>Feature sequence01 <1 714 gene locus_tag LOCUS_00010 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082986.1:two-component sensor histidine kinase 711 1259 gene locus_tag LOCUS_00020 711 1259 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531509.1 protein_id gnl|my_center|LOCUS_00020 1272 1769 gene locus_tag LOCUS_00030 gene gloA 1272 1769 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU72 protein_id gnl|my_center|LOCUS_00030 2257 1766 gene locus_tag LOCUS_00040 2257 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185972.1 protein_id gnl|my_center|LOCUS_00040 2375 2740 gene locus_tag LOCUS_00050 2375 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 2847 4211 gene locus_tag LOCUS_00060 gene soxC 2847 4211 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_00060 4215 5240 gene locus_tag LOCUS_00070 4215 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5272 5745 gene locus_tag LOCUS_00080 gene soxY 5272 5745 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083833.1 protein_id gnl|my_center|LOCUS_00080 5767 6078 gene locus_tag LOCUS_00090 gene soxZ 5767 6078 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_00090 6118 6954 gene locus_tag LOCUS_00100 6118 6954 CDS product SoxAX cytochrome complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SME7 protein_id gnl|my_center|LOCUS_00100 6972 7625 gene locus_tag LOCUS_00110 6972 7625 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228665.1 protein_id gnl|my_center|LOCUS_00110 7640 9367 gene locus_tag LOCUS_00120 gene soxB 7640 9367 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932700.1 protein_id gnl|my_center|LOCUS_00120 9373 9816 gene locus_tag LOCUS_00130 9373 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11243 9846 gene locus_tag LOCUS_00140 11243 9846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11505 12533 gene locus_tag LOCUS_00150 11505 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_00150 12614 13654 gene locus_tag LOCUS_00160 12614 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_00160 13793 16561 gene locus_tag LOCUS_00170 13793 16561 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_00170 16693 16619 gene locus_tag LOCUS_t00010 16693 16619 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16914 17516 gene locus_tag LOCUS_00180 16914 17516 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_00180 17569 18942 gene locus_tag LOCUS_00190 17569 18942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18969 19178 gene locus_tag LOCUS_00200 18969 19178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19214 19543 gene locus_tag LOCUS_00210 19214 19543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 20005 19571 gene locus_tag LOCUS_00220 20005 19571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20580 20005 gene locus_tag LOCUS_00230 20580 20005 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_00230 20939 22831 gene locus_tag LOCUS_00240 gene parE 20939 22831 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WLB9 protein_id gnl|my_center|LOCUS_00240 25954 22838 gene locus_tag LOCUS_00250 gene dnaE2 25954 22838 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3H9 protein_id gnl|my_center|LOCUS_00250 27336 25951 gene locus_tag LOCUS_00260 27336 25951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550915.1 protein_id gnl|my_center|LOCUS_00260 28009 27248 gene locus_tag LOCUS_00270 28009 27248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195290.1 protein_id gnl|my_center|LOCUS_00270 28694 28032 gene locus_tag LOCUS_00280 gene lexA 28694 28032 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7C5 protein_id gnl|my_center|LOCUS_00280 28990 29766 gene locus_tag LOCUS_00290 28990 29766 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VK4 protein_id gnl|my_center|LOCUS_00290 29769 30530 gene locus_tag LOCUS_00300 gene surE 29769 30530 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXN2 protein_id gnl|my_center|LOCUS_00300 30540 31280 gene locus_tag LOCUS_00310 30540 31280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 31277 32092 gene locus_tag LOCUS_00320 31277 32092 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039995.1 protein_id gnl|my_center|LOCUS_00320 32111 33481 gene locus_tag LOCUS_00330 gene rlmD 32111 33481 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3L5 protein_id gnl|my_center|LOCUS_00330 34401 33697 gene locus_tag LOCUS_00340 34401 33697 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205016.1 protein_id gnl|my_center|LOCUS_00340 34572 34997 gene locus_tag LOCUS_00350 gene ndk 34572 34997 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UT6 protein_id gnl|my_center|LOCUS_00350 35064 36203 gene locus_tag LOCUS_00360 gene rlmN 35064 36203 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JW2 protein_id gnl|my_center|LOCUS_00360 36470 37546 gene locus_tag LOCUS_00370 36470 37546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 37659 38864 gene locus_tag LOCUS_00380 gene ispG 37659 38864 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UT3 protein_id gnl|my_center|LOCUS_00380 38915 40240 gene locus_tag LOCUS_00390 gene hisS 38915 40240 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0L4 protein_id gnl|my_center|LOCUS_00390 40237 40881 gene locus_tag LOCUS_00400 40237 40881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 40894 42060 gene locus_tag LOCUS_00410 gene bamB 40894 42060 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9H3 protein_id gnl|my_center|LOCUS_00410 42069 43394 gene locus_tag LOCUS_00420 gene der 42069 43394 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63US9 protein_id gnl|my_center|LOCUS_00420 43727 43413 gene locus_tag LOCUS_00430 43727 43413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114819.1 protein_id gnl|my_center|LOCUS_00430 43878 44351 gene locus_tag LOCUS_00440 43878 44351 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193328.1 protein_id gnl|my_center|LOCUS_00440 44380 45414 gene locus_tag LOCUS_00450 44380 45414 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266745.1 protein_id gnl|my_center|LOCUS_00450 45497 46603 gene locus_tag LOCUS_00460 gene aroC 45497 46603 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TK6 protein_id gnl|my_center|LOCUS_00460 46631 47815 gene locus_tag LOCUS_00470 gene hcaT 46631 47815 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207024.1 protein_id gnl|my_center|LOCUS_00470 47931 48731 gene locus_tag LOCUS_00480 47931 48731 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 protein_id gnl|my_center|LOCUS_00480 48843 50243 gene locus_tag LOCUS_00490 gene leuC 48843 50243 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0Y9 protein_id gnl|my_center|LOCUS_00490 50262 50399 gene locus_tag LOCUS_00500 50262 50399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 50491 51132 gene locus_tag LOCUS_00510 gene leuD 50491 51132 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AI8 protein_id gnl|my_center|LOCUS_00510 51155 52249 gene locus_tag LOCUS_00520 gene leuB 51155 52249 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JL2 protein_id gnl|my_center|LOCUS_00520 52327 53451 gene locus_tag LOCUS_00530 gene asd 52327 53451 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAP1 protein_id gnl|my_center|LOCUS_00530 53514 55712 gene locus_tag LOCUS_00540 53514 55712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 55713 56477 gene locus_tag LOCUS_00550 gene truA 55713 56477 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JL6 protein_id gnl|my_center|LOCUS_00550 56474 57109 gene locus_tag LOCUS_00560 gene trpF 56474 57109 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI1 protein_id gnl|my_center|LOCUS_00560 57133 58386 gene locus_tag LOCUS_00570 gene trpB 57133 58386 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2W9Z8 protein_id gnl|my_center|LOCUS_00570 58399 59211 gene locus_tag LOCUS_00580 gene trpA 58399 59211 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AJ6 protein_id gnl|my_center|LOCUS_00580 59236 60114 gene locus_tag LOCUS_00590 gene accD 59236 60114 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM1 protein_id gnl|my_center|LOCUS_00590 60120 61526 gene locus_tag LOCUS_00600 gene folC 60120 61526 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811819.1 protein_id gnl|my_center|LOCUS_00600 61545 62210 gene locus_tag LOCUS_00610 61545 62210 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198053.1 protein_id gnl|my_center|LOCUS_00610 62207 62698 gene locus_tag LOCUS_00620 62207 62698 CDS product colicin V biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938481.1 protein_id gnl|my_center|LOCUS_00620 62708 64222 gene locus_tag LOCUS_00630 gene purF 62708 64222 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYD4 protein_id gnl|my_center|LOCUS_00630 64370 65626 gene locus_tag LOCUS_00640 gene ask 64370 65626 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63ST2 protein_id gnl|my_center|LOCUS_00640 65689 65779 gene locus_tag LOCUS_t00020 65689 65779 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 65948 66610 gene locus_tag LOCUS_00650 65948 66610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 68043 66655 gene locus_tag LOCUS_00660 68043 66655 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_00660 69494 68064 gene locus_tag LOCUS_00670 69494 68064 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203793.1 protein_id gnl|my_center|LOCUS_00670 69660 70022 gene locus_tag LOCUS_00680 69660 70022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 70057 70224 gene locus_tag LOCUS_00690 70057 70224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 70397 71677 gene locus_tag LOCUS_00700 70397 71677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 72320 71685 gene locus_tag LOCUS_00710 72320 71685 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_00710 72509 72841 gene locus_tag LOCUS_00720 72509 72841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 72892 73326 gene locus_tag LOCUS_00730 72892 73326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 74465 73323 gene locus_tag LOCUS_00740 gene hmp 74465 73323 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0H4 protein_id gnl|my_center|LOCUS_00740 74674 76227 gene locus_tag LOCUS_00750 74674 76227 CDS product anaerobic nitric oxide reductase transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113388.1 protein_id gnl|my_center|LOCUS_00750 78823 76217 gene locus_tag LOCUS_00760 gene cphA 78823 76217 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXL4 protein_id gnl|my_center|LOCUS_00760 80969 78858 gene locus_tag LOCUS_00770 gene cphA 80969 78858 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813560.1 protein_id gnl|my_center|LOCUS_00770 81345 83342 gene locus_tag LOCUS_00780 81345 83342 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_00780 83335 83802 gene locus_tag LOCUS_00790 83335 83802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930535.1 protein_id gnl|my_center|LOCUS_00790 84385 83819 gene locus_tag LOCUS_00800 gene flhC 84385 83819 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFT0 protein_id gnl|my_center|LOCUS_00800 84746 84429 gene locus_tag LOCUS_00810 gene flhD 84746 84429 CDS product flagellar transcriptional regulator FlhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PR2 protein_id gnl|my_center|LOCUS_00810 84942 85820 gene locus_tag LOCUS_00820 84942 85820 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_00820 87231 85804 gene locus_tag LOCUS_00830 87231 85804 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728400.1 protein_id gnl|my_center|LOCUS_00830 87421 87711 gene locus_tag LOCUS_00840 87421 87711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 87850 88314 gene locus_tag LOCUS_00850 87850 88314 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066931.1 protein_id gnl|my_center|LOCUS_00850 88445 89137 gene locus_tag LOCUS_00860 88445 89137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 89130 90119 gene locus_tag LOCUS_00870 89130 90119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816816.1 protein_id gnl|my_center|LOCUS_00870 90079 90843 gene locus_tag LOCUS_00880 gene ybgL 90079 90843 CDS product UPF0271 protein YbgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y2G6 protein_id gnl|my_center|LOCUS_00880 91270 90827 gene locus_tag LOCUS_00890 91270 90827 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816412.1 protein_id gnl|my_center|LOCUS_00890 91440 93401 gene locus_tag LOCUS_00900 91440 93401 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103149.1 protein_id gnl|my_center|LOCUS_00900 93398 94132 gene locus_tag LOCUS_00910 93398 94132 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269182.1 protein_id gnl|my_center|LOCUS_00910 94190 95218 gene locus_tag LOCUS_00920 94190 95218 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X28 protein_id gnl|my_center|LOCUS_00920 95663 95247 gene locus_tag LOCUS_00930 95663 95247 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_00930 96854 95682 gene locus_tag LOCUS_00940 96854 95682 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114061.1 protein_id gnl|my_center|LOCUS_00940 97389 96895 gene locus_tag LOCUS_00950 97389 96895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122604.1 protein_id gnl|my_center|LOCUS_00950 99441 97405 gene locus_tag LOCUS_00960 gene fadH1 99441 97405 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_00960 99660 102161 gene locus_tag LOCUS_00970 99660 102161 CDS product inner membrane transport permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_00970 102243 102740 gene locus_tag LOCUS_00980 102243 102740 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535495.1 protein_id gnl|my_center|LOCUS_00980 102743 104173 gene locus_tag LOCUS_00990 102743 104173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527474.1 protein_id gnl|my_center|LOCUS_00990 104145 105224 gene locus_tag LOCUS_01000 gene ansZ 104145 105224 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34482 protein_id gnl|my_center|LOCUS_01000 107303 105246 gene locus_tag LOCUS_01010 107303 105246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 108592 107327 gene locus_tag LOCUS_01020 108592 107327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 110093 108735 gene locus_tag LOCUS_01030 110093 108735 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809053.1 protein_id gnl|my_center|LOCUS_01030 112222 110090 gene locus_tag LOCUS_01040 112222 110090 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809055.1 protein_id gnl|my_center|LOCUS_01040 113585 112341 gene locus_tag LOCUS_01050 gene moeA 113585 112341 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039620.1 protein_id gnl|my_center|LOCUS_01050 114194 113601 gene locus_tag LOCUS_01060 gene mobA 114194 113601 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0Z6 protein_id gnl|my_center|LOCUS_01060 115060 114191 gene locus_tag LOCUS_01070 gene fdhD 115060 114191 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Z7 protein_id gnl|my_center|LOCUS_01070 116199 115081 gene locus_tag LOCUS_01080 gene moaA 116199 115081 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJJ4 protein_id gnl|my_center|LOCUS_01080 116321 116800 gene locus_tag LOCUS_01090 116321 116800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812677.1 protein_id gnl|my_center|LOCUS_01090 116793 117443 gene locus_tag LOCUS_01100 116793 117443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 117619 119733 gene locus_tag LOCUS_01110 117619 119733 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926386.1 protein_id gnl|my_center|LOCUS_01110 119730 120356 gene locus_tag LOCUS_01120 119730 120356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930374.1 protein_id gnl|my_center|LOCUS_01120 120371 120589 gene locus_tag LOCUS_01130 120371 120589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 120605 123544 gene locus_tag LOCUS_01140 gene fdhA 120605 123544 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812670.1 protein_id gnl|my_center|LOCUS_01140 123570 124172 gene locus_tag LOCUS_01150 gene fdhB 123570 124172 CDS product formate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 protein_id gnl|my_center|LOCUS_01150 124175 124438 gene locus_tag LOCUS_01160 124175 124438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 124451 125527 gene locus_tag LOCUS_01170 gene fdhC 124451 125527 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812663.1 protein_id gnl|my_center|LOCUS_01170 128881 125876 gene locus_tag LOCUS_01180 gene hmp1 128881 125876 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PEF3 protein_id gnl|my_center|LOCUS_01180 129302 130309 gene locus_tag LOCUS_01190 129302 130309 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKG3 protein_id gnl|my_center|LOCUS_01190 130306 130965 gene locus_tag LOCUS_01200 130306 130965 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_01200 130971 131348 gene locus_tag LOCUS_01210 130971 131348 CDS product Rieske iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193415.1 protein_id gnl|my_center|LOCUS_01210 131351 132307 gene locus_tag LOCUS_01220 131351 132307 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191725.1 protein_id gnl|my_center|LOCUS_01220 133046 132351 gene locus_tag LOCUS_01230 133046 132351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_01230 133629 133048 gene locus_tag LOCUS_01240 133629 133048 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA09 protein_id gnl|my_center|LOCUS_01240 133704 134294 gene locus_tag LOCUS_01250 133704 134294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 134319 134501 gene locus_tag LOCUS_01260 gene rpmF 134319 134501 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JXS0 protein_id gnl|my_center|LOCUS_01260 134567 135649 gene locus_tag LOCUS_01270 gene plsX 134567 135649 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S82 protein_id gnl|my_center|LOCUS_01270 135649 136626 gene locus_tag LOCUS_01280 gene fabH 135649 136626 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA84 protein_id gnl|my_center|LOCUS_01280 136712 137608 gene locus_tag LOCUS_01290 gene fabD 136712 137608 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGI3 protein_id gnl|my_center|LOCUS_01290 137623 138375 gene locus_tag LOCUS_01300 gene fabG 137623 138375 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197597.1 protein_id gnl|my_center|LOCUS_01300 138459 138698 gene locus_tag LOCUS_01310 gene acpP 138459 138698 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDZ1 protein_id gnl|my_center|LOCUS_01310 138783 140021 gene locus_tag LOCUS_01320 gene fabF 138783 140021 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJC8 protein_id gnl|my_center|LOCUS_01320 140419 141021 gene locus_tag LOCUS_01330 gene algU 140419 141021 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIP2 protein_id gnl|my_center|LOCUS_01330 141065 141688 gene locus_tag LOCUS_01340 141065 141688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 141692 142672 gene locus_tag LOCUS_01350 gene mucB 141692 142672 CDS product sigma factor AlgU regulatory protein MucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764762.1 protein_id gnl|my_center|LOCUS_01350 142688 144175 gene locus_tag LOCUS_01360 142688 144175 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205175.1 protein_id gnl|my_center|LOCUS_01360 144291 146093 gene locus_tag LOCUS_01370 gene lepA 144291 146093 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S94 protein_id gnl|my_center|LOCUS_01370 146096 146962 gene locus_tag LOCUS_01380 gene lepB 146096 146962 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S95 protein_id gnl|my_center|LOCUS_01380 146983 147699 gene locus_tag LOCUS_01390 gene rnc 146983 147699 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PD38 protein_id gnl|my_center|LOCUS_01390 147696 148598 gene locus_tag LOCUS_01400 gene era 147696 148598 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJA5 protein_id gnl|my_center|LOCUS_01400 148591 149325 gene locus_tag LOCUS_01410 gene recO 148591 149325 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S98 protein_id gnl|my_center|LOCUS_01410 149322 150062 gene locus_tag LOCUS_01420 gene pdxJ 149322 150062 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P341 protein_id gnl|my_center|LOCUS_01420 150076 150486 gene locus_tag LOCUS_01430 gene acpS 150076 150486 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S99 protein_id gnl|my_center|LOCUS_01430 150506 151531 gene locus_tag LOCUS_01440 gene nagZ 150506 151531 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MKN0 protein_id gnl|my_center|LOCUS_01440 152382 151600 gene locus_tag LOCUS_01450 152382 151600 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WE19 protein_id gnl|my_center|LOCUS_01450 152695 152423 gene locus_tag LOCUS_01460 152695 152423 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813873.1 protein_id gnl|my_center|LOCUS_01460 153334 152699 gene locus_tag LOCUS_01470 153334 152699 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V24 protein_id gnl|my_center|LOCUS_01470 153779 153366 gene locus_tag LOCUS_01480 gene msrB 153779 153366 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDS5 protein_id gnl|my_center|LOCUS_01480 155381 153816 gene locus_tag LOCUS_01490 155381 153816 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJZ4 protein_id gnl|my_center|LOCUS_01490 155435 157072 gene locus_tag LOCUS_01500 155435 157072 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_01500 157158 157460 gene locus_tag LOCUS_01510 157158 157460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192097.1 protein_id gnl|my_center|LOCUS_01510 158297 157500 gene locus_tag LOCUS_01520 158297 157500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070532.1 protein_id gnl|my_center|LOCUS_01520 158635 158288 gene locus_tag LOCUS_01530 158635 158288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 159521 158616 gene locus_tag LOCUS_01540 159521 158616 CDS product folate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_01540 159665 160708 gene locus_tag LOCUS_01550 159665 160708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_01550 160716 161366 gene locus_tag LOCUS_01560 gene tmk 160716 161366 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V08 protein_id gnl|my_center|LOCUS_01560 161363 162373 gene locus_tag LOCUS_01570 gene holB 161363 162373 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930597.1 protein_id gnl|my_center|LOCUS_01570 162396 162779 gene locus_tag LOCUS_01580 gene pilZ 162396 162779 CDS product type IV fimbriae assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 protein_id gnl|my_center|LOCUS_01580 162779 163564 gene locus_tag LOCUS_01590 162779 163564 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192025.1 protein_id gnl|my_center|LOCUS_01590 163561 164235 gene locus_tag LOCUS_01600 163561 164235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191824.1 protein_id gnl|my_center|LOCUS_01600 165891 164266 gene locus_tag LOCUS_01610 gene aer-1 165891 164266 CDS product aerotaxis receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103647.1 protein_id gnl|my_center|LOCUS_01610 167447 166455 gene locus_tag LOCUS_01620 167447 166455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 168961 168755 gene locus_tag LOCUS_01630 168961 168755 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 protein_id gnl|my_center|LOCUS_01630 169092 169694 gene locus_tag LOCUS_01640 169092 169694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 169691 171085 gene locus_tag LOCUS_01650 169691 171085 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106504.1 protein_id gnl|my_center|LOCUS_01650 171213 171938 gene locus_tag LOCUS_01660 171213 171938 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073550.1 protein_id gnl|my_center|LOCUS_01660 172167 172475 gene locus_tag LOCUS_01670 172167 172475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 173523 172531 gene locus_tag LOCUS_01680 173523 172531 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688125.1 protein_id gnl|my_center|LOCUS_01680 173901 173539 gene locus_tag LOCUS_01690 173901 173539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529974.1 protein_id gnl|my_center|LOCUS_01690 174471 173941 gene locus_tag LOCUS_01700 174471 173941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 174995 174468 gene locus_tag LOCUS_01710 174995 174468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 176421 175006 gene locus_tag LOCUS_01720 176421 175006 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061938.1 protein_id gnl|my_center|LOCUS_01720 177856 176441 gene locus_tag LOCUS_01730 177856 176441 CDS product copper resistance-related lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 protein_id gnl|my_center|LOCUS_01730 178182 177853 gene locus_tag LOCUS_01740 178182 177853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 178616 178236 gene locus_tag LOCUS_01750 178616 178236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 179010 178681 gene locus_tag LOCUS_01760 179010 178681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 179178 179873 gene locus_tag LOCUS_01770 179178 179873 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_01770 179876 181204 gene locus_tag LOCUS_01780 179876 181204 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815118.1 protein_id gnl|my_center|LOCUS_01780 181683 182972 gene locus_tag LOCUS_01790 gene czcC 181683 182972 CDS product outer membrane protein CzcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113317.1 protein_id gnl|my_center|LOCUS_01790 182985 184478 gene locus_tag LOCUS_01800 gene czcB 182985 184478 CDS product cobalt-zinc-cadmium resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551660.1 protein_id gnl|my_center|LOCUS_01800 184544 187717 gene locus_tag LOCUS_01810 gene czcA 184544 187717 CDS product resistance-nodulation-cell division divalent metal cation efflux transporter CzcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115707.1 protein_id gnl|my_center|LOCUS_01810 187727 188083 gene locus_tag LOCUS_01820 187727 188083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 188096 189019 gene locus_tag LOCUS_01830 188096 189019 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100957.1 protein_id gnl|my_center|LOCUS_01830 189090 189611 gene locus_tag LOCUS_01840 189090 189611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 189829 190407 gene locus_tag LOCUS_01850 189829 190407 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207928.1 protein_id gnl|my_center|LOCUS_01850 190397 191125 gene locus_tag LOCUS_01860 190397 191125 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816012.1 protein_id gnl|my_center|LOCUS_01860 192659 191034 gene locus_tag LOCUS_01870 192659 191034 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091675.1 protein_id gnl|my_center|LOCUS_01870 193057 192728 gene locus_tag LOCUS_01880 193057 192728 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62L95 protein_id gnl|my_center|LOCUS_01880 193484 193092 gene locus_tag LOCUS_01890 193484 193092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 196629 193510 gene locus_tag LOCUS_01900 196629 193510 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_01900 197754 196642 gene locus_tag LOCUS_01910 197754 196642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 198335 197757 gene locus_tag LOCUS_01920 198335 197757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 199579 198332 gene locus_tag LOCUS_01930 199579 198332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 199955 199665 gene locus_tag LOCUS_01940 199955 199665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 200463 200032 gene locus_tag LOCUS_01950 200463 200032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 202151 200757 gene locus_tag LOCUS_01960 202151 200757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815226.1 protein_id gnl|my_center|LOCUS_01960 202649 202179 gene locus_tag LOCUS_01970 202649 202179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 203440 202649 gene locus_tag LOCUS_01980 203440 202649 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809257.1 protein_id gnl|my_center|LOCUS_01980 203943 203437 gene locus_tag LOCUS_01990 203943 203437 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809255.1 protein_id gnl|my_center|LOCUS_01990 204381 204001 gene locus_tag LOCUS_02000 204381 204001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194998.1 protein_id gnl|my_center|LOCUS_02000 204934 204470 gene locus_tag LOCUS_02010 204934 204470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 206086 205025 gene locus_tag LOCUS_02020 206086 205025 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTI1 protein_id gnl|my_center|LOCUS_02020 206231 207136 gene locus_tag LOCUS_02030 206231 207136 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317531.1 protein_id gnl|my_center|LOCUS_02030 208873 208406 gene locus_tag LOCUS_02040 208873 208406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 210413 208941 gene locus_tag LOCUS_02050 210413 208941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 211393 210410 gene locus_tag LOCUS_02060 211393 210410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 213495 211402 gene locus_tag LOCUS_02070 213495 211402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 213794 215761 gene locus_tag LOCUS_02080 213794 215761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 215893 216111 gene locus_tag LOCUS_02090 215893 216111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 217154 216108 gene locus_tag LOCUS_02100 217154 216108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 217253 217483 gene locus_tag LOCUS_02110 217253 217483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 217486 217923 gene locus_tag LOCUS_02120 217486 217923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 218554 217895 gene locus_tag LOCUS_02130 218554 217895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 218720 219799 gene locus_tag LOCUS_02140 218720 219799 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946467.1 protein_id gnl|my_center|LOCUS_02140 219823 221061 gene locus_tag LOCUS_02150 gene purT 219823 221061 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VY4 protein_id gnl|my_center|LOCUS_02150 223190 221592 gene locus_tag LOCUS_02160 223190 221592 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810997.1 protein_id gnl|my_center|LOCUS_02160 224177 223269 gene locus_tag LOCUS_02170 224177 223269 CDS product muramoyltetrapeptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096158.1 protein_id gnl|my_center|LOCUS_02170 224930 224220 gene locus_tag LOCUS_02180 224930 224220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 226079 225096 gene locus_tag LOCUS_02190 226079 225096 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205316.1 protein_id gnl|my_center|LOCUS_02190 226977 226093 gene locus_tag LOCUS_02200 226977 226093 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813860.1 protein_id gnl|my_center|LOCUS_02200 228256 227051 gene locus_tag LOCUS_02210 228256 227051 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185183.1 protein_id gnl|my_center|LOCUS_02210 228989 228279 gene locus_tag LOCUS_02220 228989 228279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195807.1 protein_id gnl|my_center|LOCUS_02220 229761 228991 gene locus_tag LOCUS_02230 229761 228991 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195806.1 protein_id gnl|my_center|LOCUS_02230 231529 229907 gene locus_tag LOCUS_02240 gene guaA 231529 229907 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JF6 protein_id gnl|my_center|LOCUS_02240 232588 231596 gene locus_tag LOCUS_02250 232588 231596 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073536.1 protein_id gnl|my_center|LOCUS_02250 234071 232611 gene locus_tag LOCUS_02260 gene guaB 234071 232611 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVM3 protein_id gnl|my_center|LOCUS_02260 234519 234160 gene locus_tag LOCUS_02270 234519 234160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 234962 234516 gene locus_tag LOCUS_02280 234962 234516 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192775.1 protein_id gnl|my_center|LOCUS_02280 235064 235513 gene locus_tag LOCUS_02290 gene smpB 235064 235513 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIN9 protein_id gnl|my_center|LOCUS_02290 236424 235519 gene locus_tag LOCUS_02300 236424 235519 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063757.1 protein_id gnl|my_center|LOCUS_02300 236891 236469 gene locus_tag LOCUS_02310 236891 236469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063756.1 protein_id gnl|my_center|LOCUS_02310 239260 236912 gene locus_tag LOCUS_02320 gene ppsA 239260 236912 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEN6 protein_id gnl|my_center|LOCUS_02320 239457 240293 gene locus_tag LOCUS_02330 239457 240293 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JE0 protein_id gnl|my_center|LOCUS_02330 241968 240301 gene locus_tag LOCUS_02340 241968 240301 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020815.1 protein_id gnl|my_center|LOCUS_02340 242838 242017 gene locus_tag LOCUS_02350 242838 242017 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063752.1 protein_id gnl|my_center|LOCUS_02350 243527 242835 gene locus_tag LOCUS_02360 gene rnhB 243527 242835 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFF8 protein_id gnl|my_center|LOCUS_02360 244692 243520 gene locus_tag LOCUS_02370 gene lpxB 244692 243520 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JD7 protein_id gnl|my_center|LOCUS_02370 245484 244696 gene locus_tag LOCUS_02380 gene lpxA 245484 244696 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIM2 protein_id gnl|my_center|LOCUS_02380 245932 245498 gene locus_tag LOCUS_02390 gene fabZ 245932 245498 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T23 protein_id gnl|my_center|LOCUS_02390 247062 245977 gene locus_tag LOCUS_02400 gene lpxD 247062 245977 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2D3 protein_id gnl|my_center|LOCUS_02400 247587 247072 gene locus_tag LOCUS_02410 247587 247072 CDS product outer membrane protein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_02410 249826 247625 gene locus_tag LOCUS_02420 gene bamA 249826 247625 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T20 protein_id gnl|my_center|LOCUS_02420 251326 249983 gene locus_tag LOCUS_02430 251326 249983 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T19 protein_id gnl|my_center|LOCUS_02430 252539 251340 gene locus_tag LOCUS_02440 gene dxr 252539 251340 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T18 protein_id gnl|my_center|LOCUS_02440 253440 252547 gene locus_tag LOCUS_02450 253440 252547 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T17 protein_id gnl|my_center|LOCUS_02450 253951 253418 gene locus_tag LOCUS_02460 253951 253418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 254774 254214 gene locus_tag LOCUS_02470 gene frr 254774 254214 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T15 protein_id gnl|my_center|LOCUS_02470 255526 254816 gene locus_tag LOCUS_02480 gene pyrH 255526 254816 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYC8 protein_id gnl|my_center|LOCUS_02480 256532 255642 gene locus_tag LOCUS_02490 gene tsf 256532 255642 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZW0 protein_id gnl|my_center|LOCUS_02490 257370 256615 gene locus_tag LOCUS_02500 gene rpsB 257370 256615 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2C0 protein_id gnl|my_center|LOCUS_02500 257602 258411 gene locus_tag LOCUS_02510 gene map 257602 258411 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T11 protein_id gnl|my_center|LOCUS_02510 258434 261022 gene locus_tag LOCUS_02520 gene glnD 258434 261022 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T10 protein_id gnl|my_center|LOCUS_02520 261809 261063 gene locus_tag LOCUS_02530 261809 261063 CDS product putative S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ZC3 protein_id gnl|my_center|LOCUS_02530 262688 261813 gene locus_tag LOCUS_02540 gene galU-1 262688 261813 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKA0 protein_id gnl|my_center|LOCUS_02540 264764 262734 gene locus_tag LOCUS_02550 gene ligA 264764 262734 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T07 protein_id gnl|my_center|LOCUS_02550 265849 264761 gene locus_tag LOCUS_02560 265849 264761 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTI0 protein_id gnl|my_center|LOCUS_02560 269313 265846 gene locus_tag LOCUS_02570 gene smc 269313 265846 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCY0 protein_id gnl|my_center|LOCUS_02570 269560 269979 gene locus_tag LOCUS_02580 gene queF 269560 269979 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA3 protein_id gnl|my_center|LOCUS_02580 269990 271174 gene locus_tag LOCUS_02590 gene dapC 269990 271174 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039651.1 protein_id gnl|my_center|LOCUS_02590 271201 272031 gene locus_tag LOCUS_02600 gene dapD 271201 272031 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T02 protein_id gnl|my_center|LOCUS_02600 272047 272394 gene locus_tag LOCUS_02610 272047 272394 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206564.1 protein_id gnl|my_center|LOCUS_02610 272391 273305 gene locus_tag LOCUS_02620 gene prmB 272391 273305 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1I9 protein_id gnl|my_center|LOCUS_02620 273314 275242 gene locus_tag LOCUS_02630 273314 275242 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114037.1 protein_id gnl|my_center|LOCUS_02630 276769 275252 gene locus_tag LOCUS_02640 276769 275252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 277137 278816 gene locus_tag LOCUS_02650 277137 278816 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084106.1 protein_id gnl|my_center|LOCUS_02650 279575 278850 gene locus_tag LOCUS_02660 279575 278850 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_02660 279805 280197 gene locus_tag LOCUS_02670 279805 280197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 280388 280957 gene locus_tag LOCUS_02680 280388 280957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 281025 282344 gene locus_tag LOCUS_02690 281025 282344 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 protein_id gnl|my_center|LOCUS_02690 283657 282368 gene locus_tag LOCUS_02700 gene serS 283657 282368 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RS1 protein_id gnl|my_center|LOCUS_02700 285112 283757 gene locus_tag LOCUS_02710 285112 283757 CDS product recombination factor protein RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204086.1 protein_id gnl|my_center|LOCUS_02710 285744 285109 gene locus_tag LOCUS_02720 gene lolA 285744 285109 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW06 protein_id gnl|my_center|LOCUS_02720 288113 285852 gene locus_tag LOCUS_02730 gene ftsK 288113 285852 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930947.1 protein_id gnl|my_center|LOCUS_02730 288273 289238 gene locus_tag LOCUS_02740 gene trxB 288273 289238 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK92 protein_id gnl|my_center|LOCUS_02740 289264 289905 gene locus_tag LOCUS_02750 289264 289905 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186084.1 protein_id gnl|my_center|LOCUS_02750 289925 290851 gene locus_tag LOCUS_02760 289925 290851 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206070.1 protein_id gnl|my_center|LOCUS_02760 291254 290916 gene locus_tag LOCUS_02770 gene glnB 291254 290916 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073353.1 protein_id gnl|my_center|LOCUS_02770 292885 291251 gene locus_tag LOCUS_02780 gene nadE 292885 291251 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931082.1 protein_id gnl|my_center|LOCUS_02780 292935 294152 gene locus_tag LOCUS_02790 292935 294152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192390.1 protein_id gnl|my_center|LOCUS_02790 294733 294206 gene locus_tag LOCUS_02800 gene ppa 294733 294206 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3Z2 protein_id gnl|my_center|LOCUS_02800 295975 294785 gene locus_tag LOCUS_02810 295975 294785 CDS product porphyrin biosynthesis-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526333.1 protein_id gnl|my_center|LOCUS_02810 297921 295972 gene locus_tag LOCUS_02820 297921 295972 CDS product fused uroporphyrinogen-III synthase HemD/membrane protein HemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204934.1 protein_id gnl|my_center|LOCUS_02820 298863 297931 gene locus_tag LOCUS_02830 gene HemC 298863 297931 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P112 protein_id gnl|my_center|LOCUS_02830 299013 300437 gene locus_tag LOCUS_02840 gene argH 299013 300437 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W82 protein_id gnl|my_center|LOCUS_02840 300440 300958 gene locus_tag LOCUS_02850 300440 300958 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_02850 300949 302397 gene locus_tag LOCUS_02860 300949 302397 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974528.1 protein_id gnl|my_center|LOCUS_02860 303556 302411 gene locus_tag LOCUS_02870 303556 302411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 304235 303567 gene locus_tag LOCUS_02880 304235 303567 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228286.1 protein_id gnl|my_center|LOCUS_02880 305538 304450 gene locus_tag LOCUS_02890 305538 304450 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_02890 306908 305556 gene locus_tag LOCUS_02900 306908 305556 CDS product microcin-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522380.1 protein_id gnl|my_center|LOCUS_02900 306936 307490 gene locus_tag LOCUS_02910 306936 307490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522378.1 protein_id gnl|my_center|LOCUS_02910 307487 308107 gene locus_tag LOCUS_02920 gene mog 307487 308107 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44645 protein_id gnl|my_center|LOCUS_02920 308104 308769 gene locus_tag LOCUS_02930 308104 308769 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931226.1 protein_id gnl|my_center|LOCUS_02930 308875 309135 gene locus_tag LOCUS_02940 308875 309135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 310391 309159 gene locus_tag LOCUS_02950 310391 309159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 310429 311289 gene locus_tag LOCUS_02960 gene paaG 310429 311289 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224354.1 protein_id gnl|my_center|LOCUS_02960 311816 311286 gene locus_tag LOCUS_02970 311816 311286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 312094 313581 gene locus_tag LOCUS_02980 312094 313581 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404686.1 protein_id gnl|my_center|LOCUS_02980 315000 313582 gene locus_tag LOCUS_02990 315000 313582 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530684.1 protein_id gnl|my_center|LOCUS_02990 318125 314997 gene locus_tag LOCUS_03000 318125 314997 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972023.1 protein_id gnl|my_center|LOCUS_03000 319201 318122 gene locus_tag LOCUS_03010 319201 318122 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337326.1 protein_id gnl|my_center|LOCUS_03010 319691 319344 gene locus_tag LOCUS_03020 319691 319344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 319846 319771 gene locus_tag LOCUS_t00030 319846 319771 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 319939 319864 gene locus_tag LOCUS_t00040 319939 319864 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 320130 320693 gene locus_tag LOCUS_03030 320130 320693 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_03030 320690 321412 gene locus_tag LOCUS_03040 gene aat 320690 321412 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TV3 protein_id gnl|my_center|LOCUS_03040 321399 322133 gene locus_tag LOCUS_03050 gene ate 321399 322133 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCI0 protein_id gnl|my_center|LOCUS_03050 322209 323294 gene locus_tag LOCUS_03060 gene pyrD 322209 323294 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62K45 protein_id gnl|my_center|LOCUS_03060 324711 323302 gene locus_tag LOCUS_03070 324711 323302 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191338.1 protein_id gnl|my_center|LOCUS_03070 325469 324729 gene locus_tag LOCUS_03080 325469 324729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550196.1 protein_id gnl|my_center|LOCUS_03080 325608 326408 gene locus_tag LOCUS_03090 325608 326408 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524720.1 protein_id gnl|my_center|LOCUS_03090 327301 326423 gene locus_tag LOCUS_03100 gene pbpG 327301 326423 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809563.1 protein_id gnl|my_center|LOCUS_03100 328374 327406 gene locus_tag LOCUS_03110 328374 327406 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326200.1 protein_id gnl|my_center|LOCUS_03110 328549 329106 gene locus_tag LOCUS_03120 328549 329106 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199567.1 protein_id gnl|my_center|LOCUS_03120 329985 329203 gene locus_tag LOCUS_03130 329985 329203 CDS product damage-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814179.1 protein_id gnl|my_center|LOCUS_03130 330779 330015 gene locus_tag LOCUS_03140 330779 330015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065045.1 protein_id gnl|my_center|LOCUS_03140 334701 330811 gene locus_tag LOCUS_03150 gene hrpA 334701 330811 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202033.1 protein_id gnl|my_center|LOCUS_03150 334853 336193 gene locus_tag LOCUS_03160 gene argA 334853 336193 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SJ5 protein_id gnl|my_center|LOCUS_03160 336204 337412 gene locus_tag LOCUS_03170 gene metC 336204 337412 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191808.1 protein_id gnl|my_center|LOCUS_03170 339696 337441 gene locus_tag LOCUS_03180 339696 337441 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808393.1 protein_id gnl|my_center|LOCUS_03180 339889 340983 gene locus_tag LOCUS_03190 339889 340983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 341551 340985 gene locus_tag LOCUS_03200 gene dcd 341551 340985 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MDP4 protein_id gnl|my_center|LOCUS_03200 341987 341610 gene locus_tag LOCUS_03210 341987 341610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 343220 342195 gene locus_tag LOCUS_03220 343220 342195 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZH7 protein_id gnl|my_center|LOCUS_03220 344333 343242 gene locus_tag LOCUS_03230 344333 343242 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1M7 protein_id gnl|my_center|LOCUS_03230 344564 344767 gene locus_tag LOCUS_03240 gene rubA2 344564 344767 CDS product Rubredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK8 protein_id gnl|my_center|LOCUS_03240 345743 344775 gene locus_tag LOCUS_03250 345743 344775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098754.1 protein_id gnl|my_center|LOCUS_03250 346795 345860 gene locus_tag LOCUS_03260 346795 345860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 348152 346881 gene locus_tag LOCUS_03270 348152 346881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_03270 348332 349573 gene locus_tag LOCUS_03280 348332 349573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230324.1 protein_id gnl|my_center|LOCUS_03280 350511 349570 gene locus_tag LOCUS_03290 350511 349570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 350660 351493 gene locus_tag LOCUS_03300 gene fpr 350660 351493 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811187.1 protein_id gnl|my_center|LOCUS_03300 351963 351571 gene locus_tag LOCUS_03310 gene pcaC 351963 351571 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814363.1 protein_id gnl|my_center|LOCUS_03310 352414 351953 gene locus_tag LOCUS_03320 352414 351953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 352496 352795 gene locus_tag LOCUS_03330 352496 352795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 354717 352789 gene locus_tag LOCUS_03340 354717 352789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 355546 354842 gene locus_tag LOCUS_03350 355546 354842 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198629.1 protein_id gnl|my_center|LOCUS_03350 355732 356001 gene locus_tag LOCUS_03360 355732 356001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 356019 357086 gene locus_tag LOCUS_03370 356019 357086 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815978.1 protein_id gnl|my_center|LOCUS_03370 357542 357129 gene locus_tag LOCUS_03380 357542 357129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 359174 357759 gene locus_tag LOCUS_03390 gene cabC1 359174 357759 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206633.1 protein_id gnl|my_center|LOCUS_03390 360616 359288 gene locus_tag LOCUS_03400 360616 359288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_03400 361524 360655 gene locus_tag LOCUS_03410 361524 360655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093206.1 protein_id gnl|my_center|LOCUS_03410 361918 361538 gene locus_tag LOCUS_03420 361918 361538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259291.1 protein_id gnl|my_center|LOCUS_03420 362371 361922 gene locus_tag LOCUS_03430 362371 361922 CDS product putative esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3A4 protein_id gnl|my_center|LOCUS_03430 363166 362423 gene locus_tag LOCUS_03440 363166 362423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 363795 363187 gene locus_tag LOCUS_03450 363795 363187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 363844 364020 gene locus_tag LOCUS_03460 363844 364020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 364122 365795 gene locus_tag LOCUS_03470 364122 365795 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089372.1 protein_id gnl|my_center|LOCUS_03470 366364 365732 gene locus_tag LOCUS_03480 366364 365732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089373.1 protein_id gnl|my_center|LOCUS_03480 367962 366799 gene locus_tag LOCUS_03490 gene acadL 367962 366799 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118240.1 protein_id gnl|my_center|LOCUS_03490 368760 367990 gene locus_tag LOCUS_03500 368760 367990 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102518.1 protein_id gnl|my_center|LOCUS_03500 369771 368860 gene locus_tag LOCUS_03510 369771 368860 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_03510 369873 370841 gene locus_tag LOCUS_03520 369873 370841 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_03520 371768 370842 gene locus_tag LOCUS_03530 gene metR 371768 370842 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189234.1 protein_id gnl|my_center|LOCUS_03530 371865 374213 gene locus_tag LOCUS_03540 gene metE 371865 374213 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57703 protein_id gnl|my_center|LOCUS_03540 374294 375487 gene locus_tag LOCUS_03550 gene fadA 374294 375487 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_03550 375513 377273 gene locus_tag LOCUS_03560 gene kefC 375513 377273 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071668.1 protein_id gnl|my_center|LOCUS_03560 377275 378201 gene locus_tag LOCUS_03570 377275 378201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 381056 378171 gene locus_tag LOCUS_03580 381056 378171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 381685 381062 gene locus_tag LOCUS_03590 381685 381062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 381967 383190 gene locus_tag LOCUS_03600 381967 383190 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_03600 384253 383201 gene locus_tag LOCUS_03610 384253 383201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 384252 384671 gene locus_tag LOCUS_03620 384252 384671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 384689 384970 gene locus_tag LOCUS_03630 384689 384970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 385623 384952 gene locus_tag LOCUS_03640 385623 384952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 385918 387387 gene locus_tag LOCUS_03650 gene crnA 385918 387387 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_03650 387402 389120 gene locus_tag LOCUS_03660 387402 389120 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085584.1 protein_id gnl|my_center|LOCUS_03660 391122 389134 gene locus_tag LOCUS_03670 391122 389134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 391331 392806 gene locus_tag LOCUS_03680 391331 392806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 392985 393998 gene locus_tag LOCUS_03690 392985 393998 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_03690 394074 394484 gene locus_tag LOCUS_03700 394074 394484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 394481 395050 gene locus_tag LOCUS_03710 394481 395050 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729066.1 protein_id gnl|my_center|LOCUS_03710 395117 396004 gene locus_tag LOCUS_03720 395117 396004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 397044 396010 gene locus_tag LOCUS_03730 397044 396010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 397072 397797 gene locus_tag LOCUS_03740 397072 397797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 398096 397854 gene locus_tag LOCUS_03750 398096 397854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 399756 398113 gene locus_tag LOCUS_03760 399756 398113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 protein_id gnl|my_center|LOCUS_03760 399914 400606 gene locus_tag LOCUS_03770 399914 400606 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_03770 401973 400630 gene locus_tag LOCUS_03780 401973 400630 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_03780 403223 402327 gene locus_tag LOCUS_03790 403223 402327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 403299 403634 gene locus_tag LOCUS_03800 403299 403634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 403627 403842 gene locus_tag LOCUS_03810 403627 403842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 404604 403846 gene locus_tag LOCUS_03820 404604 403846 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071452.1 protein_id gnl|my_center|LOCUS_03820 405478 404699 gene locus_tag LOCUS_03830 gene dltE 405478 404699 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_03830 406386 405475 gene locus_tag LOCUS_03840 gene est 406386 405475 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004790086.1 protein_id gnl|my_center|LOCUS_03840 406583 407350 gene locus_tag LOCUS_03850 406583 407350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202847.1 protein_id gnl|my_center|LOCUS_03850 407539 408315 gene locus_tag LOCUS_03860 407539 408315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087258.1 protein_id gnl|my_center|LOCUS_03860 408521 410011 gene locus_tag LOCUS_03870 408521 410011 CDS product long-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706003.1 protein_id gnl|my_center|LOCUS_03870 410921 410097 gene locus_tag LOCUS_03880 410921 410097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705031.1 protein_id gnl|my_center|LOCUS_03880 413356 410927 gene locus_tag LOCUS_03890 413356 410927 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_03890 413455 414543 gene locus_tag LOCUS_03900 413455 414543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 414537 415103 gene locus_tag LOCUS_03910 414537 415103 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919061.1 protein_id gnl|my_center|LOCUS_03910 415730 415137 gene locus_tag LOCUS_03920 415730 415137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 415846 416994 gene locus_tag LOCUS_03930 415846 416994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 416991 417740 gene locus_tag LOCUS_03940 416991 417740 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228742.1 protein_id gnl|my_center|LOCUS_03940 417750 418553 gene locus_tag LOCUS_03950 417750 418553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 418550 419554 gene locus_tag LOCUS_03960 418550 419554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 419547 421871 gene locus_tag LOCUS_03970 419547 421871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706559.1 protein_id gnl|my_center|LOCUS_03970 421895 422962 gene locus_tag LOCUS_03980 421895 422962 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_03980 423027 424775 gene locus_tag LOCUS_03990 423027 424775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703340.1 protein_id gnl|my_center|LOCUS_03990 424811 425179 gene locus_tag LOCUS_04000 424811 425179 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_04000 425196 425894 gene locus_tag LOCUS_04010 425196 425894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 426945 425899 gene locus_tag LOCUS_04020 426945 425899 CDS product L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813011.1 protein_id gnl|my_center|LOCUS_04020 427048 427857 gene locus_tag LOCUS_04030 427048 427857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_04030 427893 428396 gene locus_tag LOCUS_04040 427893 428396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 428417 429010 gene locus_tag LOCUS_04050 gene msrA 428417 429010 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTR3 protein_id gnl|my_center|LOCUS_04050 430674 429028 gene locus_tag LOCUS_04060 430674 429028 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539668.1 protein_id gnl|my_center|LOCUS_04060 431126 430749 gene locus_tag LOCUS_04070 431126 430749 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405486.1 protein_id gnl|my_center|LOCUS_04070 431248 431172 gene locus_tag LOCUS_t00050 431248 431172 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 432832 431321 gene locus_tag LOCUS_04080 432832 431321 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931050.1 protein_id gnl|my_center|LOCUS_04080 434315 432825 gene locus_tag LOCUS_04090 gene glpK 434315 432825 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHM7 protein_id gnl|my_center|LOCUS_04090 434789 434340 gene locus_tag LOCUS_04100 434789 434340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 434845 435618 gene locus_tag LOCUS_04110 434845 435618 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190784.1 protein_id gnl|my_center|LOCUS_04110 435724 436572 gene locus_tag LOCUS_04120 435724 436572 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403626.1 protein_id gnl|my_center|LOCUS_04120 438041 436569 gene locus_tag LOCUS_04130 438041 436569 CDS product Baeyer-Villiger monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3H5 protein_id gnl|my_center|LOCUS_04130 438220 439593 gene locus_tag LOCUS_04140 438220 439593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 439700 441580 gene locus_tag LOCUS_04150 439700 441580 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385247.1 protein_id gnl|my_center|LOCUS_04150 441729 441640 gene locus_tag LOCUS_t00060 441729 441640 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 441798 442211 gene locus_tag LOCUS_04160 441798 442211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 442539 443858 gene locus_tag LOCUS_04170 gene nrtA 442539 443858 CDS product nitrate ABC transporter substrate-binding protein NrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887598.1 protein_id gnl|my_center|LOCUS_04170 443855 444721 gene locus_tag LOCUS_04180 gene nrtB 443855 444721 CDS product nitrate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085588.1 protein_id gnl|my_center|LOCUS_04180 444744 445592 gene locus_tag LOCUS_04190 gene nrtD 444744 445592 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918498.1 protein_id gnl|my_center|LOCUS_04190 447579 445648 gene locus_tag LOCUS_04200 447579 445648 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_04200 447914 449032 gene locus_tag LOCUS_04210 447914 449032 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816541.1 protein_id gnl|my_center|LOCUS_04210 449108 449677 gene locus_tag LOCUS_04220 449108 449677 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810992.1 protein_id gnl|my_center|LOCUS_04220 449689 451557 gene locus_tag LOCUS_04230 449689 451557 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810990.1 protein_id gnl|my_center|LOCUS_04230 451759 451670 gene locus_tag LOCUS_t00070 451759 451670 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 453153 451810 gene locus_tag LOCUS_04240 453153 451810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391173.1 protein_id gnl|my_center|LOCUS_04240 453745 453176 gene locus_tag LOCUS_04250 gene pgsA 453745 453176 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810356.1 protein_id gnl|my_center|LOCUS_04250 455819 453831 gene locus_tag LOCUS_04260 gene uvrC 455819 453831 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0Q1 protein_id gnl|my_center|LOCUS_04260 456537 455830 gene locus_tag LOCUS_04270 456537 455830 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_04270 457691 456534 gene locus_tag LOCUS_04280 457691 456534 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084303.1 protein_id gnl|my_center|LOCUS_04280 461812 457688 gene locus_tag LOCUS_04290 gene purL 461812 457688 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MDT0 protein_id gnl|my_center|LOCUS_04290 461835 463553 gene locus_tag LOCUS_04300 461835 463553 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V30 protein_id gnl|my_center|LOCUS_04300 464183 463503 gene locus_tag LOCUS_04310 464183 463503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063877.1 protein_id gnl|my_center|LOCUS_04310 464182 464835 gene locus_tag LOCUS_04320 gene tesA 464182 464835 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930532.1 protein_id gnl|my_center|LOCUS_04320 466722 464851 gene locus_tag LOCUS_04330 466722 464851 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WF06 protein_id gnl|my_center|LOCUS_04330 467005 466929 gene locus_tag LOCUS_t00080 467005 466929 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 467106 467031 gene locus_tag LOCUS_t00090 467106 467031 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 467487 467215 gene locus_tag LOCUS_04340 gene hupB 467487 467215 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_04340 470110 467702 gene locus_tag LOCUS_04350 gene lon 470110 467702 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WF10 protein_id gnl|my_center|LOCUS_04350 471547 470273 gene locus_tag LOCUS_04360 gene clpX 471547 470273 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V40 protein_id gnl|my_center|LOCUS_04360 472275 471607 gene locus_tag LOCUS_04370 gene clpP 472275 471607 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MHL9 protein_id gnl|my_center|LOCUS_04370 473580 472276 gene locus_tag LOCUS_04380 gene tig 473580 472276 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JK6 protein_id gnl|my_center|LOCUS_04380 473856 473772 gene locus_tag LOCUS_t00100 473856 473772 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 473943 474788 gene locus_tag LOCUS_04390 473943 474788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 477876 474802 gene locus_tag LOCUS_04400 477876 474802 CDS product drug-resistance cell envelope-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531375.1 protein_id gnl|my_center|LOCUS_04400 478973 477873 gene locus_tag LOCUS_04410 478973 477873 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193758.1 protein_id gnl|my_center|LOCUS_04410 480247 479048 gene locus_tag LOCUS_04420 gene radA 480247 479048 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYT2 protein_id gnl|my_center|LOCUS_04420 481561 480464 gene locus_tag LOCUS_04430 gene dadX 481561 480464 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SZ2 protein_id gnl|my_center|LOCUS_04430 481721 482995 gene locus_tag LOCUS_04440 481721 482995 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266648.1 protein_id gnl|my_center|LOCUS_04440 483664 483005 gene locus_tag LOCUS_04450 483664 483005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 484119 483661 gene locus_tag LOCUS_04460 gene rimI 484119 483661 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFJ1 protein_id gnl|my_center|LOCUS_04460 484810 484106 gene locus_tag LOCUS_04470 484810 484106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04470 485301 484807 gene locus_tag LOCUS_04480 gene ispF 485301 484807 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T71 protein_id gnl|my_center|LOCUS_04480 486029 485313 gene locus_tag LOCUS_04490 gene ispD 486029 485313 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGM5 protein_id gnl|my_center|LOCUS_04490 486153 489617 gene locus_tag LOCUS_04500 gene mfd 486153 489617 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIN8 protein_id gnl|my_center|LOCUS_04500 489621 490688 gene locus_tag LOCUS_04510 489621 490688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 490685 491557 gene locus_tag LOCUS_04520 490685 491557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 493133 491952 gene locus_tag LOCUS_04530 493133 491952 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192518.1 protein_id gnl|my_center|LOCUS_04530 494526 493165 gene locus_tag LOCUS_04540 gene rimO 494526 493165 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UQ8 protein_id gnl|my_center|LOCUS_04540 495142 494534 gene locus_tag LOCUS_04550 495142 494534 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813585.1 protein_id gnl|my_center|LOCUS_04550 496084 495341 gene locus_tag LOCUS_04560 gene phbB-1 496084 495341 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193701.1 protein_id gnl|my_center|LOCUS_04560 497308 496130 gene locus_tag LOCUS_04570 gene phbA 497308 496130 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527150.1 protein_id gnl|my_center|LOCUS_04570 499170 497332 gene locus_tag LOCUS_04580 gene phbC 499170 497332 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086513.1 protein_id gnl|my_center|LOCUS_04580 499375 499629 gene locus_tag LOCUS_04590 499375 499629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 500272 499526 gene locus_tag LOCUS_04600 500272 499526 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYH7 protein_id gnl|my_center|LOCUS_04600 501476 500313 gene locus_tag LOCUS_04610 501476 500313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 501592 502440 gene locus_tag LOCUS_04620 gene comL 501592 502440 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDF0 protein_id gnl|my_center|LOCUS_04620 504401 502437 gene locus_tag LOCUS_04630 504401 502437 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065179.1 protein_id gnl|my_center|LOCUS_04630 504629 504420 gene locus_tag LOCUS_04640 504629 504420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_04640 505107 504736 gene locus_tag LOCUS_04650 505107 504736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 505147 507513 gene locus_tag LOCUS_04660 505147 507513 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192485.1 protein_id gnl|my_center|LOCUS_04660 509016 507955 gene locus_tag LOCUS_04670 509016 507955 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065169.1 protein_id gnl|my_center|LOCUS_04670 510567 509131 gene locus_tag LOCUS_04680 gene odhL 510567 509131 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TQ9 protein_id gnl|my_center|LOCUS_04680 511866 510580 gene locus_tag LOCUS_04690 gene sucB 511866 510580 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHD8 protein_id gnl|my_center|LOCUS_04690 514865 511935 gene locus_tag LOCUS_04700 gene sucA 514865 511935 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191889.1 protein_id gnl|my_center|LOCUS_04700 516536 515229 gene locus_tag LOCUS_04710 gene gltA 516536 515229 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAC0 protein_id gnl|my_center|LOCUS_04710 516835 516563 gene locus_tag LOCUS_04720 516835 516563 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813647.1 protein_id gnl|my_center|LOCUS_04720 517624 516908 gene locus_tag LOCUS_04730 gene sdhB 517624 516908 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PEN8 protein_id gnl|my_center|LOCUS_04730 519428 517647 gene locus_tag LOCUS_04740 gene sdhA 519428 517647 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PEA3 protein_id gnl|my_center|LOCUS_04740 519808 519431 gene locus_tag LOCUS_04750 gene sdhD 519808 519431 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813653.1 protein_id gnl|my_center|LOCUS_04750 520224 519811 gene locus_tag LOCUS_04760 gene sdhC 520224 519811 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813654.1 protein_id gnl|my_center|LOCUS_04760 521147 520419 gene locus_tag LOCUS_04770 521147 520419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 521309 522295 gene locus_tag LOCUS_04780 gene mdh 521309 522295 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AG8 protein_id gnl|my_center|LOCUS_04780 522365 523339 gene locus_tag LOCUS_04790 522365 523339 CDS product lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188261.1 protein_id gnl|my_center|LOCUS_04790 523901 523353 gene locus_tag LOCUS_04800 523901 523353 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_04800 524216 523917 gene locus_tag LOCUS_04810 524216 523917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 524496 526553 gene locus_tag LOCUS_04820 524496 526553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105228.1 protein_id gnl|my_center|LOCUS_04820 526546 527454 gene locus_tag LOCUS_04830 gene rlmF 526546 527454 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKF9 protein_id gnl|my_center|LOCUS_04830 527691 527470 gene locus_tag LOCUS_04840 527691 527470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 528041 527802 gene locus_tag LOCUS_04850 528041 527802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 528463 528056 gene locus_tag LOCUS_04860 528463 528056 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314723.1 protein_id gnl|my_center|LOCUS_04860 530104 528539 gene locus_tag LOCUS_04870 gene prpR 530104 528539 CDS product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941045.1 protein_id gnl|my_center|LOCUS_04870 530301 531182 gene locus_tag LOCUS_04880 gene prpB 530301 531182 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E2 protein_id gnl|my_center|LOCUS_04880 531242 532402 gene locus_tag LOCUS_04890 gene prpC 531242 532402 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PBT7 protein_id gnl|my_center|LOCUS_04890 532406 535024 gene locus_tag LOCUS_04900 532406 535024 CDS product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115200.1 protein_id gnl|my_center|LOCUS_04900 535021 536226 gene locus_tag LOCUS_04910 535021 536226 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065151.1 protein_id gnl|my_center|LOCUS_04910 537757 536255 gene locus_tag LOCUS_04920 537757 536255 CDS product 6-aminohexanoate-cyclic-dimer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886881.1 protein_id gnl|my_center|LOCUS_04920 537891 538316 gene locus_tag LOCUS_04930 537891 538316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 540956 538365 gene locus_tag LOCUS_04940 gene acnB 540956 538365 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5Y8 protein_id gnl|my_center|LOCUS_04940 542144 541140 gene locus_tag LOCUS_04950 gene oruR 542144 541140 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206790.1 protein_id gnl|my_center|LOCUS_04950 542233 543213 gene locus_tag LOCUS_04960 542233 543213 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_04960 543218 544222 gene locus_tag LOCUS_04970 543218 544222 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106420.1 protein_id gnl|my_center|LOCUS_04970 544268 545509 gene locus_tag LOCUS_04980 544268 545509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199318.1 protein_id gnl|my_center|LOCUS_04980 545545 548268 gene locus_tag LOCUS_04990 gene citB 545545 548268 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JJ0 protein_id gnl|my_center|LOCUS_04990 548449 549354 gene locus_tag LOCUS_05000 gene epsO 548449 549354 CDS product putative pyruvyl transferase EpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71065 protein_id gnl|my_center|LOCUS_05000 551107 549362 gene locus_tag LOCUS_05010 551107 549362 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_05010 551099 552181 gene locus_tag LOCUS_05020 551099 552181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092092.1 protein_id gnl|my_center|LOCUS_05020 553027 552194 gene locus_tag LOCUS_05030 553027 552194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 553378 553595 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggatcaagaattggctcaacaacatcatccaccac 556372 554681 gene locus_tag LOCUS_05040 556372 554681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 557739 556381 gene locus_tag LOCUS_05050 557739 556381 CDS product HlyD family type I secretion membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_010239.2 protein_id gnl|my_center|LOCUS_05050 559664 557739 gene locus_tag LOCUS_05060 559664 557739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 560095 559679 gene locus_tag LOCUS_05070 560095 559679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 560739 560104 gene locus_tag LOCUS_05080 560739 560104 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084991.1 protein_id gnl|my_center|LOCUS_05080 561153 561839 gene locus_tag LOCUS_05090 561153 561839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 561964 562668 gene locus_tag LOCUS_05100 gene queC 561964 562668 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MS6 protein_id gnl|my_center|LOCUS_05100 562833 562908 gene locus_tag LOCUS_t00110 562833 562908 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 562974 563047 gene locus_tag LOCUS_t00120 562974 563047 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 563063 563155 gene locus_tag LOCUS_t00130 563063 563155 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 563233 565293 gene locus_tag LOCUS_05110 gene metG 563233 565293 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LE0 protein_id gnl|my_center|LOCUS_05110 565302 567008 gene locus_tag LOCUS_05120 565302 567008 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_05120 567054 567236 gene locus_tag LOCUS_05130 567054 567236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815055.1 protein_id gnl|my_center|LOCUS_05130 567249 568127 gene locus_tag LOCUS_05140 gene scpA 567249 568127 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WI66 protein_id gnl|my_center|LOCUS_05140 569795 568659 gene locus_tag LOCUS_05150 gene dnaJ 569795 568659 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9E9 protein_id gnl|my_center|LOCUS_05150 571896 569947 gene locus_tag LOCUS_05160 gene dnaK 571896 569947 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFT3 protein_id gnl|my_center|LOCUS_05160 572608 572009 gene locus_tag LOCUS_05170 gene grpE 572608 572009 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HD3 protein_id gnl|my_center|LOCUS_05170 573844 572738 gene locus_tag LOCUS_05180 gene hemH 573844 572738 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R43 protein_id gnl|my_center|LOCUS_05180 574932 573913 gene locus_tag LOCUS_05190 gene hrcA 574932 573913 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVX7 protein_id gnl|my_center|LOCUS_05190 575039 575974 gene locus_tag LOCUS_05200 575039 575974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 575964 577619 gene locus_tag LOCUS_05210 575964 577619 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MCI4 protein_id gnl|my_center|LOCUS_05210 578026 577652 gene locus_tag LOCUS_05220 gene fur 578026 577652 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194273.1 protein_id gnl|my_center|LOCUS_05220 578251 578694 gene locus_tag LOCUS_05230 578251 578694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 578702 579520 gene locus_tag LOCUS_05240 gene dapB 578702 579520 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62H17 protein_id gnl|my_center|LOCUS_05240 579626 579853 gene locus_tag LOCUS_05250 579626 579853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 579855 580187 gene locus_tag LOCUS_05260 579855 580187 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUN4 protein_id gnl|my_center|LOCUS_05260 580443 581255 gene locus_tag LOCUS_05270 580443 581255 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5D6 protein_id gnl|my_center|LOCUS_05270 582085 581252 gene locus_tag LOCUS_05280 gene umpA 582085 581252 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8N5 protein_id gnl|my_center|LOCUS_05280 582229 583917 gene locus_tag LOCUS_05290 gene ilvD 582229 583917 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WB9 protein_id gnl|my_center|LOCUS_05290 584182 583892 gene locus_tag LOCUS_05300 584182 583892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 584275 584583 gene locus_tag LOCUS_05310 gene nirM 584275 584583 CDS product cytochrome c-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P00099 protein_id gnl|my_center|LOCUS_05310 585634 584651 gene locus_tag LOCUS_05320 585634 584651 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814324.1 protein_id gnl|my_center|LOCUS_05320 586978 585824 gene locus_tag LOCUS_05330 586978 585824 CDS product branched chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525689.1 protein_id gnl|my_center|LOCUS_05330 587147 588112 gene locus_tag LOCUS_05340 587147 588112 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 protein_id gnl|my_center|LOCUS_05340 588109 589212 gene locus_tag LOCUS_05350 588109 589212 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186310.1 protein_id gnl|my_center|LOCUS_05350 589209 589982 gene locus_tag LOCUS_05360 589209 589982 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194783.1 protein_id gnl|my_center|LOCUS_05360 590011 590739 gene locus_tag LOCUS_05370 590011 590739 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200384.1 protein_id gnl|my_center|LOCUS_05370 591761 590724 gene locus_tag LOCUS_05380 591761 590724 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_05380 591849 592715 gene locus_tag LOCUS_05390 591849 592715 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186240.1 protein_id gnl|my_center|LOCUS_05390 592987 592712 gene locus_tag LOCUS_05400 592987 592712 CDS product polyhydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036767.1 protein_id gnl|my_center|LOCUS_05400 594165 593038 gene locus_tag LOCUS_05410 594165 593038 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816541.1 protein_id gnl|my_center|LOCUS_05410 594856 594170 gene locus_tag LOCUS_05420 594856 594170 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205176.1 protein_id gnl|my_center|LOCUS_05420 595004 595381 gene locus_tag LOCUS_05430 595004 595381 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931551.1 protein_id gnl|my_center|LOCUS_05430 595399 596205 gene locus_tag LOCUS_05440 595399 596205 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813853.1 protein_id gnl|my_center|LOCUS_05440 596320 597555 gene locus_tag LOCUS_05450 596320 597555 CDS product intracellular PHB depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813854.1 protein_id gnl|my_center|LOCUS_05450 597548 598192 gene locus_tag LOCUS_05460 597548 598192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 598189 598821 gene locus_tag LOCUS_05470 gene nth 598189 598821 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYB4 protein_id gnl|my_center|LOCUS_05470 598818 599912 gene locus_tag LOCUS_05480 598818 599912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 599934 600368 gene locus_tag LOCUS_05490 599934 600368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814061.1 protein_id gnl|my_center|LOCUS_05490 601031 600699 gene locus_tag LOCUS_05500 601031 600699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 601404 601054 gene locus_tag LOCUS_05510 601404 601054 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814065.1 protein_id gnl|my_center|LOCUS_05510 601601 602443 gene locus_tag LOCUS_05520 601601 602443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 protein_id gnl|my_center|LOCUS_05520 602458 603633 gene locus_tag LOCUS_05530 602458 603633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186167.1 protein_id gnl|my_center|LOCUS_05530 603703 604290 gene locus_tag LOCUS_05540 603703 604290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064819.1 protein_id gnl|my_center|LOCUS_05540 604428 604889 gene locus_tag LOCUS_05550 604428 604889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 606792 604894 gene locus_tag LOCUS_05560 gene htpG 606792 604894 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MAZ2 protein_id gnl|my_center|LOCUS_05560 609209 606888 gene locus_tag LOCUS_05570 gene parC 609209 606888 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKY6 protein_id gnl|my_center|LOCUS_05570 609962 609228 gene locus_tag LOCUS_05580 gene rlmB 609962 609228 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5A2 protein_id gnl|my_center|LOCUS_05580 612493 609977 gene locus_tag LOCUS_05590 gene rnr 612493 609977 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGL3 protein_id gnl|my_center|LOCUS_05590 612538 612624 gene locus_tag LOCUS_t00140 612538 612624 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 613817 612759 gene locus_tag LOCUS_05600 613817 612759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405967.1 protein_id gnl|my_center|LOCUS_05600 614401 613928 gene locus_tag LOCUS_05610 614401 613928 CDS product nucleotide phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205020.1 protein_id gnl|my_center|LOCUS_05610 615722 614421 gene locus_tag LOCUS_05620 gene purA 615722 614421 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K012 protein_id gnl|my_center|LOCUS_05620 616922 615726 gene locus_tag LOCUS_05630 gene hisZ 616922 615726 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JX4 protein_id gnl|my_center|LOCUS_05630 617129 616950 gene locus_tag LOCUS_05640 gene yjeT 617129 616950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AF73 protein_id gnl|my_center|LOCUS_05640 618066 617200 gene locus_tag LOCUS_05650 gene hflC 618066 617200 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MK82 protein_id gnl|my_center|LOCUS_05650 619379 618069 gene locus_tag LOCUS_05660 gene hflK 619379 618069 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_05660 620536 619415 gene locus_tag LOCUS_05670 gene hflX 620536 619415 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63US7 protein_id gnl|my_center|LOCUS_05670 620805 620572 gene locus_tag LOCUS_05680 gene hfq 620805 620572 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JW9 protein_id gnl|my_center|LOCUS_05680 622388 620985 gene locus_tag LOCUS_05690 622388 620985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 622403 623008 gene locus_tag LOCUS_05700 622403 623008 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193704.1 protein_id gnl|my_center|LOCUS_05700 623008 623391 gene locus_tag LOCUS_05710 623008 623391 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222851.1 protein_id gnl|my_center|LOCUS_05710 623396 624835 gene locus_tag LOCUS_05720 623396 624835 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191226.1 protein_id gnl|my_center|LOCUS_05720 626257 625313 gene locus_tag LOCUS_05730 gene dusA 626257 625313 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TW5 protein_id gnl|my_center|LOCUS_05730 630491 626349 gene locus_tag LOCUS_05740 630491 626349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 635545 630491 gene locus_tag LOCUS_05750 635545 630491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 636426 635542 gene locus_tag LOCUS_05760 636426 635542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 638917 636440 gene locus_tag LOCUS_05770 638917 636440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 642057 638914 gene locus_tag LOCUS_05780 642057 638914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 643242 642073 gene locus_tag LOCUS_05790 643242 642073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 645390 644587 gene locus_tag LOCUS_05800 645390 644587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 647490 645670 gene locus_tag LOCUS_05810 gene typA 647490 645670 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810554.1 protein_id gnl|my_center|LOCUS_05810 648488 647487 gene locus_tag LOCUS_05820 gene truB 648488 647487 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TQ0 protein_id gnl|my_center|LOCUS_05820 648846 648475 gene locus_tag LOCUS_05830 gene rbfA 648846 648475 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KL0 protein_id gnl|my_center|LOCUS_05830 651693 648874 gene locus_tag LOCUS_05840 gene infB 651693 648874 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TP8 protein_id gnl|my_center|LOCUS_05840 653236 651767 gene locus_tag LOCUS_05850 gene nusA 653236 651767 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYR3 protein_id gnl|my_center|LOCUS_05850 653750 653247 gene locus_tag LOCUS_05860 gene rimP 653750 653247 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KK7 protein_id gnl|my_center|LOCUS_05860 655346 653934 gene locus_tag LOCUS_05870 655346 653934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 655932 655318 gene locus_tag LOCUS_05880 655932 655318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 656608 656393 gene locus_tag LOCUS_05890 656608 656393 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191494.1 protein_id gnl|my_center|LOCUS_05890 657116 656622 gene locus_tag LOCUS_05900 657116 656622 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099189.1 protein_id gnl|my_center|LOCUS_05900 657244 657320 gene locus_tag LOCUS_t00150 657244 657320 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 659228 658341 gene locus_tag LOCUS_05910 659228 658341 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094781.1 protein_id gnl|my_center|LOCUS_05910 659364 659576 gene locus_tag LOCUS_05920 659364 659576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 659534 659752 gene locus_tag LOCUS_05930 659534 659752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 659854 660090 gene locus_tag LOCUS_05940 659854 660090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 660989 661744 gene locus_tag LOCUS_05950 660989 661744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525145.1 protein_id gnl|my_center|LOCUS_05950 661716 661925 gene locus_tag LOCUS_05960 661716 661925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 661919 662224 gene locus_tag LOCUS_05970 661919 662224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 662538 662723 gene locus_tag LOCUS_05980 662538 662723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 664223 663234 gene locus_tag LOCUS_05990 664223 663234 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967019.1 protein_id gnl|my_center|LOCUS_05990 665295 664273 gene locus_tag LOCUS_06000 665295 664273 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_06000 666340 665378 gene locus_tag LOCUS_06010 666340 665378 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122374.1 protein_id gnl|my_center|LOCUS_06010 666755 666450 gene locus_tag LOCUS_06020 666755 666450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 668001 666832 gene locus_tag LOCUS_06030 668001 666832 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198074.1 protein_id gnl|my_center|LOCUS_06030 668675 668070 gene locus_tag LOCUS_06040 668675 668070 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104371.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence02 703 440 gene locus_tag LOCUS_06050 703 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 4767 5618 gene locus_tag LOCUS_06060 4767 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 6295 5801 gene locus_tag LOCUS_06070 gene dps 6295 5801 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 protein_id gnl|my_center|LOCUS_06070 7646 6333 gene locus_tag LOCUS_06080 7646 6333 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205023.1 protein_id gnl|my_center|LOCUS_06080 7704 8063 gene locus_tag LOCUS_06090 7704 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 8074 8517 gene locus_tag LOCUS_06100 8074 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 8533 9120 gene locus_tag LOCUS_06110 8533 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 9614 9189 gene locus_tag LOCUS_06120 9614 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 10518 9616 gene locus_tag LOCUS_06130 10518 9616 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527134.1 protein_id gnl|my_center|LOCUS_06130 12327 10621 gene locus_tag LOCUS_06140 12327 10621 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_06140 13901 12324 gene locus_tag LOCUS_06150 13901 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527135.1 protein_id gnl|my_center|LOCUS_06150 14960 13932 gene locus_tag LOCUS_06160 14960 13932 CDS product cytochrome bd ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528683.1 protein_id gnl|my_center|LOCUS_06160 16314 14947 gene locus_tag LOCUS_06170 16314 14947 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 protein_id gnl|my_center|LOCUS_06170 16509 16943 gene locus_tag LOCUS_06180 16509 16943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 17651 16998 gene locus_tag LOCUS_06190 17651 16998 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385122.1 protein_id gnl|my_center|LOCUS_06190 18561 17866 gene locus_tag LOCUS_06200 18561 17866 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338471.1 protein_id gnl|my_center|LOCUS_06200 18618 20720 gene locus_tag LOCUS_06210 18618 20720 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402903.1 protein_id gnl|my_center|LOCUS_06210 20744 21445 gene locus_tag LOCUS_06220 20744 21445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 21514 21939 gene locus_tag LOCUS_06230 gene thi3 21514 21939 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207653.1 protein_id gnl|my_center|LOCUS_06230 22849 22031 gene locus_tag LOCUS_06240 22849 22031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 23426 23100 gene locus_tag LOCUS_06250 gene pemK 23426 23100 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MPZ5 protein_id gnl|my_center|LOCUS_06250 23680 23423 gene locus_tag LOCUS_06260 23680 23423 CDS product MazE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042074.1 protein_id gnl|my_center|LOCUS_06260 27441 23932 gene locus_tag LOCUS_06270 27441 23932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 28368 27796 gene locus_tag LOCUS_06280 28368 27796 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 protein_id gnl|my_center|LOCUS_06280 28738 28373 gene locus_tag LOCUS_06290 28738 28373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 30274 28742 gene locus_tag LOCUS_06300 30274 28742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 31425 30271 gene locus_tag LOCUS_06310 31425 30271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 32957 31428 gene locus_tag LOCUS_06320 32957 31428 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013658.1 protein_id gnl|my_center|LOCUS_06320 33179 32967 gene locus_tag LOCUS_06330 33179 32967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 33307 33516 gene locus_tag LOCUS_06340 33307 33516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 33861 35384 gene locus_tag LOCUS_06350 33861 35384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202573.1 protein_id gnl|my_center|LOCUS_06350 35718 36653 gene locus_tag LOCUS_06360 35718 36653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 36637 37548 gene locus_tag LOCUS_06370 36637 37548 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703829.1 protein_id gnl|my_center|LOCUS_06370 37942 37867 gene locus_tag LOCUS_t00160 37942 37867 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37993 41166 gene locus_tag LOCUS_06380 37993 41166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072729.1 protein_id gnl|my_center|LOCUS_06380 42072 41167 gene locus_tag LOCUS_06390 gene ttdR 42072 41167 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206176.1 protein_id gnl|my_center|LOCUS_06390 42192 42968 gene locus_tag LOCUS_06400 42192 42968 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZZ6 protein_id gnl|my_center|LOCUS_06400 43018 45870 gene locus_tag LOCUS_06410 43018 45870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 45996 46562 gene locus_tag LOCUS_06420 45996 46562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 47878 46574 gene locus_tag LOCUS_06430 47878 46574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 48962 47964 gene locus_tag LOCUS_06440 48962 47964 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815066.1 protein_id gnl|my_center|LOCUS_06440 49840 48959 gene locus_tag LOCUS_06450 49840 48959 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976229.1 protein_id gnl|my_center|LOCUS_06450 50843 49821 gene locus_tag LOCUS_06460 50843 49821 CDS product amino acid-binding periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064704.1 protein_id gnl|my_center|LOCUS_06460 51634 50840 gene locus_tag LOCUS_06470 51634 50840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144051.1 protein_id gnl|my_center|LOCUS_06470 51735 52208 gene locus_tag LOCUS_06480 51735 52208 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378342.1 protein_id gnl|my_center|LOCUS_06480 52243 52599 gene locus_tag LOCUS_06490 52243 52599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 54213 52606 gene locus_tag LOCUS_06500 54213 52606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 57178 54470 gene locus_tag LOCUS_06510 57178 54470 CDS product aculeacin A acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889514.1 protein_id gnl|my_center|LOCUS_06510 57360 58871 gene locus_tag LOCUS_06520 gene mmsA 57360 58871 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808433.1 protein_id gnl|my_center|LOCUS_06520 58967 59692 gene locus_tag LOCUS_06530 58967 59692 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_06530 59787 60383 gene locus_tag LOCUS_06540 59787 60383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 61342 60380 gene locus_tag LOCUS_06550 61342 60380 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529258.1 protein_id gnl|my_center|LOCUS_06550 61380 62408 gene locus_tag LOCUS_06560 61380 62408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104462.1 protein_id gnl|my_center|LOCUS_06560 63085 62483 gene locus_tag LOCUS_06570 63085 62483 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202183.1 protein_id gnl|my_center|LOCUS_06570 63700 63131 gene locus_tag LOCUS_06580 63700 63131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202184.1 protein_id gnl|my_center|LOCUS_06580 64309 63749 gene locus_tag LOCUS_06590 64309 63749 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194252.1 protein_id gnl|my_center|LOCUS_06590 64577 65122 gene locus_tag LOCUS_06600 64577 65122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 65900 65232 gene locus_tag LOCUS_06610 65900 65232 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224580.1 protein_id gnl|my_center|LOCUS_06610 66020 66916 gene locus_tag LOCUS_06620 66020 66916 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202679.1 protein_id gnl|my_center|LOCUS_06620 66989 67654 gene locus_tag LOCUS_06630 66989 67654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529957.1 protein_id gnl|my_center|LOCUS_06630 68270 67677 gene locus_tag LOCUS_06640 68270 67677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 70345 68345 gene locus_tag LOCUS_06650 gene rep 70345 68345 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PL9 protein_id gnl|my_center|LOCUS_06650 72494 70392 gene locus_tag LOCUS_06660 gene priA 72494 70392 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJF7 protein_id gnl|my_center|LOCUS_06660 73861 72767 gene locus_tag LOCUS_06670 gene hemE 73861 72767 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PI5 protein_id gnl|my_center|LOCUS_06670 74330 73902 gene locus_tag LOCUS_06680 74330 73902 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_06680 75196 74363 gene locus_tag LOCUS_06690 75196 74363 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y6 protein_id gnl|my_center|LOCUS_06690 76017 75193 gene locus_tag LOCUS_06700 76017 75193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101593.1 protein_id gnl|my_center|LOCUS_06700 76443 76054 gene locus_tag LOCUS_06710 76443 76054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 77013 76594 gene locus_tag LOCUS_06720 gene atpC 77013 76594 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PI1 protein_id gnl|my_center|LOCUS_06720 78474 77083 gene locus_tag LOCUS_06730 gene atpD1 78474 77083 CDS product ATP synthase subunit beta 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FR5 protein_id gnl|my_center|LOCUS_06730 79382 78513 gene locus_tag LOCUS_06740 gene atpG 79382 78513 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FR6 protein_id gnl|my_center|LOCUS_06740 80997 79456 gene locus_tag LOCUS_06750 gene atpA1 80997 79456 CDS product ATP synthase subunit alpha 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PH8 protein_id gnl|my_center|LOCUS_06750 81563 81030 gene locus_tag LOCUS_06760 gene atpH 81563 81030 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PH7 protein_id gnl|my_center|LOCUS_06760 81995 81588 gene locus_tag LOCUS_06770 gene atpF 81995 81588 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MNX7 protein_id gnl|my_center|LOCUS_06770 82376 82134 gene locus_tag LOCUS_06780 gene atpE 82376 82134 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7J8 protein_id gnl|my_center|LOCUS_06780 83196 82435 gene locus_tag LOCUS_06790 gene atpB 83196 82435 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PH4 protein_id gnl|my_center|LOCUS_06790 84660 83779 gene locus_tag LOCUS_06800 84660 83779 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195818.1 protein_id gnl|my_center|LOCUS_06800 85457 84681 gene locus_tag LOCUS_06810 gene parA 85457 84681 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806879.1 protein_id gnl|my_center|LOCUS_06810 86165 85488 gene locus_tag LOCUS_06820 gene rsmG 86165 85488 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PG9 protein_id gnl|my_center|LOCUS_06820 88120 86162 gene locus_tag LOCUS_06830 gene gidA 88120 86162 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9Q2 protein_id gnl|my_center|LOCUS_06830 89563 88757 gene locus_tag LOCUS_06840 89563 88757 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3B5 protein_id gnl|my_center|LOCUS_06840 91517 89676 gene locus_tag LOCUS_06850 gene pckG 91517 89676 CDS product phosphoenolpyruvate carboxykinase [GTP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0V5 protein_id gnl|my_center|LOCUS_06850 91774 92379 gene locus_tag LOCUS_06860 91774 92379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 93429 92401 gene locus_tag LOCUS_06870 93429 92401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 93728 93456 gene locus_tag LOCUS_06880 93728 93456 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116175.1 protein_id gnl|my_center|LOCUS_06880 93795 94256 gene locus_tag LOCUS_06890 93795 94256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 94376 96754 gene locus_tag LOCUS_06900 94376 96754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 97224 96760 gene locus_tag LOCUS_06910 97224 96760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 97497 98171 gene locus_tag LOCUS_06920 97497 98171 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037326.1 protein_id gnl|my_center|LOCUS_06920 98208 101204 gene locus_tag LOCUS_06930 98208 101204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 101344 101796 gene locus_tag LOCUS_06940 101344 101796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 101793 102365 gene locus_tag LOCUS_06950 101793 102365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549603.1 protein_id gnl|my_center|LOCUS_06950 103045 102389 gene locus_tag LOCUS_06960 103045 102389 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083162.1 protein_id gnl|my_center|LOCUS_06960 103269 103673 gene locus_tag LOCUS_06970 103269 103673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 104914 103691 gene locus_tag LOCUS_06980 gene mnmE 104914 103691 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSR5 protein_id gnl|my_center|LOCUS_06980 106733 105042 gene locus_tag LOCUS_06990 gene yidC 106733 105042 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65622 protein_id gnl|my_center|LOCUS_06990 107797 109188 gene locus_tag LOCUS_07000 gene dnaA 107797 109188 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSE0 protein_id gnl|my_center|LOCUS_07000 109417 110523 gene locus_tag LOCUS_07010 gene dnaN 109417 110523 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WI70 protein_id gnl|my_center|LOCUS_07010 110547 113072 gene locus_tag LOCUS_07020 gene gyrB 110547 113072 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHD0 protein_id gnl|my_center|LOCUS_07020 114198 113077 gene locus_tag LOCUS_07030 gene cfa 114198 113077 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946865.1 protein_id gnl|my_center|LOCUS_07030 114167 114325 gene locus_tag LOCUS_07040 114167 114325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 116178 114322 gene locus_tag LOCUS_07050 116178 114322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 119071 116333 gene locus_tag LOCUS_07060 119071 116333 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_07060 120789 119068 gene locus_tag LOCUS_07070 120789 119068 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_07070 120979 121932 gene locus_tag LOCUS_07080 gene ylbK 120979 121932 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 protein_id gnl|my_center|LOCUS_07080 121955 122650 gene locus_tag LOCUS_07090 121955 122650 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262765.1 protein_id gnl|my_center|LOCUS_07090 122674 123363 gene locus_tag LOCUS_07100 122674 123363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_07100 123399 123926 gene locus_tag LOCUS_07110 123399 123926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 125990 123936 gene locus_tag LOCUS_07120 125990 123936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_07120 126393 126088 gene locus_tag LOCUS_07130 126393 126088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 127426 126485 gene locus_tag LOCUS_07140 127426 126485 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085811.1 protein_id gnl|my_center|LOCUS_07140 129205 127454 gene locus_tag LOCUS_07150 gene phoD 129205 127454 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_07150 130997 129321 gene locus_tag LOCUS_07160 130997 129321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 131526 130978 gene locus_tag LOCUS_07170 131526 130978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549603.1 protein_id gnl|my_center|LOCUS_07170 131808 132392 gene locus_tag LOCUS_07180 131808 132392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 132508 133512 gene locus_tag LOCUS_07190 132508 133512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901674.1 protein_id gnl|my_center|LOCUS_07190 133941 133516 gene locus_tag LOCUS_07200 133941 133516 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184408.1 protein_id gnl|my_center|LOCUS_07200 134386 133955 gene locus_tag LOCUS_07210 134386 133955 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817042.1 protein_id gnl|my_center|LOCUS_07210 134498 135928 gene locus_tag LOCUS_07220 134498 135928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 138487 135935 gene locus_tag LOCUS_07230 138487 135935 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525850.1 protein_id gnl|my_center|LOCUS_07230 139706 138609 gene locus_tag LOCUS_07240 139706 138609 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190020.1 protein_id gnl|my_center|LOCUS_07240 139802 140311 gene locus_tag LOCUS_07250 gene def-1 139802 140311 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHL0 protein_id gnl|my_center|LOCUS_07250 140308 141309 gene locus_tag LOCUS_07260 gene fmt 140308 141309 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YR6 protein_id gnl|my_center|LOCUS_07260 141408 142265 gene locus_tag LOCUS_07270 gene htpX 141408 142265 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YR4 protein_id gnl|my_center|LOCUS_07270 142262 143632 gene locus_tag LOCUS_07280 142262 143632 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PAB3 protein_id gnl|my_center|LOCUS_07280 143642 144259 gene locus_tag LOCUS_07290 143642 144259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188929.1 protein_id gnl|my_center|LOCUS_07290 144256 146529 gene locus_tag LOCUS_07300 144256 146529 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_07300 146548 147273 gene locus_tag LOCUS_07310 146548 147273 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189647.1 protein_id gnl|my_center|LOCUS_07310 147270 148646 gene locus_tag LOCUS_07320 gene trkA 147270 148646 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166392.1 protein_id gnl|my_center|LOCUS_07320 148662 150122 gene locus_tag LOCUS_07330 gene trkH 148662 150122 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MC03 protein_id gnl|my_center|LOCUS_07330 150119 150526 gene locus_tag LOCUS_07340 150119 150526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 150610 150858 gene locus_tag LOCUS_07350 150610 150858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 152413 151163 gene locus_tag LOCUS_07360 152413 151163 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947133.1 protein_id gnl|my_center|LOCUS_07360 153721 153059 gene locus_tag LOCUS_07370 gene eda 153721 153059 CDS product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704295.1 protein_id gnl|my_center|LOCUS_07370 155542 153749 gene locus_tag LOCUS_07380 155542 153749 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691226.1 protein_id gnl|my_center|LOCUS_07380 155663 157129 gene locus_tag LOCUS_07390 gene zwf 155663 157129 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKN7 protein_id gnl|my_center|LOCUS_07390 157126 159885 gene locus_tag LOCUS_07400 gene ppc 157126 159885 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89R17 protein_id gnl|my_center|LOCUS_07400 159912 160703 gene locus_tag LOCUS_07410 159912 160703 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119768.1 protein_id gnl|my_center|LOCUS_07410 160737 161288 gene locus_tag LOCUS_07420 160737 161288 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185716.1 protein_id gnl|my_center|LOCUS_07420 161303 162754 gene locus_tag LOCUS_07430 161303 162754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 163408 162809 gene locus_tag LOCUS_07440 gene aox 163408 162809 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261331.1 protein_id gnl|my_center|LOCUS_07440 164284 164069 gene locus_tag LOCUS_07450 164284 164069 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266737.1 protein_id gnl|my_center|LOCUS_07450 164829 165110 gene locus_tag LOCUS_07460 164829 165110 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245507.1 protein_id gnl|my_center|LOCUS_07460 165433 165729 gene locus_tag LOCUS_07470 gene hupB 165433 165729 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64389 protein_id gnl|my_center|LOCUS_07470 167417 166101 gene locus_tag LOCUS_07480 167417 166101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039889.1 protein_id gnl|my_center|LOCUS_07480 167727 167428 gene locus_tag LOCUS_07490 167727 167428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 168413 168108 gene locus_tag LOCUS_07500 168413 168108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 168731 168489 gene locus_tag LOCUS_07510 168731 168489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 169075 168860 gene locus_tag LOCUS_07520 169075 168860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 169680 169120 gene locus_tag LOCUS_07530 169680 169120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 169904 170164 gene locus_tag LOCUS_07540 169904 170164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 170166 171509 gene locus_tag LOCUS_07550 gene hipA 170166 171509 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816876.1 protein_id gnl|my_center|LOCUS_07550 171615 172106 gene locus_tag LOCUS_07560 171615 172106 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821327.1 protein_id gnl|my_center|LOCUS_07560 172773 172129 gene locus_tag LOCUS_07570 172773 172129 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186100.1 protein_id gnl|my_center|LOCUS_07570 173140 172775 gene locus_tag LOCUS_07580 173140 172775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 173295 175169 gene locus_tag LOCUS_07590 173295 175169 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_07590 175203 176507 gene locus_tag LOCUS_07600 175203 176507 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_07600 176526 177041 gene locus_tag LOCUS_07610 176526 177041 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389747.1 protein_id gnl|my_center|LOCUS_07610 177612 178019 gene locus_tag LOCUS_07620 177612 178019 CDS product mercuric resistance operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_07620 178100 178741 gene locus_tag LOCUS_07630 178100 178741 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075543.1 protein_id gnl|my_center|LOCUS_07630 179647 178715 gene locus_tag LOCUS_07640 179647 178715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 179680 180249 gene locus_tag LOCUS_07650 179680 180249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228000.1 protein_id gnl|my_center|LOCUS_07650 180249 180530 gene locus_tag LOCUS_07660 180249 180530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 181160 180582 gene locus_tag LOCUS_07670 181160 180582 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947367.1 protein_id gnl|my_center|LOCUS_07670 181395 181700 gene locus_tag LOCUS_07680 181395 181700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 181764 183002 gene locus_tag LOCUS_07690 181764 183002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 182999 183529 gene locus_tag LOCUS_07700 182999 183529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 183532 184653 gene locus_tag LOCUS_07710 183532 184653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 184666 187785 gene locus_tag LOCUS_07720 184666 187785 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_07720 187806 188198 gene locus_tag LOCUS_07730 187806 188198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 189519 188173 gene locus_tag LOCUS_07740 gene abc1 189519 188173 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339198.1 protein_id gnl|my_center|LOCUS_07740 189953 189642 gene locus_tag LOCUS_07750 189953 189642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 190131 190853 gene locus_tag LOCUS_07760 190131 190853 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815117.1 protein_id gnl|my_center|LOCUS_07760 190886 192175 gene locus_tag LOCUS_07770 190886 192175 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266840.1 protein_id gnl|my_center|LOCUS_07770 192694 194016 gene locus_tag LOCUS_07780 192694 194016 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189952.1 protein_id gnl|my_center|LOCUS_07780 194013 195644 gene locus_tag LOCUS_07790 194013 195644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936048.1 protein_id gnl|my_center|LOCUS_07790 195641 198778 gene locus_tag LOCUS_07800 195641 198778 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189156.1 protein_id gnl|my_center|LOCUS_07800 198878 199393 gene locus_tag LOCUS_07810 198878 199393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 199548 200276 gene locus_tag LOCUS_07820 199548 200276 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001346550.1 protein_id gnl|my_center|LOCUS_07820 200307 201251 gene locus_tag LOCUS_07830 200307 201251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 201263 202066 gene locus_tag LOCUS_07840 201263 202066 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903534.1 protein_id gnl|my_center|LOCUS_07840 202081 203106 gene locus_tag LOCUS_07850 202081 203106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 203117 203617 gene locus_tag LOCUS_07860 203117 203617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 203610 204173 gene locus_tag LOCUS_07870 gene phnH 203610 204173 CDS product carbon-phosphorus lyase subunit PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171603.1 protein_id gnl|my_center|LOCUS_07870 204173 205291 gene locus_tag LOCUS_07880 204173 205291 CDS product carbon-phosphorus lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258836.1 protein_id gnl|my_center|LOCUS_07880 205278 206204 gene locus_tag LOCUS_07890 gene phnJ 205278 206204 CDS product carbon-phosphorus lyase complex subunit PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435861.1 protein_id gnl|my_center|LOCUS_07890 206201 207031 gene locus_tag LOCUS_07900 gene phnK 206201 207031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435860.1 protein_id gnl|my_center|LOCUS_07900 207047 207757 gene locus_tag LOCUS_07910 207047 207757 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529517.1 protein_id gnl|my_center|LOCUS_07910 207754 208980 gene locus_tag LOCUS_07920 207754 208980 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258832.1 protein_id gnl|my_center|LOCUS_07920 208973 209539 gene locus_tag LOCUS_07930 gene phnN 208973 209539 CDS product ribose 1,5-bisphosphate phosphokinase PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R14 protein_id gnl|my_center|LOCUS_07930 209530 210300 gene locus_tag LOCUS_07940 gene phnP 209530 210300 CDS product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267547.1 protein_id gnl|my_center|LOCUS_07940 210297 211145 gene locus_tag LOCUS_07950 210297 211145 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228081.1 protein_id gnl|my_center|LOCUS_07950 216130 211142 gene locus_tag LOCUS_07960 216130 211142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 216205 217080 gene locus_tag LOCUS_07970 gene yvbV 216205 217080 CDS product putative transporter YvbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32256 protein_id gnl|my_center|LOCUS_07970 217701 217135 gene locus_tag LOCUS_07980 217701 217135 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083338.1 protein_id gnl|my_center|LOCUS_07980 218516 217848 gene locus_tag LOCUS_07990 218516 217848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 219280 218528 gene locus_tag LOCUS_08000 219280 218528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099222.1 protein_id gnl|my_center|LOCUS_08000 222345 219361 gene locus_tag LOCUS_08010 222345 219361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 222673 223161 gene locus_tag LOCUS_08020 222673 223161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 223171 223389 gene locus_tag LOCUS_08030 223171 223389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 223680 227474 gene locus_tag LOCUS_08040 gene metH 223680 227474 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064919.1 protein_id gnl|my_center|LOCUS_08040 227698 229800 gene locus_tag LOCUS_08050 227698 229800 CDS product EscV/YscV/HrcV family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105897.1 protein_id gnl|my_center|LOCUS_08050 229813 230739 gene locus_tag LOCUS_08060 229813 230739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 230736 232127 gene locus_tag LOCUS_08070 gene HrcN 230736 232127 CDS product ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266891.1 protein_id gnl|my_center|LOCUS_08070 232124 232546 gene locus_tag LOCUS_08080 232124 232546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 232537 233616 gene locus_tag LOCUS_08090 232537 233616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 233630 234283 gene locus_tag LOCUS_08100 gene HrcR 233630 234283 CDS product EscR/YscR/HrcR family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406534.1 protein_id gnl|my_center|LOCUS_08100 234286 234543 gene locus_tag LOCUS_08110 gene fliQ 234286 234543 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097797.1 protein_id gnl|my_center|LOCUS_08110 234546 235346 gene locus_tag LOCUS_08120 234546 235346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 235343 236413 gene locus_tag LOCUS_08130 gene yscU 235343 236413 CDS product Yop proteins translocation protein U inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69986 protein_id gnl|my_center|LOCUS_08130 236535 237551 gene locus_tag LOCUS_08140 236535 237551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 237548 238336 gene locus_tag LOCUS_08150 237548 238336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036640.1 protein_id gnl|my_center|LOCUS_08150 238347 238766 gene locus_tag LOCUS_08160 238347 238766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 238770 239546 gene locus_tag LOCUS_08170 gene bscJ 238770 239546 CDS product EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064191.1 protein_id gnl|my_center|LOCUS_08170 239543 240274 gene locus_tag LOCUS_08180 239543 240274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 240277 240945 gene locus_tag LOCUS_08190 240277 240945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 240929 242668 gene locus_tag LOCUS_08200 gene bscC 240929 242668 CDS product EscC/YscC/HrcC family type III secretion system outer membrane ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809915.1 protein_id gnl|my_center|LOCUS_08200 242672 243877 gene locus_tag LOCUS_08210 242672 243877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 243858 244205 gene locus_tag LOCUS_08220 243858 244205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 244209 244757 gene locus_tag LOCUS_08230 244209 244757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 244738 245094 gene locus_tag LOCUS_08240 244738 245094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 245121 245354 gene locus_tag LOCUS_08250 245121 245354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 245365 245517 gene locus_tag LOCUS_08260 245365 245517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 245542 245775 gene locus_tag LOCUS_08270 245542 245775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 245795 246370 gene locus_tag LOCUS_08280 245795 246370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 246419 247600 gene locus_tag LOCUS_08290 246419 247600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 247614 248498 gene locus_tag LOCUS_08300 247614 248498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 248521 249288 gene locus_tag LOCUS_08310 248521 249288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 249328 250992 gene locus_tag LOCUS_08320 249328 250992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 251140 251514 gene locus_tag LOCUS_08330 251140 251514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 251582 252775 gene locus_tag LOCUS_08340 gene atuD 251582 252775 CDS product citronellyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101733.1 protein_id gnl|my_center|LOCUS_08340 252768 254783 gene locus_tag LOCUS_08350 gene mccC1 252768 254783 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207705.1 protein_id gnl|my_center|LOCUS_08350 254809 255939 gene locus_tag LOCUS_08360 254809 255939 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083801.1 protein_id gnl|my_center|LOCUS_08360 256217 257866 gene locus_tag LOCUS_08370 256217 257866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 258598 257969 gene locus_tag LOCUS_08380 258598 257969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 258772 259458 gene locus_tag LOCUS_08390 gene fabG 258772 259458 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086937.1 protein_id gnl|my_center|LOCUS_08390 260115 259483 gene locus_tag LOCUS_08400 260115 259483 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768695.1 protein_id gnl|my_center|LOCUS_08400 260224 261492 gene locus_tag LOCUS_08410 260224 261492 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937371.1 protein_id gnl|my_center|LOCUS_08410 261503 264667 gene locus_tag LOCUS_08420 261503 264667 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_08420 264660 266105 gene locus_tag LOCUS_08430 264660 266105 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_08430 266184 266519 gene locus_tag LOCUS_08440 266184 266519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_08440 266857 266567 gene locus_tag LOCUS_08450 266857 266567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 267376 266858 gene locus_tag LOCUS_08460 267376 266858 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141124.1 protein_id gnl|my_center|LOCUS_08460 267416 268378 gene locus_tag LOCUS_08470 267416 268378 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207753.1 protein_id gnl|my_center|LOCUS_08470 268394 270574 gene locus_tag LOCUS_08480 268394 270574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 271097 271384 gene locus_tag LOCUS_08490 271097 271384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 271381 272805 gene locus_tag LOCUS_08500 271381 272805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 272835 274262 gene locus_tag LOCUS_08510 272835 274262 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061938.1 protein_id gnl|my_center|LOCUS_08510 274287 274781 gene locus_tag LOCUS_08520 274287 274781 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886943.1 protein_id gnl|my_center|LOCUS_08520 274812 275183 gene locus_tag LOCUS_08530 274812 275183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 275959 275195 gene locus_tag LOCUS_08540 275959 275195 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190271.1 protein_id gnl|my_center|LOCUS_08540 277044 275965 gene locus_tag LOCUS_08550 277044 275965 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206917.1 protein_id gnl|my_center|LOCUS_08550 278273 277044 gene locus_tag LOCUS_08560 278273 277044 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206918.1 protein_id gnl|my_center|LOCUS_08560 278357 279478 gene locus_tag LOCUS_08570 278357 279478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112360.1 protein_id gnl|my_center|LOCUS_08570 279508 280026 gene locus_tag LOCUS_08580 gene dps 279508 280026 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811209.1 protein_id gnl|my_center|LOCUS_08580 280120 280668 gene locus_tag LOCUS_08590 280120 280668 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266351.1 protein_id gnl|my_center|LOCUS_08590 280665 281375 gene locus_tag LOCUS_08600 280665 281375 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266350.1 protein_id gnl|my_center|LOCUS_08600 283257 281452 gene locus_tag LOCUS_08610 283257 281452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 284054 283344 gene locus_tag LOCUS_08620 284054 283344 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 protein_id gnl|my_center|LOCUS_08620 284197 284718 gene locus_tag LOCUS_08630 284197 284718 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103092.1 protein_id gnl|my_center|LOCUS_08630 285125 284754 gene locus_tag LOCUS_08640 285125 284754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189319.1 protein_id gnl|my_center|LOCUS_08640 285177 285719 gene locus_tag LOCUS_08650 285177 285719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 285720 287021 gene locus_tag LOCUS_08660 285720 287021 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521828.1 protein_id gnl|my_center|LOCUS_08660 288523 286988 gene locus_tag LOCUS_08670 288523 286988 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926358.1 protein_id gnl|my_center|LOCUS_08670 288882 288616 gene locus_tag LOCUS_08680 288882 288616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 289058 289825 gene locus_tag LOCUS_08690 289058 289825 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811028.1 protein_id gnl|my_center|LOCUS_08690 289896 290234 gene locus_tag LOCUS_08700 289896 290234 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_08700 290256 291692 gene locus_tag LOCUS_08710 gene amtB 290256 291692 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ7 protein_id gnl|my_center|LOCUS_08710 292423 293712 gene locus_tag LOCUS_08720 gene gshA 292423 293712 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204801.1 protein_id gnl|my_center|LOCUS_08720 293709 294671 gene locus_tag LOCUS_08730 gene gshB 293709 294671 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XV3 protein_id gnl|my_center|LOCUS_08730 294671 295135 gene locus_tag LOCUS_08740 294671 295135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 295104 295373 gene locus_tag LOCUS_08750 gene ptsH 295104 295373 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_08750 295377 297128 gene locus_tag LOCUS_08760 gene ptsI 295377 297128 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WH74 protein_id gnl|my_center|LOCUS_08760 297137 298363 gene locus_tag LOCUS_08770 gene metX 297137 298363 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YJ0 protein_id gnl|my_center|LOCUS_08770 298360 299001 gene locus_tag LOCUS_08780 298360 299001 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817748.1 protein_id gnl|my_center|LOCUS_08780 299008 299337 gene locus_tag LOCUS_08790 299008 299337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 299297 302599 gene locus_tag LOCUS_08800 gene mcm 299297 302599 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D452 protein_id gnl|my_center|LOCUS_08800 303115 303774 gene locus_tag LOCUS_08810 303115 303774 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_08810 303884 306310 gene locus_tag LOCUS_08820 303884 306310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 306423 308459 gene locus_tag LOCUS_08830 306423 308459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 309191 308532 gene locus_tag LOCUS_08840 309191 308532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 309237 309932 gene locus_tag LOCUS_08850 gene lipB 309237 309932 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XX6 protein_id gnl|my_center|LOCUS_08850 309944 310927 gene locus_tag LOCUS_08860 gene lipA 309944 310927 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62N16 protein_id gnl|my_center|LOCUS_08860 311951 310944 gene locus_tag LOCUS_08870 311951 310944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_08870 313665 312022 gene locus_tag LOCUS_08880 313665 312022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 314318 313665 gene locus_tag LOCUS_08890 314318 313665 CDS product type VI secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106966.1 protein_id gnl|my_center|LOCUS_08890 317785 314315 gene locus_tag LOCUS_08900 317785 314315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925954.1 protein_id gnl|my_center|LOCUS_08900 319168 317804 gene locus_tag LOCUS_08910 319168 317804 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808318.1 protein_id gnl|my_center|LOCUS_08910 320433 319165 gene locus_tag LOCUS_08920 320433 319165 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808316.1 protein_id gnl|my_center|LOCUS_08920 320689 321231 gene locus_tag LOCUS_08930 320689 321231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 321254 323311 gene locus_tag LOCUS_08940 gene vgrG1 321254 323311 CDS product type VI secretion system protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895494.1 protein_id gnl|my_center|LOCUS_08940 323325 323783 gene locus_tag LOCUS_08950 323325 323783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 323780 325150 gene locus_tag LOCUS_08960 323780 325150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 325143 325928 gene locus_tag LOCUS_08970 325143 325928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 325937 326971 gene locus_tag LOCUS_08980 325937 326971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 326962 327732 gene locus_tag LOCUS_08990 326962 327732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 327842 329560 gene locus_tag LOCUS_09000 327842 329560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895677.1 protein_id gnl|my_center|LOCUS_09000 329574 335999 gene locus_tag LOCUS_09010 329574 335999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 336106 336513 gene locus_tag LOCUS_09020 336106 336513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926942.1 protein_id gnl|my_center|LOCUS_09020 336636 336986 gene locus_tag LOCUS_09030 336636 336986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814593.1 protein_id gnl|my_center|LOCUS_09030 336979 337509 gene locus_tag LOCUS_09040 336979 337509 CDS product protein NlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705226.1 protein_id gnl|my_center|LOCUS_09040 338447 337569 gene locus_tag LOCUS_09050 gene htpX 338447 337569 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWH2 protein_id gnl|my_center|LOCUS_09050 338788 338444 gene locus_tag LOCUS_09060 338788 338444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 338895 339806 gene locus_tag LOCUS_09070 338895 339806 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_09070 339857 340729 gene locus_tag LOCUS_09080 339857 340729 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706015.1 protein_id gnl|my_center|LOCUS_09080 342604 340661 gene locus_tag LOCUS_09090 342604 340661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 343334 342705 gene locus_tag LOCUS_09100 gene msrA 343334 342705 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZA7 protein_id gnl|my_center|LOCUS_09100 343452 345446 gene locus_tag LOCUS_09110 343452 345446 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096642.1 protein_id gnl|my_center|LOCUS_09110 345581 346531 gene locus_tag LOCUS_09120 gene pstC 345581 346531 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V81 protein_id gnl|my_center|LOCUS_09120 346535 347455 gene locus_tag LOCUS_09130 gene pstA 346535 347455 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ERR1 protein_id gnl|my_center|LOCUS_09130 347478 348254 gene locus_tag LOCUS_09140 gene pstB 347478 348254 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ66 protein_id gnl|my_center|LOCUS_09140 348409 349449 gene locus_tag LOCUS_09150 gene pstS 348409 349449 CDS product phosphate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVI2 protein_id gnl|my_center|LOCUS_09150 349628 350488 gene locus_tag LOCUS_09160 349628 350488 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531310.1 protein_id gnl|my_center|LOCUS_09160 351143 350457 gene locus_tag LOCUS_09170 351143 350457 CDS product MIP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919378.1 protein_id gnl|my_center|LOCUS_09170 351638 351150 gene locus_tag LOCUS_09180 gene arsC 351638 351150 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184680.1 protein_id gnl|my_center|LOCUS_09180 352135 351635 gene locus_tag LOCUS_09190 352135 351635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 352463 352128 gene locus_tag LOCUS_09200 352463 352128 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039907.1 protein_id gnl|my_center|LOCUS_09200 353652 352543 gene locus_tag LOCUS_09210 gene phaC1 353652 352543 CDS product polyhydroxyalkanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 protein_id gnl|my_center|LOCUS_09210 355067 354276 gene locus_tag LOCUS_09220 355067 354276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202847.1 protein_id gnl|my_center|LOCUS_09220 355178 356188 gene locus_tag LOCUS_09230 355178 356188 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807763.1 protein_id gnl|my_center|LOCUS_09230 356181 357086 gene locus_tag LOCUS_09240 356181 357086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_09240 357101 357862 gene locus_tag LOCUS_09250 357101 357862 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_09250 357969 358268 gene locus_tag LOCUS_09260 357969 358268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346844.1 protein_id gnl|my_center|LOCUS_09260 358265 358639 gene locus_tag LOCUS_09270 358265 358639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216048.1 protein_id gnl|my_center|LOCUS_09270 359547 358636 gene locus_tag LOCUS_09280 359547 358636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 361288 359672 gene locus_tag LOCUS_09290 361288 359672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 363130 361328 gene locus_tag LOCUS_09300 363130 361328 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462598.1 protein_id gnl|my_center|LOCUS_09300 363926 363234 gene locus_tag LOCUS_09310 363926 363234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 364079 364861 gene locus_tag LOCUS_09320 364079 364861 CDS product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYH5 protein_id gnl|my_center|LOCUS_09320 365246 364890 gene locus_tag LOCUS_09330 365246 364890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 366256 365276 gene locus_tag LOCUS_09340 366256 365276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 367552 366311 gene locus_tag LOCUS_09350 367552 366311 CDS product NADH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530601.1 protein_id gnl|my_center|LOCUS_09350 367613 368524 gene locus_tag LOCUS_09360 367613 368524 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_09360 368564 369703 gene locus_tag LOCUS_09370 368564 369703 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225205.1 protein_id gnl|my_center|LOCUS_09370 370670 369750 gene locus_tag LOCUS_09380 370670 369750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 protein_id gnl|my_center|LOCUS_09380 371197 370796 gene locus_tag LOCUS_09390 371197 370796 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191805.1 protein_id gnl|my_center|LOCUS_09390 371869 371207 gene locus_tag LOCUS_09400 371869 371207 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219028.1 protein_id gnl|my_center|LOCUS_09400 371893 372696 gene locus_tag LOCUS_09410 371893 372696 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070911.1 protein_id gnl|my_center|LOCUS_09410 372724 374130 gene locus_tag LOCUS_09420 372724 374130 CDS product O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064414.1 protein_id gnl|my_center|LOCUS_09420 374336 374127 gene locus_tag LOCUS_09430 374336 374127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 376058 374358 gene locus_tag LOCUS_09440 376058 374358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530604.1 protein_id gnl|my_center|LOCUS_09440 378540 376063 gene locus_tag LOCUS_09450 gene bcsA 378540 376063 CDS product cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528862.1 protein_id gnl|my_center|LOCUS_09450 379280 378537 gene locus_tag LOCUS_09460 gene bcsF 379280 378537 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174891.1 protein_id gnl|my_center|LOCUS_09460 379486 379277 gene locus_tag LOCUS_09470 379486 379277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 380889 379483 gene locus_tag LOCUS_09480 380889 379483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 383310 380890 gene locus_tag LOCUS_09490 383310 380890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 384454 383303 gene locus_tag LOCUS_09500 gene bcsZ 384454 383303 CDS product glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JST6 protein_id gnl|my_center|LOCUS_09500 386681 384456 gene locus_tag LOCUS_09510 gene bcsB 386681 384456 CDS product cellulose synthase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205645.1 protein_id gnl|my_center|LOCUS_09510 386930 387268 gene locus_tag LOCUS_09520 386930 387268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 387277 390351 gene locus_tag LOCUS_09530 387277 390351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 391240 390368 gene locus_tag LOCUS_09540 391240 390368 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547412.1 protein_id gnl|my_center|LOCUS_09540 391302 392390 gene locus_tag LOCUS_09550 391302 392390 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 protein_id gnl|my_center|LOCUS_09550 392429 393262 gene locus_tag LOCUS_09560 392429 393262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 395191 393275 gene locus_tag LOCUS_09570 gene uup 395191 393275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 protein_id gnl|my_center|LOCUS_09570 396066 395194 gene locus_tag LOCUS_09580 396066 395194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 397190 396066 gene locus_tag LOCUS_09590 gene mrdB 397190 396066 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189171.1 protein_id gnl|my_center|LOCUS_09590 399100 397187 gene locus_tag LOCUS_09600 gene mrdA 399100 397187 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204769.1 protein_id gnl|my_center|LOCUS_09600 399621 399097 gene locus_tag LOCUS_09610 gene mreD 399621 399097 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189260.1 protein_id gnl|my_center|LOCUS_09610 400441 399611 gene locus_tag LOCUS_09620 400441 399611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 401637 400594 gene locus_tag LOCUS_09630 gene mreB 401637 400594 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189550.1 protein_id gnl|my_center|LOCUS_09630 401871 402170 gene locus_tag LOCUS_09640 gene gatC 401871 402170 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MNM0 protein_id gnl|my_center|LOCUS_09640 402259 403755 gene locus_tag LOCUS_09650 gene gatA 402259 403755 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YJ9 protein_id gnl|my_center|LOCUS_09650 403769 405208 gene locus_tag LOCUS_09660 gene gatB 403769 405208 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSN3 protein_id gnl|my_center|LOCUS_09660 406561 405779 gene locus_tag LOCUS_09670 gene exoA 406561 405779 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225717.1 protein_id gnl|my_center|LOCUS_09670 406701 407291 gene locus_tag LOCUS_09680 gene pyrE 406701 407291 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PB11 protein_id gnl|my_center|LOCUS_09680 407578 407294 gene locus_tag LOCUS_09690 407578 407294 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0L0 protein_id gnl|my_center|LOCUS_09690 408773 407583 gene locus_tag LOCUS_09700 408773 407583 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807138.1 protein_id gnl|my_center|LOCUS_09700 409460 408822 gene locus_tag LOCUS_09710 409460 408822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522936.1 protein_id gnl|my_center|LOCUS_09710 409768 409457 gene locus_tag LOCUS_09720 409768 409457 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_09720 410901 409810 gene locus_tag LOCUS_09730 410901 409810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 411045 411797 gene locus_tag LOCUS_09740 gene birA 411045 411797 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064732.1 protein_id gnl|my_center|LOCUS_09740 411812 412627 gene locus_tag LOCUS_09750 gene coaX 411812 412627 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MZ8 protein_id gnl|my_center|LOCUS_09750 412624 413343 gene locus_tag LOCUS_09760 412624 413343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 414444 413347 gene locus_tag LOCUS_09770 414444 413347 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204258.1 protein_id gnl|my_center|LOCUS_09770 414562 415335 gene locus_tag LOCUS_09780 414562 415335 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_09780 415332 415736 gene locus_tag LOCUS_09790 gene folB 415332 415736 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199336.1 protein_id gnl|my_center|LOCUS_09790 415739 416611 gene locus_tag LOCUS_09800 gene ttcA 415739 416611 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Y74 protein_id gnl|my_center|LOCUS_09800 418368 416848 gene locus_tag LOCUS_09810 gene ilvA 418368 416848 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7U9 protein_id gnl|my_center|LOCUS_09810 418542 419120 gene locus_tag LOCUS_09820 418542 419120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 419126 419767 gene locus_tag LOCUS_09830 gene dsbA 419126 419767 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C2B2 protein_id gnl|my_center|LOCUS_09830 419787 420767 gene locus_tag LOCUS_09840 419787 420767 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815184.1 protein_id gnl|my_center|LOCUS_09840 420815 421351 gene locus_tag LOCUS_09850 gene hslV 420815 421351 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P967 protein_id gnl|my_center|LOCUS_09850 421348 422679 gene locus_tag LOCUS_09860 gene hslU 421348 422679 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YI4 protein_id gnl|my_center|LOCUS_09860 422769 423656 gene locus_tag LOCUS_09870 gene argB 422769 423656 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8D6 protein_id gnl|my_center|LOCUS_09870 423698 424363 gene locus_tag LOCUS_09880 423698 424363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 424364 425635 gene locus_tag LOCUS_09890 424364 425635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WKS7 protein_id gnl|my_center|LOCUS_09890 425652 427019 gene locus_tag LOCUS_09900 gene glmU 425652 427019 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ML13 protein_id gnl|my_center|LOCUS_09900 427036 428877 gene locus_tag LOCUS_09910 gene glmS 427036 428877 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7J4 protein_id gnl|my_center|LOCUS_09910 429685 428864 gene locus_tag LOCUS_09920 429685 428864 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729627.1 protein_id gnl|my_center|LOCUS_09920 429811 430842 gene locus_tag LOCUS_09930 429811 430842 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114843.1 protein_id gnl|my_center|LOCUS_09930 432006 430783 gene locus_tag LOCUS_09940 gene ampG 432006 430783 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167629.1 protein_id gnl|my_center|LOCUS_09940 432057 432142 gene locus_tag LOCUS_t00170 432057 432142 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 432196 432269 gene locus_tag LOCUS_t00180 432196 432269 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 432287 432361 gene locus_tag LOCUS_t00190 432287 432361 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence03 971 420 gene locus_tag LOCUS_09950 971 420 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4D4 protein_id gnl|my_center|LOCUS_09950 1408 998 gene locus_tag LOCUS_09960 1408 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104529.1 protein_id gnl|my_center|LOCUS_09960 2741 1443 gene locus_tag LOCUS_09970 2741 1443 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_09970 4484 2910 gene locus_tag LOCUS_09980 4484 2910 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705199.1 protein_id gnl|my_center|LOCUS_09980 5428 4502 gene locus_tag LOCUS_09990 5428 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704779.1 protein_id gnl|my_center|LOCUS_09990 6349 5441 gene locus_tag LOCUS_10000 6349 5441 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705201.1 protein_id gnl|my_center|LOCUS_10000 6434 7039 gene locus_tag LOCUS_10010 6434 7039 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163161.1 protein_id gnl|my_center|LOCUS_10010 7115 11752 gene locus_tag LOCUS_10020 7115 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 11833 12369 gene locus_tag LOCUS_10030 11833 12369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 13095 12382 gene locus_tag LOCUS_10040 13095 12382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 13614 13099 gene locus_tag LOCUS_10050 13614 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 14219 13611 gene locus_tag LOCUS_10060 14219 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088431.1 protein_id gnl|my_center|LOCUS_10060 14875 14225 gene locus_tag LOCUS_10070 14875 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088432.1 protein_id gnl|my_center|LOCUS_10070 15915 15004 gene locus_tag LOCUS_10080 15915 15004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 16174 17331 gene locus_tag LOCUS_10090 16174 17331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 17321 18049 gene locus_tag LOCUS_10100 17321 18049 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_10100 18187 19143 gene locus_tag LOCUS_10110 18187 19143 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528641.1 protein_id gnl|my_center|LOCUS_10110 19249 21351 gene locus_tag LOCUS_10120 19249 21351 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336882.1 protein_id gnl|my_center|LOCUS_10120 21348 21743 gene locus_tag LOCUS_10130 21348 21743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528643.1 protein_id gnl|my_center|LOCUS_10130 22552 22250 gene locus_tag LOCUS_10140 22552 22250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 22809 22558 gene locus_tag LOCUS_10150 22809 22558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 24077 22776 gene locus_tag LOCUS_10160 24077 22776 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_10160 25921 24074 gene locus_tag LOCUS_10170 25921 24074 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_10170 26368 25952 gene locus_tag LOCUS_10180 26368 25952 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_10180 27508 26636 gene locus_tag LOCUS_10190 27508 26636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 28008 27553 gene locus_tag LOCUS_10200 gene exaB 28008 27553 CDS product cytochrome c-550 PedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113462.1 protein_id gnl|my_center|LOCUS_10200 28331 30739 gene locus_tag LOCUS_10210 28331 30739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 31089 32279 gene locus_tag LOCUS_10220 31089 32279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 32668 33600 gene locus_tag LOCUS_10230 gene pqqB 32668 33600 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A81 protein_id gnl|my_center|LOCUS_10230 33597 34322 gene locus_tag LOCUS_10240 gene pqqC 33597 34322 CDS product pyrroloquinoline-quinone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88A82 protein_id gnl|my_center|LOCUS_10240 34319 34600 gene locus_tag LOCUS_10250 gene pqqD 34319 34600 CDS product coenzyme PQQ synthesis protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C1 protein_id gnl|my_center|LOCUS_10250 34597 35793 gene locus_tag LOCUS_10260 gene pqqE 34597 35793 CDS product coenzyme PQQ synthesis protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2C0 protein_id gnl|my_center|LOCUS_10260 35790 36575 gene locus_tag LOCUS_10270 35790 36575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 36559 37395 gene locus_tag LOCUS_10280 36559 37395 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UGG1 protein_id gnl|my_center|LOCUS_10280 37472 38293 gene locus_tag LOCUS_10290 37472 38293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 40297 38546 gene locus_tag LOCUS_10300 40297 38546 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706388.1 protein_id gnl|my_center|LOCUS_10300 41585 40596 gene locus_tag LOCUS_10310 41585 40596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 42433 41582 gene locus_tag LOCUS_10320 42433 41582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 42500 43576 gene locus_tag LOCUS_10330 42500 43576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 43721 44665 gene locus_tag LOCUS_10340 43721 44665 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766467.1 protein_id gnl|my_center|LOCUS_10340 44724 45944 gene locus_tag LOCUS_10350 44724 45944 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094632.1 protein_id gnl|my_center|LOCUS_10350 46121 45960 gene locus_tag LOCUS_10360 46121 45960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 47238 46210 gene locus_tag LOCUS_10370 47238 46210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 48379 47315 gene locus_tag LOCUS_10380 48379 47315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 49794 48379 gene locus_tag LOCUS_10390 49794 48379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895673.1 protein_id gnl|my_center|LOCUS_10390 50977 49808 gene locus_tag LOCUS_10400 gene icmP 50977 49808 CDS product insulin-cleaving metalloproteinase outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112765.1 protein_id gnl|my_center|LOCUS_10400 53675 51120 gene locus_tag LOCUS_10410 53675 51120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 53892 55718 gene locus_tag LOCUS_10420 53892 55718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 55776 56498 gene locus_tag LOCUS_10430 55776 56498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 56485 57087 gene locus_tag LOCUS_10440 56485 57087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 59156 57084 gene locus_tag LOCUS_10450 59156 57084 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460644.1 protein_id gnl|my_center|LOCUS_10450 59368 60126 gene locus_tag LOCUS_10460 gene mphE 59368 60126 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038164.1 protein_id gnl|my_center|LOCUS_10460 60128 61285 gene locus_tag LOCUS_10470 60128 61285 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038166.1 protein_id gnl|my_center|LOCUS_10470 61282 62988 gene locus_tag LOCUS_10480 61282 62988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638399.2 protein_id gnl|my_center|LOCUS_10480 62985 64193 gene locus_tag LOCUS_10490 gene yceE 62985 64193 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038168.1 protein_id gnl|my_center|LOCUS_10490 64151 65905 gene locus_tag LOCUS_10500 gene iucA 64151 65905 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038169.1 protein_id gnl|my_center|LOCUS_10500 65874 67049 gene locus_tag LOCUS_10510 65874 67049 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460650.1 protein_id gnl|my_center|LOCUS_10510 67265 67065 gene locus_tag LOCUS_10520 67265 67065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 67853 67377 gene locus_tag LOCUS_10530 gene bfr 67853 67377 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WA94 protein_id gnl|my_center|LOCUS_10530 68242 68955 gene locus_tag LOCUS_10540 68242 68955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 68986 69705 gene locus_tag LOCUS_10550 68986 69705 CDS product bipolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525409.1 protein_id gnl|my_center|LOCUS_10550 69709 70122 gene locus_tag LOCUS_10560 69709 70122 CDS product biopolymer transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188495.1 protein_id gnl|my_center|LOCUS_10560 70434 71984 gene locus_tag LOCUS_10570 gene pgi 70434 71984 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUF4 protein_id gnl|my_center|LOCUS_10570 71984 72910 gene locus_tag LOCUS_10580 71984 72910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 73783 72929 gene locus_tag LOCUS_10590 73783 72929 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213148.1 protein_id gnl|my_center|LOCUS_10590 76450 73859 gene locus_tag LOCUS_10600 76450 73859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_10600 77733 76588 gene locus_tag LOCUS_10610 gene modC 77733 76588 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 protein_id gnl|my_center|LOCUS_10610 78423 77746 gene locus_tag LOCUS_10620 gene modB 78423 77746 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 protein_id gnl|my_center|LOCUS_10620 79155 78445 gene locus_tag LOCUS_10630 79155 78445 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095191.1 protein_id gnl|my_center|LOCUS_10630 79610 79179 gene locus_tag LOCUS_10640 79610 79179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114414.1 protein_id gnl|my_center|LOCUS_10640 80183 79614 gene locus_tag LOCUS_10650 80183 79614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 81259 80270 gene locus_tag LOCUS_10660 81259 80270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 81762 81340 gene locus_tag LOCUS_10670 gene ohr 81762 81340 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035519.1 protein_id gnl|my_center|LOCUS_10670 82277 81840 gene locus_tag LOCUS_10680 82277 81840 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268553.1 protein_id gnl|my_center|LOCUS_10680 83267 82401 gene locus_tag LOCUS_10690 83267 82401 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_10690 84008 83325 gene locus_tag LOCUS_10700 84008 83325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 84846 84022 gene locus_tag LOCUS_10710 84846 84022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338346.1 protein_id gnl|my_center|LOCUS_10710 85439 84846 gene locus_tag LOCUS_10720 85439 84846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 85576 86226 gene locus_tag LOCUS_10730 85576 86226 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229546.1 protein_id gnl|my_center|LOCUS_10730 86534 86298 gene locus_tag LOCUS_10740 86534 86298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 86488 87792 gene locus_tag LOCUS_10750 86488 87792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 88900 87797 gene locus_tag LOCUS_10760 gene phaC1 88900 87797 CDS product polyhydroxyalkanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207192.1 protein_id gnl|my_center|LOCUS_10760 91045 89012 gene locus_tag LOCUS_10770 91045 89012 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064497.1 protein_id gnl|my_center|LOCUS_10770 91221 92435 gene locus_tag LOCUS_10780 91221 92435 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454895.1 protein_id gnl|my_center|LOCUS_10780 92552 93550 gene locus_tag LOCUS_10790 92552 93550 CDS product catalase-related peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YW9 protein_id gnl|my_center|LOCUS_10790 93651 94253 gene locus_tag LOCUS_10800 gene drga 93651 94253 CDS product reductase DrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_10800 95388 94279 gene locus_tag LOCUS_10810 95388 94279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_10810 95569 96477 gene locus_tag LOCUS_10820 95569 96477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 98222 96600 gene locus_tag LOCUS_10830 98222 96600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 99488 98517 gene locus_tag LOCUS_10840 99488 98517 CDS product malate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 protein_id gnl|my_center|LOCUS_10840 100170 99496 gene locus_tag LOCUS_10850 100170 99496 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267698.1 protein_id gnl|my_center|LOCUS_10850 100532 100167 gene locus_tag LOCUS_10860 100532 100167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 101548 100532 gene locus_tag LOCUS_10870 101548 100532 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 protein_id gnl|my_center|LOCUS_10870 102333 101560 gene locus_tag LOCUS_10880 102333 101560 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 protein_id gnl|my_center|LOCUS_10880 103512 102343 gene locus_tag LOCUS_10890 103512 102343 CDS product putative acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701081.1 protein_id gnl|my_center|LOCUS_10890 104511 103621 gene locus_tag LOCUS_10900 104511 103621 CDS product putative quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4D3 protein_id gnl|my_center|LOCUS_10900 105155 104535 gene locus_tag LOCUS_10910 105155 104535 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165876.1 protein_id gnl|my_center|LOCUS_10910 105285 106199 gene locus_tag LOCUS_10920 105285 106199 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811380.1 protein_id gnl|my_center|LOCUS_10920 106497 107249 gene locus_tag LOCUS_10930 106497 107249 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_10930 107296 108222 gene locus_tag LOCUS_10940 107296 108222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 108219 109703 gene locus_tag LOCUS_10950 gene crtI 108219 109703 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_10950 109855 110643 gene locus_tag LOCUS_10960 109855 110643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 110636 111799 gene locus_tag LOCUS_10970 110636 111799 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_10970 112877 115081 gene locus_tag LOCUS_10980 112877 115081 CDS product catalase peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_10980 115245 116318 gene locus_tag LOCUS_10990 115245 116318 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036457.1 protein_id gnl|my_center|LOCUS_10990 117682 116324 gene locus_tag LOCUS_11000 117682 116324 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_11000 118442 117696 gene locus_tag LOCUS_11010 118442 117696 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105985.1 protein_id gnl|my_center|LOCUS_11010 120307 118448 gene locus_tag LOCUS_11020 120307 118448 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 protein_id gnl|my_center|LOCUS_11020 121946 120318 gene locus_tag LOCUS_11030 121946 120318 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 protein_id gnl|my_center|LOCUS_11030 122192 124312 gene locus_tag LOCUS_11040 122192 124312 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267792.1 protein_id gnl|my_center|LOCUS_11040 125505 124354 gene locus_tag LOCUS_11050 125505 124354 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEC6 protein_id gnl|my_center|LOCUS_11050 125729 126235 gene locus_tag LOCUS_11060 125729 126235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932933.1 protein_id gnl|my_center|LOCUS_11060 126240 126962 gene locus_tag LOCUS_11070 126240 126962 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_11070 127393 126959 gene locus_tag LOCUS_11080 127393 126959 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764777.1 protein_id gnl|my_center|LOCUS_11080 128325 127408 gene locus_tag LOCUS_11090 128325 127408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037665.1 protein_id gnl|my_center|LOCUS_11090 128949 128386 gene locus_tag LOCUS_11100 128949 128386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265691.1 protein_id gnl|my_center|LOCUS_11100 129809 129084 gene locus_tag LOCUS_11110 129809 129084 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919170.1 protein_id gnl|my_center|LOCUS_11110 131419 129806 gene locus_tag LOCUS_11120 131419 129806 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265692.1 protein_id gnl|my_center|LOCUS_11120 132638 131526 gene locus_tag LOCUS_11130 gene oprO 132638 131526 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037719.1 protein_id gnl|my_center|LOCUS_11130 133237 132872 gene locus_tag LOCUS_11140 133237 132872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 133569 133381 gene locus_tag LOCUS_11150 133569 133381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 135803 133653 gene locus_tag LOCUS_11160 135803 133653 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528966.1 protein_id gnl|my_center|LOCUS_11160 137221 135950 gene locus_tag LOCUS_11170 137221 135950 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891990.1 protein_id gnl|my_center|LOCUS_11170 137517 137233 gene locus_tag LOCUS_11180 137517 137233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891991.1 protein_id gnl|my_center|LOCUS_11180 138514 137498 gene locus_tag LOCUS_11190 138514 137498 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_11190 139086 138511 gene locus_tag LOCUS_11200 139086 138511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 140182 139106 gene locus_tag LOCUS_11210 140182 139106 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891989.1 protein_id gnl|my_center|LOCUS_11210 141131 140169 gene locus_tag LOCUS_11220 141131 140169 CDS product aliphatic nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729583.1 protein_id gnl|my_center|LOCUS_11220 141669 141187 gene locus_tag LOCUS_11230 141669 141187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 141945 143387 gene locus_tag LOCUS_11240 141945 143387 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708519.1 protein_id gnl|my_center|LOCUS_11240 144243 143347 gene locus_tag LOCUS_11250 144243 143347 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 protein_id gnl|my_center|LOCUS_11250 144734 144261 gene locus_tag LOCUS_11260 144734 144261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203374.1 protein_id gnl|my_center|LOCUS_11260 145156 144731 gene locus_tag LOCUS_11270 145156 144731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 145391 145233 gene locus_tag LOCUS_11280 145391 145233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 145957 145562 gene locus_tag LOCUS_11290 145957 145562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 146231 146647 gene locus_tag LOCUS_11300 146231 146647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 149125 146948 gene locus_tag LOCUS_11310 149125 146948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 149934 149197 gene locus_tag LOCUS_11320 149934 149197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 150525 150450 gene locus_tag LOCUS_t00200 150525 150450 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 150626 150550 gene locus_tag LOCUS_t00210 150626 150550 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 150782 150706 gene locus_tag LOCUS_t00220 150782 150706 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 150897 152606 gene locus_tag LOCUS_11330 150897 152606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 153954 152608 gene locus_tag LOCUS_11340 gene glmM 153954 152608 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V83 protein_id gnl|my_center|LOCUS_11340 154978 154034 gene locus_tag LOCUS_11350 154978 154034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 155834 154983 gene locus_tag LOCUS_11360 155834 154983 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F745 protein_id gnl|my_center|LOCUS_11360 158291 156399 gene locus_tag LOCUS_11370 gene ftsH 158291 156399 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFV2 protein_id gnl|my_center|LOCUS_11370 159109 158474 gene locus_tag LOCUS_11380 gene rlmE 159109 158474 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ56 protein_id gnl|my_center|LOCUS_11380 159138 159509 gene locus_tag LOCUS_11390 159138 159509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 159979 159506 gene locus_tag LOCUS_11400 159979 159506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 160506 160009 gene locus_tag LOCUS_11410 gene greA 160506 160009 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79GP1 protein_id gnl|my_center|LOCUS_11410 163798 160568 gene locus_tag LOCUS_11420 gene carB 163798 160568 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2C7 protein_id gnl|my_center|LOCUS_11420 165033 163858 gene locus_tag LOCUS_11430 gene carA 165033 163858 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIL5 protein_id gnl|my_center|LOCUS_11430 166022 165168 gene locus_tag LOCUS_11440 166022 165168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_11440 167048 166101 gene locus_tag LOCUS_11450 167048 166101 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003143867.1 protein_id gnl|my_center|LOCUS_11450 167139 167387 gene locus_tag LOCUS_11460 167139 167387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 167779 167390 gene locus_tag LOCUS_11470 167779 167390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_11470 167857 168438 gene locus_tag LOCUS_11480 167857 168438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 170276 168471 gene locus_tag LOCUS_11490 170276 168471 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533897.1 protein_id gnl|my_center|LOCUS_11490 171256 170327 gene locus_tag LOCUS_11500 gene etfA 171256 170327 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815622.1 protein_id gnl|my_center|LOCUS_11500 172016 171267 gene locus_tag LOCUS_11510 gene etfB 172016 171267 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064586.1 protein_id gnl|my_center|LOCUS_11510 172826 172140 gene locus_tag LOCUS_11520 172826 172140 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A2J2 protein_id gnl|my_center|LOCUS_11520 173746 172826 gene locus_tag LOCUS_11530 173746 172826 CDS product deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188957.1 protein_id gnl|my_center|LOCUS_11530 173853 174917 gene locus_tag LOCUS_11540 gene mltB 173853 174917 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926823.1 protein_id gnl|my_center|LOCUS_11540 175849 174926 gene locus_tag LOCUS_11550 gene cysM 175849 174926 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WH92 protein_id gnl|my_center|LOCUS_11550 177348 175903 gene locus_tag LOCUS_11560 gene cht1 177348 175903 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_11560 179003 177408 gene locus_tag LOCUS_11570 gene ubiB 179003 177408 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0G8 protein_id gnl|my_center|LOCUS_11570 179713 179000 gene locus_tag LOCUS_11580 179713 179000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064918.1 protein_id gnl|my_center|LOCUS_11580 180816 179791 gene locus_tag LOCUS_11590 180816 179791 CDS product transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940037.1 protein_id gnl|my_center|LOCUS_11590 181567 180827 gene locus_tag LOCUS_11600 gene ubiE 181567 180827 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PB61 protein_id gnl|my_center|LOCUS_11600 181999 181574 gene locus_tag LOCUS_11610 181999 181574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_11610 182183 182890 gene locus_tag LOCUS_11620 gene phoB 182183 182890 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815113.1 protein_id gnl|my_center|LOCUS_11620 182931 184283 gene locus_tag LOCUS_11630 gene phoR 182931 184283 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815115.1 protein_id gnl|my_center|LOCUS_11630 185194 184736 gene locus_tag LOCUS_11640 185194 184736 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925740.1 protein_id gnl|my_center|LOCUS_11640 189171 185191 gene locus_tag LOCUS_11650 189171 185191 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204849.1 protein_id gnl|my_center|LOCUS_11650 191042 189303 gene locus_tag LOCUS_11660 gene argS 191042 189303 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MY7 protein_id gnl|my_center|LOCUS_11660 192353 191100 gene locus_tag LOCUS_11670 192353 191100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974710.1 protein_id gnl|my_center|LOCUS_11670 192686 192378 gene locus_tag LOCUS_11680 192686 192378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118582.1 protein_id gnl|my_center|LOCUS_11680 193315 192683 gene locus_tag LOCUS_11690 193315 192683 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 protein_id gnl|my_center|LOCUS_11690 193698 193318 gene locus_tag LOCUS_11700 193698 193318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 194485 193739 gene locus_tag LOCUS_11710 194485 193739 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530562.1 protein_id gnl|my_center|LOCUS_11710 195032 194496 gene locus_tag LOCUS_11720 gene bar 195032 194496 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104495.1 protein_id gnl|my_center|LOCUS_11720 195606 195040 gene locus_tag LOCUS_11730 195606 195040 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBZ3 protein_id gnl|my_center|LOCUS_11730 196796 195603 gene locus_tag LOCUS_11740 gene cca 196796 195603 CDS product CCA-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q820V9 protein_id gnl|my_center|LOCUS_11740 197824 196838 gene locus_tag LOCUS_11750 197824 196838 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767387.1 protein_id gnl|my_center|LOCUS_11750 199418 197877 gene locus_tag LOCUS_11760 199418 197877 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 protein_id gnl|my_center|LOCUS_11760 200539 199598 gene locus_tag LOCUS_11770 200539 199598 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_11770 200971 201768 gene locus_tag LOCUS_11780 gene folE2 200971 201768 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DU0 protein_id gnl|my_center|LOCUS_11780 201956 203269 gene locus_tag LOCUS_11790 201956 203269 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942964.1 protein_id gnl|my_center|LOCUS_11790 203269 204087 gene locus_tag LOCUS_11800 203269 204087 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338709.1 protein_id gnl|my_center|LOCUS_11800 204084 205310 gene locus_tag LOCUS_11810 204084 205310 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919303.1 protein_id gnl|my_center|LOCUS_11810 205307 205876 gene locus_tag LOCUS_11820 205307 205876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267595.1 protein_id gnl|my_center|LOCUS_11820 205890 207287 gene locus_tag LOCUS_11830 205890 207287 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_11830 207284 207838 gene locus_tag LOCUS_11840 207284 207838 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407549.1 protein_id gnl|my_center|LOCUS_11840 207859 208665 gene locus_tag LOCUS_11850 207859 208665 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_11850 208652 209128 gene locus_tag LOCUS_11860 208652 209128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388486.1 protein_id gnl|my_center|LOCUS_11860 209272 210141 gene locus_tag LOCUS_11870 209272 210141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534300.1 protein_id gnl|my_center|LOCUS_11870 210156 210650 gene locus_tag LOCUS_11880 210156 210650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686901.1 protein_id gnl|my_center|LOCUS_11880 211804 210659 gene locus_tag LOCUS_11890 gene ynaI 211804 210659 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263282.1 protein_id gnl|my_center|LOCUS_11890 212368 211901 gene locus_tag LOCUS_11900 212368 211901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 213349 212414 gene locus_tag LOCUS_11910 213349 212414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189747.1 protein_id gnl|my_center|LOCUS_11910 216911 213324 gene locus_tag LOCUS_11920 216911 213324 CDS product indolepyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523124.1 protein_id gnl|my_center|LOCUS_11920 217775 217044 gene locus_tag LOCUS_11930 217775 217044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 218026 218208 gene locus_tag LOCUS_11940 218026 218208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 218226 218717 gene locus_tag LOCUS_11950 218226 218717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 218799 219710 gene locus_tag LOCUS_11960 218799 219710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 219707 221071 gene locus_tag LOCUS_11970 219707 221071 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199472.1 protein_id gnl|my_center|LOCUS_11970 221084 222283 gene locus_tag LOCUS_11980 221084 222283 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193624.1 protein_id gnl|my_center|LOCUS_11980 222280 223653 gene locus_tag LOCUS_11990 222280 223653 CDS product type II/IV secretion system ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521658.1 protein_id gnl|my_center|LOCUS_11990 223650 224558 gene locus_tag LOCUS_12000 223650 224558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 224569 225522 gene locus_tag LOCUS_12010 224569 225522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 225526 226353 gene locus_tag LOCUS_12020 225526 226353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 226350 226649 gene locus_tag LOCUS_12030 226350 226649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 226658 227641 gene locus_tag LOCUS_12040 226658 227641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 228741 227656 gene locus_tag LOCUS_12050 228741 227656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 228920 229198 gene locus_tag LOCUS_12060 228920 229198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 229685 229182 gene locus_tag LOCUS_12070 gene dsbB1 229685 229182 CDS product disulfide bond formation protein B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXC8 protein_id gnl|my_center|LOCUS_12070 230044 229691 gene locus_tag LOCUS_12080 230044 229691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 230173 231123 gene locus_tag LOCUS_12090 gene tal 230173 231123 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W00 protein_id gnl|my_center|LOCUS_12090 232367 231165 gene locus_tag LOCUS_12100 232367 231165 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809576.1 protein_id gnl|my_center|LOCUS_12100 233014 232379 gene locus_tag LOCUS_12110 gene recR 233014 232379 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UU6 protein_id gnl|my_center|LOCUS_12110 233356 233024 gene locus_tag LOCUS_12120 233356 233024 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6Z6 protein_id gnl|my_center|LOCUS_12120 235223 233373 gene locus_tag LOCUS_12130 235223 233373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 238637 235362 gene locus_tag LOCUS_12140 238637 235362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 240891 238630 gene locus_tag LOCUS_12150 240891 238630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 241302 241631 gene locus_tag LOCUS_12160 gene trx-2 241302 241631 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UQ3 protein_id gnl|my_center|LOCUS_12160 241756 243012 gene locus_tag LOCUS_12170 gene rho 241756 243012 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UV1 protein_id gnl|my_center|LOCUS_12170 243110 243715 gene locus_tag LOCUS_12180 243110 243715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190125.1 protein_id gnl|my_center|LOCUS_12180 243715 244593 gene locus_tag LOCUS_12190 243715 244593 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189948.1 protein_id gnl|my_center|LOCUS_12190 244596 245096 gene locus_tag LOCUS_12200 244596 245096 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_12200 246183 245104 gene locus_tag LOCUS_12210 246183 245104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206789.1 protein_id gnl|my_center|LOCUS_12210 246701 246180 gene locus_tag LOCUS_12220 246701 246180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 246735 247193 gene locus_tag LOCUS_12230 246735 247193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 249116 247314 gene locus_tag LOCUS_12240 249116 247314 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_12240 249389 249129 gene locus_tag LOCUS_12250 249389 249129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_12250 249673 252510 gene locus_tag LOCUS_12260 249673 252510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 252507 254102 gene locus_tag LOCUS_12270 252507 254102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 255183 254035 gene locus_tag LOCUS_12280 gene tgt 255183 254035 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTY9 protein_id gnl|my_center|LOCUS_12280 255356 255880 gene locus_tag LOCUS_12290 255356 255880 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189275.1 protein_id gnl|my_center|LOCUS_12290 256149 256376 gene locus_tag LOCUS_12300 256149 256376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 257308 256409 gene locus_tag LOCUS_12310 257308 256409 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087048.1 protein_id gnl|my_center|LOCUS_12310 257502 258287 gene locus_tag LOCUS_12320 gene pyrF 257502 258287 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK37 protein_id gnl|my_center|LOCUS_12320 258362 259066 gene locus_tag LOCUS_12330 258362 259066 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526208.1 protein_id gnl|my_center|LOCUS_12330 259080 260537 gene locus_tag LOCUS_12340 259080 260537 CDS product two-component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526207.1 protein_id gnl|my_center|LOCUS_12340 260577 261602 gene locus_tag LOCUS_12350 260577 261602 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189139.1 protein_id gnl|my_center|LOCUS_12350 261589 262089 gene locus_tag LOCUS_12360 gene ybeY 261589 262089 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0P7 protein_id gnl|my_center|LOCUS_12360 262182 262257 gene locus_tag LOCUS_t00230 262182 262257 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 262496 264700 gene locus_tag LOCUS_12370 262496 264700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 264712 266118 gene locus_tag LOCUS_12380 264712 266118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528441.1 protein_id gnl|my_center|LOCUS_12380 266783 266130 gene locus_tag LOCUS_12390 266783 266130 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385122.1 protein_id gnl|my_center|LOCUS_12390 268501 266819 gene locus_tag LOCUS_12400 268501 266819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 271202 268533 gene locus_tag LOCUS_12410 gene ndvB 271202 268533 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_12410 272136 271243 gene locus_tag LOCUS_12420 272136 271243 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289749.1 protein_id gnl|my_center|LOCUS_12420 273164 272133 gene locus_tag LOCUS_12430 273164 272133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 274338 273241 gene locus_tag LOCUS_12440 274338 273241 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_12440 274408 274857 gene locus_tag LOCUS_12450 274408 274857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 275005 275811 gene locus_tag LOCUS_12460 275005 275811 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 protein_id gnl|my_center|LOCUS_12460 275839 277197 gene locus_tag LOCUS_12470 275839 277197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 277223 277822 gene locus_tag LOCUS_12480 277223 277822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 277921 278796 gene locus_tag LOCUS_12490 gene phnD 277921 278796 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707869.1 protein_id gnl|my_center|LOCUS_12490 278851 279693 gene locus_tag LOCUS_12500 gene phnC1 278851 279693 CDS product phosphonates import ATP-binding protein PhnC 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYT0 protein_id gnl|my_center|LOCUS_12500 279690 280538 gene locus_tag LOCUS_12510 279690 280538 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113153.1 protein_id gnl|my_center|LOCUS_12510 280535 281356 gene locus_tag LOCUS_12520 280535 281356 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266574.1 protein_id gnl|my_center|LOCUS_12520 281369 282340 gene locus_tag LOCUS_12530 281369 282340 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931515.1 protein_id gnl|my_center|LOCUS_12530 283969 282731 gene locus_tag LOCUS_12540 283969 282731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205256.1 protein_id gnl|my_center|LOCUS_12540 284217 283969 gene locus_tag LOCUS_12550 284217 283969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 284203 285102 gene locus_tag LOCUS_12560 284203 285102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 285089 287374 gene locus_tag LOCUS_12570 285089 287374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 287386 288075 gene locus_tag LOCUS_12580 287386 288075 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277074.1 protein_id gnl|my_center|LOCUS_12580 288949 288578 gene locus_tag LOCUS_12590 288949 288578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 289460 289017 gene locus_tag LOCUS_12600 gene cynS 289460 289017 CDS product cyanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IA8 protein_id gnl|my_center|LOCUS_12600 290428 289457 gene locus_tag LOCUS_12610 gene nrtC 290428 289457 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088476.1 protein_id gnl|my_center|LOCUS_12610 291283 290435 gene locus_tag LOCUS_12620 gene nrtB 291283 290435 CDS product nitrate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088477.1 protein_id gnl|my_center|LOCUS_12620 292650 291289 gene locus_tag LOCUS_12630 gene nrtA 292650 291289 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088478.1 protein_id gnl|my_center|LOCUS_12630 293335 292679 gene locus_tag LOCUS_12640 293335 292679 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889231.1 protein_id gnl|my_center|LOCUS_12640 294111 293488 gene locus_tag LOCUS_12650 294111 293488 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_12650 295259 294108 gene locus_tag LOCUS_12660 295259 294108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 295484 296137 gene locus_tag LOCUS_12670 295484 296137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 296998 296258 gene locus_tag LOCUS_12680 296998 296258 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102071.1 protein_id gnl|my_center|LOCUS_12680 298406 297057 gene locus_tag LOCUS_12690 gene gdhA 298406 297057 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_12690 299239 298583 gene locus_tag LOCUS_12700 299239 298583 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073182.1 protein_id gnl|my_center|LOCUS_12700 299398 300063 gene locus_tag LOCUS_12710 299398 300063 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022718.1 protein_id gnl|my_center|LOCUS_12710 300177 301538 gene locus_tag LOCUS_12720 300177 301538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 301535 302581 gene locus_tag LOCUS_12730 301535 302581 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881460.1 protein_id gnl|my_center|LOCUS_12730 302587 305643 gene locus_tag LOCUS_12740 gene acrB5 302587 305643 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_12740 305702 306736 gene locus_tag LOCUS_12750 305702 306736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 306834 308258 gene locus_tag LOCUS_12760 306834 308258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 308255 310651 gene locus_tag LOCUS_12770 308255 310651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 311196 310846 gene locus_tag LOCUS_12780 311196 310846 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0H2 protein_id gnl|my_center|LOCUS_12780 311843 311193 gene locus_tag LOCUS_12790 gene queE 311843 311193 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9F0 protein_id gnl|my_center|LOCUS_12790 312753 312196 gene locus_tag LOCUS_12800 312753 312196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022607.1 protein_id gnl|my_center|LOCUS_12800 314145 312754 gene locus_tag LOCUS_12810 gene pgm 314145 312754 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532245.1 protein_id gnl|my_center|LOCUS_12810 314260 315093 gene locus_tag LOCUS_12820 gene apaH 314260 315093 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUS4 protein_id gnl|my_center|LOCUS_12820 315140 315610 gene locus_tag LOCUS_12830 315140 315610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 316422 315667 gene locus_tag LOCUS_12840 316422 315667 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186297.1 protein_id gnl|my_center|LOCUS_12840 317758 316442 gene locus_tag LOCUS_12850 gene pyrX 317758 316442 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RI3 protein_id gnl|my_center|LOCUS_12850 318751 317780 gene locus_tag LOCUS_12860 gene pyrB 318751 317780 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RI2 protein_id gnl|my_center|LOCUS_12860 319254 318748 gene locus_tag LOCUS_12870 gene pyrR 319254 318748 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185915.1 protein_id gnl|my_center|LOCUS_12870 319673 319251 gene locus_tag LOCUS_12880 gene yqgF 319673 319251 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z3V1 protein_id gnl|my_center|LOCUS_12880 320273 319689 gene locus_tag LOCUS_12890 320273 319689 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62I86 protein_id gnl|my_center|LOCUS_12890 320441 321868 gene locus_tag LOCUS_12900 320441 321868 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_12900 321968 322372 gene locus_tag LOCUS_12910 321968 322372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 322548 324494 gene locus_tag LOCUS_12920 gene estA 322548 324494 CDS product lipase/esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038255.1 protein_id gnl|my_center|LOCUS_12920 325841 324546 gene locus_tag LOCUS_12930 gene hemL 325841 324546 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P812 protein_id gnl|my_center|LOCUS_12930 326523 325861 gene locus_tag LOCUS_12940 gene thiE 326523 325861 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87VY6 protein_id gnl|my_center|LOCUS_12940 327349 326513 gene locus_tag LOCUS_12950 327349 326513 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105183.1 protein_id gnl|my_center|LOCUS_12950 327442 327606 gene locus_tag LOCUS_12960 gene rubA 327442 327606 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W047 protein_id gnl|my_center|LOCUS_12960 327625 328995 gene locus_tag LOCUS_12970 327625 328995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 329915 328959 gene locus_tag LOCUS_12980 329915 328959 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_12980 330057 330260 gene locus_tag LOCUS_12990 330057 330260 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_12990 330283 331086 gene locus_tag LOCUS_13000 gene thiG 330283 331086 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTE5 protein_id gnl|my_center|LOCUS_13000 331083 331787 gene locus_tag LOCUS_13010 gene trmB 331083 331787 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA82 protein_id gnl|my_center|LOCUS_13010 331890 333887 gene locus_tag LOCUS_13020 331890 333887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 333998 335599 gene locus_tag LOCUS_13030 gene nadB 333998 335599 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WLQ0 protein_id gnl|my_center|LOCUS_13030 336922 336056 gene locus_tag LOCUS_13040 gene nadC 336922 336056 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536000.1 protein_id gnl|my_center|LOCUS_13040 338157 336919 gene locus_tag LOCUS_13050 gene nadA 338157 336919 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WH7 protein_id gnl|my_center|LOCUS_13050 338282 338869 gene locus_tag LOCUS_13060 338282 338869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 338981 339301 gene locus_tag LOCUS_13070 338981 339301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 339341 340546 gene locus_tag LOCUS_13080 339341 340546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 341977 340667 gene locus_tag LOCUS_13090 341977 340667 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_13090 344158 342242 gene locus_tag LOCUS_13100 gene thiC 344158 342242 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0D7 protein_id gnl|my_center|LOCUS_13100 344409 344999 gene locus_tag LOCUS_13110 344409 344999 CDS product ATP:cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_13110 347068 345005 gene locus_tag LOCUS_13120 347068 345005 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_13120 348930 347113 gene locus_tag LOCUS_13130 gene glnS 348930 347113 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU94 protein_id gnl|my_center|LOCUS_13130 350266 348977 gene locus_tag LOCUS_13140 gene dadA 350266 348977 CDS product D-amino acid dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040091.1 protein_id gnl|my_center|LOCUS_13140 351004 350564 gene locus_tag LOCUS_13150 gene mscL 351004 350564 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JH4 protein_id gnl|my_center|LOCUS_13150 351147 351872 gene locus_tag LOCUS_13160 351147 351872 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5N2 protein_id gnl|my_center|LOCUS_13160 351894 353165 gene locus_tag LOCUS_13170 gene purD 351894 353165 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJJ8 protein_id gnl|my_center|LOCUS_13170 353195 354106 gene locus_tag LOCUS_13180 gene hemF 353195 354106 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VT1 protein_id gnl|my_center|LOCUS_13180 354110 354760 gene locus_tag LOCUS_13190 gene nadD 354110 354760 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NN57 protein_id gnl|my_center|LOCUS_13190 354803 355225 gene locus_tag LOCUS_13200 354803 355225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 355241 355711 gene locus_tag LOCUS_13210 gene rlmH 355241 355711 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62II5 protein_id gnl|my_center|LOCUS_13210 355720 356391 gene locus_tag LOCUS_13220 355720 356391 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VT5 protein_id gnl|my_center|LOCUS_13220 356410 357888 gene locus_tag LOCUS_13230 gene cafA 356410 357888 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522445.1 protein_id gnl|my_center|LOCUS_13230 357895 359085 gene locus_tag LOCUS_13240 357895 359085 CDS product 8-amino-7-ketopelargonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MKM2 protein_id gnl|my_center|LOCUS_13240 359082 359837 gene locus_tag LOCUS_13250 359082 359837 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930771.1 protein_id gnl|my_center|LOCUS_13250 359859 360659 gene locus_tag LOCUS_13260 359859 360659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13260 360656 361273 gene locus_tag LOCUS_13270 360656 361273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13270 361286 362656 gene locus_tag LOCUS_13280 361286 362656 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_13280 362666 363661 gene locus_tag LOCUS_13290 gene bioB 362666 363661 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2N1 protein_id gnl|my_center|LOCUS_13290 363858 364214 gene locus_tag LOCUS_13300 363858 364214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 365500 364376 gene locus_tag LOCUS_13310 gene opcP 365500 364376 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184655.1 protein_id gnl|my_center|LOCUS_13310 366590 365793 gene locus_tag LOCUS_13320 366590 365793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 367723 366590 gene locus_tag LOCUS_13330 gene rfbU 367723 366590 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921719.1 protein_id gnl|my_center|LOCUS_13330 367862 368929 gene locus_tag LOCUS_13340 367862 368929 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094901.1 protein_id gnl|my_center|LOCUS_13340 370665 368902 gene locus_tag LOCUS_13350 gene msbA 370665 368902 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83D84 protein_id gnl|my_center|LOCUS_13350 370972 371769 gene locus_tag LOCUS_13360 370972 371769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 375306 371776 gene locus_tag LOCUS_13370 gene dnaE 375306 371776 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3A7 protein_id gnl|my_center|LOCUS_13370 375916 375356 gene locus_tag LOCUS_13380 375916 375356 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197907.1 protein_id gnl|my_center|LOCUS_13380 376648 375938 gene locus_tag LOCUS_13390 376648 375938 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568463.1 protein_id gnl|my_center|LOCUS_13390 376716 377657 gene locus_tag LOCUS_13400 376716 377657 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811174.1 protein_id gnl|my_center|LOCUS_13400 377670 378563 gene locus_tag LOCUS_13410 gene gluQ 377670 378563 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MPS7 protein_id gnl|my_center|LOCUS_13410 380267 378618 gene locus_tag LOCUS_13420 380267 378618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 381316 380387 gene locus_tag LOCUS_13430 381316 380387 CDS product putative 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45250 protein_id gnl|my_center|LOCUS_13430 383008 381431 gene locus_tag LOCUS_13440 383008 381431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 383174 383260 gene locus_tag LOCUS_t00240 383174 383260 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 383275 384363 gene locus_tag LOCUS_13450 gene queA 383275 384363 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MLW3 protein_id gnl|my_center|LOCUS_13450 384360 385235 gene locus_tag LOCUS_13460 384360 385235 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_13460 387243 385798 gene locus_tag LOCUS_13470 gene pntB 387243 385798 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P216 protein_id gnl|my_center|LOCUS_13470 387561 387268 gene locus_tag LOCUS_13480 gene pntAB 387561 387268 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083974.1 protein_id gnl|my_center|LOCUS_13480 388702 387575 gene locus_tag LOCUS_13490 gene pntAA 388702 387575 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 protein_id gnl|my_center|LOCUS_13490 388623 388826 gene locus_tag LOCUS_13500 388623 388826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 390897 388966 gene locus_tag LOCUS_13510 gene btuB 390897 388966 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071109.1 protein_id gnl|my_center|LOCUS_13510 391362 391877 gene locus_tag LOCUS_13520 391362 391877 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194031.1 protein_id gnl|my_center|LOCUS_13520 391883 392950 gene locus_tag LOCUS_13530 gene mnmA 391883 392950 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QY5 protein_id gnl|my_center|LOCUS_13530 393665 393054 gene locus_tag LOCUS_13540 393665 393054 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194148.1 protein_id gnl|my_center|LOCUS_13540 393857 395233 gene locus_tag LOCUS_13550 gene purB 393857 395233 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1A2 protein_id gnl|my_center|LOCUS_13550 395363 395809 gene locus_tag LOCUS_13560 395363 395809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 395829 396293 gene locus_tag LOCUS_13570 395829 396293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 396349 397002 gene locus_tag LOCUS_13580 396349 397002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 396999 397712 gene locus_tag LOCUS_13590 396999 397712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 397714 398241 gene locus_tag LOCUS_13600 397714 398241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 399173 398238 gene locus_tag LOCUS_13610 399173 398238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 400153 399200 gene locus_tag LOCUS_13620 gene secF 400153 399200 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P798 protein_id gnl|my_center|LOCUS_13620 402089 400185 gene locus_tag LOCUS_13630 gene secD 402089 400185 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MJ05 protein_id gnl|my_center|LOCUS_13630 402435 402100 gene locus_tag LOCUS_13640 402435 402100 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064323.1 protein_id gnl|my_center|LOCUS_13640 402578 403120 gene locus_tag LOCUS_13650 gene msrA 402578 403120 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_13650 403907 403110 gene locus_tag LOCUS_13660 403907 403110 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696991.1 protein_id gnl|my_center|LOCUS_13660 405028 403907 gene locus_tag LOCUS_13670 gene degP 405028 403907 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120947.1 protein_id gnl|my_center|LOCUS_13670 405711 405025 gene locus_tag LOCUS_13680 405711 405025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 406654 405659 gene locus_tag LOCUS_13690 406654 405659 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550815.1 protein_id gnl|my_center|LOCUS_13690 407125 406670 gene locus_tag LOCUS_13700 407125 406670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_13700 408033 407179 gene locus_tag LOCUS_13710 gene purU 408033 407179 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDM5 protein_id gnl|my_center|LOCUS_13710 409107 408070 gene locus_tag LOCUS_13720 gene rfaF 409107 408070 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 protein_id gnl|my_center|LOCUS_13720 409307 409104 gene locus_tag LOCUS_13730 409307 409104 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814195.1 protein_id gnl|my_center|LOCUS_13730 410234 409314 gene locus_tag LOCUS_13740 gene ilvE 410234 409314 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039182.1 protein_id gnl|my_center|LOCUS_13740 410377 411057 gene locus_tag LOCUS_13750 410377 411057 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088397.1 protein_id gnl|my_center|LOCUS_13750 411108 411776 gene locus_tag LOCUS_13760 gene pcm 411108 411776 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_13760 411784 413166 gene locus_tag LOCUS_13770 411784 413166 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815100.1 protein_id gnl|my_center|LOCUS_13770 414507 413179 gene locus_tag LOCUS_13780 gene kdtA 414507 413179 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185503.1 protein_id gnl|my_center|LOCUS_13780 415436 414504 gene locus_tag LOCUS_13790 415436 414504 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094906.1 protein_id gnl|my_center|LOCUS_13790 415556 416359 gene locus_tag LOCUS_13800 415556 416359 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence04 167 901 gene locus_tag LOCUS_13810 gene rsuA 167 901 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH89 protein_id gnl|my_center|LOCUS_13810 1011 1571 gene locus_tag LOCUS_13820 gene efp 1011 1571 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGI5 protein_id gnl|my_center|LOCUS_13820 1581 2705 gene locus_tag LOCUS_13830 1581 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203834.1 protein_id gnl|my_center|LOCUS_13830 2883 3437 gene locus_tag LOCUS_13840 2883 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4345 3449 gene locus_tag LOCUS_13850 gene xerC 4345 3449 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88B11 protein_id gnl|my_center|LOCUS_13850 4953 4312 gene locus_tag LOCUS_13860 4953 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5825 4950 gene locus_tag LOCUS_13870 gene dapF 5825 4950 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KL93 protein_id gnl|my_center|LOCUS_13870 6604 5858 gene locus_tag LOCUS_13880 6604 5858 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038711.1 protein_id gnl|my_center|LOCUS_13880 7583 6738 gene locus_tag LOCUS_13890 7583 6738 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807187.1 protein_id gnl|my_center|LOCUS_13890 7760 8926 gene locus_tag LOCUS_13900 gene metK 7760 8926 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YH5 protein_id gnl|my_center|LOCUS_13900 9117 10544 gene locus_tag LOCUS_13910 gene acyH 9117 10544 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M7Y2 protein_id gnl|my_center|LOCUS_13910 10561 11358 gene locus_tag LOCUS_13920 10561 11358 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125767.1 protein_id gnl|my_center|LOCUS_13920 11378 12199 gene locus_tag LOCUS_13930 gene metF 11378 12199 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PT4 protein_id gnl|my_center|LOCUS_13930 12513 12193 gene locus_tag LOCUS_13940 12513 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 12773 14752 gene locus_tag LOCUS_13950 12773 14752 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525894.1 protein_id gnl|my_center|LOCUS_13950 14772 15746 gene locus_tag LOCUS_13960 14772 15746 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_13960 15872 17053 gene locus_tag LOCUS_13970 gene argD 15872 17053 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MCV5 protein_id gnl|my_center|LOCUS_13970 17091 18002 gene locus_tag LOCUS_13980 gene argF 17091 18002 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WM2 protein_id gnl|my_center|LOCUS_13980 18038 19267 gene locus_tag LOCUS_13990 gene argG 18038 19267 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY84 protein_id gnl|my_center|LOCUS_13990 19406 20722 gene locus_tag LOCUS_14000 19406 20722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 21733 20690 gene locus_tag LOCUS_14010 gene murB 21733 20690 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X711 protein_id gnl|my_center|LOCUS_14010 21785 22270 gene locus_tag LOCUS_14020 21785 22270 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M78 protein_id gnl|my_center|LOCUS_14020 22299 22916 gene locus_tag LOCUS_14030 22299 22916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 22952 25666 gene locus_tag LOCUS_14040 gene pepN 22952 25666 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522336.1 protein_id gnl|my_center|LOCUS_14040 25697 26671 gene locus_tag LOCUS_14050 gene fbp 25697 26671 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU73 protein_id gnl|my_center|LOCUS_14050 28274 26682 gene locus_tag LOCUS_14060 28274 26682 CDS product exported protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814201.1 protein_id gnl|my_center|LOCUS_14060 28401 28874 gene locus_tag LOCUS_14070 gene moaC 28401 28874 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WV5 protein_id gnl|my_center|LOCUS_14070 29448 28915 gene locus_tag LOCUS_14080 gene pilE 29448 28915 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 protein_id gnl|my_center|LOCUS_14080 30481 29594 gene locus_tag LOCUS_14090 gene sucD 30481 29594 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WW1 protein_id gnl|my_center|LOCUS_14090 31737 30571 gene locus_tag LOCUS_14100 gene sucC 31737 30571 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WW2 protein_id gnl|my_center|LOCUS_14100 32566 32006 gene locus_tag LOCUS_14110 32566 32006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 33623 32544 gene locus_tag LOCUS_14120 gene recA 33623 32544 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MH0 protein_id gnl|my_center|LOCUS_14120 34183 33686 gene locus_tag LOCUS_14130 gene pncC 34183 33686 CDS product nicotinamide-nucleotide amidohydrolase PncC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83JZ0 protein_id gnl|my_center|LOCUS_14130 34667 34200 gene locus_tag LOCUS_14140 34667 34200 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QR3 protein_id gnl|my_center|LOCUS_14140 35779 34703 gene locus_tag LOCUS_14150 gene thiL 35779 34703 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG5 protein_id gnl|my_center|LOCUS_14150 36271 35795 gene locus_tag LOCUS_14160 gene nusB 36271 35795 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P705 protein_id gnl|my_center|LOCUS_14160 36770 36264 gene locus_tag LOCUS_14170 gene ribH 36770 36264 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HV4 protein_id gnl|my_center|LOCUS_14170 37891 36767 gene locus_tag LOCUS_14180 gene ribB 37891 36767 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808597.1 protein_id gnl|my_center|LOCUS_14180 39451 37916 gene locus_tag LOCUS_14190 gene lnt 39451 37916 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MLX3 protein_id gnl|my_center|LOCUS_14190 40365 39451 gene locus_tag LOCUS_14200 gene corC 40365 39451 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189366.1 protein_id gnl|my_center|LOCUS_14200 41817 40477 gene locus_tag LOCUS_14210 gene miaB 41817 40477 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2L3 protein_id gnl|my_center|LOCUS_14210 41980 42657 gene locus_tag LOCUS_14220 gene coq7 41980 42657 CDS product 2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GR7 protein_id gnl|my_center|LOCUS_14220 43076 42654 gene locus_tag LOCUS_14230 43076 42654 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549988.1 protein_id gnl|my_center|LOCUS_14230 43612 44040 gene locus_tag LOCUS_14240 gene rplM 43612 44040 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QW3 protein_id gnl|my_center|LOCUS_14240 44049 44441 gene locus_tag LOCUS_14250 gene rpsI 44049 44441 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MK12 protein_id gnl|my_center|LOCUS_14250 44542 45585 gene locus_tag LOCUS_14260 gene argC 44542 45585 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUW0 protein_id gnl|my_center|LOCUS_14260 45605 46321 gene locus_tag LOCUS_14270 45605 46321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 46337 46738 gene locus_tag LOCUS_14280 46337 46738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 46758 47111 gene locus_tag LOCUS_14290 gene erpA 46758 47111 CDS product putative iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HB8 protein_id gnl|my_center|LOCUS_14290 47181 48080 gene locus_tag LOCUS_14300 47181 48080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065020.1 protein_id gnl|my_center|LOCUS_14300 49080 48118 gene locus_tag LOCUS_14310 gene miaA 49080 48118 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R58 protein_id gnl|my_center|LOCUS_14310 50923 49091 gene locus_tag LOCUS_14320 gene mutL 50923 49091 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MB42 protein_id gnl|my_center|LOCUS_14320 52294 50954 gene locus_tag LOCUS_14330 gene amiC 52294 50954 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065017.1 protein_id gnl|my_center|LOCUS_14330 52795 52298 gene locus_tag LOCUS_14340 gene tsaE 52795 52298 CDS product tRNA threonylcarbamoyladenosine biosynthesis protein TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AF67 protein_id gnl|my_center|LOCUS_14340 52794 53879 gene locus_tag LOCUS_14350 gene queG 52794 53879 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUL4 protein_id gnl|my_center|LOCUS_14350 55014 53974 gene locus_tag LOCUS_14360 gene purM 55014 53974 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HE4 protein_id gnl|my_center|LOCUS_14360 55215 55916 gene locus_tag LOCUS_14370 55215 55916 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039150.1 protein_id gnl|my_center|LOCUS_14370 55897 56562 gene locus_tag LOCUS_14380 55897 56562 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_14380 56559 58025 gene locus_tag LOCUS_14390 gene pcnB 56559 58025 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R52 protein_id gnl|my_center|LOCUS_14390 58022 58504 gene locus_tag LOCUS_14400 gene folK 58022 58504 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194373.1 protein_id gnl|my_center|LOCUS_14400 58573 59220 gene locus_tag LOCUS_14410 58573 59220 CDS product deoxyguanosine kinase/deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_14410 59254 60084 gene locus_tag LOCUS_14420 gene panB 59254 60084 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9F9 protein_id gnl|my_center|LOCUS_14420 60092 60943 gene locus_tag LOCUS_14430 gene panC 60092 60943 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LE7 protein_id gnl|my_center|LOCUS_14430 60943 61323 gene locus_tag LOCUS_14440 gene panD 60943 61323 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62LE8 protein_id gnl|my_center|LOCUS_14440 61769 61506 gene locus_tag LOCUS_14450 61769 61506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 62878 61844 gene locus_tag LOCUS_14460 62878 61844 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VY35 protein_id gnl|my_center|LOCUS_14460 64040 62865 gene locus_tag LOCUS_14470 gene purK 64040 62865 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WU0 protein_id gnl|my_center|LOCUS_14470 64579 64058 gene locus_tag LOCUS_14480 gene purE 64579 64058 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJG5 protein_id gnl|my_center|LOCUS_14480 65480 64584 gene locus_tag LOCUS_14490 gene purC 65480 64584 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WU2 protein_id gnl|my_center|LOCUS_14490 66629 65565 gene locus_tag LOCUS_14500 gene cbbA 66629 65565 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064288.1 protein_id gnl|my_center|LOCUS_14500 68138 66660 gene locus_tag LOCUS_14510 gene pyk 68138 66660 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHR8 protein_id gnl|my_center|LOCUS_14510 69319 68138 gene locus_tag LOCUS_14520 gene pgk 69319 68138 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WLV8 protein_id gnl|my_center|LOCUS_14520 71962 69917 gene locus_tag LOCUS_14530 71962 69917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 73179 72169 gene locus_tag LOCUS_14540 gene hexC 73179 72169 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MH18 protein_id gnl|my_center|LOCUS_14540 75206 73206 gene locus_tag LOCUS_14550 gene tktA 75206 73206 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205244.1 protein_id gnl|my_center|LOCUS_14550 75344 76135 gene locus_tag LOCUS_14560 75344 76135 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZC1 protein_id gnl|my_center|LOCUS_14560 76138 77616 gene locus_tag LOCUS_14570 gene gabD 76138 77616 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810134.1 protein_id gnl|my_center|LOCUS_14570 77696 78622 gene locus_tag LOCUS_14580 gene glyQ 77696 78622 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIJ7 protein_id gnl|my_center|LOCUS_14580 78628 80712 gene locus_tag LOCUS_14590 gene glyS 78628 80712 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X70 protein_id gnl|my_center|LOCUS_14590 80725 81288 gene locus_tag LOCUS_14600 80725 81288 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8E8 protein_id gnl|my_center|LOCUS_14600 81315 82082 gene locus_tag LOCUS_14610 81315 82082 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_14610 82091 82843 gene locus_tag LOCUS_14620 82091 82843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204853.1 protein_id gnl|my_center|LOCUS_14620 82840 83226 gene locus_tag LOCUS_14630 82840 83226 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FS24 protein_id gnl|my_center|LOCUS_14630 83444 84454 gene locus_tag LOCUS_14640 gene dusB 83444 84454 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8G4 protein_id gnl|my_center|LOCUS_14640 84451 84705 gene locus_tag LOCUS_14650 gene fis 84451 84705 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194052.1 protein_id gnl|my_center|LOCUS_14650 84729 86321 gene locus_tag LOCUS_14660 gene purH 84729 86321 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HA6 protein_id gnl|my_center|LOCUS_14660 86349 86897 gene locus_tag LOCUS_14670 gene ruvC 86349 86897 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HA7 protein_id gnl|my_center|LOCUS_14670 86960 87550 gene locus_tag LOCUS_14680 gene ruvA 86960 87550 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PD92 protein_id gnl|my_center|LOCUS_14680 87566 88621 gene locus_tag LOCUS_14690 gene ruvB 87566 88621 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HA9 protein_id gnl|my_center|LOCUS_14690 90438 88879 gene locus_tag LOCUS_14700 90438 88879 CDS product putative diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67211 protein_id gnl|my_center|LOCUS_14700 90561 90965 gene locus_tag LOCUS_14710 90561 90965 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527641.1 protein_id gnl|my_center|LOCUS_14710 91009 91686 gene locus_tag LOCUS_14720 gene tolQ 91009 91686 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186467.1 protein_id gnl|my_center|LOCUS_14720 91742 92170 gene locus_tag LOCUS_14730 gene tolR 91742 92170 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194863.1 protein_id gnl|my_center|LOCUS_14730 92167 93078 gene locus_tag LOCUS_14740 92167 93078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 93093 94430 gene locus_tag LOCUS_14750 gene tolB 93093 94430 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8L0 protein_id gnl|my_center|LOCUS_14750 94500 95015 gene locus_tag LOCUS_14760 94500 95015 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814650.1 protein_id gnl|my_center|LOCUS_14760 95034 95780 gene locus_tag LOCUS_14770 95034 95780 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186614.1 protein_id gnl|my_center|LOCUS_14770 95866 96981 gene locus_tag LOCUS_14780 95866 96981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_14780 97039 97115 gene locus_tag LOCUS_t00250 97039 97115 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 97443 99734 gene locus_tag LOCUS_14790 97443 99734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 99721 100689 gene locus_tag LOCUS_14800 99721 100689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 102213 100675 gene locus_tag LOCUS_14810 102213 100675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 103622 102210 gene locus_tag LOCUS_14820 103622 102210 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267578.1 protein_id gnl|my_center|LOCUS_14820 104233 103619 gene locus_tag LOCUS_14830 gene fabR 104233 103619 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI38 protein_id gnl|my_center|LOCUS_14830 104638 105309 gene locus_tag LOCUS_14840 104638 105309 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061283.1 protein_id gnl|my_center|LOCUS_14840 105356 107158 gene locus_tag LOCUS_14850 105356 107158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 108286 107168 gene locus_tag LOCUS_14860 gene anmK 108286 107168 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QW9 protein_id gnl|my_center|LOCUS_14860 109698 108289 gene locus_tag LOCUS_14870 109698 108289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931221.1 protein_id gnl|my_center|LOCUS_14870 109808 111079 gene locus_tag LOCUS_14880 gene tyrS 109808 111079 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUW5 protein_id gnl|my_center|LOCUS_14880 111076 111801 gene locus_tag LOCUS_14890 gene gpmB 111076 111801 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 protein_id gnl|my_center|LOCUS_14890 111855 113111 gene locus_tag LOCUS_14900 gene glyA1 111855 113111 CDS product serine hydroxymethyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RB4 protein_id gnl|my_center|LOCUS_14900 113130 113639 gene locus_tag LOCUS_14910 gene nrdR 113130 113639 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MN60 protein_id gnl|my_center|LOCUS_14910 113645 114778 gene locus_tag LOCUS_14920 gene ribD 113645 114778 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V7S8 protein_id gnl|my_center|LOCUS_14920 114787 115416 gene locus_tag LOCUS_14930 gene ribE 114787 115416 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185756.1 protein_id gnl|my_center|LOCUS_14930 116182 115445 gene locus_tag LOCUS_14940 116182 115445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 117628 116246 gene locus_tag LOCUS_14950 117628 116246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 119137 117641 gene locus_tag LOCUS_14960 119137 117641 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQI8 protein_id gnl|my_center|LOCUS_14960 120418 119159 gene locus_tag LOCUS_14970 120418 119159 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929970.1 protein_id gnl|my_center|LOCUS_14970 122200 120440 gene locus_tag LOCUS_14980 122200 120440 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722110.1 protein_id gnl|my_center|LOCUS_14980 123502 122300 gene locus_tag LOCUS_14990 123502 122300 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536367.1 protein_id gnl|my_center|LOCUS_14990 125903 123588 gene locus_tag LOCUS_15000 gene maeB 125903 123588 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938729.1 protein_id gnl|my_center|LOCUS_15000 125994 127202 gene locus_tag LOCUS_15010 gene aspB 125994 127202 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKV4 protein_id gnl|my_center|LOCUS_15010 128072 127212 gene locus_tag LOCUS_15020 128072 127212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 128488 130071 gene locus_tag LOCUS_15030 gene ubiD 128488 130071 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RP1 protein_id gnl|my_center|LOCUS_15030 130459 130049 gene locus_tag LOCUS_15040 130459 130049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 130902 130456 gene locus_tag LOCUS_15050 130902 130456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 131204 130905 gene locus_tag LOCUS_15060 131204 130905 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200395.1 protein_id gnl|my_center|LOCUS_15060 132711 131305 gene locus_tag LOCUS_15070 132711 131305 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091272.1 protein_id gnl|my_center|LOCUS_15070 133428 132859 gene locus_tag LOCUS_15080 133428 132859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 133795 135588 gene locus_tag LOCUS_15090 gene deaD 133795 135588 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207765.1 protein_id gnl|my_center|LOCUS_15090 135785 137089 gene locus_tag LOCUS_15100 gene yadQ 135785 137089 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037785.1 protein_id gnl|my_center|LOCUS_15100 137116 137637 gene locus_tag LOCUS_15110 137116 137637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 138284 137616 gene locus_tag LOCUS_15120 gene dctR 138284 137616 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338585.1 protein_id gnl|my_center|LOCUS_15120 140262 138271 gene locus_tag LOCUS_15130 gene dctS 140262 138271 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338586.1 protein_id gnl|my_center|LOCUS_15130 140375 141403 gene locus_tag LOCUS_15140 140375 141403 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391425.1 protein_id gnl|my_center|LOCUS_15140 142293 141436 gene locus_tag LOCUS_15150 142293 141436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 142498 142788 gene locus_tag LOCUS_15160 gene groES-1 142498 142788 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WK66 protein_id gnl|my_center|LOCUS_15160 142818 144464 gene locus_tag LOCUS_15170 gene groL1 142818 144464 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F712 protein_id gnl|my_center|LOCUS_15170 146210 144543 gene locus_tag LOCUS_15180 146210 144543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 146445 146696 gene locus_tag LOCUS_15190 gene rpmE2 146445 146696 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JU1 protein_id gnl|my_center|LOCUS_15190 146802 148577 gene locus_tag LOCUS_15200 146802 148577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040117.1 protein_id gnl|my_center|LOCUS_15200 149192 148578 gene locus_tag LOCUS_15210 gene orn 149192 148578 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S41 protein_id gnl|my_center|LOCUS_15210 149284 150540 gene locus_tag LOCUS_15220 149284 150540 CDS product integral membrane zinc-metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039491.1 protein_id gnl|my_center|LOCUS_15220 150537 150917 gene locus_tag LOCUS_15230 gene phhB 150537 150917 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8Z8 protein_id gnl|my_center|LOCUS_15230 150910 151902 gene locus_tag LOCUS_15240 gene rsgA 150910 151902 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S39 protein_id gnl|my_center|LOCUS_15240 152894 151899 gene locus_tag LOCUS_15250 gene cobD 152894 151899 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHT1 protein_id gnl|my_center|LOCUS_15250 153509 152898 gene locus_tag LOCUS_15260 153509 152898 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550123.1 protein_id gnl|my_center|LOCUS_15260 154717 153527 gene locus_tag LOCUS_15270 154717 153527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527722.1 protein_id gnl|my_center|LOCUS_15270 156113 154725 gene locus_tag LOCUS_15280 156113 154725 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527721.1 protein_id gnl|my_center|LOCUS_15280 156811 156110 gene locus_tag LOCUS_15290 156811 156110 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225669.1 protein_id gnl|my_center|LOCUS_15290 157843 156812 gene locus_tag LOCUS_15300 157843 156812 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931410.1 protein_id gnl|my_center|LOCUS_15300 157942 160245 gene locus_tag LOCUS_15310 gene lptD 157942 160245 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDJ3 protein_id gnl|my_center|LOCUS_15310 160246 161625 gene locus_tag LOCUS_15320 gene surA 160246 161625 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X78 protein_id gnl|my_center|LOCUS_15320 161626 162645 gene locus_tag LOCUS_15330 gene pdxA 161626 162645 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WIH8 protein_id gnl|my_center|LOCUS_15330 162642 163418 gene locus_tag LOCUS_15340 gene rsmA 162642 163418 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MB25 protein_id gnl|my_center|LOCUS_15340 164239 163415 gene locus_tag LOCUS_15350 gene murI 164239 163415 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXW4 protein_id gnl|my_center|LOCUS_15350 164310 165086 gene locus_tag LOCUS_15360 164310 165086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 165125 165640 gene locus_tag LOCUS_15370 165125 165640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188247.1 protein_id gnl|my_center|LOCUS_15370 165985 165647 gene locus_tag LOCUS_15380 165985 165647 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383176.1 protein_id gnl|my_center|LOCUS_15380 167010 166012 gene locus_tag LOCUS_15390 167010 166012 CDS product cytochrome bd ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086510.1 protein_id gnl|my_center|LOCUS_15390 168418 167030 gene locus_tag LOCUS_15400 168418 167030 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 protein_id gnl|my_center|LOCUS_15400 168592 169764 gene locus_tag LOCUS_15410 168592 169764 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538642.1 protein_id gnl|my_center|LOCUS_15410 169914 170783 gene locus_tag LOCUS_15420 169914 170783 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929728.1 protein_id gnl|my_center|LOCUS_15420 170888 171184 gene locus_tag LOCUS_15430 170888 171184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 171258 172103 gene locus_tag LOCUS_15440 gene garR 171258 172103 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229027.1 protein_id gnl|my_center|LOCUS_15440 173458 172505 gene locus_tag LOCUS_15450 173458 172505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193435.1 protein_id gnl|my_center|LOCUS_15450 173571 174368 gene locus_tag LOCUS_15460 173571 174368 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ69 protein_id gnl|my_center|LOCUS_15460 174369 176048 gene locus_tag LOCUS_15470 174369 176048 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267700.1 protein_id gnl|my_center|LOCUS_15470 176049 176597 gene locus_tag LOCUS_15480 176049 176597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088003.1 protein_id gnl|my_center|LOCUS_15480 176600 177406 gene locus_tag LOCUS_15490 176600 177406 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_15490 177429 178352 gene locus_tag LOCUS_15500 gene cysD 177429 178352 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1B2 protein_id gnl|my_center|LOCUS_15500 178368 179717 gene locus_tag LOCUS_15510 gene cysN 178368 179717 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MG80 protein_id gnl|my_center|LOCUS_15510 179773 180546 gene locus_tag LOCUS_15520 179773 180546 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197965.1 protein_id gnl|my_center|LOCUS_15520 180946 180560 gene locus_tag LOCUS_15530 180946 180560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526300.1 protein_id gnl|my_center|LOCUS_15530 182148 180943 gene locus_tag LOCUS_15540 182148 180943 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191705.1 protein_id gnl|my_center|LOCUS_15540 183293 182145 gene locus_tag LOCUS_15550 183293 182145 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192178.1 protein_id gnl|my_center|LOCUS_15550 183395 184996 gene locus_tag LOCUS_15560 gene pepA 183395 184996 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WC3 protein_id gnl|my_center|LOCUS_15560 185008 185430 gene locus_tag LOCUS_15570 185008 185430 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193228.1 protein_id gnl|my_center|LOCUS_15570 185453 185683 gene locus_tag LOCUS_15580 185453 185683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 187309 185684 gene locus_tag LOCUS_15590 187309 185684 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267488.1 protein_id gnl|my_center|LOCUS_15590 187547 190426 gene locus_tag LOCUS_15600 gene valS 187547 190426 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TI8 protein_id gnl|my_center|LOCUS_15600 191466 190501 gene locus_tag LOCUS_15610 191466 190501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 191963 191484 gene locus_tag LOCUS_15620 191963 191484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 192688 192017 gene locus_tag LOCUS_15630 192688 192017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 192933 192706 gene locus_tag LOCUS_15640 192933 192706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_15640 193482 192970 gene locus_tag LOCUS_15650 193482 192970 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193543.1 protein_id gnl|my_center|LOCUS_15650 196146 193498 gene locus_tag LOCUS_15660 gene alaS 196146 193498 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TF9 protein_id gnl|my_center|LOCUS_15660 196920 196201 gene locus_tag LOCUS_15670 196920 196201 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957710.1 protein_id gnl|my_center|LOCUS_15670 197127 198314 gene locus_tag LOCUS_15680 197127 198314 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268489.1 protein_id gnl|my_center|LOCUS_15680 198315 199592 gene locus_tag LOCUS_15690 198315 199592 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805145.1 protein_id gnl|my_center|LOCUS_15690 199589 200851 gene locus_tag LOCUS_15700 199589 200851 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805146.1 protein_id gnl|my_center|LOCUS_15700 200848 202221 gene locus_tag LOCUS_15710 200848 202221 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805147.1 protein_id gnl|my_center|LOCUS_15710 202246 202563 gene locus_tag LOCUS_15720 202246 202563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 203034 202579 gene locus_tag LOCUS_15730 203034 202579 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7A0 protein_id gnl|my_center|LOCUS_15730 203169 204032 gene locus_tag LOCUS_15740 203169 204032 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 protein_id gnl|my_center|LOCUS_15740 204103 204990 gene locus_tag LOCUS_15750 204103 204990 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_15750 204987 205973 gene locus_tag LOCUS_15760 gene qor 204987 205973 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_15760 207006 206005 gene locus_tag LOCUS_15770 207006 206005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 207188 209389 gene locus_tag LOCUS_15780 207188 209389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 209386 209778 gene locus_tag LOCUS_15790 209386 209778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 209791 210528 gene locus_tag LOCUS_15800 209791 210528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 210622 212577 gene locus_tag LOCUS_15810 210622 212577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 212943 212578 gene locus_tag LOCUS_15820 212943 212578 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_15820 213061 213879 gene locus_tag LOCUS_15830 213061 213879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 216169 213890 gene locus_tag LOCUS_15840 216169 213890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 217142 216183 gene locus_tag LOCUS_15850 217142 216183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 217840 217325 gene locus_tag LOCUS_15860 217840 217325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 219048 217957 gene locus_tag LOCUS_15870 gene des6 219048 217957 CDS product linoleoyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118415.1 protein_id gnl|my_center|LOCUS_15870 220191 219079 gene locus_tag LOCUS_15880 220191 219079 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038954.1 protein_id gnl|my_center|LOCUS_15880 220651 220391 gene locus_tag LOCUS_15890 220651 220391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 220924 221328 gene locus_tag LOCUS_15900 220924 221328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 221450 221375 gene locus_tag LOCUS_t00260 221450 221375 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 224097 221470 gene locus_tag LOCUS_15910 gene rpoD 224097 221470 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JG1 protein_id gnl|my_center|LOCUS_15910 226038 224182 gene locus_tag LOCUS_15920 226038 224182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 226653 226180 gene locus_tag LOCUS_15930 226653 226180 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_15930 226862 226650 gene locus_tag LOCUS_15940 gene rpsU2 226862 226650 CDS product 30S ribosomal protein S21 B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DT5 protein_id gnl|my_center|LOCUS_15940 228257 227028 gene locus_tag LOCUS_15950 228257 227028 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190760.1 protein_id gnl|my_center|LOCUS_15950 229230 228244 gene locus_tag LOCUS_15960 229230 228244 CDS product DNA-binding protein YbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522867.1 protein_id gnl|my_center|LOCUS_15960 229357 231372 gene locus_tag LOCUS_15970 229357 231372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 234211 231374 gene locus_tag LOCUS_15980 234211 231374 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936224.1 protein_id gnl|my_center|LOCUS_15980 234589 234218 gene locus_tag LOCUS_15990 234589 234218 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936225.1 protein_id gnl|my_center|LOCUS_15990 237045 234589 gene locus_tag LOCUS_16000 237045 234589 CDS product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_16000 239234 237342 gene locus_tag LOCUS_16010 239234 237342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 239326 240420 gene locus_tag LOCUS_16020 gene gcp 239326 240420 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2B1 protein_id gnl|my_center|LOCUS_16020 241158 240991 gene locus_tag LOCUS_16030 241158 240991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 241090 241305 gene locus_tag LOCUS_16040 241090 241305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 241539 241970 gene locus_tag LOCUS_16050 241539 241970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 242004 243602 gene locus_tag LOCUS_16060 242004 243602 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546101.1 protein_id gnl|my_center|LOCUS_16060 243706 245196 gene locus_tag LOCUS_16070 gene glcD 243706 245196 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931193.1 protein_id gnl|my_center|LOCUS_16070 245209 246291 gene locus_tag LOCUS_16080 gene glcE 245209 246291 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_16080 246302 247552 gene locus_tag LOCUS_16090 gene glcF 246302 247552 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R29 protein_id gnl|my_center|LOCUS_16090 248156 247563 gene locus_tag LOCUS_16100 248156 247563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 249249 248236 gene locus_tag LOCUS_16110 249249 248236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 249857 249249 gene locus_tag LOCUS_16120 249857 249249 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 protein_id gnl|my_center|LOCUS_16120 250489 249854 gene locus_tag LOCUS_16130 gene pdxH 250489 249854 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN7 protein_id gnl|my_center|LOCUS_16130 250506 251456 gene locus_tag LOCUS_16140 gene xerD 250506 251456 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WM8 protein_id gnl|my_center|LOCUS_16140 251491 252099 gene locus_tag LOCUS_16150 gene plsY 251491 252099 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WM5 protein_id gnl|my_center|LOCUS_16150 255533 252096 gene locus_tag LOCUS_16160 255533 252096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 255593 255721 gene locus_tag LOCUS_16170 255593 255721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 256464 256030 gene locus_tag LOCUS_16180 256464 256030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 258251 256575 gene locus_tag LOCUS_16190 258251 256575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 263973 258322 gene locus_tag LOCUS_16200 gene uvrA2 263973 258322 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDQ5 protein_id gnl|my_center|LOCUS_16200 264550 264137 gene locus_tag LOCUS_16210 264550 264137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 264852 265724 gene locus_tag LOCUS_16220 264852 265724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 265782 266327 gene locus_tag LOCUS_16230 265782 266327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 266940 266365 gene locus_tag LOCUS_16240 266940 266365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 267518 266979 gene locus_tag LOCUS_16250 267518 266979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 268737 267673 gene locus_tag LOCUS_16260 gene aroG 268737 267673 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R35 protein_id gnl|my_center|LOCUS_16260 270527 269058 gene locus_tag LOCUS_16270 gene tldD 270527 269058 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194084.1 protein_id gnl|my_center|LOCUS_16270 271344 270538 gene locus_tag LOCUS_16280 271344 270538 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522140.1 protein_id gnl|my_center|LOCUS_16280 275356 271346 gene locus_tag LOCUS_16290 275356 271346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 275471 278188 gene locus_tag LOCUS_16300 gene glnE 275471 278188 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R39 protein_id gnl|my_center|LOCUS_16300 278944 278198 gene locus_tag LOCUS_16310 gene mtgA 278944 278198 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W039 protein_id gnl|my_center|LOCUS_16310 279840 278941 gene locus_tag LOCUS_16320 gene aroE 279840 278941 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QP8 protein_id gnl|my_center|LOCUS_16320 280689 279856 gene locus_tag LOCUS_16330 280689 279856 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931246.1 protein_id gnl|my_center|LOCUS_16330 282692 280686 gene locus_tag LOCUS_16340 282692 280686 CDS product ribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931245.1 protein_id gnl|my_center|LOCUS_16340 283264 282701 gene locus_tag LOCUS_16350 gene ubiC 283264 282701 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTK1 protein_id gnl|my_center|LOCUS_16350 283905 283261 gene locus_tag LOCUS_16360 283905 283261 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931244.1 protein_id gnl|my_center|LOCUS_16360 285299 283902 gene locus_tag LOCUS_16370 gene mpl 285299 283902 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WL33 protein_id gnl|my_center|LOCUS_16370 285362 285973 gene locus_tag LOCUS_16380 285362 285973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 285970 286467 gene locus_tag LOCUS_16390 285970 286467 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205249.1 protein_id gnl|my_center|LOCUS_16390 286685 287140 gene locus_tag LOCUS_16400 gene fabE 286685 287140 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814952.1 protein_id gnl|my_center|LOCUS_16400 287157 288506 gene locus_tag LOCUS_16410 gene fabG 287157 288506 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814951.1 protein_id gnl|my_center|LOCUS_16410 288515 289429 gene locus_tag LOCUS_16420 gene prmA 288515 289429 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MN81 protein_id gnl|my_center|LOCUS_16420 289452 290234 gene locus_tag LOCUS_16430 289452 290234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 290253 291209 gene locus_tag LOCUS_16440 290253 291209 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 protein_id gnl|my_center|LOCUS_16440 291230 291706 gene locus_tag LOCUS_16450 291230 291706 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194406.1 protein_id gnl|my_center|LOCUS_16450 292338 291769 gene locus_tag LOCUS_16460 292338 291769 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194943.1 protein_id gnl|my_center|LOCUS_16460 292637 292368 gene locus_tag LOCUS_16470 292637 292368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 292736 292981 gene locus_tag LOCUS_16480 292736 292981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 294438 292978 gene locus_tag LOCUS_16490 gene mymA 294438 292978 CDS product putative FAD-containing monooxygenase MymA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNF7 protein_id gnl|my_center|LOCUS_16490 294619 295518 gene locus_tag LOCUS_16500 294619 295518 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028960.1 protein_id gnl|my_center|LOCUS_16500 295676 296800 gene locus_tag LOCUS_16510 295676 296800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 297660 296809 gene locus_tag LOCUS_16520 297660 296809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 297979 297650 gene locus_tag LOCUS_16530 297979 297650 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6T5 protein_id gnl|my_center|LOCUS_16530 298330 299085 gene locus_tag LOCUS_16540 298330 299085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 299180 299620 gene locus_tag LOCUS_16550 299180 299620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096201.1 protein_id gnl|my_center|LOCUS_16550 299694 301337 gene locus_tag LOCUS_16560 299694 301337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 protein_id gnl|my_center|LOCUS_16560 301714 304092 gene locus_tag LOCUS_16570 301714 304092 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942009.1 protein_id gnl|my_center|LOCUS_16570 304237 304851 gene locus_tag LOCUS_16580 304237 304851 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_16580 305196 305471 gene locus_tag LOCUS_16590 305196 305471 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KM64 protein_id gnl|my_center|LOCUS_16590 305471 305812 gene locus_tag LOCUS_16600 305471 305812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 308977 305840 gene locus_tag LOCUS_16610 308977 305840 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028629.1 protein_id gnl|my_center|LOCUS_16610 309140 310183 gene locus_tag LOCUS_16620 309140 310183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 310323 311054 gene locus_tag LOCUS_16630 310323 311054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 311517 311035 gene locus_tag LOCUS_16640 311517 311035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086373.1 protein_id gnl|my_center|LOCUS_16640 312931 311684 gene locus_tag LOCUS_16650 gene nrdB 312931 311684 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUU0 protein_id gnl|my_center|LOCUS_16650 315937 313001 gene locus_tag LOCUS_16660 gene nrdA 315937 313001 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MK29 protein_id gnl|my_center|LOCUS_16660 316726 316163 gene locus_tag LOCUS_16670 gene ampD 316726 316163 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927521.1 protein_id gnl|my_center|LOCUS_16670 317000 316743 gene locus_tag LOCUS_16680 317000 316743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 317839 317000 gene locus_tag LOCUS_16690 317839 317000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538773.1 protein_id gnl|my_center|LOCUS_16690 317887 319284 gene locus_tag LOCUS_16700 gene ffh 317887 319284 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QM8 protein_id gnl|my_center|LOCUS_16700 319423 319671 gene locus_tag LOCUS_16710 319423 319671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 320411 319794 gene locus_tag LOCUS_16720 320411 319794 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_16720 322251 320491 gene locus_tag LOCUS_16730 gene proS 322251 320491 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QM5 protein_id gnl|my_center|LOCUS_16730 322356 322946 gene locus_tag LOCUS_16740 gene rppH 322356 322946 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MMW9 protein_id gnl|my_center|LOCUS_16740 323615 322983 gene locus_tag LOCUS_16750 323615 322983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 324067 323588 gene locus_tag LOCUS_16760 324067 323588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 325015 324158 gene locus_tag LOCUS_16770 325015 324158 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102328.1 protein_id gnl|my_center|LOCUS_16770 326158 325037 gene locus_tag LOCUS_16780 gene proB 326158 325037 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QM1 protein_id gnl|my_center|LOCUS_16780 327279 326164 gene locus_tag LOCUS_16790 gene obg 327279 326164 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QM0 protein_id gnl|my_center|LOCUS_16790 327674 327414 gene locus_tag LOCUS_16800 gene rpmA 327674 327414 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FD28 protein_id gnl|my_center|LOCUS_16800 328002 327691 gene locus_tag LOCUS_16810 gene rplU 328002 327691 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MD35 protein_id gnl|my_center|LOCUS_16810 328201 329193 gene locus_tag LOCUS_16820 gene ispB 328201 329193 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 protein_id gnl|my_center|LOCUS_16820 329294 330991 gene locus_tag LOCUS_16830 gene pilF 329294 330991 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221967.1 protein_id gnl|my_center|LOCUS_16830 331040 332278 gene locus_tag LOCUS_16840 gene pilC 331040 332278 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 protein_id gnl|my_center|LOCUS_16840 332275 333114 gene locus_tag LOCUS_16850 332275 333114 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MNB9 protein_id gnl|my_center|LOCUS_16850 333105 333749 gene locus_tag LOCUS_16860 gene coaE 333105 333749 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GU3 protein_id gnl|my_center|LOCUS_16860 333759 334631 gene locus_tag LOCUS_16870 gene zapD 333759 334631 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GU2 protein_id gnl|my_center|LOCUS_16870 335559 334606 gene locus_tag LOCUS_16880 335559 334606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064924.1 protein_id gnl|my_center|LOCUS_16880 336485 335580 gene locus_tag LOCUS_16890 336485 335580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194150.1 protein_id gnl|my_center|LOCUS_16890 337695 336466 gene locus_tag LOCUS_16900 gene argJ 337695 336466 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSW3 protein_id gnl|my_center|LOCUS_16900 340491 337732 gene locus_tag LOCUS_16910 gene secA 340491 337732 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PDA1 protein_id gnl|my_center|LOCUS_16910 341569 340592 gene locus_tag LOCUS_16920 341569 340592 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814565.1 protein_id gnl|my_center|LOCUS_16920 341641 342090 gene locus_tag LOCUS_16930 341641 342090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 343074 342154 gene locus_tag LOCUS_16940 gene lpxC 343074 342154 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QK4 protein_id gnl|my_center|LOCUS_16940 343722 343219 gene locus_tag LOCUS_16950 343722 343219 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064337.1 protein_id gnl|my_center|LOCUS_16950 345080 343911 gene locus_tag LOCUS_16960 gene ftsZ 345080 343911 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P969 protein_id gnl|my_center|LOCUS_16960 346393 345146 gene locus_tag LOCUS_16970 gene ftsA 346393 345146 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKB3 protein_id gnl|my_center|LOCUS_16970 347183 346404 gene locus_tag LOCUS_16980 gene ftsQ 347183 346404 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QK0 protein_id gnl|my_center|LOCUS_16980 348155 347184 gene locus_tag LOCUS_16990 gene ddlB 348155 347184 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBX0 protein_id gnl|my_center|LOCUS_16990 349552 348152 gene locus_tag LOCUS_17000 gene murC 349552 348152 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QJ8 protein_id gnl|my_center|LOCUS_17000 350622 349549 gene locus_tag LOCUS_17010 gene murG 350622 349549 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GS7 protein_id gnl|my_center|LOCUS_17010 351875 350619 gene locus_tag LOCUS_17020 gene ftsW 351875 350619 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKF0 protein_id gnl|my_center|LOCUS_17020 353347 351869 gene locus_tag LOCUS_17030 gene murD 353347 351869 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QJ5 protein_id gnl|my_center|LOCUS_17030 354529 353375 gene locus_tag LOCUS_17040 gene murX 354529 353375 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBW4 protein_id gnl|my_center|LOCUS_17040 355913 354519 gene locus_tag LOCUS_17050 gene murF 355913 354519 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QJ3 protein_id gnl|my_center|LOCUS_17050 357402 355906 gene locus_tag LOCUS_17060 357402 355906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 359153 357399 gene locus_tag LOCUS_17070 gene ftsI 359153 357399 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039091.1 protein_id gnl|my_center|LOCUS_17070 359427 359146 gene locus_tag LOCUS_17080 359427 359146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 360386 359415 gene locus_tag LOCUS_17090 gene rsmH 360386 359415 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QI9 protein_id gnl|my_center|LOCUS_17090 360790 360389 gene locus_tag LOCUS_17100 gene mraZ 360790 360389 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QI8 protein_id gnl|my_center|LOCUS_17100 362265 361378 gene locus_tag LOCUS_17110 362265 361378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 363406 362285 gene locus_tag LOCUS_17120 gene pyrC 363406 362285 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P951 protein_id gnl|my_center|LOCUS_17120 364819 363470 gene locus_tag LOCUS_17130 364819 363470 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972867.1 protein_id gnl|my_center|LOCUS_17130 364872 365675 gene locus_tag LOCUS_17140 364872 365675 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205980.1 protein_id gnl|my_center|LOCUS_17140 366644 365670 gene locus_tag LOCUS_17150 366644 365670 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_17150 366797 368041 gene locus_tag LOCUS_17160 366797 368041 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814551.1 protein_id gnl|my_center|LOCUS_17160 369081 368044 gene locus_tag LOCUS_17170 369081 368044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence05 1062 1385 gene locus_tag LOCUS_17180 1062 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1434 1637 gene locus_tag LOCUS_17190 1434 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2256 1651 gene locus_tag LOCUS_17200 2256 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2371 3513 gene locus_tag LOCUS_17210 gene acd 2371 3513 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224351.1 protein_id gnl|my_center|LOCUS_17210 3706 4398 gene locus_tag LOCUS_17220 3706 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 5213 4404 gene locus_tag LOCUS_17230 5213 4404 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88BA9 protein_id gnl|my_center|LOCUS_17230 5533 5210 gene locus_tag LOCUS_17240 5533 5210 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807250.1 protein_id gnl|my_center|LOCUS_17240 5630 6379 gene locus_tag LOCUS_17250 gene gly3 5630 6379 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206673.1 protein_id gnl|my_center|LOCUS_17250 6470 7063 gene locus_tag LOCUS_17260 6470 7063 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814256.1 protein_id gnl|my_center|LOCUS_17260 7139 7468 gene locus_tag LOCUS_17270 gene spb 7139 7468 CDS product trans-acting regulatory protein hvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331338.1 protein_id gnl|my_center|LOCUS_17270 9272 8061 gene locus_tag LOCUS_17280 gene metZ 9272 8061 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM6 protein_id gnl|my_center|LOCUS_17280 10690 9269 gene locus_tag LOCUS_17290 gene gltX 10690 9269 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCS7 protein_id gnl|my_center|LOCUS_17290 10813 11403 gene locus_tag LOCUS_17300 10813 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 11507 13741 gene locus_tag LOCUS_17310 11507 13741 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810151.1 protein_id gnl|my_center|LOCUS_17310 13741 14718 gene locus_tag LOCUS_17320 13741 14718 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810153.1 protein_id gnl|my_center|LOCUS_17320 14733 16130 gene locus_tag LOCUS_17330 14733 16130 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926305.1 protein_id gnl|my_center|LOCUS_17330 16135 17976 gene locus_tag LOCUS_17340 gene dppF 16135 17976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946429.1 protein_id gnl|my_center|LOCUS_17340 19128 17998 gene locus_tag LOCUS_17350 19128 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 20196 19423 gene locus_tag LOCUS_17360 gene gloB 20196 19423 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3G3 protein_id gnl|my_center|LOCUS_17360 20187 21005 gene locus_tag LOCUS_17370 20187 21005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_17370 21024 21479 gene locus_tag LOCUS_17380 gene rnhA 21024 21479 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MI74 protein_id gnl|my_center|LOCUS_17380 21476 22171 gene locus_tag LOCUS_17390 gene dnaQ 21476 22171 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531112.1 protein_id gnl|my_center|LOCUS_17390 22183 24480 gene locus_tag LOCUS_17400 22183 24480 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808566.1 protein_id gnl|my_center|LOCUS_17400 24481 26277 gene locus_tag LOCUS_17410 24481 26277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 26308 27087 gene locus_tag LOCUS_17420 26308 27087 CDS product cAMP phosphodiesterase class-II:metallo-beta-lactamase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_17420 27106 28758 gene locus_tag LOCUS_17430 27106 28758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 28770 34088 gene locus_tag LOCUS_17440 gene hmwA 28770 34088 CDS product adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208725.1 protein_id gnl|my_center|LOCUS_17440 34100 35572 gene locus_tag LOCUS_17450 34100 35572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 35590 37854 gene locus_tag LOCUS_17460 gene gidA 35590 37854 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 protein_id gnl|my_center|LOCUS_17460 40347 37885 gene locus_tag LOCUS_17470 40347 37885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 41700 40351 gene locus_tag LOCUS_17480 41700 40351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 45609 41704 gene locus_tag LOCUS_17490 45609 41704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 47854 45620 gene locus_tag LOCUS_17500 47854 45620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 49818 47851 gene locus_tag LOCUS_17510 49818 47851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 51389 49923 gene locus_tag LOCUS_17520 51389 49923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 52211 51396 gene locus_tag LOCUS_17530 52211 51396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 52341 53588 gene locus_tag LOCUS_17540 52341 53588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 53585 54907 gene locus_tag LOCUS_17550 53585 54907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 54910 55602 gene locus_tag LOCUS_17560 gene ccmC 54910 55602 CDS product heme export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_17560 55621 55794 gene locus_tag LOCUS_17570 55621 55794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 55787 56194 gene locus_tag LOCUS_17580 gene ccmE 55787 56194 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Z07 protein_id gnl|my_center|LOCUS_17580 56191 58182 gene locus_tag LOCUS_17590 56191 58182 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457778.1 protein_id gnl|my_center|LOCUS_17590 58179 58748 gene locus_tag LOCUS_17600 gene cycY 58179 58748 CDS product thiol:disulfide interchange protein CycY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30960 protein_id gnl|my_center|LOCUS_17600 58745 59161 gene locus_tag LOCUS_17610 58745 59161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 60877 59216 gene locus_tag LOCUS_17620 60877 59216 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814257.1 protein_id gnl|my_center|LOCUS_17620 62058 60916 gene locus_tag LOCUS_17630 62058 60916 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269384.1 protein_id gnl|my_center|LOCUS_17630 62321 63142 gene locus_tag LOCUS_17640 62321 63142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 64251 63196 gene locus_tag LOCUS_17650 64251 63196 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462750.1 protein_id gnl|my_center|LOCUS_17650 64770 64306 gene locus_tag LOCUS_17660 64770 64306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 65157 67652 gene locus_tag LOCUS_17670 65157 67652 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462399.1 protein_id gnl|my_center|LOCUS_17670 67767 69566 gene locus_tag LOCUS_17680 67767 69566 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009937746.1 protein_id gnl|my_center|LOCUS_17680 69761 71740 gene locus_tag LOCUS_17690 69761 71740 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814863.1 protein_id gnl|my_center|LOCUS_17690 71768 73024 gene locus_tag LOCUS_17700 71768 73024 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PC68 protein_id gnl|my_center|LOCUS_17700 73036 74502 gene locus_tag LOCUS_17710 73036 74502 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814858.1 protein_id gnl|my_center|LOCUS_17710 74492 75472 gene locus_tag LOCUS_17720 gene cobC 74492 75472 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103681.1 protein_id gnl|my_center|LOCUS_17720 75950 75483 gene locus_tag LOCUS_17730 75950 75483 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813677.1 protein_id gnl|my_center|LOCUS_17730 76383 75961 gene locus_tag LOCUS_17740 76383 75961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 76892 76404 gene locus_tag LOCUS_17750 76892 76404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 77449 76889 gene locus_tag LOCUS_17760 77449 76889 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204054.1 protein_id gnl|my_center|LOCUS_17760 77871 79583 gene locus_tag LOCUS_17770 gene ilvI 77871 79583 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9I7 protein_id gnl|my_center|LOCUS_17770 79599 80090 gene locus_tag LOCUS_17780 gene ilvH 79599 80090 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_17780 80147 81163 gene locus_tag LOCUS_17790 gene ilvC 80147 81163 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP6 protein_id gnl|my_center|LOCUS_17790 83308 81233 gene locus_tag LOCUS_17800 83308 81233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 83567 84211 gene locus_tag LOCUS_17810 gene psd 83567 84211 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP5 protein_id gnl|my_center|LOCUS_17810 84214 85032 gene locus_tag LOCUS_17820 gene pssA 84214 85032 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186682.1 protein_id gnl|my_center|LOCUS_17820 85347 86888 gene locus_tag LOCUS_17830 gene leuA 85347 86888 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VP3 protein_id gnl|my_center|LOCUS_17830 87024 87287 gene locus_tag LOCUS_17840 gene rpsO 87024 87287 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGT0 protein_id gnl|my_center|LOCUS_17840 87419 89563 gene locus_tag LOCUS_17850 gene pnp 87419 89563 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCR4 protein_id gnl|my_center|LOCUS_17850 89563 90594 gene locus_tag LOCUS_17860 89563 90594 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_17860 90624 91376 gene locus_tag LOCUS_17870 gene tpiA 90624 91376 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WKF6 protein_id gnl|my_center|LOCUS_17870 91384 91746 gene locus_tag LOCUS_17880 gene secG 91384 91746 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_17880 91768 91853 gene locus_tag LOCUS_t00270 91768 91853 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 91941 92300 gene locus_tag LOCUS_17890 gene nuoA 91941 92300 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PCU8 protein_id gnl|my_center|LOCUS_17890 92342 92818 gene locus_tag LOCUS_17900 gene nuoB1 92342 92818 CDS product NADH-quinone oxidoreductase subunit B 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VN2 protein_id gnl|my_center|LOCUS_17900 92831 93442 gene locus_tag LOCUS_17910 gene nuoC 92831 93442 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IN7 protein_id gnl|my_center|LOCUS_17910 93445 94698 gene locus_tag LOCUS_17920 gene nuoD 93445 94698 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VN0 protein_id gnl|my_center|LOCUS_17920 94714 95193 gene locus_tag LOCUS_17930 gene nuoE 94714 95193 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813932.1 protein_id gnl|my_center|LOCUS_17930 95190 96485 gene locus_tag LOCUS_17940 gene nuoF 95190 96485 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813930.1 protein_id gnl|my_center|LOCUS_17940 96506 98782 gene locus_tag LOCUS_17950 gene nuoG 96506 98782 CDS product NADH-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MLE8 protein_id gnl|my_center|LOCUS_17950 98779 99846 gene locus_tag LOCUS_17960 gene nuoH 98779 99846 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PE96 protein_id gnl|my_center|LOCUS_17960 99863 100354 gene locus_tag LOCUS_17970 gene nuoI 99863 100354 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZP7 protein_id gnl|my_center|LOCUS_17970 100385 101041 gene locus_tag LOCUS_17980 gene nuoJ 100385 101041 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_17980 101058 101363 gene locus_tag LOCUS_17990 gene nuoK 101058 101363 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IP5 protein_id gnl|my_center|LOCUS_17990 101371 103356 gene locus_tag LOCUS_18000 gene nuoL 101371 103356 CDS product NADH dehydrogenase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_18000 103397 104878 gene locus_tag LOCUS_18010 gene nuoM 103397 104878 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813918.1 protein_id gnl|my_center|LOCUS_18010 104886 106370 gene locus_tag LOCUS_18020 gene nuoN 104886 106370 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA26 protein_id gnl|my_center|LOCUS_18020 106403 106705 gene locus_tag LOCUS_18030 106403 106705 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813915.1 protein_id gnl|my_center|LOCUS_18030 106820 107254 gene locus_tag LOCUS_18040 106820 107254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 108958 107309 gene locus_tag LOCUS_18050 108958 107309 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193882.1 protein_id gnl|my_center|LOCUS_18050 109164 109871 gene locus_tag LOCUS_18060 109164 109871 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192091.1 protein_id gnl|my_center|LOCUS_18060 109885 110529 gene locus_tag LOCUS_18070 109885 110529 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813726.1 protein_id gnl|my_center|LOCUS_18070 110641 112287 gene locus_tag LOCUS_18080 gene pyrG 110641 112287 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VW76 protein_id gnl|my_center|LOCUS_18080 112314 113171 gene locus_tag LOCUS_18090 gene kdsA 112314 113171 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J09 protein_id gnl|my_center|LOCUS_18090 113221 114504 gene locus_tag LOCUS_18100 gene eno 113221 114504 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MIG8 protein_id gnl|my_center|LOCUS_18100 114632 114889 gene locus_tag LOCUS_18110 114632 114889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 115806 114886 gene locus_tag LOCUS_18120 gene hslO 115806 114886 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9P0 protein_id gnl|my_center|LOCUS_18120 116354 115830 gene locus_tag LOCUS_18130 116354 115830 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524734.1 protein_id gnl|my_center|LOCUS_18130 116433 117242 gene locus_tag LOCUS_18140 116433 117242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202011.1 protein_id gnl|my_center|LOCUS_18140 117258 118157 gene locus_tag LOCUS_18150 117258 118157 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_18150 118169 118825 gene locus_tag LOCUS_18160 118169 118825 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_18160 118825 119481 gene locus_tag LOCUS_18170 118825 119481 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809953.1 protein_id gnl|my_center|LOCUS_18170 119488 120525 gene locus_tag LOCUS_18180 gene trpS 119488 120525 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH36 protein_id gnl|my_center|LOCUS_18180 120527 121114 gene locus_tag LOCUS_18190 120527 121114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533965.1 protein_id gnl|my_center|LOCUS_18190 121115 121993 gene locus_tag LOCUS_18200 gene dapA 121115 121993 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFM6 protein_id gnl|my_center|LOCUS_18200 122018 123175 gene locus_tag LOCUS_18210 122018 123175 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064176.1 protein_id gnl|my_center|LOCUS_18210 123181 123999 gene locus_tag LOCUS_18220 123181 123999 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_18220 124348 124118 gene locus_tag LOCUS_18230 124348 124118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 125739 124588 gene locus_tag LOCUS_18240 125739 124588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931112.1 protein_id gnl|my_center|LOCUS_18240 125842 126390 gene locus_tag LOCUS_18250 125842 126390 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_18250 127420 126407 gene locus_tag LOCUS_18260 127420 126407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 129984 127420 gene locus_tag LOCUS_18270 gene mutS 129984 127420 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62J26 protein_id gnl|my_center|LOCUS_18270 130828 130061 gene locus_tag LOCUS_18280 gene suhB 130828 130061 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 protein_id gnl|my_center|LOCUS_18280 130959 131678 gene locus_tag LOCUS_18290 130959 131678 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039343.1 protein_id gnl|my_center|LOCUS_18290 131706 132539 gene locus_tag LOCUS_18300 gene cysE 131706 132539 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193377.1 protein_id gnl|my_center|LOCUS_18300 133410 132583 gene locus_tag LOCUS_18310 gene lpxH 133410 132583 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P558 protein_id gnl|my_center|LOCUS_18310 133974 133483 gene locus_tag LOCUS_18320 gene ppiB 133974 133483 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VX98 protein_id gnl|my_center|LOCUS_18320 135365 134097 gene locus_tag LOCUS_18330 135365 134097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 136484 135393 gene locus_tag LOCUS_18340 136484 135393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 136757 138082 gene locus_tag LOCUS_18350 gene cysS 136757 138082 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SS8 protein_id gnl|my_center|LOCUS_18350 138067 138744 gene locus_tag LOCUS_18360 138067 138744 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820119.1 protein_id gnl|my_center|LOCUS_18360 138754 139716 gene locus_tag LOCUS_18370 gene accA-1 138754 139716 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_274168.1 protein_id gnl|my_center|LOCUS_18370 139717 140685 gene locus_tag LOCUS_18380 139717 140685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 140696 141634 gene locus_tag LOCUS_18390 140696 141634 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972748.1 protein_id gnl|my_center|LOCUS_18390 141638 143317 gene locus_tag LOCUS_18400 141638 143317 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204537.1 protein_id gnl|my_center|LOCUS_18400 143802 143308 gene locus_tag LOCUS_18410 143802 143308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 143932 145671 gene locus_tag LOCUS_18420 143932 145671 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730303.1 protein_id gnl|my_center|LOCUS_18420 146520 145663 gene locus_tag LOCUS_18430 146520 145663 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 protein_id gnl|my_center|LOCUS_18430 147020 146556 gene locus_tag LOCUS_18440 147020 146556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206964.1 protein_id gnl|my_center|LOCUS_18440 147926 147351 gene locus_tag LOCUS_18450 147926 147351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 150254 148065 gene locus_tag LOCUS_18460 150254 148065 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459204.1 protein_id gnl|my_center|LOCUS_18460 151336 150356 gene locus_tag LOCUS_18470 151336 150356 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_18470 151595 153196 gene locus_tag LOCUS_18480 gene prfC 151595 153196 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7B0 protein_id gnl|my_center|LOCUS_18480 153261 153605 gene locus_tag LOCUS_18490 153261 153605 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143941.1 protein_id gnl|my_center|LOCUS_18490 153926 153672 gene locus_tag LOCUS_18500 153926 153672 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191359.1 protein_id gnl|my_center|LOCUS_18500 154613 153945 gene locus_tag LOCUS_18510 154613 153945 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203514.1 protein_id gnl|my_center|LOCUS_18510 156096 154768 gene locus_tag LOCUS_18520 156096 154768 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 protein_id gnl|my_center|LOCUS_18520 156539 156093 gene locus_tag LOCUS_18530 156539 156093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 156787 158772 gene locus_tag LOCUS_18540 156787 158772 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706128.1 protein_id gnl|my_center|LOCUS_18540 159792 158782 gene locus_tag LOCUS_18550 159792 158782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 161441 159798 gene locus_tag LOCUS_18560 161441 159798 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102870.1 protein_id gnl|my_center|LOCUS_18560 161978 161457 gene locus_tag LOCUS_18570 161978 161457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 163444 161990 gene locus_tag LOCUS_18580 gene calB 163444 161990 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YG5 protein_id gnl|my_center|LOCUS_18580 163710 164291 gene locus_tag LOCUS_18590 163710 164291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 164424 166115 gene locus_tag LOCUS_18600 gene rpfB 164424 166115 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 protein_id gnl|my_center|LOCUS_18600 166252 166656 gene locus_tag LOCUS_18610 gene rpsF 166252 166656 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JQ9 protein_id gnl|my_center|LOCUS_18610 166683 167033 gene locus_tag LOCUS_18620 gene priB 166683 167033 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFR6 protein_id gnl|my_center|LOCUS_18620 167059 167328 gene locus_tag LOCUS_18630 gene rpsR 167059 167328 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62JR1 protein_id gnl|my_center|LOCUS_18630 167347 167799 gene locus_tag LOCUS_18640 gene rplI 167347 167799 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UY3 protein_id gnl|my_center|LOCUS_18640 167922 169331 gene locus_tag LOCUS_18650 gene dnaB 167922 169331 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P253 protein_id gnl|my_center|LOCUS_18650 171083 169695 gene locus_tag LOCUS_18660 171083 169695 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931133.1 protein_id gnl|my_center|LOCUS_18660 171109 171369 gene locus_tag LOCUS_18670 171109 171369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 171888 171418 gene locus_tag LOCUS_18680 171888 171418 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521302.1 protein_id gnl|my_center|LOCUS_18680 172339 171968 gene locus_tag LOCUS_18690 172339 171968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192320.1 protein_id gnl|my_center|LOCUS_18690 172713 172336 gene locus_tag LOCUS_18700 172713 172336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 172776 174035 gene locus_tag LOCUS_18710 172776 174035 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527177.1 protein_id gnl|my_center|LOCUS_18710 173977 175356 gene locus_tag LOCUS_18720 173977 175356 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5G6 protein_id gnl|my_center|LOCUS_18720 175358 176773 gene locus_tag LOCUS_18730 gene thrC 175358 176773 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813072.1 protein_id gnl|my_center|LOCUS_18730 176838 178286 gene locus_tag LOCUS_18740 176838 178286 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 protein_id gnl|my_center|LOCUS_18740 178400 180433 gene locus_tag LOCUS_18750 gene atoS 178400 180433 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706864.1 protein_id gnl|my_center|LOCUS_18750 180435 180935 gene locus_tag LOCUS_18760 gene mobB 180435 180935 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085099.1 protein_id gnl|my_center|LOCUS_18760 180928 182148 gene locus_tag LOCUS_18770 gene moeA 180928 182148 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205013.1 protein_id gnl|my_center|LOCUS_18770 182145 182402 gene locus_tag LOCUS_18780 gene moaD 182145 182402 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLJ1 protein_id gnl|my_center|LOCUS_18780 182403 182870 gene locus_tag LOCUS_18790 gene moaE 182403 182870 CDS product molybdopterin converting factor subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_18790 182852 183250 gene locus_tag LOCUS_18800 gene crcB 182852 183250 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 protein_id gnl|my_center|LOCUS_18800 183964 183260 gene locus_tag LOCUS_18810 183964 183260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 184064 185476 gene locus_tag LOCUS_18820 gene glnA 184064 185476 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SK2 protein_id gnl|my_center|LOCUS_18820 185651 186163 gene locus_tag LOCUS_18830 185651 186163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 186176 187276 gene locus_tag LOCUS_18840 gene glnL 186176 187276 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532137.1 protein_id gnl|my_center|LOCUS_18840 187300 188877 gene locus_tag LOCUS_18850 gene ntrC 187300 188877 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192209.1 protein_id gnl|my_center|LOCUS_18850 190986 188956 gene locus_tag LOCUS_18860 190986 188956 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546024.1 protein_id gnl|my_center|LOCUS_18860 191976 191191 gene locus_tag LOCUS_18870 191976 191191 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546769.1 protein_id gnl|my_center|LOCUS_18870 194039 191976 gene locus_tag LOCUS_18880 194039 191976 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550186.1 protein_id gnl|my_center|LOCUS_18880 194928 194080 gene locus_tag LOCUS_18890 gene folD 194928 194080 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1Y9 protein_id gnl|my_center|LOCUS_18890 195656 195009 gene locus_tag LOCUS_18900 195656 195009 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811946.1 protein_id gnl|my_center|LOCUS_18900 197994 195667 gene locus_tag LOCUS_18910 197994 195667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 198225 200930 gene locus_tag LOCUS_18920 gene aceE 198225 200930 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MID8 protein_id gnl|my_center|LOCUS_18920 200945 202270 gene locus_tag LOCUS_18930 200945 202270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 202283 204064 gene locus_tag LOCUS_18940 gene lpdA 202283 204064 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZC3 protein_id gnl|my_center|LOCUS_18940 204340 204993 gene locus_tag LOCUS_18950 gene rpiA 204340 204993 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7Z2 protein_id gnl|my_center|LOCUS_18950 205140 205841 gene locus_tag LOCUS_18960 205140 205841 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930881.1 protein_id gnl|my_center|LOCUS_18960 206146 205838 gene locus_tag LOCUS_18970 206146 205838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 206520 206248 gene locus_tag LOCUS_18980 206520 206248 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SJ4 protein_id gnl|my_center|LOCUS_18980 207105 206536 gene locus_tag LOCUS_18990 207105 206536 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S46 protein_id gnl|my_center|LOCUS_18990 207996 207109 gene locus_tag LOCUS_19000 gene thyA 207996 207109 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CP33 protein_id gnl|my_center|LOCUS_19000 210098 208317 gene locus_tag LOCUS_19010 210098 208317 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084324.1 protein_id gnl|my_center|LOCUS_19010 211247 210117 gene locus_tag LOCUS_19020 211247 210117 CDS product carotenoid 1,2-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_19020 213802 211244 gene locus_tag LOCUS_19030 213802 211244 CDS product adhesion component ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915882.1 protein_id gnl|my_center|LOCUS_19030 214483 213806 gene locus_tag LOCUS_19040 214483 213806 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888822.1 protein_id gnl|my_center|LOCUS_19040 215276 214491 gene locus_tag LOCUS_19050 gene fabI 215276 214491 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBN2 protein_id gnl|my_center|LOCUS_19050 216535 215396 gene locus_tag LOCUS_19060 216535 215396 CDS product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387894.1 protein_id gnl|my_center|LOCUS_19060 217459 216542 gene locus_tag LOCUS_19070 217459 216542 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196438.1 protein_id gnl|my_center|LOCUS_19070 217849 217580 gene locus_tag LOCUS_19080 217849 217580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 217963 218039 gene locus_tag LOCUS_t00280 217963 218039 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 218142 218513 gene locus_tag LOCUS_19090 218142 218513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 218510 219286 gene locus_tag LOCUS_19100 218510 219286 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266956.1 protein_id gnl|my_center|LOCUS_19100 219658 219347 gene locus_tag LOCUS_19110 219658 219347 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370060.1 protein_id gnl|my_center|LOCUS_19110 219855 220589 gene locus_tag LOCUS_19120 219855 220589 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_19120 221356 220583 gene locus_tag LOCUS_19130 221356 220583 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_19130 221486 221614 gene locus_tag LOCUS_19140 221486 221614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 221734 223641 gene locus_tag LOCUS_19150 gene thrS 221734 223641 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KI2 protein_id gnl|my_center|LOCUS_19150 223720 224187 gene locus_tag LOCUS_19160 gene infC 223720 224187 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJ61 protein_id gnl|my_center|LOCUS_19160 224355 224552 gene locus_tag LOCUS_19170 gene rpmI 224355 224552 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MHF0 protein_id gnl|my_center|LOCUS_19170 224568 224924 gene locus_tag LOCUS_19180 gene rplT 224568 224924 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TM5 protein_id gnl|my_center|LOCUS_19180 225099 226106 gene locus_tag LOCUS_19190 gene pheS 225099 226106 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KI6 protein_id gnl|my_center|LOCUS_19190 226152 228584 gene locus_tag LOCUS_19200 gene pheT 226152 228584 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62KI7 protein_id gnl|my_center|LOCUS_19200 228611 228979 gene locus_tag LOCUS_19210 228611 228979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 229017 229400 gene locus_tag LOCUS_19220 229017 229400 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526841.1 protein_id gnl|my_center|LOCUS_19220 229428 229504 gene locus_tag LOCUS_t00290 229428 229504 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 230129 230428 gene locus_tag LOCUS_19230 230129 230428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 231272 230700 gene locus_tag LOCUS_19240 231272 230700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 231969 231247 gene locus_tag LOCUS_19250 231969 231247 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224580.1 protein_id gnl|my_center|LOCUS_19250 232086 233444 gene locus_tag LOCUS_19260 232086 233444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035375.1 protein_id gnl|my_center|LOCUS_19260 233441 235747 gene locus_tag LOCUS_19270 gene yihQ 233441 235747 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_709678.1 protein_id gnl|my_center|LOCUS_19270 235848 237314 gene locus_tag LOCUS_19280 235848 237314 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462079.1 protein_id gnl|my_center|LOCUS_19280 237311 238012 gene locus_tag LOCUS_19290 gene kdpE 237311 238012 CDS product two-component regulatory protein response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001007153.2 protein_id gnl|my_center|LOCUS_19290 238107 239996 gene locus_tag LOCUS_19300 gene kup 238107 239996 CDS product putative potassium transport system protein kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6E6 protein_id gnl|my_center|LOCUS_19300 241595 240066 gene locus_tag LOCUS_19310 241595 240066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_19310 241789 242010 gene locus_tag LOCUS_19320 241789 242010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764045.1 protein_id gnl|my_center|LOCUS_19320 242021 243265 gene locus_tag LOCUS_19330 242021 243265 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268944.1 protein_id gnl|my_center|LOCUS_19330 243985 243266 gene locus_tag LOCUS_19340 243985 243266 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_19340 244232 244005 gene locus_tag LOCUS_19350 244232 244005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 244232 245071 gene locus_tag LOCUS_19360 244232 245071 CDS product short-chain type dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_19360 245097 246086 gene locus_tag LOCUS_19370 245097 246086 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_19370 246716 246093 gene locus_tag LOCUS_19380 246716 246093 CDS product peptidase S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812191.1 protein_id gnl|my_center|LOCUS_19380 246930 247706 gene locus_tag LOCUS_19390 246930 247706 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085862.1 protein_id gnl|my_center|LOCUS_19390 248487 247714 gene locus_tag LOCUS_19400 248487 247714 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067768.1 protein_id gnl|my_center|LOCUS_19400 249981 248512 gene locus_tag LOCUS_19410 249981 248512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 250669 250001 gene locus_tag LOCUS_19420 250669 250001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 251791 250748 gene locus_tag LOCUS_19430 251791 250748 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 protein_id gnl|my_center|LOCUS_19430 253128 251809 gene locus_tag LOCUS_19440 253128 251809 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809289.1 protein_id gnl|my_center|LOCUS_19440 253274 254320 gene locus_tag LOCUS_19450 gene cyoA 253274 254320 CDS product cytochrome ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887948.1 protein_id gnl|my_center|LOCUS_19450 254301 256304 gene locus_tag LOCUS_19460 254301 256304 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061309.1 protein_id gnl|my_center|LOCUS_19460 256297 256956 gene locus_tag LOCUS_19470 256297 256956 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819722.1 protein_id gnl|my_center|LOCUS_19470 256953 257354 gene locus_tag LOCUS_19480 256953 257354 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809276.1 protein_id gnl|my_center|LOCUS_19480 257371 258141 gene locus_tag LOCUS_19490 257371 258141 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNF3 protein_id gnl|my_center|LOCUS_19490 >Feature sequence06 1179 1937 gene locus_tag LOCUS_19500 1179 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2052 2897 gene locus_tag LOCUS_19510 2052 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 3984 2911 gene locus_tag LOCUS_19520 3984 2911 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086459.1 protein_id gnl|my_center|LOCUS_19520 5199 3997 gene locus_tag LOCUS_19530 5199 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 5380 6021 gene locus_tag LOCUS_19540 5380 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 6152 6895 gene locus_tag LOCUS_19550 6152 6895 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193573.1 protein_id gnl|my_center|LOCUS_19550 6950 8218 gene locus_tag LOCUS_19560 gene hemA 6950 8218 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MD88 protein_id gnl|my_center|LOCUS_19560 8219 9301 gene locus_tag LOCUS_19570 gene prfA 8219 9301 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY93 protein_id gnl|my_center|LOCUS_19570 9298 10161 gene locus_tag LOCUS_19580 gene prmC 9298 10161 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5B4 protein_id gnl|my_center|LOCUS_19580 10278 10619 gene locus_tag LOCUS_19590 10278 10619 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8H7 protein_id gnl|my_center|LOCUS_19590 10641 11240 gene locus_tag LOCUS_19600 gene ubiX 10641 11240 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WD94 protein_id gnl|my_center|LOCUS_19600 12138 11257 gene locus_tag LOCUS_19610 12138 11257 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812386.1 protein_id gnl|my_center|LOCUS_19610 12887 12812 gene locus_tag LOCUS_t00300 12887 12812 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13444 12902 gene locus_tag LOCUS_19620 13444 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 14012 13482 gene locus_tag LOCUS_19630 gene sspA 14012 13482 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_19630 14918 14160 gene locus_tag LOCUS_19640 gene petC 14918 14160 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521940.1 protein_id gnl|my_center|LOCUS_19640 16244 14979 gene locus_tag LOCUS_19650 gene petB 16244 14979 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBF9 protein_id gnl|my_center|LOCUS_19650 16875 16270 gene locus_tag LOCUS_19660 gene petA 16875 16270 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7E7 protein_id gnl|my_center|LOCUS_19660 17877 17110 gene locus_tag LOCUS_19670 17877 17110 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQX5 protein_id gnl|my_center|LOCUS_19670 17894 19048 gene locus_tag LOCUS_19680 17894 19048 CDS product DegQ protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521939.1 protein_id gnl|my_center|LOCUS_19680 19789 19052 gene locus_tag LOCUS_19690 gene tatC 19789 19052 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VSY0 protein_id gnl|my_center|LOCUS_19690 20172 19804 gene locus_tag LOCUS_19700 gene tatB 20172 19804 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MPF0 protein_id gnl|my_center|LOCUS_19700 20433 20197 gene locus_tag LOCUS_19710 gene tatE 20433 20197 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA48 protein_id gnl|my_center|LOCUS_19710 20817 20461 gene locus_tag LOCUS_19720 20817 20461 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085225.1 protein_id gnl|my_center|LOCUS_19720 21177 20839 gene locus_tag LOCUS_19730 gene hisE 21177 20839 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FA47 protein_id gnl|my_center|LOCUS_19730 21615 21190 gene locus_tag LOCUS_19740 gene hisI 21615 21190 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZZG6 protein_id gnl|my_center|LOCUS_19740 22392 21628 gene locus_tag LOCUS_19750 gene hisF 22392 21628 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q92 protein_id gnl|my_center|LOCUS_19750 23141 22392 gene locus_tag LOCUS_19760 gene hisA 23141 22392 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q91 protein_id gnl|my_center|LOCUS_19760 23828 23196 gene locus_tag LOCUS_19770 gene hisH 23828 23196 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GE3 protein_id gnl|my_center|LOCUS_19770 24412 23825 gene locus_tag LOCUS_19780 gene hisB 24412 23825 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU41 protein_id gnl|my_center|LOCUS_19780 25527 24427 gene locus_tag LOCUS_19790 gene hisC2 25527 24427 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q87 protein_id gnl|my_center|LOCUS_19790 26857 25535 gene locus_tag LOCUS_19800 gene hisD 26857 25535 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q86 protein_id gnl|my_center|LOCUS_19800 27557 26904 gene locus_tag LOCUS_19810 gene hisG 27557 26904 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GD8 protein_id gnl|my_center|LOCUS_19810 28819 27563 gene locus_tag LOCUS_19820 gene murA 28819 27563 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0ML51 protein_id gnl|my_center|LOCUS_19820 29078 28836 gene locus_tag LOCUS_19830 29078 28836 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199917.1 protein_id gnl|my_center|LOCUS_19830 29867 29112 gene locus_tag LOCUS_19840 29867 29112 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WG20 protein_id gnl|my_center|LOCUS_19840 30772 29864 gene locus_tag LOCUS_19850 30772 29864 CDS product ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205265.1 protein_id gnl|my_center|LOCUS_19850 31057 30806 gene locus_tag LOCUS_19860 31057 30806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 31682 31059 gene locus_tag LOCUS_19870 31682 31059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_19870 32627 31755 gene locus_tag LOCUS_19880 32627 31755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_19880 33116 32643 gene locus_tag LOCUS_19890 33116 32643 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204152.1 protein_id gnl|my_center|LOCUS_19890 33914 33129 gene locus_tag LOCUS_19900 33914 33129 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 protein_id gnl|my_center|LOCUS_19900 34699 33911 gene locus_tag LOCUS_19910 34699 33911 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199931.1 protein_id gnl|my_center|LOCUS_19910 34881 36878 gene locus_tag LOCUS_19920 34881 36878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 36875 37870 gene locus_tag LOCUS_19930 36875 37870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 37947 38894 gene locus_tag LOCUS_19940 37947 38894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 38891 39751 gene locus_tag LOCUS_19950 38891 39751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 39748 40314 gene locus_tag LOCUS_19960 39748 40314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 40302 41477 gene locus_tag LOCUS_19970 40302 41477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 41474 42202 gene locus_tag LOCUS_19980 41474 42202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 42204 42839 gene locus_tag LOCUS_19990 42204 42839 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_19990 44753 42840 gene locus_tag LOCUS_20000 44753 42840 CDS product sodium/hydrogen exchanger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522854.1 protein_id gnl|my_center|LOCUS_20000 44947 45939 gene locus_tag LOCUS_20010 44947 45939 CDS product arabinose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_20010 45939 46466 gene locus_tag LOCUS_20020 45939 46466 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_20020 46472 47050 gene locus_tag LOCUS_20030 46472 47050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 47047 47628 gene locus_tag LOCUS_20040 gene lptA 47047 47628 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7T9 protein_id gnl|my_center|LOCUS_20040 47625 48380 gene locus_tag LOCUS_20050 47625 48380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815177.1 protein_id gnl|my_center|LOCUS_20050 48393 49913 gene locus_tag LOCUS_20060 gene rpoN 48393 49913 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XK7 protein_id gnl|my_center|LOCUS_20060 49954 50283 gene locus_tag LOCUS_20070 gene rpoN 49954 50283 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815178.1 protein_id gnl|my_center|LOCUS_20070 50394 50864 gene locus_tag LOCUS_20080 gene ptsN 50394 50864 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202935.1 protein_id gnl|my_center|LOCUS_20080 50869 51852 gene locus_tag LOCUS_20090 gene hprK 50869 51852 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7U365 protein_id gnl|my_center|LOCUS_20090 51854 52714 gene locus_tag LOCUS_20100 51854 52714 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MAZ7 protein_id gnl|my_center|LOCUS_20100 53773 52670 gene locus_tag LOCUS_20110 53773 52670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 54414 53770 gene locus_tag LOCUS_20120 gene mutM 54414 53770 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XL4 protein_id gnl|my_center|LOCUS_20120 54723 56441 gene locus_tag LOCUS_20130 54723 56441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195237.1 protein_id gnl|my_center|LOCUS_20130 56446 57015 gene locus_tag LOCUS_20140 56446 57015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 57020 57952 gene locus_tag LOCUS_20150 gene ispE 57020 57952 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8L2 protein_id gnl|my_center|LOCUS_20150 57986 58062 gene locus_tag LOCUS_t00310 57986 58062 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 58135 59088 gene locus_tag LOCUS_20160 gene prs 58135 59088 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XL8 protein_id gnl|my_center|LOCUS_20160 59176 59769 gene locus_tag LOCUS_20170 gene rplY 59176 59769 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62FC2 protein_id gnl|my_center|LOCUS_20170 59855 60514 gene locus_tag LOCUS_20180 gene exoD 59855 60514 CDS product protein ExoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q52923 protein_id gnl|my_center|LOCUS_20180 60990 60523 gene locus_tag LOCUS_20190 60990 60523 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304871.1 protein_id gnl|my_center|LOCUS_20190 61145 62821 gene locus_tag LOCUS_20200 gene leuA 61145 62821 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM59 protein_id gnl|my_center|LOCUS_20200 63350 62829 gene locus_tag LOCUS_20210 63350 62829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 63628 64227 gene locus_tag LOCUS_20220 gene pth 63628 64227 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3Q0 protein_id gnl|my_center|LOCUS_20220 64224 65339 gene locus_tag LOCUS_20230 64224 65339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_20230 65447 67072 gene locus_tag LOCUS_20240 65447 67072 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070845.1 protein_id gnl|my_center|LOCUS_20240 67133 68224 gene locus_tag LOCUS_20250 gene ychF 67133 68224 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QG1 protein_id gnl|my_center|LOCUS_20250 68275 69504 gene locus_tag LOCUS_20260 68275 69504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 70118 69501 gene locus_tag LOCUS_20270 70118 69501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036802.1 protein_id gnl|my_center|LOCUS_20270 70417 70133 gene locus_tag LOCUS_20280 70417 70133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 70876 70547 gene locus_tag LOCUS_20290 70876 70547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 71391 70888 gene locus_tag LOCUS_20300 gene coaD 71391 70888 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XM3 protein_id gnl|my_center|LOCUS_20300 72009 71452 gene locus_tag LOCUS_20310 72009 71452 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808577.1 protein_id gnl|my_center|LOCUS_20310 73400 72057 gene locus_tag LOCUS_20320 73400 72057 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763632.1 protein_id gnl|my_center|LOCUS_20320 74839 73427 gene locus_tag LOCUS_20330 74839 73427 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_20330 74956 75897 gene locus_tag LOCUS_20340 gene ftsY 74956 75897 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WG13 protein_id gnl|my_center|LOCUS_20340 75894 76628 gene locus_tag LOCUS_20350 75894 76628 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884317.1 protein_id gnl|my_center|LOCUS_20350 76650 77558 gene locus_tag LOCUS_20360 76650 77558 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VST9 protein_id gnl|my_center|LOCUS_20360 77646 79157 gene locus_tag LOCUS_20370 77646 79157 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942823.1 protein_id gnl|my_center|LOCUS_20370 80098 79151 gene locus_tag LOCUS_20380 gene rfbD 80098 79151 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37760 protein_id gnl|my_center|LOCUS_20380 81400 80372 gene locus_tag LOCUS_20390 81400 80372 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXY8 protein_id gnl|my_center|LOCUS_20390 81540 81941 gene locus_tag LOCUS_20400 81540 81941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 82455 81952 gene locus_tag LOCUS_20410 gene rfaH 82455 81952 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83DB2 protein_id gnl|my_center|LOCUS_20410 82608 84716 gene locus_tag LOCUS_20420 82608 84716 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103628.1 protein_id gnl|my_center|LOCUS_20420 85275 84724 gene locus_tag LOCUS_20430 gene rmlC 85275 84724 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU21 protein_id gnl|my_center|LOCUS_20430 85303 85707 gene locus_tag LOCUS_20440 85303 85707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258928.1 protein_id gnl|my_center|LOCUS_20440 85848 86039 gene locus_tag LOCUS_20450 85848 86039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20450 86884 86006 gene locus_tag LOCUS_20460 gene rfbA 86884 86006 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMA9 protein_id gnl|my_center|LOCUS_20460 87255 86926 gene locus_tag LOCUS_20470 87255 86926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 88084 87242 gene locus_tag LOCUS_20480 88084 87242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 88258 89985 gene locus_tag LOCUS_20490 88258 89985 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529178.1 protein_id gnl|my_center|LOCUS_20490 90310 89987 gene locus_tag LOCUS_20500 90310 89987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962809.1 protein_id gnl|my_center|LOCUS_20500 90690 90289 gene locus_tag LOCUS_20510 90690 90289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 92220 90733 gene locus_tag LOCUS_20520 gene pslB 92220 90733 CDS product biofilm formation protein PslB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113717.1 protein_id gnl|my_center|LOCUS_20520 92738 92217 gene locus_tag LOCUS_20530 gene wcaH 92738 92217 CDS product GDP-mannose mannosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CM01 protein_id gnl|my_center|LOCUS_20530 93738 92755 gene locus_tag LOCUS_20540 gene wbcJ 93738 92755 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN61 protein_id gnl|my_center|LOCUS_20540 94853 93735 gene locus_tag LOCUS_20550 gene gmd 94853 93735 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNI5 protein_id gnl|my_center|LOCUS_20550 95073 96458 gene locus_tag LOCUS_20560 95073 96458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 96619 97218 gene locus_tag LOCUS_20570 96619 97218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 97190 97609 gene locus_tag LOCUS_20580 97190 97609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 97606 97881 gene locus_tag LOCUS_20590 97606 97881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 97881 98735 gene locus_tag LOCUS_20600 97881 98735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 98749 98940 gene locus_tag LOCUS_20610 98749 98940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 99501 99776 gene locus_tag LOCUS_20620 99501 99776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 99856 100548 gene locus_tag LOCUS_20630 99856 100548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 100545 103397 gene locus_tag LOCUS_20640 100545 103397 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205406.1 protein_id gnl|my_center|LOCUS_20640 103450 105918 gene locus_tag LOCUS_20650 103450 105918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 105925 107088 gene locus_tag LOCUS_20660 105925 107088 CDS product transport-related membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529927.1 protein_id gnl|my_center|LOCUS_20660 107801 107181 gene locus_tag LOCUS_20670 107801 107181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 109041 108667 gene locus_tag LOCUS_20680 109041 108667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20680 110353 109325 gene locus_tag LOCUS_20690 gene galE 110353 109325 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263233.1 protein_id gnl|my_center|LOCUS_20690 111486 110362 gene locus_tag LOCUS_20700 111486 110362 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186419.1 protein_id gnl|my_center|LOCUS_20700 112837 111923 gene locus_tag LOCUS_20710 112837 111923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 113976 112975 gene locus_tag LOCUS_20720 113976 112975 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706045.1 protein_id gnl|my_center|LOCUS_20720 114779 114081 gene locus_tag LOCUS_20730 114779 114081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 116424 115627 gene locus_tag LOCUS_20740 116424 115627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 117251 116421 gene locus_tag LOCUS_20750 117251 116421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 117133 117366 gene locus_tag LOCUS_20760 117133 117366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 118939 117773 gene locus_tag LOCUS_20770 118939 117773 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_20770 119355 118936 gene locus_tag LOCUS_20780 119355 118936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 120504 119443 gene locus_tag LOCUS_20790 120504 119443 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186126.1 protein_id gnl|my_center|LOCUS_20790 122113 120875 gene locus_tag LOCUS_20800 122113 120875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_20800 122435 122256 gene locus_tag LOCUS_20810 122435 122256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 122731 122435 gene locus_tag LOCUS_20820 122731 122435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710070.1 protein_id gnl|my_center|LOCUS_20820 123182 122859 gene locus_tag LOCUS_20830 123182 122859 CDS product mRNA interferase PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388731.1 protein_id gnl|my_center|LOCUS_20830 123406 123182 gene locus_tag LOCUS_20840 123406 123182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388652.1 protein_id gnl|my_center|LOCUS_20840 124649 123726 gene locus_tag LOCUS_20850 124649 123726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038232.1 protein_id gnl|my_center|LOCUS_20850 125398 124646 gene locus_tag LOCUS_20860 125398 124646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038853.1 protein_id gnl|my_center|LOCUS_20860 126728 125544 gene locus_tag LOCUS_20870 126728 125544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 127204 126734 gene locus_tag LOCUS_20880 127204 126734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 127456 127797 gene locus_tag LOCUS_20890 127456 127797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 127787 129043 gene locus_tag LOCUS_20900 127787 129043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038930.1 protein_id gnl|my_center|LOCUS_20900 129062 129226 gene locus_tag LOCUS_20910 129062 129226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 129278 129532 gene locus_tag LOCUS_20920 129278 129532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 129544 129957 gene locus_tag LOCUS_20930 gene vapC 129544 129957 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q930F9 protein_id gnl|my_center|LOCUS_20930 130048 131040 gene locus_tag LOCUS_20940 gene ascD 130048 131040 CDS product CDP-6-deoxy-L-threo-D-glycero-4-hexulose-3-dehydrase reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68641 protein_id gnl|my_center|LOCUS_20940 131037 131810 gene locus_tag LOCUS_20950 gene ddhA 131037 131810 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261038.1 protein_id gnl|my_center|LOCUS_20950 131835 132932 gene locus_tag LOCUS_20960 gene ddhB 131835 132932 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261039.1 protein_id gnl|my_center|LOCUS_20960 132945 134285 gene locus_tag LOCUS_20970 gene rfbH 132945 134285 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939427.1 protein_id gnl|my_center|LOCUS_20970 134286 135173 gene locus_tag LOCUS_20980 gene prt 134286 135173 CDS product paratose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208595.1 protein_id gnl|my_center|LOCUS_20980 135170 136192 gene locus_tag LOCUS_20990 gene rfbE 135170 136192 CDS product CDP-paratose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14169 protein_id gnl|my_center|LOCUS_20990 137379 136213 gene locus_tag LOCUS_21000 137379 136213 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_21000 137464 138399 gene locus_tag LOCUS_21010 137464 138399 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088745.1 protein_id gnl|my_center|LOCUS_21010 140274 139390 gene locus_tag LOCUS_21020 140274 139390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 142530 141298 gene locus_tag LOCUS_21030 142530 141298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033576.1 protein_id gnl|my_center|LOCUS_21030 143483 142647 gene locus_tag LOCUS_21040 143483 142647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 144430 143480 gene locus_tag LOCUS_21050 144430 143480 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_21050 144594 146495 gene locus_tag LOCUS_21060 gene wbpM 144594 146495 CDS product nucleotide sugar epimerase/dehydratase WbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895647.1 protein_id gnl|my_center|LOCUS_21060 147069 146500 gene locus_tag LOCUS_21070 gene bplG 147069 146500 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929610.1 protein_id gnl|my_center|LOCUS_21070 148287 147100 gene locus_tag LOCUS_21080 gene wlbF 148287 147100 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064734.1 protein_id gnl|my_center|LOCUS_21080 148916 148284 gene locus_tag LOCUS_21090 148916 148284 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203510.1 protein_id gnl|my_center|LOCUS_21090 150106 148913 gene locus_tag LOCUS_21100 150106 148913 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_21100 151347 150163 gene locus_tag LOCUS_21110 151347 150163 CDS product O-antigen biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815492.1 protein_id gnl|my_center|LOCUS_21110 151632 153536 gene locus_tag LOCUS_21120 151632 153536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 154655 153570 gene locus_tag LOCUS_21130 154655 153570 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419507.1 protein_id gnl|my_center|LOCUS_21130 156778 154724 gene locus_tag LOCUS_21140 156778 154724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 159131 156855 gene locus_tag LOCUS_21150 159131 156855 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208315.1 protein_id gnl|my_center|LOCUS_21150 159362 159862 gene locus_tag LOCUS_21160 159362 159862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 159864 160220 gene locus_tag LOCUS_21170 159864 160220 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087527.1 protein_id gnl|my_center|LOCUS_21170 160280 160747 gene locus_tag LOCUS_21180 160280 160747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 160762 161238 gene locus_tag LOCUS_21190 160762 161238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 161546 161247 gene locus_tag LOCUS_21200 161546 161247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 161665 161892 gene locus_tag LOCUS_21210 161665 161892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 162235 161942 gene locus_tag LOCUS_21220 162235 161942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 162754 162431 gene locus_tag LOCUS_21230 162754 162431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 163002 162763 gene locus_tag LOCUS_21240 163002 162763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 167918 163002 gene locus_tag LOCUS_21250 167918 163002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 168330 168049 gene locus_tag LOCUS_21260 168330 168049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 169749 168349 gene locus_tag LOCUS_21270 169749 168349 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_21270 171401 169746 gene locus_tag LOCUS_21280 171401 169746 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_21280 173051 171498 gene locus_tag LOCUS_21290 173051 171498 CDS product putative monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702808.1 protein_id gnl|my_center|LOCUS_21290 173246 173539 gene locus_tag LOCUS_21300 gene higB 173246 173539 CDS product addiction module antitoxin RelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640638.1 protein_id gnl|my_center|LOCUS_21300 173552 173857 gene locus_tag LOCUS_21310 173552 173857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44191 protein_id gnl|my_center|LOCUS_21310 173892 174320 gene locus_tag LOCUS_21320 173892 174320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 174311 175366 gene locus_tag LOCUS_21330 174311 175366 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550696.1 protein_id gnl|my_center|LOCUS_21330 175982 175371 gene locus_tag LOCUS_21340 175982 175371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 177221 175992 gene locus_tag LOCUS_21350 177221 175992 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_21350 178159 177296 gene locus_tag LOCUS_21360 178159 177296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLC7 protein_id gnl|my_center|LOCUS_21360 178382 179503 gene locus_tag LOCUS_21370 178382 179503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 179615 180100 gene locus_tag LOCUS_21380 179615 180100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 180923 180261 gene locus_tag LOCUS_21390 180923 180261 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088037.1 protein_id gnl|my_center|LOCUS_21390 182266 180923 gene locus_tag LOCUS_21400 182266 180923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 182492 182752 gene locus_tag LOCUS_21410 182492 182752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 182761 184035 gene locus_tag LOCUS_21420 182761 184035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 184047 185018 gene locus_tag LOCUS_21430 gene rpoH 184047 185018 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7H1 protein_id gnl|my_center|LOCUS_21430 185089 185766 gene locus_tag LOCUS_21440 185089 185766 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920683.1 protein_id gnl|my_center|LOCUS_21440 185766 186491 gene locus_tag LOCUS_21450 185766 186491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 186673 187311 gene locus_tag LOCUS_21460 186673 187311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 187931 187320 gene locus_tag LOCUS_21470 187931 187320 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197988.1 protein_id gnl|my_center|LOCUS_21470 188852 187938 gene locus_tag LOCUS_21480 gene ctaB 188852 187938 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XS7 protein_id gnl|my_center|LOCUS_21480 189901 188861 gene locus_tag LOCUS_21490 189901 188861 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931623.1 protein_id gnl|my_center|LOCUS_21490 190547 189915 gene locus_tag LOCUS_21500 190547 189915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815732.1 protein_id gnl|my_center|LOCUS_21500 191359 190544 gene locus_tag LOCUS_21510 191359 190544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 191413 191613 gene locus_tag LOCUS_21520 191413 191613 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815736.1 protein_id gnl|my_center|LOCUS_21520 192551 191697 gene locus_tag LOCUS_21530 gene coIII 192551 191697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815738.1 protein_id gnl|my_center|LOCUS_21530 192845 192615 gene locus_tag LOCUS_21540 192845 192615 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815740.1 protein_id gnl|my_center|LOCUS_21540 193411 192845 gene locus_tag LOCUS_21550 193411 192845 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185071.1 protein_id gnl|my_center|LOCUS_21550 193561 193424 gene locus_tag LOCUS_21560 193561 193424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 195233 193629 gene locus_tag LOCUS_21570 gene ctaD 195233 193629 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VT14 protein_id gnl|my_center|LOCUS_21570 196428 195253 gene locus_tag LOCUS_21580 196428 195253 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBJ5 protein_id gnl|my_center|LOCUS_21580 196873 196478 gene locus_tag LOCUS_21590 196873 196478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 197964 197161 gene locus_tag LOCUS_21600 197964 197161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 198404 198886 gene locus_tag LOCUS_21610 198404 198886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 198883 199353 gene locus_tag LOCUS_21620 gene trmL 198883 199353 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XU1 protein_id gnl|my_center|LOCUS_21620 200535 199519 gene locus_tag LOCUS_21630 gene gpsA 200535 199519 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63XU3 protein_id gnl|my_center|LOCUS_21630 201033 200548 gene locus_tag LOCUS_21640 gene secB 201033 200548 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VS46 protein_id gnl|my_center|LOCUS_21640 201389 201114 gene locus_tag LOCUS_21650 gene grx3 201389 201114 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_21650 201894 201412 gene locus_tag LOCUS_21660 201894 201412 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958278.1 protein_id gnl|my_center|LOCUS_21660 202000 202746 gene locus_tag LOCUS_21670 gene gpmA 202000 202746 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PA77 protein_id gnl|my_center|LOCUS_21670 202753 204045 gene locus_tag LOCUS_21680 202753 204045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_21680 204051 205436 gene locus_tag LOCUS_21690 gene ctpA 204051 205436 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807434.1 protein_id gnl|my_center|LOCUS_21690 205448 206209 gene locus_tag LOCUS_21700 gene thiF 205448 206209 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_21700 206898 206206 gene locus_tag LOCUS_21710 206898 206206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 207027 207374 gene locus_tag LOCUS_21720 207027 207374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 207371 208147 gene locus_tag LOCUS_21730 207371 208147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 208560 208144 gene locus_tag LOCUS_21740 208560 208144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 208960 209409 gene locus_tag LOCUS_21750 gene gspG 208960 209409 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence07 251 625 gene locus_tag LOCUS_21760 gene gspI 251 625 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204729.1 protein_id gnl|my_center|LOCUS_21760 622 1317 gene locus_tag LOCUS_21770 622 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 1317 2267 gene locus_tag LOCUS_21780 1317 2267 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5P3 protein_id gnl|my_center|LOCUS_21780 2268 3521 gene locus_tag LOCUS_21790 2268 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 3518 4048 gene locus_tag LOCUS_21800 3518 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 4045 4776 gene locus_tag LOCUS_21810 4045 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 4776 7211 gene locus_tag LOCUS_21820 4776 7211 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009315212.1 protein_id gnl|my_center|LOCUS_21820 7208 8671 gene locus_tag LOCUS_21830 gene gspE 7208 8671 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533498.1 protein_id gnl|my_center|LOCUS_21830 8690 9904 gene locus_tag LOCUS_21840 gene gspF 8690 9904 CDS product type II secretion system protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196821.1 protein_id gnl|my_center|LOCUS_21840 9901 10608 gene locus_tag LOCUS_21850 9901 10608 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 protein_id gnl|my_center|LOCUS_21850 10614 12512 gene locus_tag LOCUS_21860 10614 12512 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811551.1 protein_id gnl|my_center|LOCUS_21860 12519 13235 gene locus_tag LOCUS_21870 12519 13235 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 protein_id gnl|my_center|LOCUS_21870 13232 15139 gene locus_tag LOCUS_21880 13232 15139 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930488.1 protein_id gnl|my_center|LOCUS_21880 16129 15176 gene locus_tag LOCUS_21890 gene hmgcL 16129 15176 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038737.1 protein_id gnl|my_center|LOCUS_21890 18171 16126 gene locus_tag LOCUS_21900 gene accC 18171 16126 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 protein_id gnl|my_center|LOCUS_21900 19298 18246 gene locus_tag LOCUS_21910 19298 18246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 20218 19409 gene locus_tag LOCUS_21920 20218 19409 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039999.1 protein_id gnl|my_center|LOCUS_21920 21860 20250 gene locus_tag LOCUS_21930 21860 20250 CDS product biotin-dependent carboxyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528747.1 protein_id gnl|my_center|LOCUS_21930 22471 21863 gene locus_tag LOCUS_21940 22471 21863 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115035.1 protein_id gnl|my_center|LOCUS_21940 23223 22555 gene locus_tag LOCUS_21950 23223 22555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 23336 23896 gene locus_tag LOCUS_21960 23336 23896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 23989 24495 gene locus_tag LOCUS_21970 23989 24495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 24534 25094 gene locus_tag LOCUS_21980 24534 25094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 26659 25136 gene locus_tag LOCUS_21990 gene hapE 26659 25136 CDS product flavin-binding monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207742.1 protein_id gnl|my_center|LOCUS_21990 26792 27514 gene locus_tag LOCUS_22000 26792 27514 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994509.1 protein_id gnl|my_center|LOCUS_22000 28022 27498 gene locus_tag LOCUS_22010 28022 27498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 29366 28026 gene locus_tag LOCUS_22020 29366 28026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 30076 29363 gene locus_tag LOCUS_22030 30076 29363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 30584 30066 gene locus_tag LOCUS_22040 30584 30066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 32521 30695 gene locus_tag LOCUS_22050 gene aceK 32521 30695 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P789 protein_id gnl|my_center|LOCUS_22050 32642 33913 gene locus_tag LOCUS_22060 32642 33913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 35144 33963 gene locus_tag LOCUS_22070 gene ivd 35144 33963 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815950.1 protein_id gnl|my_center|LOCUS_22070 35240 36262 gene locus_tag LOCUS_22080 35240 36262 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203773.1 protein_id gnl|my_center|LOCUS_22080 36347 37312 gene locus_tag LOCUS_22090 36347 37312 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537568.1 protein_id gnl|my_center|LOCUS_22090 37368 37793 gene locus_tag LOCUS_22100 gene dksA 37368 37793 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBV2 protein_id gnl|my_center|LOCUS_22100 38447 39211 gene locus_tag LOCUS_22110 38447 39211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 40191 39265 gene locus_tag LOCUS_22120 gene rsmI 40191 39265 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PU7 protein_id gnl|my_center|LOCUS_22120 40190 40693 gene locus_tag LOCUS_22130 40190 40693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 40784 41386 gene locus_tag LOCUS_22140 gene gmhA 40784 41386 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX7 protein_id gnl|my_center|LOCUS_22140 41376 42047 gene locus_tag LOCUS_22150 41376 42047 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196853.1 protein_id gnl|my_center|LOCUS_22150 42096 42584 gene locus_tag LOCUS_22160 42096 42584 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815191.1 protein_id gnl|my_center|LOCUS_22160 43152 42607 gene locus_tag LOCUS_22170 43152 42607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 43144 44253 gene locus_tag LOCUS_22180 43144 44253 CDS product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704976.1 protein_id gnl|my_center|LOCUS_22180 44901 44257 gene locus_tag LOCUS_22190 44901 44257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 46417 45020 gene locus_tag LOCUS_22200 46417 45020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 49037 46386 gene locus_tag LOCUS_22210 gene clpV1 49037 46386 CDS product protein ClpV1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I742 protein_id gnl|my_center|LOCUS_22210 50038 49034 gene locus_tag LOCUS_22220 50038 49034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104969.1 protein_id gnl|my_center|LOCUS_22220 51919 50054 gene locus_tag LOCUS_22230 51919 50054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115055.1 protein_id gnl|my_center|LOCUS_22230 52442 51939 gene locus_tag LOCUS_22240 gene impF 52442 51939 CDS product type VI secretion system protein ImpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096188.1 protein_id gnl|my_center|LOCUS_22240 52929 52447 gene locus_tag LOCUS_22250 gene hcp1 52929 52447 CDS product protein hcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I747 protein_id gnl|my_center|LOCUS_22250 53432 52950 gene locus_tag LOCUS_22260 gene hcp1 53432 52950 CDS product protein hcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I747 protein_id gnl|my_center|LOCUS_22260 54962 53472 gene locus_tag LOCUS_22270 54962 53472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 protein_id gnl|my_center|LOCUS_22270 55477 54965 gene locus_tag LOCUS_22280 55477 54965 CDS product type VI secretion system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 protein_id gnl|my_center|LOCUS_22280 56596 55520 gene locus_tag LOCUS_22290 56596 55520 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925946.1 protein_id gnl|my_center|LOCUS_22290 58086 56725 gene locus_tag LOCUS_22300 gene gor 58086 56725 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537517.1 protein_id gnl|my_center|LOCUS_22300 58433 58227 gene locus_tag LOCUS_22310 58433 58227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 60661 58514 gene locus_tag LOCUS_22320 60661 58514 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_22320 60820 61617 gene locus_tag LOCUS_22330 60820 61617 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268115.1 protein_id gnl|my_center|LOCUS_22330 62202 61612 gene locus_tag LOCUS_22340 62202 61612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 63282 62290 gene locus_tag LOCUS_22350 63282 62290 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930758.1 protein_id gnl|my_center|LOCUS_22350 64573 63335 gene locus_tag LOCUS_22360 64573 63335 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551490.1 protein_id gnl|my_center|LOCUS_22360 64695 65630 gene locus_tag LOCUS_22370 gene estR 64695 65630 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117503.1 protein_id gnl|my_center|LOCUS_22370 65725 66483 gene locus_tag LOCUS_22380 65725 66483 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729133.1 protein_id gnl|my_center|LOCUS_22380 66440 67021 gene locus_tag LOCUS_22390 66440 67021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207867.1 protein_id gnl|my_center|LOCUS_22390 67062 67649 gene locus_tag LOCUS_22400 67062 67649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708892.1 protein_id gnl|my_center|LOCUS_22400 69052 67691 gene locus_tag LOCUS_22410 69052 67691 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929970.1 protein_id gnl|my_center|LOCUS_22410 71317 69119 gene locus_tag LOCUS_22420 71317 69119 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918028.1 protein_id gnl|my_center|LOCUS_22420 71973 71431 gene locus_tag LOCUS_22430 71973 71431 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004203413.1 protein_id gnl|my_center|LOCUS_22430 73295 71970 gene locus_tag LOCUS_22440 73295 71970 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198314.1 protein_id gnl|my_center|LOCUS_22440 73437 75500 gene locus_tag LOCUS_22450 73437 75500 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921329.1 protein_id gnl|my_center|LOCUS_22450 75607 77523 gene locus_tag LOCUS_22460 75607 77523 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035993.1 protein_id gnl|my_center|LOCUS_22460 78520 77531 gene locus_tag LOCUS_22470 78520 77531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 78465 79673 gene locus_tag LOCUS_22480 78465 79673 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706023.1 protein_id gnl|my_center|LOCUS_22480 79763 80095 gene locus_tag LOCUS_22490 79763 80095 CDS product bacteriophage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205297.1 protein_id gnl|my_center|LOCUS_22490 80082 80369 gene locus_tag LOCUS_22500 80082 80369 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770554.1 protein_id gnl|my_center|LOCUS_22500 81624 80395 gene locus_tag LOCUS_22510 81624 80395 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483054.1 protein_id gnl|my_center|LOCUS_22510 82054 81617 gene locus_tag LOCUS_22520 82054 81617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 82620 82249 gene locus_tag LOCUS_22530 82620 82249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063921.1 protein_id gnl|my_center|LOCUS_22530 82931 82629 gene locus_tag LOCUS_22540 82931 82629 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390234.1 protein_id gnl|my_center|LOCUS_22540 83404 83643 gene locus_tag LOCUS_22550 83404 83643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 83683 84072 gene locus_tag LOCUS_22560 83683 84072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 84169 84732 gene locus_tag LOCUS_22570 84169 84732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 85632 85042 gene locus_tag LOCUS_22580 85632 85042 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_22580 86090 85632 gene locus_tag LOCUS_22590 86090 85632 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974879.1 protein_id gnl|my_center|LOCUS_22590 87003 86233 gene locus_tag LOCUS_22600 87003 86233 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204859.1 protein_id gnl|my_center|LOCUS_22600 87239 88405 gene locus_tag LOCUS_22610 87239 88405 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767507.1 protein_id gnl|my_center|LOCUS_22610 89004 88468 gene locus_tag LOCUS_22620 89004 88468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266352.1 protein_id gnl|my_center|LOCUS_22620 89222 91726 gene locus_tag LOCUS_22630 89222 91726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 92504 91692 gene locus_tag LOCUS_22640 92504 91692 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727S2 protein_id gnl|my_center|LOCUS_22640 93372 92497 gene locus_tag LOCUS_22650 gene mdcH 93372 92497 CDS product malonate decarboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038699.1 protein_id gnl|my_center|LOCUS_22650 94307 93417 gene locus_tag LOCUS_22660 gene citG 94307 93417 CDS product putative 2-(5''-triphosphoribosyl)-3'-dephosphocoenzyme-A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4U2 protein_id gnl|my_center|LOCUS_22660 95026 94304 gene locus_tag LOCUS_22670 gene mdcG 95026 94304 CDS product phosphoribosyl-dephospho-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89XP2 protein_id gnl|my_center|LOCUS_22670 95744 95019 gene locus_tag LOCUS_22680 gene mdcC 95744 95019 CDS product malonate decarboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038696.1 protein_id gnl|my_center|LOCUS_22680 96640 95741 gene locus_tag LOCUS_22690 gene mdcB 96640 95741 CDS product biotin-independent malonate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038695.1 protein_id gnl|my_center|LOCUS_22690 96953 96630 gene locus_tag LOCUS_22700 gene mdcC 96953 96630 CDS product malonate decarboxylase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4U6 protein_id gnl|my_center|LOCUS_22700 98630 96966 gene locus_tag LOCUS_22710 gene mdcA 98630 96966 CDS product malonate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038693.1 protein_id gnl|my_center|LOCUS_22710 99989 98646 gene locus_tag LOCUS_22720 99989 98646 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087200.1 protein_id gnl|my_center|LOCUS_22720 100522 99992 gene locus_tag LOCUS_22730 100522 99992 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087201.1 protein_id gnl|my_center|LOCUS_22730 101617 100601 gene locus_tag LOCUS_22740 101617 100601 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087202.1 protein_id gnl|my_center|LOCUS_22740 102467 101715 gene locus_tag LOCUS_22750 gene maiA 102467 101715 CDS product maleate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFK2 protein_id gnl|my_center|LOCUS_22750 103212 102493 gene locus_tag LOCUS_22760 103212 102493 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106623.1 protein_id gnl|my_center|LOCUS_22760 103384 104055 gene locus_tag LOCUS_22770 103384 104055 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967085.1 protein_id gnl|my_center|LOCUS_22770 104673 104065 gene locus_tag LOCUS_22780 104673 104065 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117903.1 protein_id gnl|my_center|LOCUS_22780 104746 106083 gene locus_tag LOCUS_22790 gene gltP 104746 106083 CDS product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 protein_id gnl|my_center|LOCUS_22790 106608 106084 gene locus_tag LOCUS_22800 106608 106084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706014.1 protein_id gnl|my_center|LOCUS_22800 108000 106663 gene locus_tag LOCUS_22810 108000 106663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_22810 108243 108899 gene locus_tag LOCUS_22820 108243 108899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 110275 108896 gene locus_tag LOCUS_22830 110275 108896 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020815.1 protein_id gnl|my_center|LOCUS_22830 111150 110293 gene locus_tag LOCUS_22840 gene uppP2 111150 110293 CDS product undecaprenyl-diphosphatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58741 protein_id gnl|my_center|LOCUS_22840 111359 112483 gene locus_tag LOCUS_22850 111359 112483 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198210.1 protein_id gnl|my_center|LOCUS_22850 112484 114376 gene locus_tag LOCUS_22860 112484 114376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 114396 115079 gene locus_tag LOCUS_22870 114396 115079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 115088 116263 gene locus_tag LOCUS_22880 115088 116263 CDS product dTDP-4-dehydro-6-deoxyglucose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943648.1 protein_id gnl|my_center|LOCUS_22880 116260 116937 gene locus_tag LOCUS_22890 116260 116937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 116934 117671 gene locus_tag LOCUS_22900 116934 117671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104776.1 protein_id gnl|my_center|LOCUS_22900 118045 119022 gene locus_tag LOCUS_22910 118045 119022 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228406.1 protein_id gnl|my_center|LOCUS_22910 119030 123079 gene locus_tag LOCUS_22920 119030 123079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 123628 123080 gene locus_tag LOCUS_22930 123628 123080 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193433.1 protein_id gnl|my_center|LOCUS_22930 124455 123625 gene locus_tag LOCUS_22940 gene cobS 124455 123625 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSL8 protein_id gnl|my_center|LOCUS_22940 125528 124452 gene locus_tag LOCUS_22950 gene cobT 125528 124452 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYK9 protein_id gnl|my_center|LOCUS_22950 127016 125553 gene locus_tag LOCUS_22960 gene cobQ 127016 125553 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RZU9 protein_id gnl|my_center|LOCUS_22960 127984 127013 gene locus_tag LOCUS_22970 127984 127013 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229224.1 protein_id gnl|my_center|LOCUS_22970 128913 127981 gene locus_tag LOCUS_22980 gene cobD 128913 127981 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WA0 protein_id gnl|my_center|LOCUS_22980 129500 128919 gene locus_tag LOCUS_22990 129500 128919 CDS product cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229235.1 protein_id gnl|my_center|LOCUS_22990 130308 129517 gene locus_tag LOCUS_23000 gene fecE 130308 129517 CDS product ferric citrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385686.1 protein_id gnl|my_center|LOCUS_23000 131300 130314 gene locus_tag LOCUS_23010 131300 130314 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228166.1 protein_id gnl|my_center|LOCUS_23010 132154 131297 gene locus_tag LOCUS_23020 132154 131297 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228165.1 protein_id gnl|my_center|LOCUS_23020 132726 132151 gene locus_tag LOCUS_23030 gene cobU 132726 132151 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404268.1 protein_id gnl|my_center|LOCUS_23030 134603 132744 gene locus_tag LOCUS_23040 134603 132744 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931557.1 protein_id gnl|my_center|LOCUS_23040 135108 134887 gene locus_tag LOCUS_23050 135108 134887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406940.1 protein_id gnl|my_center|LOCUS_23050 135666 135112 gene locus_tag LOCUS_23060 gene blc 135666 135112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037571.1 protein_id gnl|my_center|LOCUS_23060 135838 135990 gene locus_tag LOCUS_23070 135838 135990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 137333 135987 gene locus_tag LOCUS_23080 gene hipA 137333 135987 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816876.1 protein_id gnl|my_center|LOCUS_23080 137593 137333 gene locus_tag LOCUS_23090 137593 137333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 138230 137688 gene locus_tag LOCUS_23100 138230 137688 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887360.1 protein_id gnl|my_center|LOCUS_23100 139533 139054 gene locus_tag LOCUS_23110 139533 139054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 139696 141072 gene locus_tag LOCUS_23120 139696 141072 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 protein_id gnl|my_center|LOCUS_23120 141580 141410 gene locus_tag LOCUS_23130 141580 141410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 141584 142180 gene locus_tag LOCUS_23140 141584 142180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 144096 147758 gene locus_tag LOCUS_23150 144096 147758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 147759 148682 gene locus_tag LOCUS_23160 147759 148682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 150137 149133 gene locus_tag LOCUS_23170 150137 149133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 152215 151724 gene locus_tag LOCUS_23180 152215 151724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 152697 152212 gene locus_tag LOCUS_23190 152697 152212 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 protein_id gnl|my_center|LOCUS_23190 152944 153600 gene locus_tag LOCUS_23200 152944 153600 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812436.1 protein_id gnl|my_center|LOCUS_23200 154508 153609 gene locus_tag LOCUS_23210 gene oruR 154508 153609 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_23210 154802 155122 gene locus_tag LOCUS_23220 154802 155122 CDS product putative ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702785.1 protein_id gnl|my_center|LOCUS_23220 155138 156559 gene locus_tag LOCUS_23230 155138 156559 CDS product putative cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702784.1 protein_id gnl|my_center|LOCUS_23230 156683 157915 gene locus_tag LOCUS_23240 156683 157915 CDS product putative ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702783.1 protein_id gnl|my_center|LOCUS_23240 158095 160365 gene locus_tag LOCUS_23250 158095 160365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 160399 162069 gene locus_tag LOCUS_23260 160399 162069 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_23260 162062 163840 gene locus_tag LOCUS_23270 162062 163840 CDS product putative aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705270.1 protein_id gnl|my_center|LOCUS_23270 163824 164849 gene locus_tag LOCUS_23280 gene oruR 163824 164849 CDS product ornithine utilization regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72171 protein_id gnl|my_center|LOCUS_23280 165953 164919 gene locus_tag LOCUS_23290 165953 164919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207738.1 protein_id gnl|my_center|LOCUS_23290 167444 165969 gene locus_tag LOCUS_23300 167444 165969 CDS product fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_23300 168652 167594 gene locus_tag LOCUS_23310 168652 167594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207691.1 protein_id gnl|my_center|LOCUS_23310 169973 170335 gene locus_tag LOCUS_23320 169973 170335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 170401 170670 gene locus_tag LOCUS_23330 170401 170670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 170730 172352 gene locus_tag LOCUS_23340 170730 172352 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971015.1 protein_id gnl|my_center|LOCUS_23340 174370 172892 gene locus_tag LOCUS_23350 174370 172892 CDS product aromatic hydrocarbon degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_23350 174498 174716 gene locus_tag LOCUS_23360 174498 174716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 174926 175396 gene locus_tag LOCUS_23370 174926 175396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 175389 177017 gene locus_tag LOCUS_23380 175389 177017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 177828 177283 gene locus_tag LOCUS_23390 177828 177283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 178251 177862 gene locus_tag LOCUS_23400 178251 177862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 179221 178649 gene locus_tag LOCUS_23410 179221 178649 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766910.1 protein_id gnl|my_center|LOCUS_23410 179594 179226 gene locus_tag LOCUS_23420 179594 179226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 181127 179598 gene locus_tag LOCUS_23430 181127 179598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 182278 181124 gene locus_tag LOCUS_23440 182278 181124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 183762 182281 gene locus_tag LOCUS_23450 183762 182281 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926852.1 protein_id gnl|my_center|LOCUS_23450 184074 183772 gene locus_tag LOCUS_23460 184074 183772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 184192 184434 gene locus_tag LOCUS_23470 184192 184434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 186985 185252 gene locus_tag LOCUS_23480 gene phoD 186985 185252 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 protein_id gnl|my_center|LOCUS_23480 187465 187235 gene locus_tag LOCUS_23490 187465 187235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 187542 189143 gene locus_tag LOCUS_23500 187542 189143 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029647.1 protein_id gnl|my_center|LOCUS_23500 189337 189164 gene locus_tag LOCUS_23510 189337 189164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 189556 189711 gene locus_tag LOCUS_23520 189556 189711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 189757 189969 gene locus_tag LOCUS_23530 189757 189969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 190788 190126 gene locus_tag LOCUS_23540 190788 190126 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082882.1 protein_id gnl|my_center|LOCUS_23540 191145 190849 gene locus_tag LOCUS_23550 191145 190849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 192206 191244 gene locus_tag LOCUS_23560 gene corA 192206 191244 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44998 protein_id gnl|my_center|LOCUS_23560 192932 192252 gene locus_tag LOCUS_23570 192932 192252 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P741 protein_id gnl|my_center|LOCUS_23570 194479 192950 gene locus_tag LOCUS_23580 194479 192950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23580 195148 194483 gene locus_tag LOCUS_23590 195148 194483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23590 195248 195625 gene locus_tag LOCUS_23600 195248 195625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23600 195677 195862 gene locus_tag LOCUS_23610 195677 195862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23610 196104 196952 gene locus_tag LOCUS_23620 196104 196952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence08 1278 550 gene locus_tag LOCUS_23630 1278 550 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082761.1 protein_id gnl|my_center|LOCUS_23630 1977 1291 gene locus_tag LOCUS_23640 1977 1291 CDS product glutamate/aspartate transporter permease GltK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090325.1 protein_id gnl|my_center|LOCUS_23640 2717 1977 gene locus_tag LOCUS_23650 2717 1977 CDS product glutamate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389841.1 protein_id gnl|my_center|LOCUS_23650 3714 2815 gene locus_tag LOCUS_23660 3714 2815 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090327.1 protein_id gnl|my_center|LOCUS_23660 5240 3789 gene locus_tag LOCUS_23670 gene aspA 5240 3789 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D018 protein_id gnl|my_center|LOCUS_23670 6284 5373 gene locus_tag LOCUS_23680 6284 5373 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194310.1 protein_id gnl|my_center|LOCUS_23680 8103 6265 gene locus_tag LOCUS_23690 8103 6265 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_23690 8195 9016 gene locus_tag LOCUS_23700 8195 9016 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_23700 9435 9034 gene locus_tag LOCUS_23710 9435 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 9583 9987 gene locus_tag LOCUS_23720 9583 9987 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189082.1 protein_id gnl|my_center|LOCUS_23720 10875 10000 gene locus_tag LOCUS_23730 10875 10000 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814390.1 protein_id gnl|my_center|LOCUS_23730 12523 11021 gene locus_tag LOCUS_23740 12523 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709147.1 protein_id gnl|my_center|LOCUS_23740 12978 12526 gene locus_tag LOCUS_23750 12978 12526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709148.1 protein_id gnl|my_center|LOCUS_23750 13979 13002 gene locus_tag LOCUS_23760 13979 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969733.1 protein_id gnl|my_center|LOCUS_23760 14642 14355 gene locus_tag LOCUS_23770 14642 14355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 14982 14737 gene locus_tag LOCUS_23780 14982 14737 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529551.1 protein_id gnl|my_center|LOCUS_23780 15299 14979 gene locus_tag LOCUS_23790 15299 14979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 15335 15808 gene locus_tag LOCUS_23800 15335 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 16113 15859 gene locus_tag LOCUS_23810 16113 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 17961 16366 gene locus_tag LOCUS_23820 17961 16366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 18312 17968 gene locus_tag LOCUS_23830 18312 17968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 19136 18336 gene locus_tag LOCUS_23840 19136 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 protein_id gnl|my_center|LOCUS_23840 19925 19158 gene locus_tag LOCUS_23850 19925 19158 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_23850 21217 20018 gene locus_tag LOCUS_23860 21217 20018 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537877.1 protein_id gnl|my_center|LOCUS_23860 23634 21229 gene locus_tag LOCUS_23870 23634 21229 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189629.1 protein_id gnl|my_center|LOCUS_23870 25501 23711 gene locus_tag LOCUS_23880 25501 23711 CDS product acyl-CoA dehydrogenase oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526128.1 protein_id gnl|my_center|LOCUS_23880 26134 25520 gene locus_tag LOCUS_23890 26134 25520 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 protein_id gnl|my_center|LOCUS_23890 26387 26839 gene locus_tag LOCUS_23900 26387 26839 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976297.1 protein_id gnl|my_center|LOCUS_23900 26992 27531 gene locus_tag LOCUS_23910 26992 27531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 28230 27580 gene locus_tag LOCUS_23920 28230 27580 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_23920 28822 28295 gene locus_tag LOCUS_23930 28822 28295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 31531 28892 gene locus_tag LOCUS_23940 31531 28892 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_23940 34947 31594 gene locus_tag LOCUS_23950 gene putA 34947 31594 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVC8 protein_id gnl|my_center|LOCUS_23950 35875 34937 gene locus_tag LOCUS_23960 35875 34937 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P8S4 protein_id gnl|my_center|LOCUS_23960 36900 35872 gene locus_tag LOCUS_23970 gene ocd 36900 35872 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976142.1 protein_id gnl|my_center|LOCUS_23970 38619 36991 gene locus_tag LOCUS_23980 gene mccB 38619 36991 CDS product acetyl-CoA carboxylase carboxyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083806.1 protein_id gnl|my_center|LOCUS_23980 39526 38621 gene locus_tag LOCUS_23990 gene atuB 39526 38621 CDS product citronellol catabolism dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090991.1 protein_id gnl|my_center|LOCUS_23990 39683 41467 gene locus_tag LOCUS_24000 gene atuA 39683 41467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114739.1 protein_id gnl|my_center|LOCUS_24000 41610 42362 gene locus_tag LOCUS_24010 41610 42362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 43021 42428 gene locus_tag LOCUS_24020 43021 42428 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524888.1 protein_id gnl|my_center|LOCUS_24020 43458 43036 gene locus_tag LOCUS_24030 43458 43036 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405100.1 protein_id gnl|my_center|LOCUS_24030 43678 43466 gene locus_tag LOCUS_24040 43678 43466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 44421 43762 gene locus_tag LOCUS_24050 gene yadF 44421 43762 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAC9 protein_id gnl|my_center|LOCUS_24050 45316 44540 gene locus_tag LOCUS_24060 45316 44540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 45919 45413 gene locus_tag LOCUS_24070 45919 45413 CDS product ATP-independent periplasmic protein-refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228995.1 protein_id gnl|my_center|LOCUS_24070 46054 46740 gene locus_tag LOCUS_24080 46054 46740 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887702.1 protein_id gnl|my_center|LOCUS_24080 46756 48153 gene locus_tag LOCUS_24090 46756 48153 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208493.1 protein_id gnl|my_center|LOCUS_24090 49057 48155 gene locus_tag LOCUS_24100 49057 48155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 50802 49054 gene locus_tag LOCUS_24110 50802 49054 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268710.1 protein_id gnl|my_center|LOCUS_24110 51827 50799 gene locus_tag LOCUS_24120 51827 50799 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_24120 53201 51852 gene locus_tag LOCUS_24130 gene clsB 53201 51852 CDS product cardiolipin synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P5Y6 protein_id gnl|my_center|LOCUS_24130 53986 53192 gene locus_tag LOCUS_24140 53986 53192 CDS product endonuclease/exonuclease/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268327.1 protein_id gnl|my_center|LOCUS_24140 54711 54190 gene locus_tag LOCUS_24150 gene ntpA 54711 54190 CDS product NUDIX pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189197.1 protein_id gnl|my_center|LOCUS_24150 56513 54708 gene locus_tag LOCUS_24160 gene aspS 56513 54708 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X93 protein_id gnl|my_center|LOCUS_24160 57187 56510 gene locus_tag LOCUS_24170 57187 56510 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224946.1 protein_id gnl|my_center|LOCUS_24170 57521 57177 gene locus_tag LOCUS_24180 57521 57177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 58804 57683 gene locus_tag LOCUS_24190 58804 57683 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208462.1 protein_id gnl|my_center|LOCUS_24190 58976 59950 gene locus_tag LOCUS_24200 58976 59950 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266321.1 protein_id gnl|my_center|LOCUS_24200 60074 62110 gene locus_tag LOCUS_24210 60074 62110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 62621 62085 gene locus_tag LOCUS_24220 62621 62085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929652.1 protein_id gnl|my_center|LOCUS_24220 63481 62726 gene locus_tag LOCUS_24230 gene exoY 63481 62726 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315226.1 protein_id gnl|my_center|LOCUS_24230 64912 63605 gene locus_tag LOCUS_24240 64912 63605 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194360.1 protein_id gnl|my_center|LOCUS_24240 65024 66013 gene locus_tag LOCUS_24250 gene galE 65024 66013 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938655.1 protein_id gnl|my_center|LOCUS_24250 66142 67233 gene locus_tag LOCUS_24260 gene exoZ 66142 67233 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085156.1 protein_id gnl|my_center|LOCUS_24260 67205 67981 gene locus_tag LOCUS_24270 gene tagA 67205 67981 CDS product acetyl-mannosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965614.1 protein_id gnl|my_center|LOCUS_24270 68453 67989 gene locus_tag LOCUS_24280 68453 67989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 68835 70037 gene locus_tag LOCUS_24290 68835 70037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 70078 70896 gene locus_tag LOCUS_24300 70078 70896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 70917 72290 gene locus_tag LOCUS_24310 70917 72290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 72287 73186 gene locus_tag LOCUS_24320 72287 73186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 73188 74564 gene locus_tag LOCUS_24330 73188 74564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 74561 76048 gene locus_tag LOCUS_24340 74561 76048 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533311.1 protein_id gnl|my_center|LOCUS_24340 76045 77295 gene locus_tag LOCUS_24350 76045 77295 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_24350 77289 78497 gene locus_tag LOCUS_24360 77289 78497 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061719.1 protein_id gnl|my_center|LOCUS_24360 80005 78515 gene locus_tag LOCUS_24370 80005 78515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 81623 80100 gene locus_tag LOCUS_24380 81623 80100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 82517 81855 gene locus_tag LOCUS_24390 gene ycgM 82517 81855 CDS product acylpyruvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 protein_id gnl|my_center|LOCUS_24390 82791 83012 gene locus_tag LOCUS_24400 82791 83012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 84295 83786 gene locus_tag LOCUS_24410 gene ssb 84295 83786 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA94 protein_id gnl|my_center|LOCUS_24410 85640 84324 gene locus_tag LOCUS_24420 85640 84324 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951164.1 protein_id gnl|my_center|LOCUS_24420 85732 88638 gene locus_tag LOCUS_24430 gene uvrA 85732 88638 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WG05 protein_id gnl|my_center|LOCUS_24430 88698 89591 gene locus_tag LOCUS_24440 88698 89591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 89767 90564 gene locus_tag LOCUS_24450 89767 90564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 90585 91493 gene locus_tag LOCUS_24460 90585 91493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 93033 91546 gene locus_tag LOCUS_24470 gene gltD 93033 91546 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_109751.2 protein_id gnl|my_center|LOCUS_24470 97786 93062 gene locus_tag LOCUS_24480 gene gltB 97786 93062 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204155.1 protein_id gnl|my_center|LOCUS_24480 98636 97932 gene locus_tag LOCUS_24490 98636 97932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196743.1 protein_id gnl|my_center|LOCUS_24490 99777 98641 gene locus_tag LOCUS_24500 99777 98641 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGI5 protein_id gnl|my_center|LOCUS_24500 100874 99780 gene locus_tag LOCUS_24510 gene aroB 100874 99780 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q57 protein_id gnl|my_center|LOCUS_24510 101428 100871 gene locus_tag LOCUS_24520 gene aroK 101428 100871 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9I6 protein_id gnl|my_center|LOCUS_24520 103550 101478 gene locus_tag LOCUS_24530 gene pilQ 103550 101478 CDS product pilus assembly protein PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946666.1 protein_id gnl|my_center|LOCUS_24530 104059 103550 gene locus_tag LOCUS_24540 104059 103550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 104661 104056 gene locus_tag LOCUS_24550 104661 104056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 105226 104651 gene locus_tag LOCUS_24560 105226 104651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 106065 105217 gene locus_tag LOCUS_24570 106065 105217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 106459 108843 gene locus_tag LOCUS_24580 106459 108843 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204005.1 protein_id gnl|my_center|LOCUS_24580 109222 108866 gene locus_tag LOCUS_24590 109222 108866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 109377 110684 gene locus_tag LOCUS_24600 gene lysA 109377 110684 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P709 protein_id gnl|my_center|LOCUS_24600 112077 110737 gene locus_tag LOCUS_24610 112077 110737 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931573.1 protein_id gnl|my_center|LOCUS_24610 114251 112074 gene locus_tag LOCUS_24620 114251 112074 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205270.1 protein_id gnl|my_center|LOCUS_24620 115005 114352 gene locus_tag LOCUS_24630 115005 114352 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004557316.1 protein_id gnl|my_center|LOCUS_24630 115191 115847 gene locus_tag LOCUS_24640 gene engB 115191 115847 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q42 protein_id gnl|my_center|LOCUS_24640 115867 116862 gene locus_tag LOCUS_24650 gene hemB 115867 116862 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q41 protein_id gnl|my_center|LOCUS_24650 116869 117912 gene locus_tag LOCUS_24660 gene corA 116869 117912 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208248.1 protein_id gnl|my_center|LOCUS_24660 119829 117916 gene locus_tag LOCUS_24670 gene dsbD 119829 117916 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9J5 protein_id gnl|my_center|LOCUS_24670 120597 119833 gene locus_tag LOCUS_24680 gene nodJ 120597 119833 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEK6 protein_id gnl|my_center|LOCUS_24680 121540 120590 gene locus_tag LOCUS_24690 gene nodI 121540 120590 CDS product Nod factor export ATP-binding protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYU3 protein_id gnl|my_center|LOCUS_24690 122089 121691 gene locus_tag LOCUS_24700 gene rplQ 122089 121691 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GN2 protein_id gnl|my_center|LOCUS_24700 123103 122123 gene locus_tag LOCUS_24710 gene rpoA 123103 122123 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q37 protein_id gnl|my_center|LOCUS_24710 123800 123177 gene locus_tag LOCUS_24720 gene rpsD 123800 123177 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GN0 protein_id gnl|my_center|LOCUS_24720 124269 123874 gene locus_tag LOCUS_24730 gene rpsK 124269 123874 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M7V4 protein_id gnl|my_center|LOCUS_24730 124662 124297 gene locus_tag LOCUS_24740 gene rpsM 124662 124297 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q34 protein_id gnl|my_center|LOCUS_24740 125034 124816 gene locus_tag LOCUS_24750 gene infA2 125034 124816 CDS product translation initiation factor IF-1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q32 protein_id gnl|my_center|LOCUS_24750 126366 125038 gene locus_tag LOCUS_24760 gene secY 126366 125038 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFR5 protein_id gnl|my_center|LOCUS_24760 126812 126378 gene locus_tag LOCUS_24770 gene rplO 126812 126378 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1I2 protein_id gnl|my_center|LOCUS_24770 126994 126812 gene locus_tag LOCUS_24780 gene rpmD 126994 126812 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MCD0 protein_id gnl|my_center|LOCUS_24780 127521 126997 gene locus_tag LOCUS_24790 gene rpsE 127521 126997 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q28 protein_id gnl|my_center|LOCUS_24790 127893 127531 gene locus_tag LOCUS_24800 gene rplR 127893 127531 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDT0 protein_id gnl|my_center|LOCUS_24800 128445 127912 gene locus_tag LOCUS_24810 gene rplF 128445 127912 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GM0 protein_id gnl|my_center|LOCUS_24810 128854 128459 gene locus_tag LOCUS_24820 gene rpsH 128854 128459 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GL9 protein_id gnl|my_center|LOCUS_24820 129172 128867 gene locus_tag LOCUS_24830 gene rpsN 129172 128867 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q24 protein_id gnl|my_center|LOCUS_24830 129720 129181 gene locus_tag LOCUS_24840 gene rplE 129720 129181 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q23 protein_id gnl|my_center|LOCUS_24840 130045 129731 gene locus_tag LOCUS_24850 gene rplX 130045 129731 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA66 protein_id gnl|my_center|LOCUS_24850 130421 130053 gene locus_tag LOCUS_24860 gene rplN 130421 130053 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P9L2 protein_id gnl|my_center|LOCUS_24860 130802 130530 gene locus_tag LOCUS_24870 gene rpsQ 130802 130530 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q20 protein_id gnl|my_center|LOCUS_24870 130993 130799 gene locus_tag LOCUS_24880 gene rpmC 130993 130799 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTC5 protein_id gnl|my_center|LOCUS_24880 131413 130997 gene locus_tag LOCUS_24890 gene rplP 131413 130997 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q18 protein_id gnl|my_center|LOCUS_24890 132228 131428 gene locus_tag LOCUS_24900 gene rpsC 132228 131428 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GL1 protein_id gnl|my_center|LOCUS_24900 132567 132238 gene locus_tag LOCUS_24910 gene rplV 132567 132238 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTC8 protein_id gnl|my_center|LOCUS_24910 132853 132578 gene locus_tag LOCUS_24920 gene rpsS 132853 132578 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GK9 protein_id gnl|my_center|LOCUS_24920 133696 132869 gene locus_tag LOCUS_24930 gene rplB 133696 132869 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MA56 protein_id gnl|my_center|LOCUS_24930 133994 133698 gene locus_tag LOCUS_24940 gene rplW 133994 133698 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTD1 protein_id gnl|my_center|LOCUS_24940 134611 133991 gene locus_tag LOCUS_24950 gene rplD 134611 133991 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GK6 protein_id gnl|my_center|LOCUS_24950 135266 134622 gene locus_tag LOCUS_24960 gene rplC 135266 134622 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VTD3 protein_id gnl|my_center|LOCUS_24960 135766 135365 gene locus_tag LOCUS_24970 gene rpsJ 135766 135365 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBE0 protein_id gnl|my_center|LOCUS_24970 136967 135774 gene locus_tag LOCUS_24980 gene tuf 136967 135774 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_104168.1 protein_id gnl|my_center|LOCUS_24980 139103 137001 gene locus_tag LOCUS_24990 gene fusA 139103 137001 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M9M6 protein_id gnl|my_center|LOCUS_24990 139592 139122 gene locus_tag LOCUS_25000 gene rpsG 139592 139122 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GK1 protein_id gnl|my_center|LOCUS_25000 140103 139717 gene locus_tag LOCUS_25010 gene rpsL 140103 139717 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q06 protein_id gnl|my_center|LOCUS_25010 144475 140246 gene locus_tag LOCUS_25020 gene rpoC 144475 140246 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0R8 protein_id gnl|my_center|LOCUS_25020 148608 144499 gene locus_tag LOCUS_25030 gene rpoB 148608 144499 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q03 protein_id gnl|my_center|LOCUS_25030 149124 148747 gene locus_tag LOCUS_25040 gene rplL 149124 148747 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P742 protein_id gnl|my_center|LOCUS_25040 149702 149172 gene locus_tag LOCUS_25050 gene rplJ 149702 149172 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7W0S1 protein_id gnl|my_center|LOCUS_25050 150623 149925 gene locus_tag LOCUS_25060 gene rplA 150623 149925 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q00 protein_id gnl|my_center|LOCUS_25060 151055 150624 gene locus_tag LOCUS_25070 gene rplK 151055 150624 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PZ9 protein_id gnl|my_center|LOCUS_25070 151700 151167 gene locus_tag LOCUS_25080 gene nusG 151700 151167 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MC75 protein_id gnl|my_center|LOCUS_25080 152083 151700 gene locus_tag LOCUS_25090 gene secE 152083 151700 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFG9 protein_id gnl|my_center|LOCUS_25090 152216 152141 gene locus_tag LOCUS_t00320 152216 152141 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence09 406 1059 gene locus_tag LOCUS_25100 406 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 1919 2125 gene locus_tag LOCUS_25110 1919 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 4427 2166 gene locus_tag LOCUS_25120 4427 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 5213 4521 gene locus_tag LOCUS_25130 5213 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25130 5682 5332 gene locus_tag LOCUS_25140 5682 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 6010 5675 gene locus_tag LOCUS_25150 6010 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 6342 6007 gene locus_tag LOCUS_25160 6342 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 6690 6346 gene locus_tag LOCUS_25170 6690 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 7781 6990 gene locus_tag LOCUS_25180 7781 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 8073 7774 gene locus_tag LOCUS_25190 8073 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 9555 8197 gene locus_tag LOCUS_25200 9555 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 11825 10542 gene locus_tag LOCUS_25210 11825 10542 CDS product phage integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 protein_id gnl|my_center|LOCUS_25210 12123 12033 gene locus_tag LOCUS_t00330 12123 12033 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14238 12184 gene locus_tag LOCUS_25220 14238 12184 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525415.1 protein_id gnl|my_center|LOCUS_25220 16333 14351 gene locus_tag LOCUS_25230 gene acsA 16333 14351 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62AD1 protein_id gnl|my_center|LOCUS_25230 16537 17076 gene locus_tag LOCUS_25240 16537 17076 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXI9 protein_id gnl|my_center|LOCUS_25240 17107 18627 gene locus_tag LOCUS_25250 17107 18627 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WAC6 protein_id gnl|my_center|LOCUS_25250 19427 18630 gene locus_tag LOCUS_25260 19427 18630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 21484 19571 gene locus_tag LOCUS_25270 gene prpE 21484 19571 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813753.1 protein_id gnl|my_center|LOCUS_25270 21660 22694 gene locus_tag LOCUS_25280 gene idiA 21660 22694 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_25280 22822 23487 gene locus_tag LOCUS_25290 22822 23487 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230938.1 protein_id gnl|my_center|LOCUS_25290 24897 24007 gene locus_tag LOCUS_25300 24897 24007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230939.1 protein_id gnl|my_center|LOCUS_25300 26182 24902 gene locus_tag LOCUS_25310 26182 24902 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266536.1 protein_id gnl|my_center|LOCUS_25310 27657 26230 gene locus_tag LOCUS_25320 27657 26230 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_25320 28498 27785 gene locus_tag LOCUS_25330 28498 27785 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_25330 29502 28495 gene locus_tag LOCUS_25340 29502 28495 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8U7F8 protein_id gnl|my_center|LOCUS_25340 29679 30974 gene locus_tag LOCUS_25350 29679 30974 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932228.1 protein_id gnl|my_center|LOCUS_25350 31906 30977 gene locus_tag LOCUS_25360 gene ispH 31906 30977 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYS2 protein_id gnl|my_center|LOCUS_25360 32378 31914 gene locus_tag LOCUS_25370 32378 31914 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WH1 protein_id gnl|my_center|LOCUS_25370 32464 33198 gene locus_tag LOCUS_25380 32464 33198 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM8 protein_id gnl|my_center|LOCUS_25380 33335 33568 gene locus_tag LOCUS_25390 gene rpmB 33335 33568 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWY1 protein_id gnl|my_center|LOCUS_25390 33582 33749 gene locus_tag LOCUS_25400 gene rpmG 33582 33749 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HM4 protein_id gnl|my_center|LOCUS_25400 34195 33983 gene locus_tag LOCUS_25410 34195 33983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 35568 34375 gene locus_tag LOCUS_25420 35568 34375 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_25420 37047 35701 gene locus_tag LOCUS_25430 37047 35701 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186079.1 protein_id gnl|my_center|LOCUS_25430 37703 37062 gene locus_tag LOCUS_25440 gene purN 37703 37062 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MDC4 protein_id gnl|my_center|LOCUS_25440 37807 38763 gene locus_tag LOCUS_25450 37807 38763 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WI2 protein_id gnl|my_center|LOCUS_25450 38770 41565 gene locus_tag LOCUS_25460 gene ileS 38770 41565 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MHQ7 protein_id gnl|my_center|LOCUS_25460 41558 42100 gene locus_tag LOCUS_25470 gene lspA 41558 42100 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HL3 protein_id gnl|my_center|LOCUS_25470 42107 43357 gene locus_tag LOCUS_25480 gene dfp 42107 43357 CDS product DNA/pantothenate metabolism flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039645.1 protein_id gnl|my_center|LOCUS_25480 43354 43806 gene locus_tag LOCUS_25490 gene dut 43354 43806 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZU7 protein_id gnl|my_center|LOCUS_25490 43874 45016 gene locus_tag LOCUS_25500 43874 45016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 47412 45088 gene locus_tag LOCUS_25510 gene clpA 47412 45088 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196461.1 protein_id gnl|my_center|LOCUS_25510 47717 47409 gene locus_tag LOCUS_25520 gene clpS 47717 47409 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HH7 protein_id gnl|my_center|LOCUS_25520 48080 48301 gene locus_tag LOCUS_25530 48080 48301 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196460.1 protein_id gnl|my_center|LOCUS_25530 49631 48384 gene locus_tag LOCUS_25540 gene icd 49631 48384 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WJ4 protein_id gnl|my_center|LOCUS_25540 49793 50281 gene locus_tag LOCUS_25550 49793 50281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820399.1 protein_id gnl|my_center|LOCUS_25550 51005 50358 gene locus_tag LOCUS_25560 gene sodB 51005 50358 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P564 protein_id gnl|my_center|LOCUS_25560 52384 51017 gene locus_tag LOCUS_25570 gene xseA 52384 51017 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVB6 protein_id gnl|my_center|LOCUS_25570 52685 53299 gene locus_tag LOCUS_25580 52685 53299 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812889.1 protein_id gnl|my_center|LOCUS_25580 53312 53740 gene locus_tag LOCUS_25590 53312 53740 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_25590 53737 54807 gene locus_tag LOCUS_25600 gene lpxK 53737 54807 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WL3 protein_id gnl|my_center|LOCUS_25600 54800 54964 gene locus_tag LOCUS_25610 54800 54964 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVB1 protein_id gnl|my_center|LOCUS_25610 54970 55737 gene locus_tag LOCUS_25620 gene kdsB 54970 55737 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WL5 protein_id gnl|my_center|LOCUS_25620 55909 56562 gene locus_tag LOCUS_25630 gene adk 55909 56562 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WL6 protein_id gnl|my_center|LOCUS_25630 58182 56623 gene locus_tag LOCUS_25640 58182 56623 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M8W9 protein_id gnl|my_center|LOCUS_25640 58259 58525 gene locus_tag LOCUS_25650 gene rpsT 58259 58525 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6Q6 protein_id gnl|my_center|LOCUS_25650 58955 58632 gene locus_tag LOCUS_25660 58955 58632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204914.1 protein_id gnl|my_center|LOCUS_25660 59918 59085 gene locus_tag LOCUS_25670 gene folE2 59918 59085 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DU0 protein_id gnl|my_center|LOCUS_25670 61845 59926 gene locus_tag LOCUS_25680 gene dxs 61845 59926 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P4G1 protein_id gnl|my_center|LOCUS_25680 62744 61842 gene locus_tag LOCUS_25690 62744 61842 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697633.1 protein_id gnl|my_center|LOCUS_25690 63001 62741 gene locus_tag LOCUS_25700 63001 62741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 63175 64320 gene locus_tag LOCUS_25710 63175 64320 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190814.1 protein_id gnl|my_center|LOCUS_25710 64403 65257 gene locus_tag LOCUS_25720 64403 65257 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_25720 66052 65267 gene locus_tag LOCUS_25730 66052 65267 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_25730 66976 66071 gene locus_tag LOCUS_25740 66976 66071 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_25740 69786 67003 gene locus_tag LOCUS_25750 gene polA 69786 67003 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_25750 69787 70524 gene locus_tag LOCUS_25760 69787 70524 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WCD0 protein_id gnl|my_center|LOCUS_25760 70589 71551 gene locus_tag LOCUS_25770 gene thrB 70589 71551 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DV9 protein_id gnl|my_center|LOCUS_25770 71615 72370 gene locus_tag LOCUS_25780 71615 72370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529044.1 protein_id gnl|my_center|LOCUS_25780 72443 72730 gene locus_tag LOCUS_25790 72443 72730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 72907 73188 gene locus_tag LOCUS_25800 72907 73188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 73321 73593 gene locus_tag LOCUS_25810 73321 73593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 75856 73625 gene locus_tag LOCUS_25820 gene uvrD 75856 73625 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0M904 protein_id gnl|my_center|LOCUS_25820 76021 78666 gene locus_tag LOCUS_25830 gene leuS 76021 78666 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62H20 protein_id gnl|my_center|LOCUS_25830 78693 79199 gene locus_tag LOCUS_25840 gene lptE 78693 79199 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX32 protein_id gnl|my_center|LOCUS_25840 79196 80236 gene locus_tag LOCUS_25850 gene holA 79196 80236 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194041.1 protein_id gnl|my_center|LOCUS_25850 80250 81506 gene locus_tag LOCUS_25860 gene proA 80250 81506 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62H23 protein_id gnl|my_center|LOCUS_25860 81534 81965 gene locus_tag LOCUS_25870 81534 81965 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930898.1 protein_id gnl|my_center|LOCUS_25870 81981 83327 gene locus_tag LOCUS_25880 gene rlmL 81981 83327 CDS product ribosomal RNA large subunit methyltransferase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0V4 protein_id gnl|my_center|LOCUS_25880 83771 83313 gene locus_tag LOCUS_25890 83771 83313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 85382 83793 gene locus_tag LOCUS_25900 85382 83793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 86177 85689 gene locus_tag LOCUS_25910 86177 85689 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8V1 protein_id gnl|my_center|LOCUS_25910 87269 86235 gene locus_tag LOCUS_25920 gene pilT 87269 86235 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 protein_id gnl|my_center|LOCUS_25920 87309 88022 gene locus_tag LOCUS_25930 87309 88022 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_25930 88031 88837 gene locus_tag LOCUS_25940 gene proC 88031 88837 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R27 protein_id gnl|my_center|LOCUS_25940 89717 88854 gene locus_tag LOCUS_25950 gene ubiA 89717 88854 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R13 protein_id gnl|my_center|LOCUS_25950 90665 89721 gene locus_tag LOCUS_25960 90665 89721 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811203.1 protein_id gnl|my_center|LOCUS_25960 92651 90747 gene locus_tag LOCUS_25970 92651 90747 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958448.1 protein_id gnl|my_center|LOCUS_25970 92864 93247 gene locus_tag LOCUS_25980 gene yjgF 92864 93247 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 protein_id gnl|my_center|LOCUS_25980 93268 95373 gene locus_tag LOCUS_25990 gene recG 93268 95373 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P3B5 protein_id gnl|my_center|LOCUS_25990 95859 95479 gene locus_tag LOCUS_26000 gene rplS 95859 95479 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0K5 protein_id gnl|my_center|LOCUS_26000 96725 95988 gene locus_tag LOCUS_26010 gene trmD 96725 95988 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWY7 protein_id gnl|my_center|LOCUS_26010 97291 96725 gene locus_tag LOCUS_26020 gene rimM 97291 96725 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P2N7 protein_id gnl|my_center|LOCUS_26020 97688 97434 gene locus_tag LOCUS_26030 gene rpsP 97688 97434 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VXD8 protein_id gnl|my_center|LOCUS_26030 97830 98183 gene locus_tag LOCUS_26040 97830 98183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 99416 98409 gene locus_tag LOCUS_26050 gene hldD 99416 98409 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M34 protein_id gnl|my_center|LOCUS_26050 100364 99441 gene locus_tag LOCUS_26060 100364 99441 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217546.1 protein_id gnl|my_center|LOCUS_26060 101586 100378 gene locus_tag LOCUS_26070 gene lapB 101586 100378 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S09 protein_id gnl|my_center|LOCUS_26070 102295 101999 gene locus_tag LOCUS_26080 gene ihfB 102295 101999 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGW8 protein_id gnl|my_center|LOCUS_26080 104055 102352 gene locus_tag LOCUS_26090 gene rpsA 104055 102352 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S06 protein_id gnl|my_center|LOCUS_26090 104887 104213 gene locus_tag LOCUS_26100 gene cmk 104887 104213 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ92 protein_id gnl|my_center|LOCUS_26100 106234 104891 gene locus_tag LOCUS_26110 106234 104891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26110 107181 106294 gene locus_tag LOCUS_26120 107181 106294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26120 108308 107181 gene locus_tag LOCUS_26130 gene hisC2 108308 107181 CDS product histidinol-phosphate aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ68 protein_id gnl|my_center|LOCUS_26130 109410 108319 gene locus_tag LOCUS_26140 109410 108319 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190098.1 protein_id gnl|my_center|LOCUS_26140 110528 109410 gene locus_tag LOCUS_26150 gene serC 110528 109410 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S02 protein_id gnl|my_center|LOCUS_26150 113201 110556 gene locus_tag LOCUS_26160 gene gyrA 113201 110556 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZG5 protein_id gnl|my_center|LOCUS_26160 113359 114693 gene locus_tag LOCUS_26170 113359 114693 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037414.1 protein_id gnl|my_center|LOCUS_26170 114769 115419 gene locus_tag LOCUS_26180 gene ompA 114769 115419 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813377.1 protein_id gnl|my_center|LOCUS_26180 115527 116243 gene locus_tag LOCUS_26190 gene ubiG 115527 116243 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ63 protein_id gnl|my_center|LOCUS_26190 116254 116910 gene locus_tag LOCUS_26200 gene gph-1 116254 116910 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190123.1 protein_id gnl|my_center|LOCUS_26200 116948 117331 gene locus_tag LOCUS_tm00010 116948 117331 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 117683 117372 gene locus_tag LOCUS_26210 117683 117372 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551036.1 protein_id gnl|my_center|LOCUS_26210 119021 117753 gene locus_tag LOCUS_26220 gene gcd 119021 117753 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229955.1 protein_id gnl|my_center|LOCUS_26220 119420 119184 gene locus_tag LOCUS_26230 119420 119184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 119897 120763 gene locus_tag LOCUS_26240 119897 120763 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268385.1 protein_id gnl|my_center|LOCUS_26240 121644 120760 gene locus_tag LOCUS_26250 121644 120760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 122582 121647 gene locus_tag LOCUS_26260 122582 121647 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142546.1 protein_id gnl|my_center|LOCUS_26260 122696 123826 gene locus_tag LOCUS_26270 gene nerA 122696 123826 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036508.1 protein_id gnl|my_center|LOCUS_26270 123916 124233 gene locus_tag LOCUS_26280 123916 124233 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030572.1 protein_id gnl|my_center|LOCUS_26280 125289 124237 gene locus_tag LOCUS_26290 125289 124237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550375.1 protein_id gnl|my_center|LOCUS_26290 126192 125356 gene locus_tag LOCUS_26300 gene frmB 126192 125356 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E801 protein_id gnl|my_center|LOCUS_26300 127312 126194 gene locus_tag LOCUS_26310 127312 126194 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KES6 protein_id gnl|my_center|LOCUS_26310 127458 128039 gene locus_tag LOCUS_26320 127458 128039 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921086.1 protein_id gnl|my_center|LOCUS_26320 128036 128671 gene locus_tag LOCUS_26330 128036 128671 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708151.1 protein_id gnl|my_center|LOCUS_26330 129338 128685 gene locus_tag LOCUS_26340 129338 128685 CDS product SM-20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706239.1 protein_id gnl|my_center|LOCUS_26340 130316 129405 gene locus_tag LOCUS_26350 130316 129405 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706646.1 protein_id gnl|my_center|LOCUS_26350 131181 130459 gene locus_tag LOCUS_26360 131181 130459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 132292 131324 gene locus_tag LOCUS_26370 gene astE 132292 131324 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811668.1 protein_id gnl|my_center|LOCUS_26370 134791 132425 gene locus_tag LOCUS_26380 134791 132425 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104717.1 protein_id gnl|my_center|LOCUS_26380 135966 134806 gene locus_tag LOCUS_26390 135966 134806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104718.1 protein_id gnl|my_center|LOCUS_26390 137415 136072 gene locus_tag LOCUS_26400 137415 136072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114488.1 protein_id gnl|my_center|LOCUS_26400 139453 137471 gene locus_tag LOCUS_26410 139453 137471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 protein_id gnl|my_center|LOCUS_26410 139742 140617 gene locus_tag LOCUS_26420 gene ada 139742 140617 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_26420 141267 140632 gene locus_tag LOCUS_26430 141267 140632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 141804 142571 gene locus_tag LOCUS_26440 141804 142571 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105202.1 protein_id gnl|my_center|LOCUS_26440 142668 143927 gene locus_tag LOCUS_26450 gene yfeW 142668 143927 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_26450 >Feature sequence10 469 1404 gene locus_tag LOCUS_26460 469 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1401 2843 gene locus_tag LOCUS_26470 1401 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 3419 2922 gene locus_tag LOCUS_26480 3419 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 6071 4017 gene locus_tag LOCUS_26490 6071 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038874.1 protein_id gnl|my_center|LOCUS_26490 8703 6094 gene locus_tag LOCUS_26500 8703 6094 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939302.1 protein_id gnl|my_center|LOCUS_26500 9839 8703 gene locus_tag LOCUS_26510 9839 8703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 13419 9832 gene locus_tag LOCUS_26520 13419 9832 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022345.1 protein_id gnl|my_center|LOCUS_26520 17105 13428 gene locus_tag LOCUS_26530 17105 13428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_26530 17738 17151 gene locus_tag LOCUS_26540 17738 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065384.1 protein_id gnl|my_center|LOCUS_26540 18328 17735 gene locus_tag LOCUS_26550 18328 17735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 19304 18309 gene locus_tag LOCUS_26560 19304 18309 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_26560 19433 19612 gene locus_tag LOCUS_26570 19433 19612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 20273 20584 gene locus_tag LOCUS_26580 20273 20584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 20718 20972 gene locus_tag LOCUS_26590 20718 20972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 20965 21141 gene locus_tag LOCUS_26600 20965 21141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 21294 21219 gene locus_tag LOCUS_t00340 21294 21219 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 22603 21416 gene locus_tag LOCUS_26610 gene aspC 22603 21416 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKK1 protein_id gnl|my_center|LOCUS_26610 22840 24903 gene locus_tag LOCUS_26620 gene uvrB 22840 24903 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P150 protein_id gnl|my_center|LOCUS_26620 24963 25454 gene locus_tag LOCUS_26630 gene ptpA 24963 25454 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_26630 25754 26245 gene locus_tag LOCUS_26640 gene iscR 25754 26245 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195928.1 protein_id gnl|my_center|LOCUS_26640 26273 27484 gene locus_tag LOCUS_26650 gene iscS 26273 27484 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SN1 protein_id gnl|my_center|LOCUS_26650 27512 27892 gene locus_tag LOCUS_26660 gene iscU 27512 27892 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEG3 protein_id gnl|my_center|LOCUS_26660 27927 28250 gene locus_tag LOCUS_26670 27927 28250 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191333.1 protein_id gnl|my_center|LOCUS_26670 28250 28786 gene locus_tag LOCUS_26680 gene hscB 28250 28786 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IZ4 protein_id gnl|my_center|LOCUS_26680 28786 30669 gene locus_tag LOCUS_26690 gene hscA 28786 30669 CDS product chaperone protein HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IZ5 protein_id gnl|my_center|LOCUS_26690 30699 31037 gene locus_tag LOCUS_26700 gene fdx 30699 31037 CDS product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387062.1 protein_id gnl|my_center|LOCUS_26700 31057 31251 gene locus_tag LOCUS_26710 31057 31251 CDS product Fe-S assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004698764.1 protein_id gnl|my_center|LOCUS_26710 32670 31252 gene locus_tag LOCUS_26720 32670 31252 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931292.1 protein_id gnl|my_center|LOCUS_26720 33363 32968 gene locus_tag LOCUS_26730 33363 32968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 34276 33425 gene locus_tag LOCUS_26740 34276 33425 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103243.1 protein_id gnl|my_center|LOCUS_26740 35058 34513 gene locus_tag LOCUS_26750 35058 34513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 35118 38402 gene locus_tag LOCUS_26760 35118 38402 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_26760 38442 41006 gene locus_tag LOCUS_26770 38442 41006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187774.1 protein_id gnl|my_center|LOCUS_26770 41009 41926 gene locus_tag LOCUS_26780 41009 41926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 protein_id gnl|my_center|LOCUS_26780 42387 42151 gene locus_tag LOCUS_26790 42387 42151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 42905 42567 gene locus_tag LOCUS_26800 42905 42567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 44864 43317 gene locus_tag LOCUS_26810 gene lysS 44864 43317 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SN9 protein_id gnl|my_center|LOCUS_26810 45782 44868 gene locus_tag LOCUS_26820 gene prfB 45782 44868 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ35 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26820 47773 46025 gene locus_tag LOCUS_26830 gene recJ 47773 46025 CDS product single-stranded-DNA-specific exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191649.1 protein_id gnl|my_center|LOCUS_26830 48963 47773 gene locus_tag LOCUS_26840 48963 47773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 49022 50278 gene locus_tag LOCUS_26850 49022 50278 CDS product lipoprotein releasing system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_26850 50271 50960 gene locus_tag LOCUS_26860 gene lolD 50271 50960 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EHT6 protein_id gnl|my_center|LOCUS_26860 51575 50976 gene locus_tag LOCUS_26870 51575 50976 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 protein_id gnl|my_center|LOCUS_26870 51552 52337 gene locus_tag LOCUS_26880 51552 52337 CDS product TatD related DNase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527360.1 protein_id gnl|my_center|LOCUS_26880 52426 54861 gene locus_tag LOCUS_26890 52426 54861 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039712.1 protein_id gnl|my_center|LOCUS_26890 54961 56376 gene locus_tag LOCUS_26900 54961 56376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087741.1 protein_id gnl|my_center|LOCUS_26900 56386 57345 gene locus_tag LOCUS_26910 56386 57345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087742.1 protein_id gnl|my_center|LOCUS_26910 57342 58145 gene locus_tag LOCUS_26920 57342 58145 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267290.1 protein_id gnl|my_center|LOCUS_26920 58983 58201 gene locus_tag LOCUS_26930 gene bdhA 58983 58201 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113501.1 protein_id gnl|my_center|LOCUS_26930 59053 59913 gene locus_tag LOCUS_26940 59053 59913 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203918.1 protein_id gnl|my_center|LOCUS_26940 59944 62238 gene locus_tag LOCUS_26950 gene relA 59944 62238 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521683.1 protein_id gnl|my_center|LOCUS_26950 64394 62247 gene locus_tag LOCUS_26960 gene ppk 64394 62247 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63V75 protein_id gnl|my_center|LOCUS_26960 64539 66038 gene locus_tag LOCUS_26970 gene ppx 64539 66038 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192703.1 protein_id gnl|my_center|LOCUS_26970 66874 66074 gene locus_tag LOCUS_26980 66874 66074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809629.1 protein_id gnl|my_center|LOCUS_26980 67129 67338 gene locus_tag LOCUS_26990 67129 67338 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_26990 69321 67405 gene locus_tag LOCUS_27000 69321 67405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 70093 69425 gene locus_tag LOCUS_27010 gene dheII 70093 69425 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_27010 70198 71100 gene locus_tag LOCUS_27020 70198 71100 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266649.1 protein_id gnl|my_center|LOCUS_27020 71228 74563 gene locus_tag LOCUS_27030 71228 74563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 74775 75755 gene locus_tag LOCUS_27040 74775 75755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 75932 76177 gene locus_tag LOCUS_27050 75932 76177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 76283 77965 gene locus_tag LOCUS_27060 76283 77965 CDS product efflux pump/antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528518.1 protein_id gnl|my_center|LOCUS_27060 79498 78182 gene locus_tag LOCUS_27070 gene aceA 79498 78182 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706620.1 protein_id gnl|my_center|LOCUS_27070 80280 79789 gene locus_tag LOCUS_27080 80280 79789 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SX7 protein_id gnl|my_center|LOCUS_27080 81388 80372 gene locus_tag LOCUS_27090 81388 80372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 81514 82389 gene locus_tag LOCUS_27100 81514 82389 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207613.1 protein_id gnl|my_center|LOCUS_27100 85041 82453 gene locus_tag LOCUS_27110 gene clpB 85041 82453 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63UW2 protein_id gnl|my_center|LOCUS_27110 85165 85689 gene locus_tag LOCUS_27120 85165 85689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 85761 86114 gene locus_tag LOCUS_27130 85761 86114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 87559 86096 gene locus_tag LOCUS_27140 87559 86096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 88989 87658 gene locus_tag LOCUS_27150 88989 87658 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229174.1 protein_id gnl|my_center|LOCUS_27150 89621 88983 gene locus_tag LOCUS_27160 89621 88983 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RV4 protein_id gnl|my_center|LOCUS_27160 90366 89635 gene locus_tag LOCUS_27170 gene rph 90366 89635 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62HZ8 protein_id gnl|my_center|LOCUS_27170 91595 90405 gene locus_tag LOCUS_27180 gene dinP 91595 90405 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZJ4 protein_id gnl|my_center|LOCUS_27180 91652 92581 gene locus_tag LOCUS_27190 91652 92581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185526.1 protein_id gnl|my_center|LOCUS_27190 92689 93336 gene locus_tag LOCUS_27200 gene gmk 92689 93336 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RV7 protein_id gnl|my_center|LOCUS_27200 93346 93552 gene locus_tag LOCUS_27210 gene rpoZ 93346 93552 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RV8 protein_id gnl|my_center|LOCUS_27210 93653 94438 gene locus_tag LOCUS_27220 93653 94438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 94449 95261 gene locus_tag LOCUS_27230 gene minD 94449 95261 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MFH6 protein_id gnl|my_center|LOCUS_27230 95266 95520 gene locus_tag LOCUS_27240 gene minE 95266 95520 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MEI5 protein_id gnl|my_center|LOCUS_27240 95568 97808 gene locus_tag LOCUS_27250 95568 97808 CDS product guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194871.1 protein_id gnl|my_center|LOCUS_27250 98945 98301 gene locus_tag LOCUS_27260 gene greB 98945 98301 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ24 protein_id gnl|my_center|LOCUS_27260 98961 100697 gene locus_tag LOCUS_27270 98961 100697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 101825 100680 gene locus_tag LOCUS_27280 gene cheB1 101825 100680 CDS product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62G12 protein_id gnl|my_center|LOCUS_27280 102436 101837 gene locus_tag LOCUS_27290 gene cheD1 102436 101837 CDS product putative chemoreceptor glutamine deamidase CheD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF62 protein_id gnl|my_center|LOCUS_27290 103425 102433 gene locus_tag LOCUS_27300 gene cheR 103425 102433 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGN6 protein_id gnl|my_center|LOCUS_27300 103605 105143 gene locus_tag LOCUS_27310 103605 105143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 105136 105765 gene locus_tag LOCUS_27320 105136 105765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 107031 106054 gene locus_tag LOCUS_27330 gene flgL 107031 106054 CDS product flagellar hook-filament junction protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212764.1 protein_id gnl|my_center|LOCUS_27330 108785 107052 gene locus_tag LOCUS_27340 gene flgK 108785 107052 CDS product flagellar hook-associated protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTW4 protein_id gnl|my_center|LOCUS_27340 109229 108816 gene locus_tag LOCUS_27350 109229 108816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 110377 109232 gene locus_tag LOCUS_27360 gene flgI 110377 109232 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YB1 protein_id gnl|my_center|LOCUS_27360 111080 110391 gene locus_tag LOCUS_27370 gene flgH 111080 110391 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VYG3 protein_id gnl|my_center|LOCUS_27370 111911 111129 gene locus_tag LOCUS_27380 gene flgG 111911 111129 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNG7 protein_id gnl|my_center|LOCUS_27380 112663 111926 gene locus_tag LOCUS_27390 gene flgF 112663 111926 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHB5 protein_id gnl|my_center|LOCUS_27390 113996 112683 gene locus_tag LOCUS_27400 gene flgE 113996 112683 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC97 protein_id gnl|my_center|LOCUS_27400 114694 114023 gene locus_tag LOCUS_27410 gene flgD 114694 114023 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CHX8 protein_id gnl|my_center|LOCUS_27410 115130 114708 gene locus_tag LOCUS_27420 gene flgC 115130 114708 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885A2 protein_id gnl|my_center|LOCUS_27420 115602 115150 gene locus_tag LOCUS_27430 gene flgB 115602 115150 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P279 protein_id gnl|my_center|LOCUS_27430 115795 116541 gene locus_tag LOCUS_27440 115795 116541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 116656 116946 gene locus_tag LOCUS_27450 116656 116946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 116989 117504 gene locus_tag LOCUS_27460 116989 117504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 117919 117479 gene locus_tag LOCUS_27470 117919 117479 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_27470 119830 117932 gene locus_tag LOCUS_27480 119830 117932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 120553 119837 gene locus_tag LOCUS_27490 gene fliA 120553 119837 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PT1 protein_id gnl|my_center|LOCUS_27490 121337 120579 gene locus_tag LOCUS_27500 121337 120579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 122740 121361 gene locus_tag LOCUS_27510 122740 121361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 124845 122737 gene locus_tag LOCUS_27520 gene flhA 124845 122737 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198639.1 protein_id gnl|my_center|LOCUS_27520 126594 125464 gene locus_tag LOCUS_27530 gene flhB 126594 125464 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_27530 126702 127052 gene locus_tag LOCUS_27540 126702 127052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 128870 127125 gene locus_tag LOCUS_27550 128870 127125 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267534.1 protein_id gnl|my_center|LOCUS_27550 130930 129086 gene locus_tag LOCUS_27560 130930 129086 CDS product chemotaxis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342347.1 protein_id gnl|my_center|LOCUS_27560 131728 130967 gene locus_tag LOCUS_27570 gene cheZ 131728 130967 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZ92 protein_id gnl|my_center|LOCUS_27570 132151 131762 gene locus_tag LOCUS_27580 132151 131762 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500431.1 protein_id gnl|my_center|LOCUS_27580 133091 132162 gene locus_tag LOCUS_27590 gene cheV 133091 132162 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073135.1 protein_id gnl|my_center|LOCUS_27590 134104 133136 gene locus_tag LOCUS_27600 gene motB 134104 133136 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817154.1 protein_id gnl|my_center|LOCUS_27600 134973 134110 gene locus_tag LOCUS_27610 gene motA 134973 134110 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198197.1 protein_id gnl|my_center|LOCUS_27610 135861 135298 gene locus_tag LOCUS_27620 gene flhC 135861 135298 CDS product flagellar transcriptional regulator FlhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFT0 protein_id gnl|my_center|LOCUS_27620 136365 135931 gene locus_tag LOCUS_27630 136365 135931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence11 235 804 gene locus_tag LOCUS_27640 235 804 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942355.1 protein_id gnl|my_center|LOCUS_27640 1267 2445 gene locus_tag LOCUS_27650 gene nhaA 1267 2445 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G8 protein_id gnl|my_center|LOCUS_27650 2461 3132 gene locus_tag LOCUS_27660 gene ywbO 2461 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39598 protein_id gnl|my_center|LOCUS_27660 3212 4546 gene locus_tag LOCUS_27670 3212 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038811.1 protein_id gnl|my_center|LOCUS_27670 5007 4564 gene locus_tag LOCUS_27680 5007 4564 CDS product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204789.1 protein_id gnl|my_center|LOCUS_27680 7101 5113 gene locus_tag LOCUS_27690 gene sepA 7101 5113 CDS product alkyl sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989908.1 protein_id gnl|my_center|LOCUS_27690 8537 7140 gene locus_tag LOCUS_27700 8537 7140 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4E6 protein_id gnl|my_center|LOCUS_27700 8576 9208 gene locus_tag LOCUS_27710 gene pmtA 8576 9208 CDS product phospholipid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_27710 9427 9230 gene locus_tag LOCUS_27720 9427 9230 CDS product copper chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206222.1 protein_id gnl|my_center|LOCUS_27720 9551 11767 gene locus_tag LOCUS_27730 9551 11767 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266544.1 protein_id gnl|my_center|LOCUS_27730 11790 12206 gene locus_tag LOCUS_27740 11790 12206 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816523.1 protein_id gnl|my_center|LOCUS_27740 12818 12219 gene locus_tag LOCUS_27750 12818 12219 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640067.1 protein_id gnl|my_center|LOCUS_27750 15954 12820 gene locus_tag LOCUS_27760 gene acrB 15954 12820 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095890.1 protein_id gnl|my_center|LOCUS_27760 17142 15979 gene locus_tag LOCUS_27770 gene acrA 17142 15979 CDS product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_27770 17393 18679 gene locus_tag LOCUS_27780 gene ndh 17393 18679 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808608.1 protein_id gnl|my_center|LOCUS_27780 19415 18684 gene locus_tag LOCUS_27790 19415 18684 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188660.1 protein_id gnl|my_center|LOCUS_27790 19672 19412 gene locus_tag LOCUS_27800 19672 19412 CDS product sugar transporter SemiSWEET inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G85 protein_id gnl|my_center|LOCUS_27800 20628 19672 gene locus_tag LOCUS_27810 20628 19672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 21008 20625 gene locus_tag LOCUS_27820 21008 20625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 21141 21725 gene locus_tag LOCUS_27830 21141 21725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 22091 22528 gene locus_tag LOCUS_27840 22091 22528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 22521 24140 gene locus_tag LOCUS_27850 22521 24140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 25043 24144 gene locus_tag LOCUS_27860 25043 24144 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263863.1 protein_id gnl|my_center|LOCUS_27860 27205 25250 gene locus_tag LOCUS_27870 27205 25250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103382.1 protein_id gnl|my_center|LOCUS_27870 27870 27295 gene locus_tag LOCUS_27880 27870 27295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 28030 28338 gene locus_tag LOCUS_27890 28030 28338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 28351 30069 gene locus_tag LOCUS_27900 28351 30069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114194.1 protein_id gnl|my_center|LOCUS_27900 30062 30379 gene locus_tag LOCUS_27910 30062 30379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 32290 30761 gene locus_tag LOCUS_27920 32290 30761 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035506.1 protein_id gnl|my_center|LOCUS_27920 32610 32287 gene locus_tag LOCUS_27930 32610 32287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 34342 32771 gene locus_tag LOCUS_27940 gene ahpF 34342 32771 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206518.1 protein_id gnl|my_center|LOCUS_27940 35003 34440 gene locus_tag LOCUS_27950 gene ahpC 35003 34440 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071237.1 protein_id gnl|my_center|LOCUS_27950 35409 36761 gene locus_tag LOCUS_27960 35409 36761 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525828.1 protein_id gnl|my_center|LOCUS_27960 36991 36776 gene locus_tag LOCUS_27970 36991 36776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 37038 37346 gene locus_tag LOCUS_27980 37038 37346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 37646 37362 gene locus_tag LOCUS_27990 37646 37362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 37828 38730 gene locus_tag LOCUS_28000 37828 38730 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036907.1 protein_id gnl|my_center|LOCUS_28000 38867 39733 gene locus_tag LOCUS_28010 38867 39733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 39752 40633 gene locus_tag LOCUS_28020 39752 40633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 40630 41367 gene locus_tag LOCUS_28030 gene phnC 40630 41367 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AQ6 protein_id gnl|my_center|LOCUS_28030 41371 42288 gene locus_tag LOCUS_28040 41371 42288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461155.1 protein_id gnl|my_center|LOCUS_28040 43898 42306 gene locus_tag LOCUS_28050 gene ggt 43898 42306 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035546.1 protein_id gnl|my_center|LOCUS_28050 44760 43924 gene locus_tag LOCUS_28060 44760 43924 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RUP6 protein_id gnl|my_center|LOCUS_28060 46101 44779 gene locus_tag LOCUS_28070 46101 44779 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_28070 46604 46101 gene locus_tag LOCUS_28080 46604 46101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 47711 46620 gene locus_tag LOCUS_28090 47711 46620 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_28090 48524 48078 gene locus_tag LOCUS_28100 gene ywrC 48524 48078 CDS product putative HTH-type transcriptional regulator YwrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05217 protein_id gnl|my_center|LOCUS_28100 48681 49433 gene locus_tag LOCUS_28110 gene modA 48681 49433 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_28110 50310 49450 gene locus_tag LOCUS_28120 50310 49450 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813546.1 protein_id gnl|my_center|LOCUS_28120 51800 50322 gene locus_tag LOCUS_28130 51800 50322 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_28130 52095 53654 gene locus_tag LOCUS_28140 52095 53654 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_28140 55082 53640 gene locus_tag LOCUS_28150 55082 53640 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_28150 56252 55086 gene locus_tag LOCUS_28160 56252 55086 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 protein_id gnl|my_center|LOCUS_28160 56407 57009 gene locus_tag LOCUS_28170 56407 57009 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_28170 58168 57014 gene locus_tag LOCUS_28180 58168 57014 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 protein_id gnl|my_center|LOCUS_28180 59339 58194 gene locus_tag LOCUS_28190 59339 58194 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNE9 protein_id gnl|my_center|LOCUS_28190 60647 59463 gene locus_tag LOCUS_28200 60647 59463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 61071 60652 gene locus_tag LOCUS_28210 61071 60652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 61223 61870 gene locus_tag LOCUS_28220 61223 61870 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937743.1 protein_id gnl|my_center|LOCUS_28220 61867 62970 gene locus_tag LOCUS_28230 61867 62970 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887703.1 protein_id gnl|my_center|LOCUS_28230 62967 66077 gene locus_tag LOCUS_28240 62967 66077 CDS product ACR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887704.1 protein_id gnl|my_center|LOCUS_28240 66074 66853 gene locus_tag LOCUS_28250 66074 66853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 66936 68234 gene locus_tag LOCUS_28260 66936 68234 CDS product SGNH hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027110.1 protein_id gnl|my_center|LOCUS_28260 68976 68242 gene locus_tag LOCUS_28270 68976 68242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 70325 69003 gene locus_tag LOCUS_28280 70325 69003 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 protein_id gnl|my_center|LOCUS_28280 70954 70322 gene locus_tag LOCUS_28290 70954 70322 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027327.1 protein_id gnl|my_center|LOCUS_28290 71269 70955 gene locus_tag LOCUS_28300 71269 70955 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7H3 protein_id gnl|my_center|LOCUS_28300 71473 72561 gene locus_tag LOCUS_28310 71473 72561 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080864.1 protein_id gnl|my_center|LOCUS_28310 72685 74364 gene locus_tag LOCUS_28320 72685 74364 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090609.1 protein_id gnl|my_center|LOCUS_28320 74372 74809 gene locus_tag LOCUS_28330 74372 74809 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226776.1 protein_id gnl|my_center|LOCUS_28330 75973 74813 gene locus_tag LOCUS_28340 75973 74813 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 protein_id gnl|my_center|LOCUS_28340 76117 77151 gene locus_tag LOCUS_28350 gene oruR 76117 77151 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947736.1 protein_id gnl|my_center|LOCUS_28350 77244 79283 gene locus_tag LOCUS_28360 gene fadH1 77244 79283 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_28360 79334 81025 gene locus_tag LOCUS_28370 79334 81025 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_28370 82129 81269 gene locus_tag LOCUS_28380 82129 81269 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770654.1 protein_id gnl|my_center|LOCUS_28380 82423 83337 gene locus_tag LOCUS_28390 82423 83337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202681.1 protein_id gnl|my_center|LOCUS_28390 84728 83397 gene locus_tag LOCUS_28400 84728 83397 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_28400 85027 84725 gene locus_tag LOCUS_28410 85027 84725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 86419 85736 gene locus_tag LOCUS_28420 86419 85736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28420 86707 86835 gene locus_tag LOCUS_28430 86707 86835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 86896 87477 gene locus_tag LOCUS_28440 86896 87477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_28440 87571 87804 gene locus_tag LOCUS_28450 87571 87804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 87923 88654 gene locus_tag LOCUS_28460 87923 88654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 89371 89958 gene locus_tag LOCUS_28470 89371 89958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 90058 90945 gene locus_tag LOCUS_28480 90058 90945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 91019 91552 gene locus_tag LOCUS_28490 91019 91552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 91634 92230 gene locus_tag LOCUS_28500 91634 92230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 92410 92610 gene locus_tag LOCUS_28510 92410 92610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 93096 93377 gene locus_tag LOCUS_28520 93096 93377 CDS product plasmid maintenance system killer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530250.1 protein_id gnl|my_center|LOCUS_28520 93388 93684 gene locus_tag LOCUS_28530 93388 93684 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390816.1 protein_id gnl|my_center|LOCUS_28530 93767 94477 gene locus_tag LOCUS_28540 93767 94477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 94595 95197 gene locus_tag LOCUS_28550 94595 95197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 95202 95966 gene locus_tag LOCUS_28560 95202 95966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 96841 97260 gene locus_tag LOCUS_28570 96841 97260 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530666.1 protein_id gnl|my_center|LOCUS_28570 97332 97595 gene locus_tag LOCUS_28580 97332 97595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 97766 98008 gene locus_tag LOCUS_28590 97766 98008 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_28590 98005 98268 gene locus_tag LOCUS_28600 98005 98268 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_28600 98297 98539 gene locus_tag LOCUS_28610 98297 98539 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7H1 protein_id gnl|my_center|LOCUS_28610 98900 99394 gene locus_tag LOCUS_28620 98900 99394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 101717 99489 gene locus_tag LOCUS_28630 gene glcB 101717 99489 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MBM1 protein_id gnl|my_center|LOCUS_28630 101899 103545 gene locus_tag LOCUS_28640 101899 103545 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706545.1 protein_id gnl|my_center|LOCUS_28640 103579 103791 gene locus_tag LOCUS_28650 103579 103791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 103833 104735 gene locus_tag LOCUS_28660 103833 104735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 105904 104741 gene locus_tag LOCUS_28670 gene olE1 105904 104741 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116208.1 protein_id gnl|my_center|LOCUS_28670 106955 106050 gene locus_tag LOCUS_28680 gene rdgC 106955 106050 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P1R9 protein_id gnl|my_center|LOCUS_28680 107097 108155 gene locus_tag LOCUS_28690 107097 108155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_28690 108152 108946 gene locus_tag LOCUS_28700 108152 108946 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_28700 109027 109845 gene locus_tag LOCUS_28710 109027 109845 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367416.1 protein_id gnl|my_center|LOCUS_28710 109922 110179 gene locus_tag LOCUS_28720 109922 110179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 110803 110189 gene locus_tag LOCUS_28730 110803 110189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 111392 110811 gene locus_tag LOCUS_28740 111392 110811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 112076 111528 gene locus_tag LOCUS_28750 112076 111528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 112603 112079 gene locus_tag LOCUS_28760 112603 112079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 >Feature sequence12 1159 383 gene locus_tag LOCUS_28770 1159 383 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815367.1 protein_id gnl|my_center|LOCUS_28770 1318 2064 gene locus_tag LOCUS_28780 1318 2064 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_28780 2122 3402 gene locus_tag LOCUS_28790 2122 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 3405 3887 gene locus_tag LOCUS_28800 3405 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267848.1 protein_id gnl|my_center|LOCUS_28800 3948 4934 gene locus_tag LOCUS_28810 3948 4934 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064835.1 protein_id gnl|my_center|LOCUS_28810 4968 6821 gene locus_tag LOCUS_28820 4968 6821 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_28820 7603 6815 gene locus_tag LOCUS_28830 gene trpC 7603 6815 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD70 protein_id gnl|my_center|LOCUS_28830 8654 7617 gene locus_tag LOCUS_28840 gene trpD 8654 7617 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QH1 protein_id gnl|my_center|LOCUS_28840 9270 8686 gene locus_tag LOCUS_28850 9270 8686 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689643.1 protein_id gnl|my_center|LOCUS_28850 10891 9383 gene locus_tag LOCUS_28860 gene trpE 10891 9383 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186866.1 protein_id gnl|my_center|LOCUS_28860 11568 10888 gene locus_tag LOCUS_28870 gene gph 11568 10888 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_28870 12255 11575 gene locus_tag LOCUS_28880 gene rpe 12255 11575 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WDZ4 protein_id gnl|my_center|LOCUS_28880 12407 12790 gene locus_tag LOCUS_28890 gene apaG 12407 12790 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6PBP1 protein_id gnl|my_center|LOCUS_28890 12984 12787 gene locus_tag LOCUS_28900 12984 12787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 13088 14176 gene locus_tag LOCUS_28910 13088 14176 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_28910 14991 14182 gene locus_tag LOCUS_28920 14991 14182 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200647.1 protein_id gnl|my_center|LOCUS_28920 16316 15081 gene locus_tag LOCUS_28930 16316 15081 CDS product ubiquinone biosynthesis hydroxylase UbiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186858.1 protein_id gnl|my_center|LOCUS_28930 16445 16520 gene locus_tag LOCUS_t00350 16445 16520 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 16665 17774 gene locus_tag LOCUS_28940 16665 17774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 17816 18223 gene locus_tag LOCUS_28950 17816 18223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 18508 18239 gene locus_tag LOCUS_28960 18508 18239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 20069 18555 gene locus_tag LOCUS_28970 20069 18555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 20596 20180 gene locus_tag LOCUS_28980 20596 20180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 21343 20684 gene locus_tag LOCUS_28990 21343 20684 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090120.1 protein_id gnl|my_center|LOCUS_28990 23570 21354 gene locus_tag LOCUS_29000 23570 21354 CDS product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227650.1 protein_id gnl|my_center|LOCUS_29000 24659 23862 gene locus_tag LOCUS_29010 24659 23862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103688.1 protein_id gnl|my_center|LOCUS_29010 26109 24673 gene locus_tag LOCUS_29020 26109 24673 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TLW9 protein_id gnl|my_center|LOCUS_29020 28593 26251 gene locus_tag LOCUS_29030 28593 26251 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267184.1 protein_id gnl|my_center|LOCUS_29030 29796 28624 gene locus_tag LOCUS_29040 29796 28624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 31233 29866 gene locus_tag LOCUS_29050 31233 29866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX91 protein_id gnl|my_center|LOCUS_29050 33120 31261 gene locus_tag LOCUS_29060 33120 31261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 protein_id gnl|my_center|LOCUS_29060 34100 33498 gene locus_tag LOCUS_29070 34100 33498 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086676.1 protein_id gnl|my_center|LOCUS_29070 36377 34215 gene locus_tag LOCUS_29080 36377 34215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 37649 36498 gene locus_tag LOCUS_29090 37649 36498 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532735.1 protein_id gnl|my_center|LOCUS_29090 38361 37744 gene locus_tag LOCUS_29100 gene cysC 38361 37744 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP33 protein_id gnl|my_center|LOCUS_29100 39389 38361 gene locus_tag LOCUS_29110 39389 38361 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_29110 41051 39612 gene locus_tag LOCUS_29120 41051 39612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 41542 41069 gene locus_tag LOCUS_29130 41542 41069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 41710 41549 gene locus_tag LOCUS_29140 41710 41549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 42855 41818 gene locus_tag LOCUS_29150 42855 41818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 51781 42929 gene locus_tag LOCUS_29160 51781 42929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 52404 51790 gene locus_tag LOCUS_29170 52404 51790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 53267 52497 gene locus_tag LOCUS_29180 53267 52497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 54141 53254 gene locus_tag LOCUS_29190 54141 53254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 54619 54134 gene locus_tag LOCUS_29200 54619 54134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 55491 54616 gene locus_tag LOCUS_29210 55491 54616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 56744 55494 gene locus_tag LOCUS_29220 56744 55494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 58445 56748 gene locus_tag LOCUS_29230 58445 56748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 59295 58465 gene locus_tag LOCUS_29240 59295 58465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 60904 59303 gene locus_tag LOCUS_29250 60904 59303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 61033 61497 gene locus_tag LOCUS_29260 61033 61497 CDS product sulfur reduction protein DsrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294655.1 protein_id gnl|my_center|LOCUS_29260 61523 62779 gene locus_tag LOCUS_29270 61523 62779 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086798.1 protein_id gnl|my_center|LOCUS_29270 62754 62909 gene locus_tag LOCUS_29280 62754 62909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 64116 63367 gene locus_tag LOCUS_29290 64116 63367 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_29290 64501 64109 gene locus_tag LOCUS_29300 64501 64109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 64590 65258 gene locus_tag LOCUS_29310 64590 65258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 67117 65351 gene locus_tag LOCUS_29320 gene fadD 67117 65351 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199468.1 protein_id gnl|my_center|LOCUS_29320 68514 67321 gene locus_tag LOCUS_29330 68514 67321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 69338 68553 gene locus_tag LOCUS_29340 69338 68553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 70421 69420 gene locus_tag LOCUS_29350 70421 69420 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082450.1 protein_id gnl|my_center|LOCUS_29350 70734 71738 gene locus_tag LOCUS_29360 70734 71738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 71919 72941 gene locus_tag LOCUS_29370 71919 72941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 73955 72924 gene locus_tag LOCUS_29380 73955 72924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 76455 74101 gene locus_tag LOCUS_29390 gene fadE 76455 74101 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403966.1 protein_id gnl|my_center|LOCUS_29390 78641 76497 gene locus_tag LOCUS_29400 78641 76497 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100703.1 protein_id gnl|my_center|LOCUS_29400 79868 78663 gene locus_tag LOCUS_29410 79868 78663 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087747.1 protein_id gnl|my_center|LOCUS_29410 80459 80016 gene locus_tag LOCUS_29420 80459 80016 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968151.1 protein_id gnl|my_center|LOCUS_29420 80641 80447 gene locus_tag LOCUS_29430 80641 80447 CDS product antitoxin VapB32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_29430 80752 81378 gene locus_tag LOCUS_29440 80752 81378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 81439 82662 gene locus_tag LOCUS_29450 81439 82662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 82760 83965 gene locus_tag LOCUS_29460 82760 83965 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207506.1 protein_id gnl|my_center|LOCUS_29460 84680 83979 gene locus_tag LOCUS_29470 84680 83979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106486.1 protein_id gnl|my_center|LOCUS_29470 87802 84677 gene locus_tag LOCUS_29480 87802 84677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 91888 87830 gene locus_tag LOCUS_29490 91888 87830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 93642 91885 gene locus_tag LOCUS_29500 93642 91885 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204930.1 protein_id gnl|my_center|LOCUS_29500 >Feature sequence13 439 828 gene locus_tag LOCUS_29510 439 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 856 2505 gene locus_tag LOCUS_29520 gene fliD 856 2505 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVV2 protein_id gnl|my_center|LOCUS_29520 2605 2997 gene locus_tag LOCUS_29530 2605 2997 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNP8 protein_id gnl|my_center|LOCUS_29530 3024 3371 gene locus_tag LOCUS_29540 3024 3371 CDS product flagellar protein FliT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197170.1 protein_id gnl|my_center|LOCUS_29540 3403 4698 gene locus_tag LOCUS_29550 3403 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 4688 4975 gene locus_tag LOCUS_29560 4688 4975 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811829.1 protein_id gnl|my_center|LOCUS_29560 4972 5727 gene locus_tag LOCUS_29570 4972 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 7284 5746 gene locus_tag LOCUS_29580 7284 5746 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930860.1 protein_id gnl|my_center|LOCUS_29580 7679 7356 gene locus_tag LOCUS_29590 gene fliE 7679 7356 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9D8 protein_id gnl|my_center|LOCUS_29590 7902 9614 gene locus_tag LOCUS_29600 gene fliF 7902 9614 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YF7 protein_id gnl|my_center|LOCUS_29600 9648 10649 gene locus_tag LOCUS_29610 gene fliG 9648 10649 CDS product flagellar motor switch protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197167.1 protein_id gnl|my_center|LOCUS_29610 10636 11373 gene locus_tag LOCUS_29620 gene fliH 10636 11373 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930338.1 protein_id gnl|my_center|LOCUS_29620 11374 12780 gene locus_tag LOCUS_29630 gene fliI 11374 12780 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197164.1 protein_id gnl|my_center|LOCUS_29630 12796 13245 gene locus_tag LOCUS_29640 12796 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 13242 14777 gene locus_tag LOCUS_29650 13242 14777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 14891 15406 gene locus_tag LOCUS_29660 14891 15406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 15423 16478 gene locus_tag LOCUS_29670 gene fliM 15423 16478 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196784.1 protein_id gnl|my_center|LOCUS_29670 16502 16951 gene locus_tag LOCUS_29680 16502 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 17017 17442 gene locus_tag LOCUS_29690 17017 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 17439 18209 gene locus_tag LOCUS_29700 gene fliP 17439 18209 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P183 protein_id gnl|my_center|LOCUS_29700 18230 18499 gene locus_tag LOCUS_29710 gene fliQ 18230 18499 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367302.1 protein_id gnl|my_center|LOCUS_29710 18511 19275 gene locus_tag LOCUS_29720 gene fliR 18511 19275 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFK4 protein_id gnl|my_center|LOCUS_29720 19742 19287 gene locus_tag LOCUS_29730 19742 19287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 21778 19730 gene locus_tag LOCUS_29740 21778 19730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 23370 21955 gene locus_tag LOCUS_29750 23370 21955 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018494.1 protein_id gnl|my_center|LOCUS_29750 24283 23372 gene locus_tag LOCUS_29760 24283 23372 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063968.1 protein_id gnl|my_center|LOCUS_29760 24692 24303 gene locus_tag LOCUS_29770 gene ectC 24692 24303 CDS product L-ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DYF2 protein_id gnl|my_center|LOCUS_29770 26023 24689 gene locus_tag LOCUS_29780 gene ectB 26023 24689 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263924.1 protein_id gnl|my_center|LOCUS_29780 26547 26020 gene locus_tag LOCUS_29790 gene ectA 26547 26020 CDS product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263923.1 protein_id gnl|my_center|LOCUS_29790 26842 27324 gene locus_tag LOCUS_29800 26842 27324 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410818.1 protein_id gnl|my_center|LOCUS_29800 27419 27646 gene locus_tag LOCUS_29810 27419 27646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 28628 27654 gene locus_tag LOCUS_29820 28628 27654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 29369 28845 gene locus_tag LOCUS_29830 29369 28845 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403299.1 protein_id gnl|my_center|LOCUS_29830 31582 29384 gene locus_tag LOCUS_29840 31582 29384 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704962.1 protein_id gnl|my_center|LOCUS_29840 33711 31603 gene locus_tag LOCUS_29850 gene cheA-1 33711 31603 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704965.1 protein_id gnl|my_center|LOCUS_29850 34059 33715 gene locus_tag LOCUS_29860 34059 33715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 34456 34091 gene locus_tag LOCUS_29870 34456 34091 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704967.1 protein_id gnl|my_center|LOCUS_29870 35661 34477 gene locus_tag LOCUS_29880 35661 34477 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704968.1 protein_id gnl|my_center|LOCUS_29880 35833 35645 gene locus_tag LOCUS_29890 35833 35645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 36362 36069 gene locus_tag LOCUS_29900 36362 36069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 37371 36385 gene locus_tag LOCUS_29910 37371 36385 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_29910 38255 37569 gene locus_tag LOCUS_29920 38255 37569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 39598 38300 gene locus_tag LOCUS_29930 39598 38300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113046.1 protein_id gnl|my_center|LOCUS_29930 40296 39595 gene locus_tag LOCUS_29940 40296 39595 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269051.1 protein_id gnl|my_center|LOCUS_29940 40910 40293 gene locus_tag LOCUS_29950 40910 40293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 41795 40980 gene locus_tag LOCUS_29960 41795 40980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 44856 41800 gene locus_tag LOCUS_29970 44856 41800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 45038 45385 gene locus_tag LOCUS_29980 45038 45385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 45396 46670 gene locus_tag LOCUS_29990 gene fccB-2 45396 46670 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933736.1 protein_id gnl|my_center|LOCUS_29990 46852 47622 gene locus_tag LOCUS_30000 46852 47622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 48021 47647 gene locus_tag LOCUS_30010 48021 47647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 49245 48328 gene locus_tag LOCUS_30020 49245 48328 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532147.1 protein_id gnl|my_center|LOCUS_30020 49720 49265 gene locus_tag LOCUS_30030 49720 49265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 49872 50084 gene locus_tag LOCUS_30040 49872 50084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 50088 50867 gene locus_tag LOCUS_30050 50088 50867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 50983 53415 gene locus_tag LOCUS_30060 50983 53415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 53417 55177 gene locus_tag LOCUS_30070 53417 55177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 55296 55520 gene locus_tag LOCUS_30080 55296 55520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 55733 57151 gene locus_tag LOCUS_30090 gene udg2 55733 57151 CDS product UDP-glucose 6-dehydrogenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539365.1 protein_id gnl|my_center|LOCUS_30090 57222 58346 gene locus_tag LOCUS_30100 57222 58346 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268679.1 protein_id gnl|my_center|LOCUS_30100 59590 58817 gene locus_tag LOCUS_30110 59590 58817 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206620.1 protein_id gnl|my_center|LOCUS_30110 59684 60160 gene locus_tag LOCUS_30120 gene aroQ 59684 60160 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QP2 protein_id gnl|my_center|LOCUS_30120 60241 61692 gene locus_tag LOCUS_30130 gene ibeB 60241 61692 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123112.1 protein_id gnl|my_center|LOCUS_30130 61689 62891 gene locus_tag LOCUS_30140 61689 62891 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_30140 62888 66028 gene locus_tag LOCUS_30150 gene czcA 62888 66028 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_30150 66043 66915 gene locus_tag LOCUS_30160 66043 66915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 67749 66931 gene locus_tag LOCUS_30170 67749 66931 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970367.1 protein_id gnl|my_center|LOCUS_30170 68540 67776 gene locus_tag LOCUS_30180 68540 67776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970366.1 protein_id gnl|my_center|LOCUS_30180 69240 68533 gene locus_tag LOCUS_30190 69240 68533 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970365.1 protein_id gnl|my_center|LOCUS_30190