568 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967040.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 1635..2441 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967041.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 2469..3248 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967042.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 3313..4059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703772.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 sequence343 source 1..4416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(348..821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS complement(850..1710) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 1872..2303 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 2335..2763 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 sequence344 source 1..4385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1479 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769277.1:histidine kinase locus_tag LOCUS_24050 CDS 1485..3023 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038211.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene pilR CDS 3025..3618 product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194313.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene ampD sequence345 source 1..4378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(692..767) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(850..1677) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967128.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 1870..2751 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815017.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(2972..3949) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HAI0 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene guaC CDS complement(4163..4354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 sequence346 source 1..4373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..597 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807491.1:amino acid ABC transporter substrate-binding protein locus_tag LOCUS_24120 CDS 706..1605 product glutamate/aspartate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205239.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene gltI CDS 1714..2472 product glutamate/aspartate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194293.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene gltJ CDS 2475..3140 product glutamate/aspartate transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090325.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 3290..4027 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 sequence347 source 1..4366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 988..1281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(1465..3087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 sequence348 source 1..4364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 645..2375 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 2542..4146 product biotin-dependent carboxyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528747.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 sequence349 source 1..4358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 139..1584 product D-arabinitol 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203803.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 1606..2556 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267683.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 sequence350 source 1..4353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2114 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526440.1:two-component sensor histidine kinase locus_tag LOCUS_24230 CDS 2136..2843 product two-component regulatory protein response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001007153.2 transl_table 11 codon_start 1 locus_tag LOCUS_24240 gene kdpE CDS complement(3099..3632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 sequence351 source 1..4334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 228..1229 product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 1347..1895 product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766514.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 1892..2512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 2543..3328 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809590.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(3446..4009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 sequence352 source 1..4326 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2023 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031412.1:NADPH-dependent 2,4-dienoyl-CoA reductase locus_tag LOCUS_24310 CDS 2043..3209 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089530.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 sequence353 source 1..4317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..775 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207561.1:nodulation protein NolG locus_tag LOCUS_24330 CDS 801..1514 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene pcm CDS 1536..1877 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522276.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 1938..3317 product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 sequence354 source 1..4296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1720..2628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 sequence355 source 1..4290 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(596..1561) product Nod factor export ATP-binding protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P412 transl_table 11 codon_start 1 locus_tag LOCUS_24380 gene nodI CDS 1759..3573 product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188840.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene phbC CDS 3563..4000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 sequence356 source 1..4274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1416..2522 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 2745..3653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 sequence357 source 1..4263 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 423..836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 888..1433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064361.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 1528..2028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 note possible pseudo, frameshifted CDS 2030..2701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(2824..3174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189087.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 sequence358 source 1..4260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 716..1831 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PI5 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene hemE sequence359 source 1..4256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 265..600 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 608..865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(1047..2930) product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 3636..3836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 sequence360 source 1..4244 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(515..1990) product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1C6 transl_table 11 codon_start 1 locus_tag LOCUS_24540 gene guaB CDS 2140..2664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(2683..3078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(3071..3595) product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811752.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 3644..4117 product ssrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZP1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene smpB sequence361 source 1..4241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(138..614) product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035394.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(556..930) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039735.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(1215..3086) product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0V5 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene pckG CDS complement(3452..4159) product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0D1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene queC sequence362 source 1..4233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(492..1169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 1363..2316 product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCN7 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene trxB CDS 2502..2735 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HM5 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene rpmB CDS 2747..2917 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WH4 transl_table 11 codon_start 1 locus_tag LOCUS_24660 gene rpmG CDS complement(3157..4233) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 sequence363 source 1..4232 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(560..1105) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 1263..2024 product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GN6 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene engB CDS 2082..2987 product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889174.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(3071..3940) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523078.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 sequence364 source 1..4222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(731..2326) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970676.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(2417..3298) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521226.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 sequence365 source 1..4185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..831 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194383.1:LysR family transcriptional regulator locus_tag LOCUS_24740 CDS 1048..2799 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266859.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 2977..3492 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene dps CDS 3652..4020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 sequence366 source 1..4173 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 944..1369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063756.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 1411..2328 product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811759.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(2562..3485) product phosphoribosylpyrophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085900.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 misc_feature complement(3488..>4173) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89QK7:putative thymidine phosphorylase locus_tag LOCUS_24810 sequence367 source 1..4170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(234..1529) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204801.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 gene gshA CDS complement(1651..3147) product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS69 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene trkH misc_feature complement(3284..>4170) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038750.1:Trk system potassium transport protein TrkA locus_tag LOCUS_24840 sequence368 source 1..4162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1007 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTY6:glutamate--cysteine ligase locus_tag LOCUS_24850 CDS complement(1093..1335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(1332..1586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 1712..2686 product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9S4 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(2771..3997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 sequence369 source 1..4151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 718..1518 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WG23 transl_table 11 codon_start 1 locus_tag LOCUS_24900 gene fabI CDS 1617..2513 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262037.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 misc_feature complement(2585..>4151) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808393.1:lysine decarboxylase locus_tag LOCUS_24920 sequence370 source 1..4147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1274..2605) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene aceA sequence371 source 1..4137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(652..1728) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186310.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(1742..2671) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(2983..4137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065065.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 sequence372 source 1..4134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(145..513) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 gene secG CDS complement(549..1292) product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZT5 transl_table 11 codon_start 1 locus_tag LOCUS_24980 gene tpiA CDS complement(1295..2296) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196428.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 misc_feature complement(2410..>4134) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63VN7:polyribonucleotide nucleotidyltransferase locus_tag LOCUS_25000 sequence373 source 1..4133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1334..2146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 sequence374 source 1..4125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..840 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PC99:release factor glutamine methyltransferase locus_tag LOCUS_25020 CDS 899..1216 product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCR2 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 1416..2423 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537763.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 2541..3848 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210164.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 sequence375 source 1..4108 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 814..1692 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWH2 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene htpX CDS 1896..2066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 2079..2564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 2483..3568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 note possible pseudo, frameshifted CDS complement(3486..4106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 sequence376 source 1..4102 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(906..1745) product binding-protein-dependent maltose/mannitol transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105365.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(1759..2658) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267681.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 misc_feature complement(2784..>4102) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066581.1:sugar ABC transporter substrate-binding protein locus_tag LOCUS_25130 sequence377 source 1..4088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 723..1568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 1698..3320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267608.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 3322..4056 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770800.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 sequence378 source 1..4081 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..683 product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJG5 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene purE CDS 680..1849 product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WU0 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene purK CDS 1852..2868 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIK9 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 3114..4037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 sequence379 source 1..4077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(631..1821) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098395.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(2090..2431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(2502..3245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 3207..3668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 sequence380 source 1..4074 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..1520 product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 1517..2212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522861.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 2372..2872 product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8H5 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene coaD CDS 3186..3425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS 3538..3888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 sequence381 source 1..4071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 20..787 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q46 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene msrP CDS 789..1433 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDX7 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene msrQ CDS 1630..1854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 1851..2303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 2300..3430 product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q87 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene hisC2 CDS 3427..4062 product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q88 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene hisB sequence382 source 1..4062 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 614..1228 product FMN-dependent NADH-azoreductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2E2 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene azoR2 CDS 1475..2518 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086839.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 2526..3764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25380 sequence383 source 1..4053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1170..1457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 1676..2278 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206517.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 2275..2880 product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197821.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(2941..3690) product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFJ3 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene rlmB CDS complement(3832..4053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 sequence384 source 1..4034 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..855 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KR33:cryptochrome DASH locus_tag LOCUS_25440 CDS 852..2357 product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036476.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 2510..3199 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974210.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene csgA misc_feature complement(3297..>4034) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63SV9:methionine aminopeptidase locus_tag LOCUS_25470 sequence385 source 1..4008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(811..1506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS complement(1496..2944) product sensor histidine kinase GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52101 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene glrK misc_feature complement(2970..>4008) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63X63:tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase locus_tag LOCUS_25500 sequence386 source 1..3988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..603 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WH18:30S ribosomal protein S1 locus_tag LOCUS_25510 CDS 729..1049 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M28 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene ihfB CDS 1340..1660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 1650..2807 product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WH97 transl_table 11 codon_start 1 locus_tag LOCUS_25540 gene lapB CDS 2860..3267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 sequence387 source 1..3977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 332..520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS 831..2840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 3093..3425 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6Z6 transl_table 11 codon_start 1 locus_tag LOCUS_25580 sequence388 source 1..3947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(429..602) product DUF2256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039179.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(618..1658) product NAD/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036475.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(1655..2221) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704785.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 2370..2612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 2891..3145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036496.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 misc_feature complement(3174..>3947) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038652.1:hydrolase locus_tag LOCUS_25640 sequence389 source 1..3945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(814..1812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039422.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(1900..3399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 misc_feature complement(3396..>3945) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039419.1:GntR family transcriptional regulator locus_tag LOCUS_25670 sequence390 source 1..3940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1272..1703 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002001056.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS 1858..2820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064416.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 sequence391 source 1..3911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..1599) product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UQ8 transl_table 11 codon_start 1 locus_tag LOCUS_25700 gene rimO CDS complement(1692..2225) product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192676.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene phaR tRNA complement(2424..2500) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 misc_feature complement(2578..>3911) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004521683.1:GTP pyrophosphokinase locus_tag LOCUS_25720 sequence392 source 1..3908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 831..2090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 2311..3594 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478734.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 sequence393 source 1..3901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..919 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809986.1:MFS transporter locus_tag LOCUS_25750 CDS complement(964..1308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(1668..2639) product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene yedA CDS 2710..3198 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977400.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 sequence394 source 1..3882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 130..516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS 1001..1156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(1309..2043) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198318.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(2101..2592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(2684..3544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 sequence395 source 1..3879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 25..1374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 1374..2249 product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JL6 transl_table 11 codon_start 1 locus_tag LOCUS_25850 gene truA CDS 2318..3046 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JL7 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene trpF sequence396 source 1..3875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 297..971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS 1074..1961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 2051..2662 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223369.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 sequence397 source 1..3874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(427..1731) product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 1869..2975 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJB4 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene dadX tRNA 2043..2134 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 3052..3846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 sequence398 source 1..3855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 387..1712 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(1745..2779) product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816062.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 misc_feature complement(2838..>3855) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003816059.1:histidine kinase locus_tag LOCUS_25950 sequence399 source 1..3851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 154..579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(672..845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS complement(930..1157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764045.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(1162..1533) product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313912.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(1537..1995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 2422..3555 product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035678.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 gene rhlE sequence400 source 1..3851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 130..1155 product bifunctional glyoxylate/hydroxypyruvate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113741.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 1152..2219 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113738.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 gene ptxS CDS 2335..3024 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 sequence401 source 1..3841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(922..1875) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931529.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(1924..2391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(2516..3427) product putative 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87WJ7 transl_table 11 codon_start 1 locus_tag LOCUS_26070 sequence402 source 1..3822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..847 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P24474:nitrite reductase locus_tag LOCUS_26080 CDS complement(1006..1635) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QXY9 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene upp CDS complement(1724..2716) product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039172.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS complement(2818..3672) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918242.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 sequence403 source 1..3803 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(760..2865) product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224754.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(2981..3700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 sequence404 source 1..3796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 539..2140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(2163..2726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(2971..3300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 sequence405 source 1..3794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..730 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524568.1:acyl-CoA dehydrogenase locus_tag LOCUS_26180 CDS 785..1993 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525801.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 sequence406 source 1..3770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..1145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(1244..2314) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551047.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(2346..3236) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192193.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 sequence407 source 1..3766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1495 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004553995.1:nitrate/sulfite reductase locus_tag LOCUS_26230 CDS 1508..1888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 1885..2514 product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P607 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene cysH CDS 2530..3483 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1B2 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene cysD sequence408 source 1..3750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(603..1277) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706151.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 1470..2426 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888129.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 2518..3036 product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339642.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 sequence409 source 1..3741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(194..679) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192378.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(686..1723) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929877.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(1949..3037) product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460932.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 sequence410 source 1..3733 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(433..1620) product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PC41 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene nrdB misc_feature complement(1756..>3733) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WKK1:ribonucleoside-diphosphate reductase locus_tag LOCUS_26340 sequence411 source 1..3733 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(804..1883) product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339267.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 2004..2918 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206176.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 gene ttdR CDS 2979..3644 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888219.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 sequence412 source 1..3724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(369..1301) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938926.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene motB CDS complement(1314..2174) product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 gene motA sequence413 source 1..3716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1665..2744) product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229224.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 misc_feature complement(2748..>3716) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q53WA0:cobalamin biosynthesis protein CobD locus_tag LOCUS_26410 sequence414 source 1..3713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 789..1067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 1282..1929 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815944.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 2027..2698 product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 gene gpmB CDS complement(2705..3391) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113716.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 sequence415 source 1..3709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 72..2987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 3084..3530 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 sequence416 source 1..3708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(68..2182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 misc_feature complement(2205..>3708) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P8Y5:putative esterase locus_tag LOCUS_26490 sequence417 source 1..3697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1395 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62CK6:UvrABC system protein B locus_tag LOCUS_26500 CDS 1638..2174 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 gene iscR CDS 2285..3499 product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SN1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 gene iscS sequence418 source 1..3688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 58..1008 product copper ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539779.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene nosF CDS 1012..1827 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192012.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 1824..2402 product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547269.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 2405..3073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 misc_feature complement(3188..>3688) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194757.1:ATP-dependent RNA helicase RhlE locus_tag LOCUS_26570 sequence419 source 1..3674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1300..2169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 note possible pseudo, internal stop codon CDS complement(2185..2370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(2297..3340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 note possible pseudo, internal stop codon sequence420 source 1..3659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(627..1982) product beta alanine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557408.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 2126..3094 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195540.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 3168..3470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 sequence421 source 1..3651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..788 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003820743.1:membrane protein locus_tag LOCUS_26640 CDS 934..2229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 2359..3282 product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 sequence422 source 1..3650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 413..1780 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936075.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 1813..3336 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189785.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 sequence423 source 1..3643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 103..1080 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931174.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 1131..2111 product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807825.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 sequence424 source 1..3625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1620 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887704.1:ACR family transporter locus_tag LOCUS_26710 CDS 1698..2909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 3254..3502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 sequence425 source 1..3606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(603..1679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS complement(2586..3020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(3037..3435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 sequence426 source 1..3600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 118..327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 476..1606 product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(1720..2727) product D-isomer specific 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525849.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 sequence427 source 1..3595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 125..865 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHB5 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene flgF CDS 911..1693 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNG7 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene flgG CDS 1721..2455 product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYG3 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene flgH sequence428 source 1..3575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1101..1448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 1673..2092 product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 2244..3077 product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930693.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 sequence429 source 1..3570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..544 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942826.1:carotenoid 1,2-hydratase locus_tag LOCUS_26870 CDS 873..1148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(1164..2732) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998048.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(2769..3101) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266599.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(3098..3496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 sequence430 source 1..3564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 149..1942 product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 1979..2668 product PKHD-type hydroxylase YbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EHD3 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene ybiX sequence431 source 1..3533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(429..1004) product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HA8 transl_table 11 codon_start 1 locus_tag LOCUS_26940 gene ruvA CDS 1093..2043 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189139.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS 2104..2562 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X65 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene ybeY misc_feature complement(2645..>3533) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931103.1:MFS transporter locus_tag LOCUS_26970 sequence432 source 1..3533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(509..1447) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707521.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(1444..2481) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707520.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 misc_feature complement(2567..>3533) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707519.1:ABC transporter substrate-binding protein locus_tag LOCUS_27000 sequence433 source 1..3532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(2271..>3532) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204555.1:methylmalonate-semialdehyde dehydrogenase (acylating) locus_tag LOCUS_27010 sequence434 source 1..3513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(360..1025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 1184..2281 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204258.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 2297..2491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 misc_feature complement(2546..>3513) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IZA3:alpha,alpha-trehalose-phosphate synthase (UDP-forming) locus_tag LOCUS_27050 sequence435 source 1..3512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(544..1320) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257230.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS complement(1427..2332) product deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 2434..3354 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 sequence436 source 1..3505 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1367 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63JK9:3-isopropylmalate dehydratase large subunit locus_tag LOCUS_27090 CDS 1528..2178 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AI8 transl_table 11 codon_start 1 locus_tag LOCUS_27100 gene leuD CDS 2256..3326 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JL2 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene leuB sequence437 source 1..3498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 491..847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(925..1131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(1437..2291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(2537..2929) product transcription elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205481.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 sequence438 source 1..3495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1796..3319 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815305.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 gene paaH sequence439 source 1..3492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(167..1420) product lipoprotein releasing system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 1419..3398 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550744.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 sequence440 source 1..3481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 302..1573 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSZ3 transl_table 11 codon_start 1 locus_tag LOCUS_27190 gene murA CDS 1748..2395 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GD8 transl_table 11 codon_start 1 locus_tag LOCUS_27200 gene hisG sequence441 source 1..3481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(826..1047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS complement(1213..1818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 1962..2993 product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 sequence442 source 1..3470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..598 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814735.1:methyltransferase type 11 locus_tag LOCUS_27240 CDS 675..1121 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V99 transl_table 11 codon_start 1 locus_tag LOCUS_27250 gene rnhA CDS 1461..2780 product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814733.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 sequence443 source 1..3457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(781..1884) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS complement(2150..2977) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813987.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 3125..3361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 sequence444 source 1..3450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1593..2147) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XK0 transl_table 11 codon_start 1 locus_tag LOCUS_27300 gene apt CDS 2509..3417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 sequence445 source 1..3441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1217..2494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198598.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 misc_feature complement(2590..>3441) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063733.1:methyl-accepting chemotaxis protein I locus_tag LOCUS_27330 sequence446 source 1..3414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 267..1061 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888785.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 1257..2039 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888786.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 2036..2788 product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888285.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 sequence447 source 1..3407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(187..2250) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R07 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene recG sequence448 source 1..3403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..1277 product D-amino acid dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063961.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene dadA note possible pseudo, internal stop codon CDS 1317..1880 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222864.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(1941..3071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 sequence449 source 1..3399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 369..794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931059.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 1003..2016 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809579.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 2079..2231 product DUF3096 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528205.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 misc_feature complement(2319..>3399) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192263.1:murein transglycosylase locus_tag LOCUS_27440 sequence450 source 1..3394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..908) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040563.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS complement(905..1882) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(1892..2812) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815013.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 sequence451 source 1..3378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(492..950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(947..1867) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090796.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(1888..3096) product chromate resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205325.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene chrA sequence452 source 1..3358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(377..811) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(808..1281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106488.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(1299..2342) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390379.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(2339..3223) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807953.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 sequence453 source 1..3337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(598..1035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(1036..1671) product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819722.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 misc_feature complement(1664..>3337) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919640.1:cytochrome ubiquinol oxidase subunit I locus_tag LOCUS_27580 sequence454 source 1..3335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(573..1079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(1076..1576) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XD53 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS 1767..2792 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107131.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 gene gntR sequence455 source 1..3333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 773..1909 product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S72 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene moaA CDS 2005..2634 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0Z6 transl_table 11 codon_start 1 locus_tag LOCUS_27630 gene mobA sequence456 source 1..3330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 94..555 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930750.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 578..2848 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 sequence457 source 1..3308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..1183) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(1275..2216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193435.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(2320..2700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 misc_feature complement(2747..>3308) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552347.1:LPS export ABC transporter permease LptG locus_tag LOCUS_27690 sequence458 source 1..3306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 282..1019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(1128..1469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 1689..1895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 1942..2346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(2363..3259) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529258.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 sequence459 source 1..3306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 976..1728 product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2W2 transl_table 11 codon_start 1 locus_tag LOCUS_27750 gene nodJ misc_feature complement(1744..>3306) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090609.1:oxidoreductase locus_tag LOCUS_27760 sequence460 source 1..3273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(97..1467) product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929616.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 gene kdtA CDS complement(1597..3000) product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808464.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 gene pgm sequence461 source 1..3269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..623 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391104.1:AraC family transcriptional regulator locus_tag LOCUS_27790 CDS 675..1184 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSL6 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene ogt CDS 1438..2277 product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807047.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 sequence462 source 1..3242 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..1071 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038916.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene etfB CDS 1084..2016 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene etfA sequence463 source 1..3240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 609..2213 product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQF4 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene pntA CDS 2249..3172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 sequence464 source 1..3235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1290..1679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 note possible pseudo, internal stop codon CDS 2353..2688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 sequence465 source 1..3234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 112..411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(568..1410) product CDP-abequose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207926.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(1546..3123) product galactarate dehydratase (L-threo-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EM67 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene garD sequence466 source 1..3225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..934 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63V22:UPF0061 protein locus_tag LOCUS_27910 CDS 922..1344 product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQC6 transl_table 11 codon_start 1 locus_tag LOCUS_27920 gene msrB CDS 1374..1913 product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JM5 transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 1938..2198 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008605.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene bolA CDS 2266..3051 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WE19 transl_table 11 codon_start 1 locus_tag LOCUS_27950 sequence467 source 1..3222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1033 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37895:putative GTPase locus_tag LOCUS_27960 CDS 1080..2612 product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 sequence468 source 1..3216 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2149 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205570.1:nitrite reductase large subunit locus_tag LOCUS_27980 CDS 2186..2524 product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene nirD-2 sequence469 source 1..3211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(811..886) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(939..1619) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189647.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 misc_feature complement(1824..>3211) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203783.1:PAS domain-containing sensor histidine kinase locus_tag LOCUS_28010 sequence470 source 1..3208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1003..1740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946218.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 sequence471 source 1..3204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 220..1773 product malonyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064005.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 sequence472 source 1..3202 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 439..2166 product acetyl/propionyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105457.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(2178..3008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 sequence473 source 1..3197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(89..1930) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205272.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 gene recQ CDS complement(2202..2480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(2609..2851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 sequence474 source 1..3196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(728..2335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 misc_feature complement(2456..>3196) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_231159.2:formate dehydrogenase accessory protein locus_tag LOCUS_28100 sequence475 source 1..3192 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1110..2447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 sequence476 source 1..3189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(286..663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 995..2395 product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087945.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(2435..3187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 sequence477 source 1..3175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 781..1896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113218.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(2048..2611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(2682..3053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063921.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 sequence478 source 1..3172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 note possible pseudo, frameshifted CDS complement(823..1587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 note possible pseudo, frameshifted CDS complement(1647..2318) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118095.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 misc_feature complement(2611..>3172) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62HC7:glutamate-ammonia-ligase adenylyltransferase locus_tag LOCUS_28210 sequence479 source 1..3168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 103..474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 578..2518 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 gene mrdA sequence480 source 1..3163 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(388..1170) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096993.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 1326..2294 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203918.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 sequence481 source 1..3161 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1457..2380 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GT5 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene lpxC CDS 2391..2567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 sequence482 source 1..3156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1208 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6P162:acetyltransferase component of pyruvate dehydrogenase complex locus_tag LOCUS_28280 CDS 1225..3075 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZC3 transl_table 11 codon_start 1 locus_tag LOCUS_28290 gene lpdA sequence483 source 1..3154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 149..670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS complement(723..1550) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004541423.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 1718..2398 product 3-oxoadipate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929696.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 gene catI CDS 2428..3078 product 3-oxoadipate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194517.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 sequence484 source 1..3151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(580..1593) product sugar ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706698.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 1730..2788 product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 sequence485 source 1..3142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..623 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931174.1:MFS transporter locus_tag LOCUS_28360 CDS 780..1862 product opine/octopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974667.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 1884..2771 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919495.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 sequence486 source 1..3140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1367..1960) product TniR protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904941.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 2263..2529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 note possible pseudo, internal stop codon CDS 2510..2845 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 sequence487 source 1..3130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 700..1170 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709240.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 1262..1570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS 1601..3061 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UT8 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene rlmD sequence488 source 1..3125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 303..387 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 550..634 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(712..1164) product acetyltransferase YpeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63424 transl_table 11 codon_start 1 locus_tag LOCUS_28450 gene ypeA CDS complement(1165..3123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 sequence489 source 1..3116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(782..1990) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930653.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 2178..2951 product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 gene fpr sequence490 source 1..3112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence491 source 1..3095 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2204..2716) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315770.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 sequence492 source 1..3093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3070 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390159.1:diguanylate cyclase locus_tag LOCUS_28500 sequence493 source 1..3088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(816..1565) product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064586.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene etfB misc_feature complement(1631..>3088) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SKN9:long-chain-fatty-acid--CoA ligase locus_tag LOCUS_28520 sequence494 source 1..3086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence495 source 1..3076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(201..1436) product protein NirF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51480 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene nirF CDS complement(1433..1849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 2015..2890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 sequence496 source 1..3070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..2595) product xanthine dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522221.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene xdhB sequence497 source 1..3065 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1717 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P9X3:putative protein kinase UbiB locus_tag LOCUS_28570 CDS complement(1751..2590) product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567445.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 sequence498 source 1..3064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence499 source 1..3056 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 233..541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 837..1019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(1095..1763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(1838..2872) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920179.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 sequence500 source 1..3039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(189..737) product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene trx CDS 812..1549 product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XY05 transl_table 11 codon_start 1 locus_tag LOCUS_28640 sequence501 source 1..3031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 532..1428 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522925.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(1576..2592) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 sequence502 source 1..3030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(532..1059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(1097..2428) product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene GALNS sequence503 source 1..3026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..847 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KIT0:D-lactate dehydrogenase locus_tag LOCUS_28700 CDS complement(863..1213) product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222125.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(1314..2246) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188126.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 misc_feature complement(2275..>3026) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003810841.1:ABC transporter ATP-binding protein locus_tag LOCUS_28730 sequence504 source 1..3014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1928 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194903.1:DNA translocase FtsK locus_tag LOCUS_28740 CDS 2096..2644 product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57068 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene lolA sequence505 source 1..2995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1864..2487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 sequence506 source 1..2994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1273..1911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 2029..2382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 2379..2930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 sequence507 source 1..2991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1667 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WJT4:NADH-quinone oxidoreductase locus_tag LOCUS_28800 CDS 1664..2740 product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MLE6 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene nuoH sequence508 source 1..2972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 549..1538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 1535..1930 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143803.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(2015..2638) product Asp/Glu/hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406312.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 sequence509 source 1..2968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(716..1036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(1119..2012) product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GR9 transl_table 11 codon_start 1 locus_tag LOCUS_28860 gene rsmH CDS complement(2050..2346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28870 sequence510 source 1..2965 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 483..1397 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088986.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 1423..2262 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088987.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 sequence511 source 1..2945 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..945 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071311.1:diguanylate cyclase locus_tag LOCUS_28900 CDS 1084..1551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550743.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 1659..2054 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 sequence512 source 1..2916 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 384..695 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0DMK4 transl_table 11 codon_start 1 locus_tag LOCUS_28930 gene hupA CDS complement(770..2053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(2093..2608) product Mg(2+) transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064951.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 sequence513 source 1..2914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1258 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123361.1:DNA methyltransferase locus_tag LOCUS_28960 CDS 1255..2424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 2459..2749 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389943.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 sequence514 source 1..2907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(158..1912) product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931133.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(2096..2581) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 sequence515 source 1..2891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1081..1866) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 misc_feature complement(1886..>2891) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807270.1:long-chain-fatty-acid--CoA ligase locus_tag LOCUS_29020 sequence516 source 1..2877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1143..1216) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(1283..2782) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063671.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene gabG sequence517 source 1..2867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(736..1533) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808069.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(1533..2696) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 sequence518 source 1..2864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1065..1481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 misc_feature complement(1870..>2864) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224755.1:acyl-CoA dehydrogenase locus_tag LOCUS_29070 sequence519 source 1..2855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1095 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63P87:UvrABC system protein A locus_tag LOCUS_29080 CDS 1204..1770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS 2068..2409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 sequence520 source 1..2852 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1312..1971 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(2135..2536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29120 sequence521 source 1..2849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 711..1748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 1773..2669 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 sequence522 source 1..2846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 503..898 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44638 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene gloA CDS complement(1027..1632) product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814256.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 1779..1967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 misc_feature complement(2109..>2846) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UEA1:glutaminase locus_tag LOCUS_29180 sequence523 source 1..2839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 568..1026 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 1068..1439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS 1822..2163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 sequence524 source 1..2839 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 716..2023 product membrane attached sodium:dicarboxylate symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526889.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 sequence525 source 1..2832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(77..625) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QX7 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene ruvC CDS complement(685..1677) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035755.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene cdsA CDS complement(1825..2598) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105553.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 sequence526 source 1..2825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(68..541) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962904.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 692..1390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 1387..1824 product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0M0 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 1897..2559 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038722.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 sequence527 source 1..2824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 472..1680 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WDK9 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene tyrB-2 CDS complement(1789..2190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 sequence528 source 1..2820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(265..531) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036968.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 tmRNA complement(838..1224) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(1237..1902) product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190123.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene gph-1 CDS complement(1913..2623) product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8S3 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene ubiG sequence529 source 1..2814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(259..1170) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105293.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(1207..2574) product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104433.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 sequence530 source 1..2810 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(556..1311) product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA44 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 1475..2620 product DegQ protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 sequence531 source 1..2799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..985 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057549.1:iron(III) ABC transporter permease locus_tag LOCUS_29400 CDS complement(1146..2786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040345.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 sequence532 source 1..2796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(330..989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 misc_feature complement(1032..>2796) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004191126.1:oligopeptidase A locus_tag LOCUS_29430 sequence533 source 1..2791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(178..840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(995..1369) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881844.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 CDS 1417..2742 product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528975.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene folC sequence534 source 1..2788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(311..1609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 sequence535 source 1..2775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(533..1720) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene corA CDS complement(1731..2738) product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTA2 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene hemB sequence536 source 1..2760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2184 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103884.1:GGDEF domain-containing protein locus_tag LOCUS_29500 CDS complement(2295..2759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 sequence537 source 1..2755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 634..1212 product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8Y6 transl_table 11 codon_start 1 locus_tag LOCUS_29520 gene ppa sequence538 source 1..2754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1123 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189232.1:adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA locus_tag LOCUS_29530 CDS 1120..1797 product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Y24 transl_table 11 codon_start 1 locus_tag LOCUS_29540 gene bioD sequence539 source 1..2733 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 921..2621 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33231 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene lldP sequence540 source 1..2732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1334..>2732) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62FE9:phosphomethylpyrimidine synthase locus_tag LOCUS_29560 sequence541 source 1..2716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 1800..2180 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309349.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 gene ureA sequence542 source 1..2699 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 264..623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 misc_feature complement(760..>2699) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963528.1:radical SAM protein locus_tag LOCUS_29600 sequence543 source 1..2688 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 459..638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 689..1105 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812700.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 1154..2572 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191226.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 sequence544 source 1..2686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 221..1675 product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707523.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 sequence545 source 1..2686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 109..708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812677.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS 701..1420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930372.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 sequence546 source 1..2669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1398..2039) product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P535 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene ubiX CDS complement(2032..2502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 sequence547 source 1..2664 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1393..2130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(2471..2662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 sequence548 source 1..2651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..851 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072003.1:methylcrotonoyl-CoA carboxylase locus_tag LOCUS_29710 sequence549 source 1..2632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(809..1948) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PE75 transl_table 11 codon_start 1 locus_tag LOCUS_29720 gene lldD misc_feature complement(1945..>2632) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000636695.1:transcriptional regulator LldR locus_tag LOCUS_29730 sequence550 source 1..2630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1449 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119956.1:cation transporter locus_tag LOCUS_29740 CDS 1550..1945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 sequence551 source 1..2629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(522..1541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 note possible pseudo, internal stop codon CDS complement(1614..2102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 note possible pseudo, internal stop codon sequence552 source 1..2628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(889..>2628) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004536383.1:enoyl-CoA hydratase locus_tag LOCUS_29780 sequence553 source 1..2615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1707 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860792.1:helicase locus_tag LOCUS_29790 CDS complement(1956..2351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 sequence554 source 1..2614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 613..1425 product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206567.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 1508..2443 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 sequence555 source 1..2612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..914) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200845.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(1017..2003) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809384.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 sequence556 source 1..2607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(352..861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 970..2259 product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706579.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 sequence557 source 1..2604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(888..1463) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083828.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene ahpC CDS 1717..2193 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0G1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene bfr sequence558 source 1..2599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 689..2104 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063882.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 2181..2396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 sequence559 source 1..2592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 215..2542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 sequence560 source 1..2589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence561 source 1..2589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2416 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6NZL9:pyruvate dehydrogenase E1 component locus_tag LOCUS_29920 sequence562 source 1..2587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 496..1416 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931026.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 1507..2460 product transposase InsH for insertion sequence element IS5I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CE54 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene insH7 sequence563 source 1..2579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1063 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VWE8:phosphoribosylamine--glycine ligase locus_tag LOCUS_29950 CDS 1063..2010 product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VT1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene hemF sequence564 source 1..2576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..936 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030480.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 951..1793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(1900..2346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 sequence565 source 1..2571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(551..1540) product ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205265.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(1540..1836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(1872..2510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 sequence566 source 1..2570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 515..1087 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462440.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 1096..2244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205256.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 sequence567 source 1..2570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 misc_feature complement(1605..>2570) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204227.1:methyl-accepting chemotaxis protein locus_tag LOCUS_30060 sequence568 source 1..2569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 216..965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582232.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 962..1213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 1210..2037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 2037..2243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 2243..2542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 sequence569 source 1..2565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1034..1753) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 misc_feature complement(1956..>2565) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004538577.1:enoyl-CoA hydratase locus_tag LOCUS_30130 sequence570 source 1..2562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 144..1928 product iron uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 1933..2265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 sequence571 source 1..2561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(168..434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038488.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(695..1084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 misc_feature complement(1509..>2561) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6PAC0:citrate synthase locus_tag LOCUS_30180 sequence572 source 1..2560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(556..1854) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812401.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(1851..2387) product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816847.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 sequence573 source 1..2560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence574 source 1..2560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 15..278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(298..657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(830..1738) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101343.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 1872..2261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097827.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 repeat_region 2297..2530 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccggccagtgcgcatatcccagtgatctagact sequence575 source 1..2560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 769..2037 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390598.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 sequence576 source 1..2541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 165..788 product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042061.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 gene parA CDS complement(808..1023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS complement(1020..1295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(1292..1444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(1627..2289) product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556051.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 sequence577 source 1..2534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(503..2086) product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113025.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 sequence578 source 1..2532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 606..1838 product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036696.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 1886..2143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 sequence579 source 1..2524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(444..695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(966..2147) product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P945 transl_table 11 codon_start 1 locus_tag LOCUS_30350 gene metK sequence580 source 1..2523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(484..936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 2269..2403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 sequence581 source 1..2516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence582 source 1..2498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(93..1160) product muconate cycloisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113308.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene catB CDS 1399..2265 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256690.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 sequence583 source 1..2498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(369..1034) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040802.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(1150..2154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064098.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 sequence584 source 1..2497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 120..368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 708..1127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 1154..1363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(1719..2246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 sequence585 source 1..2478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 851..1426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 sequence586 source 1..2477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1566 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229661.1:acetyl-CoA carboxylase subunit beta locus_tag LOCUS_30470 CDS 1592..2389 product methylglutaconyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337545.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 sequence587 source 1..2477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(442..1602) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 misc_feature complement(1665..>2477) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114736.1:geranyl-CoA carboxylase subunit alpha locus_tag LOCUS_30500 sequence588 source 1..2462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1342..2313) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809384.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 sequence589 source 1..2460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 512..1429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 1466..2086 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJU6 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene gmk CDS 2103..2306 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I01 transl_table 11 codon_start 1 locus_tag LOCUS_30540 gene rpoZ sequence590 source 1..2449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(776..1861) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537788.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 sequence591 source 1..2444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(617..1639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(1689..2444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 sequence592 source 1..2443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence593 source 1..2436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 90..989 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 misc_feature complement(1001..>2436) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113468.1:phosphoethanolamine--lipid A transferase EptA locus_tag LOCUS_30590 sequence594 source 1..2432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 383..1351 product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63IV9 transl_table 11 codon_start 1 locus_tag LOCUS_30600 sequence595 source 1..2419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..821 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931022.1:membrane protein locus_tag LOCUS_30610 misc_feature complement(1364..>2419) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337354.1:carbohydrate kinase locus_tag LOCUS_30620 sequence596 source 1..2411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(165..791) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037307.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 gene pssA CDS complement(999..2306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 sequence597 source 1..2409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 108..659 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815434.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene hurI CDS 845..1804 product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113764.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 sequence598 source 1..2396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 584..2263 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084137.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 gene fadD sequence599 source 1..2395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(145..220) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(285..929) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526226.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene bpeR CDS 1387..2358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30690 sequence600 source 1..2395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence601 source 1..2392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1646 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387813.1:acetyl/propionyl-CoA carboxylase subunit alpha locus_tag LOCUS_30700 CDS 1758..2228 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 sequence602 source 1..2386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(324..854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 1059..2141 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU24 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene rmlB sequence603 source 1..2386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..868 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P3Y0:bifunctional ligase/repressor BirA locus_tag LOCUS_30740 CDS 894..1610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 1783..2253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192851.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 sequence604 source 1..2385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1319..1519 product copZ protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770077.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 1516..2004 product heavy metal-dependent transcription regulator 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58379 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene hmrR2 sequence605 source 1..2385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(20..1045) product conjugal transfer protein TraU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947798.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene traU CDS complement(1042..1677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(1674..2057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30810 sequence606 source 1..2371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..582 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097695.1:Tat pathway signal protein locus_tag LOCUS_30820 CDS complement(668..1531) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WS1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene fghA misc_feature complement(1647..>2371) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y7L9:S-(hydroxymethyl)glutathione dehydrogenase locus_tag LOCUS_30840 sequence607 source 1..2366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 371..1012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30850 note possible pseudo, frameshifted CDS 937..2076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 note possible pseudo, frameshifted sequence608 source 1..2358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039217.1:benzoate transporter locus_tag LOCUS_30870 CDS 1160..2107 product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WI63 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene gshB sequence609 source 1..2358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(699..1934) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKG1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene ftsZ sequence610 source 1..2346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083526.1:copper-translocating P-type ATPase note possible pseudo, frameshifted locus_tag LOCUS_30900 CDS 1447..1932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 note possible pseudo, frameshifted sequence611 source 1..2345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(34..>2345) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003118645.1:helicase locus_tag LOCUS_30920 sequence612 source 1..2336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..792 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086607.1:ABC transporter permease locus_tag LOCUS_30930 CDS 796..1779 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707177.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 sequence613 source 1..2330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1311..>2330) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887703.1:hemolysin secretion protein D locus_tag LOCUS_30950 sequence614 source 1..2317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(237..1544) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJJ6 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene gdhA sequence615 source 1..2309 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(165..1313) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(1501..2211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 sequence616 source 1..2308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1537 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941205.1:bifunctional diguanylate cyclase/phosphodiesterase locus_tag LOCUS_30990 sequence617 source 1..2308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(464..970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 sequence618 source 1..2306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3V808:4-hydroxythreonine-4-phosphate dehydrogenase locus_tag LOCUS_31010 CDS complement(638..1069) product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JH4 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene mscL CDS 1356..1865 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7E7 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene petA sequence619 source 1..2306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 34..774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 782..1384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 sequence620 source 1..2303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(448..900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 1005..1127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 1134..1319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(1609..1944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004243.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 sequence621 source 1..2302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1686 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112507.1:flagellar hook-associated protein FlgK locus_tag LOCUS_31100 sequence622 source 1..2301 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence623 source 1..2298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1063 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0C6PBF9:cytochrome b locus_tag LOCUS_31110 CDS 1082..1840 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521940.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene petC sequence624 source 1..2296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 269..985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS complement(1145..1633) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524657.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 sequence625 source 1..2293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 158..511 product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89I69 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 677..832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(887..1924) product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2N1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene bioB sequence626 source 1..2293 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(711..1826) product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089141.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 sequence627 source 1..2285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(719..2041) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401015.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene fadE2 sequence628 source 1..2277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(295..1395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 misc_feature complement(1643..>2277) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003691638.1:U32 family peptidase locus_tag LOCUS_31210 sequence629 source 1..2261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence630 source 1..2259 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence631 source 1..2255 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 311..1066 product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038916.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene etfB CDS 1067..1999 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene etfA sequence632 source 1..2254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31240 sequence633 source 1..2251 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 683..1606 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 sequence634 source 1..2235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence635 source 1..2228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 320..2038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932512.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 sequence636 source 1..2228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(235..1464) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247215.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 sequence637 source 1..2224 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 35..1381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337768.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 1405..2109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31290 sequence638 source 1..2217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(431..1360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 sequence639 source 1..2211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(965..1435) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 sequence640 source 1..2210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(773..1120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(1117..1479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 sequence641 source 1..2210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 418..1185 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114816.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 1274..2146 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383375.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 sequence642 source 1..2206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..734) product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(784..1047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(1044..1571) product cys-tRNA(pro)/cys-tRNA(cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 misc_feature complement(1604..>2206) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038737.1:hydroxymethylglutaryl-CoA lyase locus_tag LOCUS_31400 sequence643 source 1..2201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..742 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193636.1:sodium:proton antiporter locus_tag LOCUS_31410 CDS 757..1746 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_102310.2 transl_table 11 codon_start 1 locus_tag LOCUS_31420 sequence644 source 1..2191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(906..>2191) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073938.1:type I restriction-modification system deoxyribonuclease locus_tag LOCUS_31430 sequence645 source 1..2186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1419..>2186) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004342954.1:serine/threonine protein kinase locus_tag LOCUS_31440 sequence646 source 1..2170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1122 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VZ37:lysine--tRNA ligase locus_tag LOCUS_31450 CDS 1142..1777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114038.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 sequence647 source 1..2158 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..653 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072952.1:MBL fold metallo-hydrolase locus_tag LOCUS_31470 CDS 927..2021 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267755.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 sequence648 source 1..2145 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1059 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887498.1:membrane protein locus_tag LOCUS_31490 CDS complement(1071..1658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 sequence649 source 1..2145 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1050..>2145) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336808.1:double-strand break repair helicase AddA locus_tag LOCUS_31510 sequence650 source 1..2140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..799 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5F5C8:bifunctional enzyme BirA/CoaX locus_tag LOCUS_31520 CDS complement(850..1629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706124.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 sequence651 source 1..2131 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1917 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021173.1:histidine kinase locus_tag LOCUS_31540 sequence652 source 1..2129 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 416..625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(682..1527) product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV19 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene psd sequence653 source 1..2123 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(221..466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(476..910) product peptidase S24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389771.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 misc_feature complement(1319..>2123) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941225.1:DDE transposase locus_tag LOCUS_31590 sequence654 source 1..2122 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1019..1762) product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62F43 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene gpmA sequence655 source 1..2120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(282..551) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937389.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 misc_feature complement(725..>2120) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064320.1:D-alanyl-D-alanine carboxypeptidase locus_tag LOCUS_31620 sequence656 source 1..2112 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(505..753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(947..1267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198082.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 misc_feature complement(1423..>2112) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62H74:catalase-peroxidase locus_tag LOCUS_31650 sequence657 source 1..2105 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..1498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 sequence658 source 1..2096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 199..1200 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709321.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 1409..2011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194356.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 sequence659 source 1..2094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 414..824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 sequence660 source 1..2092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 211..1668 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 sequence661 source 1..2083 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 221..436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388652.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 436..756 product mRNA interferase PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888293.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 971..1564 product invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 1561..1944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 sequence662 source 1..2064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(578..>2064) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000405145.1:sterol desaturase locus_tag LOCUS_31750 sequence663 source 1..2052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 111..734 product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104154.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 787..1911 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036379.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 sequence664 source 1..2047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 415..1311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(1343..1822) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195428.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 sequence665 source 1..2044 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..785 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JQS2:potassium-transporting ATPase ATP-binding subunit locus_tag LOCUS_31800 CDS 839..1456 product potassium-transporting ATPase KdpC subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9V4 transl_table 11 codon_start 1 locus_tag LOCUS_31810 gene kdpC sequence666 source 1..2043 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence667 source 1..2035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(307..1326) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887001.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 misc_feature complement(1383..>2035) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066704.1:dehydroascorbate transporter locus_tag LOCUS_31830 sequence668 source 1..2035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 54..458 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRU1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene dgkA CDS 451..1044 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBZ3 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(1118..1456) product nitrogen regulatory protein P-II 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193987.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 misc_feature complement(1529..>2035) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204936.1:NAD+ synthase locus_tag LOCUS_31870 sequence669 source 1..2035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 199..528 product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DI8 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 556..1893 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MHA5 transl_table 11 codon_start 1 locus_tag LOCUS_31890 gene argG sequence670 source 1..2032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1097 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919356.1:adenylyl-sulfate kinase locus_tag LOCUS_31900 CDS 1215..1544 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931551.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 sequence671 source 1..2031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 327..797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 845..1000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 1327..1785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 sequence672 source 1..2029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1615 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001370571.1:methyl-accepting chemotaxis protein locus_tag LOCUS_31950 CDS complement(1661..2029) product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 sequence673 source 1..2021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1830 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63US0:putative potassium transport system protein kup locus_tag LOCUS_31970 sequence674 source 1..2018 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(381..995) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 misc_feature complement(1042..>2018) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405415.1:thiol:disulfide interchange protein DsbD locus_tag LOCUS_31990 sequence675 source 1..2013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(455..1024) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S31 transl_table 11 codon_start 1 locus_tag LOCUS_32000 gene rimM CDS complement(1098..1349) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S30 transl_table 11 codon_start 1 locus_tag LOCUS_32010 gene rpsP CDS 1485..2006 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971215.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 sequence676 source 1..2013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(73..1890) product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388392.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 sequence677 source 1..2007 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence678 source 1..2006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1721 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196461.1:ATP-dependent Clp protease ATP-binding subunit ClpA locus_tag LOCUS_32040 sequence679 source 1..2001 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence680 source 1..1995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1085 product DUF1016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022383.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 1082..1873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 sequence681 source 1..1988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence682 source 1..1985 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1216..>1985) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809945.1:metalloprotease locus_tag LOCUS_32070 sequence683 source 1..1983 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 88..252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS complement(422..754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(893..1063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 note possible pseudo, frameshifted misc_feature complement(1215..>1983) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087698.1:cation efflux system protein locus_tag LOCUS_32110 sequence684 source 1..1977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence685 source 1..1952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 226..1236 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195141.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(1550..1777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32130 sequence686 source 1..1947 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(674..1111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(1234..1704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 sequence687 source 1..1938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 263..991 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9W8 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene ung CDS complement(1029..1430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32170 note possible pseudo, frameshifted sequence688 source 1..1928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(195..1163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040004.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 misc_feature complement(1261..>1928) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203893.1:CoA transferase locus_tag LOCUS_32190 sequence689 source 1..1927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 69..980 product chromosome replication initiation inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523490.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 1103..1726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 sequence690 source 1..1914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(65..1033) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 misc_feature complement(1030..>1914) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705945.1:isovaleryl-CoA dehydrogenase locus_tag LOCUS_32230 sequence691 source 1..1907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(387..1517) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4W6 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene asd sequence692 source 1..1905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(212..>1905) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205270.1:cytochrome c biogenesis protein locus_tag LOCUS_32250 sequence693 source 1..1896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 277..1653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 sequence694 source 1..1895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence695 source 1..1894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(125..559) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522571.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS complement(566..1825) product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW48 transl_table 11 codon_start 1 locus_tag LOCUS_32280 gene pepA sequence696 source 1..1891 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(389..1207) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084052.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(1210..1764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 sequence697 source 1..1888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS 766..1719 product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920230.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 sequence698 source 1..1878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..971 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268007.1:DNA recombination protein RecT locus_tag LOCUS_32330 sequence699 source 1..1877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(259..471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205393.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(644..808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(1047..1457) product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188495.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 sequence700 source 1..1872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 662..1672 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085945.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 sequence701 source 1..1867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence702 source 1..1864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 364..1638 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522404.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 sequence703 source 1..1860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 90..1400 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HV8 transl_table 11 codon_start 1 locus_tag LOCUS_32390 gene hemL CDS 1543..1725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 sequence704 source 1..1853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 631..1425 product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931049.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 gene glpR sequence705 source 1..1851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(93..1115) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941999.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 gene cysP CDS 1283..1555 product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IU9 transl_table 11 codon_start 1 locus_tag LOCUS_32430 sequence706 source 1..1846 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence707 source 1..1842 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(456..1256) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 misc_feature complement(1253..>1842) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005768840.1:amine oxidase locus_tag LOCUS_32450 sequence708 source 1..1834 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(33..449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(795..1133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 sequence709 source 1..1831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(928..1557) product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 gene ribE sequence710 source 1..1831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 640..1188 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QR3 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 1185..1748 product competence damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194139.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 sequence711 source 1..1811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence712 source 1..1809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(701..1189) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFT3 transl_table 11 codon_start 1 locus_tag LOCUS_32510 gene bsaA CDS complement(1263..1751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 sequence713 source 1..1808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1227 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114738.1:acetyl-CoA carboxylase carboxyltransferase subunit locus_tag LOCUS_32530 sequence714 source 1..1805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 606..1559 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090122.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 sequence715 source 1..1801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 486..1424 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 sequence716 source 1..1797 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 379..1071 product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125729.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene folE CDS 1074..1496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 sequence717 source 1..1796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 52..792 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086755.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 867..1637 product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383134.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 sequence718 source 1..1795 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(546..>1795) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63QF1:glutamyl-tRNA reductase locus_tag LOCUS_32600 sequence719 source 1..1793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence720 source 1..1792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 514..1299 product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073567.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 sequence721 source 1..1790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(335..1243) product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SZ9 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene prmB misc_feature complement(1240..>1790) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62JB1:succinyl-diaminopimelate desuccinylase locus_tag LOCUS_32630 sequence722 source 1..1790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(599..1531) product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064585.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene etfA sequence723 source 1..1786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 218..1219 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z0 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene gapA sequence724 source 1..1785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(374..1516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931024.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 sequence725 source 1..1783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(126..857) product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MP4 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene ubiE CDS complement(1035..1448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(1507..1782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 sequence726 source 1..1777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence727 source 1..1776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1220..1295) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(1310..1582) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene hupB sequence728 source 1..1761 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 371..784 product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706600.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene rnk sequence729 source 1..1758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence730 source 1..1756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(430..1065) product peptidase S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812191.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 sequence731 source 1..1746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(461..1555) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 sequence732 source 1..1736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(291..1334) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971054.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 sequence733 source 1..1730 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..503 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813028.1:LysR family transcriptional regulator locus_tag LOCUS_32750 sequence734 source 1..1729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 188..994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 sequence735 source 1..1727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 550..1185 product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFM0 transl_table 11 codon_start 1 locus_tag LOCUS_32770 sequence736 source 1..1723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(900..1187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 note possible pseudo, frameshifted sequence737 source 1..1711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 82..321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(371..1615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967476.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 sequence738 source 1..1696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 63..449 product copper-resistance exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530770.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 sequence739 source 1..1695 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 192..1322 product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207123.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 gene acads sequence740 source 1..1692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 357..1238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 sequence741 source 1..1691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence742 source 1..1680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(30..770) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807684.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 misc_feature complement(767..>1680) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039581.1:thiolase locus_tag LOCUS_32860 sequence743 source 1..1671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(545..1537) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706691.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 sequence744 source 1..1667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(800..>1667) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266544.1:copper-translocating P-type ATPase locus_tag LOCUS_32880 sequence745 source 1..1661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence746 source 1..1658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(120..1280) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088189.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 sequence747 source 1..1658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 sequence748 source 1..1654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(137..598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(609..1391) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 sequence749 source 1..1649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(371..1144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 tRNA complement(1335..1411) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 sequence750 source 1..1645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence751 source 1..1641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(73..1596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 sequence752 source 1..1635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(354..833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(886..1527) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 sequence753 source 1..1630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(450..743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(750..1154) product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817440.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(1163..1345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33000 sequence754 source 1..1628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(172..507) product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195219.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 sequence755 source 1..1627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 305..1225 product flagellar rod assembly protein/muramidase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197262.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene flgJ sequence756 source 1..1620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 927..1304 product cyclic diguanosine monophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNG8 transl_table 11 codon_start 1 locus_tag LOCUS_33030 sequence757 source 1..1614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(64..750) product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXP7 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene cbiC misc_feature complement(747..>1614) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057238.1:sirohydrochlorin cobaltochelatase locus_tag LOCUS_33050 sequence758 source 1..1612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 320..733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33060 sequence759 source 1..1611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence760 source 1..1607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence761 source 1..1595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 535..1479 product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198019.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 sequence762 source 1..1591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 767..1021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 sequence763 source 1..1589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence764 source 1..1574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence765 source 1..1570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence766 source 1..1569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 sequence767 source 1..1569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence768 source 1..1568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(657..1109) product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene accB sequence769 source 1..1563 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(101..577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 sequence770 source 1..1558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence771 source 1..1555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33120 sequence772 source 1..1553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..791 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038904.1:LysR family transcriptional regulator locus_tag LOCUS_33130 sequence773 source 1..1551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(208..1020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33140 sequence774 source 1..1549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(574..>1549) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095867.1:cysteine synthase locus_tag LOCUS_33150 sequence775 source 1..1548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(313..858) product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189275.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 sequence776 source 1..1548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 374..1246 product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAP5 transl_table 11 codon_start 1 locus_tag LOCUS_33170 gene accD sequence777 source 1..1539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(584..790) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS 973..1176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 sequence778 source 1..1530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(417..632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 note possible pseudo, frameshifted CDS complement(886..1443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33220 note possible pseudo, frameshifted sequence779 source 1..1530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..657 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036313.1:Bcr/CflA family drug resistance efflux transporter locus_tag LOCUS_33230 CDS complement(700..1488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 sequence780 source 1..1529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(592..1521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 sequence781 source 1..1528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..813 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205142.1:phage-related DNA polymerase locus_tag LOCUS_33260 sequence782 source 1..1527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 174..1493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 note possible pseudo, frameshifted sequence783 source 1..1513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence784 source 1..1508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 309..1034 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204014.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 sequence785 source 1..1508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..534 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061410.1:aldehyde dehydrogenase locus_tag LOCUS_33290 sequence786 source 1..1491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 454..1155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33300 sequence787 source 1..1485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(292..>1485) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113216.1:bifunctional diguanylate cyclase/phosphodiesterase locus_tag LOCUS_33310 sequence788 source 1..1474 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(310..480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 667..1428 product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063645.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 sequence789 source 1..1471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence790 source 1..1462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..633 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P31961:phosphogluconate dehydratase locus_tag LOCUS_33340 CDS 624..1280 product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 sequence791 source 1..1459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 302..1186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 sequence792 source 1..1451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(642..1238) product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086623.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 sequence793 source 1..1441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence794 source 1..1438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence795 source 1..1424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..719 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PT4 transl_table 11 codon_start 1 locus_tag LOCUS_33380 gene metF CDS 842..1291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 sequence796 source 1..1419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(273..1322) product putative family 20 transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HI37 transl_table 11 codon_start 1 locus_tag LOCUS_33400 sequence797 source 1..1415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 158..715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(780..1172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 sequence798 source 1..1413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(270..467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(581..1276) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972591.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 sequence799 source 1..1410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(317..1273) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204912.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 sequence800 source 1..1409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(650..>1409) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62LG5:prolipoprotein diacylglyceryl transferase locus_tag LOCUS_33460 sequence801 source 1..1408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(493..1161) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088972.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 sequence802 source 1..1400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence803 source 1..1399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence804 source 1..1380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..693 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640238.1:cyclopropane-fatty-acyl-phospholipid synthase locus_tag LOCUS_33480 CDS 751..1272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 sequence805 source 1..1375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1355 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I4P9:flagellar hook protein FlgE locus_tag LOCUS_33500 sequence806 source 1..1367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 78..578 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521293.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(883..1308) product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196360.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 sequence807 source 1..1359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(147..1196) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QW0 transl_table 11 codon_start 1 locus_tag LOCUS_33530 gene pyrC sequence808 source 1..1359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(678..998) product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KF42 transl_table 11 codon_start 1 locus_tag LOCUS_33540 gene catC CDS complement(998..1174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 sequence809 source 1..1356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(235..1152) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707518.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 sequence810 source 1..1354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence811 source 1..1350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence812 source 1..1350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1177 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071101.1:alkaline phosphatase locus_tag LOCUS_33570 sequence813 source 1..1345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence814 source 1..1334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(526..846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 sequence815 source 1..1331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..985 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887549.1:hybrid sensor histidine kinase/response regulator locus_tag LOCUS_33590 sequence816 source 1..1325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence817 source 1..1322 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence818 source 1..1321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(151..1239) product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941225.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 sequence819 source 1..1320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..587 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VYN6:pyrroline-5-carboxylate reductase locus_tag LOCUS_33610 misc_feature complement(633..>1320) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q62H69:4-hydroxybenzoate octaprenyltransferase locus_tag LOCUS_33620 sequence820 source 1..1310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence821 source 1..1306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(11..397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(403..798) product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE7 transl_table 11 codon_start 1 locus_tag LOCUS_33640 gene hisE CDS complement(803..1192) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q93 transl_table 11 codon_start 1 locus_tag LOCUS_33650 gene hisI sequence822 source 1..1305 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1042 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921338.1:sodium-dependent bicarbonate transport family permease locus_tag LOCUS_33660 sequence823 source 1..1299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(490..>1299) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7VYA3:3-hydroxyisobutyrate dehydrogenase locus_tag LOCUS_33670 sequence824 source 1..1298 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(359..1216) product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528568.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 sequence825 source 1..1283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 290..493 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KI4 transl_table 11 codon_start 1 locus_tag LOCUS_33690 gene rpmI CDS 519..878 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8X6 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene rplT sequence826 source 1..1281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(357..>1281) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P15493:lipase locus_tag LOCUS_33710 sequence827 source 1..1272 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 78..854 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PD09 transl_table 11 codon_start 1 locus_tag LOCUS_33720 gene gloB sequence828 source 1..1269 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(217..1011) product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBF7 transl_table 11 codon_start 1 locus_tag LOCUS_33730 gene tatC sequence829 source 1..1260 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 136..1125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 sequence830 source 1..1258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence831 source 1..1257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(159..>1257) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705454.1:diguanylate phosphodiesterase locus_tag LOCUS_33750 sequence832 source 1..1244 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(508..>1244) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815363.1:glycerophosphoryl diester phosphodiesterase locus_tag LOCUS_33760 sequence833 source 1..1243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..735 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087556.1:MBL fold metallo-hydrolase locus_tag LOCUS_33770 CDS 905..1075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 sequence834 source 1..1241 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence835 source 1..1230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 677..1042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(1069..1230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 sequence836 source 1..1228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 325..708 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S33 transl_table 11 codon_start 1 locus_tag LOCUS_33810 gene rplS sequence837 source 1..1222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence838 source 1..1218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence839 source 1..1210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence840 source 1..1205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(175..597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33820 sequence841 source 1..1205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence842 source 1..1195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(344..1090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 sequence843 source 1..1191 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence844 source 1..1188 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence845 source 1..1183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(217..1182) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709159.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 sequence846 source 1..1180 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(284..>1180) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004537788.1:porin locus_tag LOCUS_33850 sequence847 source 1..1178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(570..>1178) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q886E0:tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC locus_tag LOCUS_33860 sequence848 source 1..1178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 133..1089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 sequence849 source 1..1171 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(190..597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926942.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 sequence850 source 1..1156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(361..954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 sequence851 source 1..1151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence852 source 1..1144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence853 source 1..1131 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 267..926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 sequence854 source 1..1130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(509..>1130) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027852.1:glycerophosphoryl diester phosphodiesterase locus_tag LOCUS_33910 sequence855 source 1..1123 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(469..>1123) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228090.1:glycosyl transferase locus_tag LOCUS_33920 sequence856 source 1..1123 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence857 source 1..1116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence858 source 1..1114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence859 source 1..1110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 219..1100 product DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390782.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 sequence860 source 1..1109 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..524 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004666649.1:integrase locus_tag LOCUS_33940 sequence861 source 1..1099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence862 source 1..1084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(280..798) product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ3 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene sodC2 sequence863 source 1..1078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 452..1018 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192722.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 gene pgsA sequence864 source 1..1070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence865 source 1..1067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..603 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63R58:tRNA dimethylallyltransferase locus_tag LOCUS_33970 sequence866 source 1..1052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence867 source 1..1051 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 383..763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 sequence868 source 1..1042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence869 source 1..1036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 51..650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 660..818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 sequence870 source 1..1035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..642 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040276.1:threonine ammonia-lyase locus_tag LOCUS_34010 sequence871 source 1..1030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence872 source 1..1030 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 135..422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS 419..694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 sequence873 source 1..1029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 166..948 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 sequence874 source 1..1023 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence875 source 1..1020 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence876 source 1..1014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(93..542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 sequence877 source 1..1012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..722 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004522602.1:NOL1/NOP2/Sun family protein locus_tag LOCUS_34060 sequence878 source 1..1012 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence879 source 1..1004 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..602 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KK01:UPF0313 protein locus_tag LOCUS_34070