>Feature sequence001 995 240 gene locus_tag LOCUS_00010 995 240 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767601.1 protein_id gnl|my_center|LOCUS_00010 1908 1000 gene locus_tag LOCUS_00020 1908 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3239 2022 gene locus_tag LOCUS_00030 gene gltP 3239 2022 CDS product sodium:dicarboxylate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_00030 3919 3305 gene locus_tag LOCUS_00040 3919 3305 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_00040 4588 3941 gene locus_tag LOCUS_00050 gene tal 4588 3941 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R94 protein_id gnl|my_center|LOCUS_00050 4981 6819 gene locus_tag LOCUS_00060 4981 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7041 8432 gene locus_tag LOCUS_00070 7041 8432 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_00070 8530 9342 gene locus_tag LOCUS_00080 8530 9342 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_00080 9933 24278 gene locus_tag LOCUS_00090 9933 24278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 24353 52396 gene locus_tag LOCUS_00100 24353 52396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 >Feature sequence002 890 261 gene locus_tag LOCUS_00110 890 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 2330 972 gene locus_tag LOCUS_00120 2330 972 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_00120 5445 2527 gene locus_tag LOCUS_00130 5445 2527 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933213.1 protein_id gnl|my_center|LOCUS_00130 5587 7233 gene locus_tag LOCUS_00140 5587 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 7402 7599 gene locus_tag LOCUS_00150 7402 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 7683 8165 gene locus_tag LOCUS_00160 7683 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 8283 8990 gene locus_tag LOCUS_00170 8283 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653722.1 protein_id gnl|my_center|LOCUS_00170 9501 11288 gene locus_tag LOCUS_00180 9501 11288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 11341 12534 gene locus_tag LOCUS_00190 11341 12534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 12543 13286 gene locus_tag LOCUS_00200 12543 13286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 13341 14123 gene locus_tag LOCUS_00210 13341 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 14168 14995 gene locus_tag LOCUS_00220 14168 14995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 15313 15564 gene locus_tag LOCUS_00230 15313 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 15775 17184 gene locus_tag LOCUS_00240 15775 17184 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_00240 17205 18149 gene locus_tag LOCUS_00250 17205 18149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 18237 20984 gene locus_tag LOCUS_00260 18237 20984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 21024 21851 gene locus_tag LOCUS_00270 21024 21851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 22067 23449 gene locus_tag LOCUS_00280 22067 23449 CDS product peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203217.1 protein_id gnl|my_center|LOCUS_00280 23785 25110 gene locus_tag LOCUS_00290 23785 25110 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_00290 25349 26443 gene locus_tag LOCUS_00300 25349 26443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 26512 27534 gene locus_tag LOCUS_00310 26512 27534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 30652 27749 gene locus_tag LOCUS_00320 30652 27749 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933213.1 protein_id gnl|my_center|LOCUS_00320 30818 36529 gene locus_tag LOCUS_00330 30818 36529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36675 39086 gene locus_tag LOCUS_00340 36675 39086 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_00340 40052 39198 gene locus_tag LOCUS_00350 gene msrA 40052 39198 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCX9 protein_id gnl|my_center|LOCUS_00350 43142 40926 gene locus_tag LOCUS_00360 43142 40926 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_00360 >Feature sequence003 2652 2479 gene locus_tag LOCUS_00370 2652 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 3658 2684 gene locus_tag LOCUS_00380 3658 2684 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_00380 3859 6483 gene locus_tag LOCUS_00390 gene alaS 3859 6483 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YB4 protein_id gnl|my_center|LOCUS_00390 6633 7616 gene locus_tag LOCUS_00400 6633 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 9106 7715 gene locus_tag LOCUS_00410 9106 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 9628 12015 gene locus_tag LOCUS_00420 9628 12015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109083.1 protein_id gnl|my_center|LOCUS_00420 12022 14406 gene locus_tag LOCUS_00430 12022 14406 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404901.1 protein_id gnl|my_center|LOCUS_00430 14420 15445 gene locus_tag LOCUS_00440 14420 15445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 15485 16210 gene locus_tag LOCUS_00450 15485 16210 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_00450 16363 17106 gene locus_tag LOCUS_00460 16363 17106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_00460 17103 17849 gene locus_tag LOCUS_00470 17103 17849 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_00470 18872 17910 gene locus_tag LOCUS_00480 gene purC 18872 17910 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV7 protein_id gnl|my_center|LOCUS_00480 18978 19514 gene locus_tag LOCUS_00490 18978 19514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 19698 20606 gene locus_tag LOCUS_00500 gene pyrB 19698 20606 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U74 protein_id gnl|my_center|LOCUS_00500 20660 21118 gene locus_tag LOCUS_00510 gene pyrI 20660 21118 CDS product aspartate carbamoyltransferase regulatory chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U75 protein_id gnl|my_center|LOCUS_00510 21257 21718 gene locus_tag LOCUS_00520 21257 21718 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64W20 protein_id gnl|my_center|LOCUS_00520 21757 23082 gene locus_tag LOCUS_00530 21757 23082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 23235 23732 gene locus_tag LOCUS_00540 gene gldD 23235 23732 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_00540 23794 24453 gene locus_tag LOCUS_00550 23794 24453 CDS product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_00550 26411 24450 gene locus_tag LOCUS_00560 26411 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 27087 26461 gene locus_tag LOCUS_00570 gene recR 27087 26461 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T6 protein_id gnl|my_center|LOCUS_00570 29599 27116 gene locus_tag LOCUS_00580 gene wzc 29599 27116 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_00580 30452 29676 gene locus_tag LOCUS_00590 gene wza 30452 29676 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_00590 30555 31145 gene locus_tag LOCUS_00600 30555 31145 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UM6 protein_id gnl|my_center|LOCUS_00600 31907 31170 gene locus_tag LOCUS_00610 31907 31170 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_00610 32590 32042 gene locus_tag LOCUS_00620 gene glpG 32590 32042 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631577.1 protein_id gnl|my_center|LOCUS_00620 34333 32600 gene locus_tag LOCUS_00630 34333 32600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 35582 34404 gene locus_tag LOCUS_00640 35582 34404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 35626 35910 gene locus_tag LOCUS_00650 35626 35910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 35940 36851 gene locus_tag LOCUS_00660 35940 36851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 36844 37326 gene locus_tag LOCUS_00670 36844 37326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 37467 39131 gene locus_tag LOCUS_00680 37467 39131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence004 980 312 gene locus_tag LOCUS_00690 gene ppa 980 312 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84777 protein_id gnl|my_center|LOCUS_00690 2143 1079 gene locus_tag LOCUS_00700 2143 1079 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_00700 2347 2928 gene locus_tag LOCUS_00710 gene ruvA 2347 2928 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_00710 3097 10656 gene locus_tag LOCUS_00720 3097 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 10832 11209 gene locus_tag LOCUS_00730 gene gcvH 10832 11209 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4S8 protein_id gnl|my_center|LOCUS_00730 11364 11768 gene locus_tag LOCUS_00740 11364 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881282.1 protein_id gnl|my_center|LOCUS_00740 11962 14019 gene locus_tag LOCUS_00750 11962 14019 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_00750 14083 15474 gene locus_tag LOCUS_00760 14083 15474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 15727 16269 gene locus_tag LOCUS_00770 15727 16269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 16517 16894 gene locus_tag LOCUS_00780 16517 16894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 17225 17731 gene locus_tag LOCUS_00790 17225 17731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 20272 18917 gene locus_tag LOCUS_00800 20272 18917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 20968 21951 gene locus_tag LOCUS_00810 gene asd 20968 21951 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_00810 21983 23242 gene locus_tag LOCUS_00820 gene lysC 21983 23242 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_00820 23360 24532 gene locus_tag LOCUS_00830 23360 24532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 24544 25878 gene locus_tag LOCUS_00840 24544 25878 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932437.1 protein_id gnl|my_center|LOCUS_00840 26313 25969 gene locus_tag LOCUS_00850 26313 25969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 27461 26331 gene locus_tag LOCUS_00860 27461 26331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 28279 27710 gene locus_tag LOCUS_00870 gene pabA 28279 27710 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_00870 29311 28532 gene locus_tag LOCUS_00880 29311 28532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 31219 30074 gene locus_tag LOCUS_00890 gene acdA 31219 30074 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_00890 32268 31312 gene locus_tag LOCUS_00900 32268 31312 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_00900 34308 32290 gene locus_tag LOCUS_00910 34308 32290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 34445 35209 gene locus_tag LOCUS_00920 34445 35209 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980255.1 protein_id gnl|my_center|LOCUS_00920 35542 36654 gene locus_tag LOCUS_00930 35542 36654 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_00930 36714 39155 gene locus_tag LOCUS_00940 36714 39155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 39278 39351 gene locus_tag LOCUS_t00010 39278 39351 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 39376 39462 gene locus_tag LOCUS_t00020 39376 39462 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 39556 40173 gene locus_tag LOCUS_00950 39556 40173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761546.1 protein_id gnl|my_center|LOCUS_00950 >Feature sequence005 86 1990 gene locus_tag LOCUS_00960 86 1990 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108133.1 protein_id gnl|my_center|LOCUS_00960 2037 3515 gene locus_tag LOCUS_00970 2037 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405190.1 protein_id gnl|my_center|LOCUS_00970 3599 4294 gene locus_tag LOCUS_00980 3599 4294 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_00980 5012 4302 gene locus_tag LOCUS_00990 5012 4302 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_00990 5276 6136 gene locus_tag LOCUS_01000 5276 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 6072 11642 gene locus_tag LOCUS_01010 6072 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 11812 12531 gene locus_tag LOCUS_01020 11812 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 12536 12988 gene locus_tag LOCUS_01030 12536 12988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 13024 28197 gene locus_tag LOCUS_01040 13024 28197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 28297 36429 gene locus_tag LOCUS_01050 28297 36429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 36450 37499 gene locus_tag LOCUS_01060 36450 37499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 >Feature sequence006 6 188 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtcgcaataccccgaaaggttctgctcgaaatgagac 1681 743 gene locus_tag LOCUS_01070 1681 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 2555 1773 gene locus_tag LOCUS_01080 2555 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 3705 2599 gene locus_tag LOCUS_01090 gene csm5 3705 2599 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 protein_id gnl|my_center|LOCUS_01090 4474 3731 gene locus_tag LOCUS_01100 4474 3731 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082356.1 protein_id gnl|my_center|LOCUS_01100 4903 4481 gene locus_tag LOCUS_01110 4903 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 6010 4937 gene locus_tag LOCUS_01120 gene csm4 6010 4937 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546537.1 protein_id gnl|my_center|LOCUS_01120 6726 6010 gene locus_tag LOCUS_01130 6726 6010 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917166.1 protein_id gnl|my_center|LOCUS_01130 8429 6735 gene locus_tag LOCUS_01140 8429 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 8795 12574 gene locus_tag LOCUS_01150 8795 12574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 12606 16310 gene locus_tag LOCUS_01160 12606 16310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 17350 16427 gene locus_tag LOCUS_01170 gene gldA 17350 16427 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_01170 19259 17538 gene locus_tag LOCUS_01180 19259 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108507.1 protein_id gnl|my_center|LOCUS_01180 20400 19423 gene locus_tag LOCUS_01190 20400 19423 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_01190 20564 20490 gene locus_tag LOCUS_t00030 20564 20490 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21416 20910 gene locus_tag LOCUS_01200 gene aroK 21416 20910 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHI3 protein_id gnl|my_center|LOCUS_01200 21589 21978 gene locus_tag LOCUS_01210 gene mgsA 21589 21978 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18B16 protein_id gnl|my_center|LOCUS_01210 23519 22179 gene locus_tag LOCUS_01220 gene pgi 23519 22179 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM7 protein_id gnl|my_center|LOCUS_01220 24216 23563 gene locus_tag LOCUS_01230 24216 23563 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403598.1 protein_id gnl|my_center|LOCUS_01230 24749 25987 gene locus_tag LOCUS_01240 24749 25987 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_01240 25999 26676 gene locus_tag LOCUS_01250 25999 26676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 26737 27048 gene locus_tag LOCUS_01260 26737 27048 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_01260 27067 27573 gene locus_tag LOCUS_01270 27067 27573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_01270 27912 27634 gene locus_tag LOCUS_01280 27912 27634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 29572 27965 gene locus_tag LOCUS_01290 29572 27965 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_01290 30478 29897 gene locus_tag LOCUS_01300 30478 29897 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765039.1 protein_id gnl|my_center|LOCUS_01300 31200 30481 gene locus_tag LOCUS_01310 31200 30481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 33164 31317 gene locus_tag LOCUS_01320 33164 31317 CDS product tyrosine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286400.1 protein_id gnl|my_center|LOCUS_01320 36450 33892 gene locus_tag LOCUS_01330 36450 33892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 >Feature sequence007 9482 8022 gene locus_tag LOCUS_01340 9482 8022 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_01340 9691 11430 gene locus_tag LOCUS_01350 9691 11430 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_01350 12322 11480 gene locus_tag LOCUS_01360 12322 11480 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_01360 13312 12341 gene locus_tag LOCUS_01370 gene ltd 13312 12341 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_01370 13543 14286 gene locus_tag LOCUS_01380 13543 14286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 14361 15185 gene locus_tag LOCUS_01390 14361 15185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881733.1 protein_id gnl|my_center|LOCUS_01390 15285 18749 gene locus_tag LOCUS_01400 15285 18749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 18766 19326 gene locus_tag LOCUS_01410 18766 19326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 19326 21101 gene locus_tag LOCUS_01420 19326 21101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 21132 21611 gene locus_tag LOCUS_01430 21132 21611 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_01430 21620 22249 gene locus_tag LOCUS_01440 21620 22249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 22392 23912 gene locus_tag LOCUS_01450 22392 23912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 24782 23952 gene locus_tag LOCUS_01460 24782 23952 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782748.1 protein_id gnl|my_center|LOCUS_01460 24879 25709 gene locus_tag LOCUS_01470 gene uspA 24879 25709 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_01470 25812 26294 gene locus_tag LOCUS_01480 25812 26294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 26374 27708 gene locus_tag LOCUS_01490 26374 27708 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_01490 28730 27723 gene locus_tag LOCUS_01500 28730 27723 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_01500 30197 28749 gene locus_tag LOCUS_01510 30197 28749 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_01510 31334 34399 gene locus_tag LOCUS_01520 31334 34399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 >Feature sequence008 563 108 gene locus_tag LOCUS_01530 563 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 2146 755 gene locus_tag LOCUS_01540 2146 755 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_01540 3799 2324 gene locus_tag LOCUS_01550 3799 2324 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_01550 4904 4299 gene locus_tag LOCUS_01560 4904 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 5158 6147 gene locus_tag LOCUS_01570 5158 6147 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_01570 6395 7462 gene locus_tag LOCUS_01580 6395 7462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203634.1 protein_id gnl|my_center|LOCUS_01580 7543 9309 gene locus_tag LOCUS_01590 7543 9309 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108021.1 protein_id gnl|my_center|LOCUS_01590 10099 9380 gene locus_tag LOCUS_01600 gene comB 10099 9380 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_01600 11178 10282 gene locus_tag LOCUS_01610 gene xerC 11178 10282 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 protein_id gnl|my_center|LOCUS_01610 11456 14062 gene locus_tag LOCUS_01620 gene mutS 11456 14062 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 protein_id gnl|my_center|LOCUS_01620 14222 15604 gene locus_tag LOCUS_01630 14222 15604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 15639 16979 gene locus_tag LOCUS_01640 15639 16979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_01640 17089 19272 gene locus_tag LOCUS_01650 17089 19272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 19276 20670 gene locus_tag LOCUS_01660 19276 20670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 20716 21306 gene locus_tag LOCUS_01670 20716 21306 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 protein_id gnl|my_center|LOCUS_01670 21334 22500 gene locus_tag LOCUS_01680 21334 22500 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962920.1 protein_id gnl|my_center|LOCUS_01680 22573 22989 gene locus_tag LOCUS_01690 22573 22989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022228.1 protein_id gnl|my_center|LOCUS_01690 23959 23375 gene locus_tag LOCUS_01700 23959 23375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 24269 27553 gene locus_tag LOCUS_01710 24269 27553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_01710 28326 28709 gene locus_tag LOCUS_01720 28326 28709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 29520 30341 gene locus_tag LOCUS_01730 29520 30341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867167.1 protein_id gnl|my_center|LOCUS_01730 30338 31141 gene locus_tag LOCUS_01740 30338 31141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890439.1 protein_id gnl|my_center|LOCUS_01740 31138 31479 gene locus_tag LOCUS_01750 31138 31479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 31511 31690 gene locus_tag LOCUS_01760 31511 31690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 31712 31909 gene locus_tag LOCUS_01770 31712 31909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 32108 32296 gene locus_tag LOCUS_01780 32108 32296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 32899 34875 gene locus_tag LOCUS_01790 32899 34875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 >Feature sequence009 861 61 gene locus_tag LOCUS_01800 gene moaA 861 61 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ09 protein_id gnl|my_center|LOCUS_01800 2020 845 gene locus_tag LOCUS_01810 2020 845 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_01810 2548 2270 gene locus_tag LOCUS_01820 gene rpmE 2548 2270 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_01820 3239 2676 gene locus_tag LOCUS_01830 gene pth 3239 2676 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_01830 3971 3351 gene locus_tag LOCUS_01840 gene rplY 3971 3351 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X29 protein_id gnl|my_center|LOCUS_01840 4272 6671 gene locus_tag LOCUS_01850 4272 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 6865 9249 gene locus_tag LOCUS_01860 6865 9249 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_01860 9246 10544 gene locus_tag LOCUS_01870 9246 10544 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_01870 11035 10541 gene locus_tag LOCUS_01880 11035 10541 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_01880 11822 11025 gene locus_tag LOCUS_01890 11822 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203221.1 protein_id gnl|my_center|LOCUS_01890 11946 13301 gene locus_tag LOCUS_01900 gene radA 11946 13301 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A538 protein_id gnl|my_center|LOCUS_01900 13763 14533 gene locus_tag LOCUS_01910 13763 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01910 16572 14620 gene locus_tag LOCUS_01920 gene ogt 16572 14620 CDS product O-GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_01920 17584 16616 gene locus_tag LOCUS_01930 17584 16616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402846.1 protein_id gnl|my_center|LOCUS_01930 17735 18967 gene locus_tag LOCUS_01940 17735 18967 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_01940 18977 20512 gene locus_tag LOCUS_01950 gene speE2 18977 20512 CDS product polyamine aminopropyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67365 protein_id gnl|my_center|LOCUS_01950 20970 21971 gene locus_tag LOCUS_01960 gene nadA 20970 21971 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG0 protein_id gnl|my_center|LOCUS_01960 21992 22600 gene locus_tag LOCUS_01970 21992 22600 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_01970 22645 24519 gene locus_tag LOCUS_01980 gene mnmG 22645 24519 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_01980 24594 26237 gene locus_tag LOCUS_01990 gene ade 24594 26237 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022289.1 protein_id gnl|my_center|LOCUS_01990 26230 28047 gene locus_tag LOCUS_02000 gene uvrC 26230 28047 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_02000 28363 33723 gene locus_tag LOCUS_02010 28363 33723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence010 1237 860 gene locus_tag LOCUS_02020 1237 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 1623 2810 gene locus_tag LOCUS_02030 1623 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 4132 2825 gene locus_tag LOCUS_02040 4132 2825 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_02040 5328 4195 gene locus_tag LOCUS_02050 5328 4195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108152.1 protein_id gnl|my_center|LOCUS_02050 6265 5420 gene locus_tag LOCUS_02060 6265 5420 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_02060 9455 6291 gene locus_tag LOCUS_02070 9455 6291 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_02070 10625 9504 gene locus_tag LOCUS_02080 10625 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 12902 11103 gene locus_tag LOCUS_02090 12902 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 14462 12987 gene locus_tag LOCUS_02100 gene ynaJ 14462 12987 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039147.1 protein_id gnl|my_center|LOCUS_02100 16259 14499 gene locus_tag LOCUS_02110 16259 14499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 17789 16344 gene locus_tag LOCUS_02120 17789 16344 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 protein_id gnl|my_center|LOCUS_02120 19270 17843 gene locus_tag LOCUS_02130 gene srfJ 19270 17843 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 protein_id gnl|my_center|LOCUS_02130 20251 19367 gene locus_tag LOCUS_02140 20251 19367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 23717 20241 gene locus_tag LOCUS_02150 23717 20241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582531.1 protein_id gnl|my_center|LOCUS_02150 25971 23737 gene locus_tag LOCUS_02160 gene xloA 25971 23737 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_02160 27814 26261 gene locus_tag LOCUS_02170 27814 26261 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_02170 30924 27826 gene locus_tag LOCUS_02180 30924 27826 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_02180 32229 31120 gene locus_tag LOCUS_02190 32229 31120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 33714 32284 gene locus_tag LOCUS_02200 33714 32284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 >Feature sequence011 2341 1934 gene locus_tag LOCUS_02210 2341 1934 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_02210 3140 2442 gene locus_tag LOCUS_02220 gene rprY 3140 2442 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_02220 3353 3787 gene locus_tag LOCUS_02230 gene dut 3353 3787 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A245 protein_id gnl|my_center|LOCUS_02230 3874 4878 gene locus_tag LOCUS_02240 3874 4878 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_02240 5095 6783 gene locus_tag LOCUS_02250 5095 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_02250 6794 7630 gene locus_tag LOCUS_02260 6794 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 7637 8878 gene locus_tag LOCUS_02270 7637 8878 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_02270 8934 12245 gene locus_tag LOCUS_02280 8934 12245 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_02280 12249 12647 gene locus_tag LOCUS_02290 12249 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 12652 13068 gene locus_tag LOCUS_02300 gene ybeY 12652 13068 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_02300 13256 13654 gene locus_tag LOCUS_02310 13256 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 13725 16298 gene locus_tag LOCUS_02320 13725 16298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 18145 16295 gene locus_tag LOCUS_02330 gene mutL 18145 16295 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NX1 protein_id gnl|my_center|LOCUS_02330 18441 18154 gene locus_tag LOCUS_02340 18441 18154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 18627 18698 gene locus_tag LOCUS_t00040 18627 18698 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 18784 19614 gene locus_tag LOCUS_02350 gene hypB 18784 19614 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_02350 20756 19737 gene locus_tag LOCUS_02360 20756 19737 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_02360 22609 20759 gene locus_tag LOCUS_02370 22609 20759 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108505.1 protein_id gnl|my_center|LOCUS_02370 23915 22953 gene locus_tag LOCUS_02380 gene queA 23915 22953 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L7 protein_id gnl|my_center|LOCUS_02380 24737 24054 gene locus_tag LOCUS_02390 gene truB 24737 24054 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U2 protein_id gnl|my_center|LOCUS_02390 25631 24837 gene locus_tag LOCUS_02400 gene uppP 25631 24837 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_02400 26034 25684 gene locus_tag LOCUS_02410 26034 25684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 26923 26045 gene locus_tag LOCUS_02420 26923 26045 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U5 protein_id gnl|my_center|LOCUS_02420 27046 29853 gene locus_tag LOCUS_02430 27046 29853 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_02430 29913 30779 gene locus_tag LOCUS_02440 29913 30779 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_02440 30808 31971 gene locus_tag LOCUS_02450 gene dxr 30808 31971 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY9 protein_id gnl|my_center|LOCUS_02450 32083 33510 gene locus_tag LOCUS_02460 32083 33510 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_02460 >Feature sequence012 1137 724 gene locus_tag LOCUS_02470 1137 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 1816 1298 gene locus_tag LOCUS_02480 1816 1298 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_02480 4351 1883 gene locus_tag LOCUS_02490 4351 1883 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_02490 4715 4386 gene locus_tag LOCUS_02500 4715 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 5567 4830 gene locus_tag LOCUS_02510 gene uppS 5567 4830 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E0 protein_id gnl|my_center|LOCUS_02510 6767 5670 gene locus_tag LOCUS_02520 6767 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962872.1 protein_id gnl|my_center|LOCUS_02520 7521 6814 gene locus_tag LOCUS_02530 7521 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 9082 7697 gene locus_tag LOCUS_02540 9082 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 9763 9485 gene locus_tag LOCUS_02550 9763 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 10439 10179 gene locus_tag LOCUS_02560 10439 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 10528 12864 gene locus_tag LOCUS_02570 10528 12864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 12939 13340 gene locus_tag LOCUS_02580 12939 13340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 13997 13383 gene locus_tag LOCUS_02590 gene rnhB 13997 13383 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_02590 14371 14144 gene locus_tag LOCUS_02600 14371 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 14622 14374 gene locus_tag LOCUS_02610 14622 14374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 14747 16441 gene locus_tag LOCUS_02620 gene gsiA 14747 16441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_02620 16419 16598 gene locus_tag LOCUS_02630 16419 16598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 16679 18400 gene locus_tag LOCUS_02640 16679 18400 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_02640 18826 18452 gene locus_tag LOCUS_02650 18826 18452 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5K3 protein_id gnl|my_center|LOCUS_02650 20684 18861 gene locus_tag LOCUS_02660 20684 18861 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_02660 21131 25189 gene locus_tag LOCUS_02670 21131 25189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 25626 27170 gene locus_tag LOCUS_02680 gene hutH2 25626 27170 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_02680 27177 27905 gene locus_tag LOCUS_02690 27177 27905 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_02690 27916 29133 gene locus_tag LOCUS_02700 gene fabB 27916 29133 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_02700 29146 29388 gene locus_tag LOCUS_02710 29146 29388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 29402 30301 gene locus_tag LOCUS_02720 29402 30301 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_02720 30301 31368 gene locus_tag LOCUS_02730 30301 31368 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072813.1 protein_id gnl|my_center|LOCUS_02730 31365 31781 gene locus_tag LOCUS_02740 31365 31781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 >Feature sequence013 3 1010 gene locus_tag LOCUS_02750 3 1010 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393777.1 protein_id gnl|my_center|LOCUS_02750 4346 1014 gene locus_tag LOCUS_02760 gene infB 4346 1014 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR4 protein_id gnl|my_center|LOCUS_02760 5685 4447 gene locus_tag LOCUS_02770 gene nusA 5685 4447 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR5 protein_id gnl|my_center|LOCUS_02770 6187 5693 gene locus_tag LOCUS_02780 gene rimP 6187 5693 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR6 protein_id gnl|my_center|LOCUS_02780 6358 7605 gene locus_tag LOCUS_02790 6358 7605 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_02790 7796 8815 gene locus_tag LOCUS_02800 gene lpxD 7796 8815 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_02800 9331 8885 gene locus_tag LOCUS_02810 9331 8885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_02810 9500 12172 gene locus_tag LOCUS_02820 9500 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 12960 12274 gene locus_tag LOCUS_02830 12960 12274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 12854 13114 gene locus_tag LOCUS_02840 12854 13114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 13287 13682 gene locus_tag LOCUS_02850 13287 13682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 13754 14428 gene locus_tag LOCUS_02860 13754 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880863.1 protein_id gnl|my_center|LOCUS_02860 14539 15084 gene locus_tag LOCUS_02870 14539 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 15199 15894 gene locus_tag LOCUS_02880 15199 15894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 15938 16789 gene locus_tag LOCUS_02890 15938 16789 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425211.1 protein_id gnl|my_center|LOCUS_02890 18343 16805 gene locus_tag LOCUS_02900 18343 16805 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_02900 19388 18354 gene locus_tag LOCUS_02910 19388 18354 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM8 protein_id gnl|my_center|LOCUS_02910 20504 19392 gene locus_tag LOCUS_02920 gene smf 20504 19392 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_02920 21199 20528 gene locus_tag LOCUS_02930 21199 20528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 22584 21277 gene locus_tag LOCUS_02940 22584 21277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 23051 22596 gene locus_tag LOCUS_02950 23051 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 24223 23057 gene locus_tag LOCUS_02960 gene putA 24223 23057 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_02960 27728 24390 gene locus_tag LOCUS_02970 27728 24390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 28095 29753 gene locus_tag LOCUS_02980 28095 29753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 31142 29823 gene locus_tag LOCUS_02990 gene murA 31142 29823 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY6 protein_id gnl|my_center|LOCUS_02990 >Feature sequence014 191 1096 gene locus_tag LOCUS_03000 191 1096 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_03000 3685 1127 gene locus_tag LOCUS_03010 3685 1127 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203460.1 protein_id gnl|my_center|LOCUS_03010 4105 4716 gene locus_tag LOCUS_03020 4105 4716 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_03020 4839 6443 gene locus_tag LOCUS_03030 4839 6443 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_03030 6493 7122 gene locus_tag LOCUS_03040 6493 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 7226 7310 gene locus_tag LOCUS_t00050 7226 7310 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10338 7906 gene locus_tag LOCUS_03050 10338 7906 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_03050 11109 10663 gene locus_tag LOCUS_03060 11109 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 12544 11252 gene locus_tag LOCUS_03070 12544 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 15803 12600 gene locus_tag LOCUS_03080 15803 12600 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_03080 16929 15814 gene locus_tag LOCUS_03090 16929 15814 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393847.1 protein_id gnl|my_center|LOCUS_03090 17120 18205 gene locus_tag LOCUS_03100 17120 18205 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_03100 18180 18908 gene locus_tag LOCUS_03110 18180 18908 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_03110 19312 21219 gene locus_tag LOCUS_03120 gene dxs 19312 21219 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y02 protein_id gnl|my_center|LOCUS_03120 21376 22209 gene locus_tag LOCUS_03130 gene modA 21376 22209 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857589.1 protein_id gnl|my_center|LOCUS_03130 22330 25368 gene locus_tag LOCUS_03140 22330 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 25889 27604 gene locus_tag LOCUS_03150 25889 27604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 31039 27737 gene locus_tag LOCUS_03160 31039 27737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 31414 31178 gene locus_tag LOCUS_03170 31414 31178 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67303 protein_id gnl|my_center|LOCUS_03170 >Feature sequence015 <1 1002 gene locus_tag LOCUS_03180 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964344.1:acyl-CoA--6-aminopenicillanic acid acyl-transferase 1007 1882 gene locus_tag LOCUS_03190 1007 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 1885 3129 gene locus_tag LOCUS_03200 1885 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3131 4426 gene locus_tag LOCUS_03210 3131 4426 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_03210 4432 5571 gene locus_tag LOCUS_03220 4432 5571 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_03220 5797 6195 gene locus_tag LOCUS_03230 5797 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 6683 7030 gene locus_tag LOCUS_03240 6683 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 8102 7086 gene locus_tag LOCUS_03250 gene hypE 8102 7086 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 protein_id gnl|my_center|LOCUS_03250 9234 8152 gene locus_tag LOCUS_03260 gene hypD 9234 8152 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545661.1 protein_id gnl|my_center|LOCUS_03260 9573 9310 gene locus_tag LOCUS_03270 9573 9310 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_03270 11976 9661 gene locus_tag LOCUS_03280 gene hypF 11976 9661 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66902 protein_id gnl|my_center|LOCUS_03280 12123 12959 gene locus_tag LOCUS_03290 12123 12959 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_03290 12973 13965 gene locus_tag LOCUS_03300 12973 13965 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496951.1 protein_id gnl|my_center|LOCUS_03300 14054 14743 gene locus_tag LOCUS_03310 14054 14743 CDS product molybdenum ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877607.1 protein_id gnl|my_center|LOCUS_03310 14778 15836 gene locus_tag LOCUS_03320 14778 15836 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_03320 15902 17308 gene locus_tag LOCUS_03330 15902 17308 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_03330 19979 17340 gene locus_tag LOCUS_03340 19979 17340 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108893.1 protein_id gnl|my_center|LOCUS_03340 20376 21557 gene locus_tag LOCUS_03350 20376 21557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 21629 22189 gene locus_tag LOCUS_03360 21629 22189 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108700.1 protein_id gnl|my_center|LOCUS_03360 22194 22796 gene locus_tag LOCUS_03370 22194 22796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 23166 22837 gene locus_tag LOCUS_03380 23166 22837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 24360 23293 gene locus_tag LOCUS_03390 gene yloQ 24360 23293 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJV8 protein_id gnl|my_center|LOCUS_03390 25712 24372 gene locus_tag LOCUS_03400 25712 24372 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435305.1 protein_id gnl|my_center|LOCUS_03400 27734 25836 gene locus_tag LOCUS_03410 27734 25836 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107277.1 protein_id gnl|my_center|LOCUS_03410 28252 27911 gene locus_tag LOCUS_03420 28252 27911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 31017 29242 gene locus_tag LOCUS_03430 31017 29242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 >Feature sequence016 41 805 gene locus_tag LOCUS_03440 41 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 902 2002 gene locus_tag LOCUS_03450 902 2002 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_03450 2082 3260 gene locus_tag LOCUS_03460 2082 3260 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 protein_id gnl|my_center|LOCUS_03460 3330 4877 gene locus_tag LOCUS_03470 3330 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 5136 5492 gene locus_tag LOCUS_03480 gene ogt2 5136 5492 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_03480 9264 5542 gene locus_tag LOCUS_03490 9264 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 10815 9784 gene locus_tag LOCUS_03500 10815 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 11899 11075 gene locus_tag LOCUS_03510 11899 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 12288 11923 gene locus_tag LOCUS_03520 12288 11923 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964132.1 protein_id gnl|my_center|LOCUS_03520 12883 13239 gene locus_tag LOCUS_03530 12883 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 14989 13412 gene locus_tag LOCUS_03540 14989 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 15365 15039 gene locus_tag LOCUS_03550 15365 15039 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_03550 15752 16810 gene locus_tag LOCUS_03560 15752 16810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_03560 16846 17721 gene locus_tag LOCUS_03570 16846 17721 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_03570 20884 17777 gene locus_tag LOCUS_03580 20884 17777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 22058 21201 gene locus_tag LOCUS_03590 gene lipA 22058 21201 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_03590 23941 22121 gene locus_tag LOCUS_03600 23941 22121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_03600 24746 23970 gene locus_tag LOCUS_03610 24746 23970 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203148.1 protein_id gnl|my_center|LOCUS_03610 25347 24805 gene locus_tag LOCUS_03620 25347 24805 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_03620 25723 30645 gene locus_tag LOCUS_03630 25723 30645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence017 5646 3478 gene locus_tag LOCUS_03640 5646 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6142 6366 gene locus_tag LOCUS_03650 6142 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 6421 6648 gene locus_tag LOCUS_03660 6421 6648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 6743 7432 gene locus_tag LOCUS_03670 gene trmB 6743 7432 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X7 protein_id gnl|my_center|LOCUS_03670 7919 7467 gene locus_tag LOCUS_03680 gene dtd 7919 7467 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_03680 8008 8405 gene locus_tag LOCUS_tm00010 8008 8405 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 8752 9207 gene locus_tag LOCUS_03690 8752 9207 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 protein_id gnl|my_center|LOCUS_03690 9211 10428 gene locus_tag LOCUS_03700 9211 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 10672 10463 gene locus_tag LOCUS_03710 10672 10463 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065663.1 protein_id gnl|my_center|LOCUS_03710 10894 10736 gene locus_tag LOCUS_03720 10894 10736 CDS product Arc family DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 protein_id gnl|my_center|LOCUS_03720 11778 10927 gene locus_tag LOCUS_03730 11778 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_03730 12068 12952 gene locus_tag LOCUS_03740 12068 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082086.1 protein_id gnl|my_center|LOCUS_03740 12981 13481 gene locus_tag LOCUS_03750 12981 13481 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_03750 14017 13556 gene locus_tag LOCUS_03760 14017 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 14267 16672 gene locus_tag LOCUS_03770 14267 16672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_03770 16937 18196 gene locus_tag LOCUS_03780 16937 18196 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_03780 18237 18944 gene locus_tag LOCUS_03790 gene cysH 18237 18944 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81FZ1 protein_id gnl|my_center|LOCUS_03790 19100 19294 gene locus_tag LOCUS_03800 19100 19294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 19284 19541 gene locus_tag LOCUS_03810 19284 19541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879113.1 protein_id gnl|my_center|LOCUS_03810 19561 21036 gene locus_tag LOCUS_03820 19561 21036 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459002.1 protein_id gnl|my_center|LOCUS_03820 21165 22490 gene locus_tag LOCUS_03830 gene thrC1 21165 22490 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66864 protein_id gnl|my_center|LOCUS_03830 24492 22591 gene locus_tag LOCUS_03840 gene purF 24492 22591 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_03840 25994 24534 gene locus_tag LOCUS_03850 gene cysS 25994 24534 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZY1 protein_id gnl|my_center|LOCUS_03850 26362 26033 gene locus_tag LOCUS_03860 26362 26033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_03860 26642 26352 gene locus_tag LOCUS_03870 26642 26352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 27181 26621 gene locus_tag LOCUS_03880 27181 26621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 27538 27194 gene locus_tag LOCUS_03890 27538 27194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 28151 27693 gene locus_tag LOCUS_03900 28151 27693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 29220 28252 gene locus_tag LOCUS_03910 29220 28252 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_03910 >Feature sequence018 23 3175 gene locus_tag LOCUS_03920 23 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 3182 4345 gene locus_tag LOCUS_03930 3182 4345 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_03930 4415 5599 gene locus_tag LOCUS_03940 4415 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 5710 7824 gene locus_tag LOCUS_03950 5710 7824 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_03950 7890 8267 gene locus_tag LOCUS_03960 gene acpS 7890 8267 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180W4 protein_id gnl|my_center|LOCUS_03960 8278 9981 gene locus_tag LOCUS_03970 gene acsA 8278 9981 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 protein_id gnl|my_center|LOCUS_03970 10162 10416 gene locus_tag LOCUS_03980 10162 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 10539 11786 gene locus_tag LOCUS_03990 gene kbl 10539 11786 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_03990 13348 11885 gene locus_tag LOCUS_04000 13348 11885 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_04000 13891 13505 gene locus_tag LOCUS_04010 gene vapC 13891 13505 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XW84 protein_id gnl|my_center|LOCUS_04010 14129 13875 gene locus_tag LOCUS_04020 14129 13875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 14812 14381 gene locus_tag LOCUS_04030 14812 14381 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261614.1 protein_id gnl|my_center|LOCUS_04030 15699 14818 gene locus_tag LOCUS_04040 15699 14818 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584059.1 protein_id gnl|my_center|LOCUS_04040 15778 16461 gene locus_tag LOCUS_04050 15778 16461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 17529 16654 gene locus_tag LOCUS_04060 17529 16654 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069743.1 protein_id gnl|my_center|LOCUS_04060 18448 17576 gene locus_tag LOCUS_04070 18448 17576 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785714.1 protein_id gnl|my_center|LOCUS_04070 19593 18718 gene locus_tag LOCUS_04080 gene fabD 19593 18718 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_04080 20914 19883 gene locus_tag LOCUS_04090 20914 19883 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932102.1 protein_id gnl|my_center|LOCUS_04090 21258 20989 gene locus_tag LOCUS_04100 gene acyP 21258 20989 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74ES0 protein_id gnl|my_center|LOCUS_04100 22480 21281 gene locus_tag LOCUS_04110 22480 21281 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_04110 24361 22523 gene locus_tag LOCUS_04120 24361 22523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 27331 24509 gene locus_tag LOCUS_04130 27331 24509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 >Feature sequence019 607 801 gene locus_tag LOCUS_04140 607 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 1377 2321 gene locus_tag LOCUS_04150 1377 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3716 2484 gene locus_tag LOCUS_04160 3716 2484 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_04160 3923 4645 gene locus_tag LOCUS_04170 3923 4645 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679291.1 protein_id gnl|my_center|LOCUS_04170 5260 4670 gene locus_tag LOCUS_04180 5260 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 5539 6096 gene locus_tag LOCUS_04190 5539 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 6249 7688 gene locus_tag LOCUS_04200 6249 7688 CDS product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389423.1 protein_id gnl|my_center|LOCUS_04200 7990 9399 gene locus_tag LOCUS_04210 7990 9399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 9662 11998 gene locus_tag LOCUS_04220 9662 11998 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_04220 12075 13115 gene locus_tag LOCUS_04230 gene rlmN 12075 13115 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_04230 13185 13664 gene locus_tag LOCUS_04240 13185 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 13921 14424 gene locus_tag LOCUS_04250 13921 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 14519 15358 gene locus_tag LOCUS_04260 gene panC 14519 15358 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XM3 protein_id gnl|my_center|LOCUS_04260 15420 15773 gene locus_tag LOCUS_04270 gene panD 15420 15773 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZR7 protein_id gnl|my_center|LOCUS_04270 15777 16787 gene locus_tag LOCUS_04280 15777 16787 CDS product dolichol-P-glucose synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_04280 16799 17287 gene locus_tag LOCUS_04290 16799 17287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 19837 17324 gene locus_tag LOCUS_04300 gene priA 19837 17324 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 protein_id gnl|my_center|LOCUS_04300 20234 20626 gene locus_tag LOCUS_04310 20234 20626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 20709 23639 gene locus_tag LOCUS_04320 20709 23639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 23702 26845 gene locus_tag LOCUS_04330 23702 26845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 >Feature sequence020 5107 5910 gene locus_tag LOCUS_04340 5107 5910 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_04340 5926 6273 gene locus_tag LOCUS_04350 5926 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_04350 6298 6861 gene locus_tag LOCUS_04360 6298 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04360 6948 7511 gene locus_tag LOCUS_04370 6948 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04370 7520 8464 gene locus_tag LOCUS_04380 7520 8464 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_04380 8543 10195 gene locus_tag LOCUS_04390 gene recN 8543 10195 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_04390 10215 10685 gene locus_tag LOCUS_04400 10215 10685 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022658.1 protein_id gnl|my_center|LOCUS_04400 10863 11699 gene locus_tag LOCUS_04410 10863 11699 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_04410 11843 12430 gene locus_tag LOCUS_04420 11843 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 12523 13356 gene locus_tag LOCUS_04430 12523 13356 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_04430 13420 13884 gene locus_tag LOCUS_04440 13420 13884 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_04440 14118 17366 gene locus_tag LOCUS_04450 14118 17366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 17388 18191 gene locus_tag LOCUS_04460 17388 18191 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_04460 18456 19403 gene locus_tag LOCUS_04470 18456 19403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 20144 19602 gene locus_tag LOCUS_04480 20144 19602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 20254 20910 gene locus_tag LOCUS_04490 20254 20910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 23548 20966 gene locus_tag LOCUS_04500 23548 20966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 24836 27328 gene locus_tag LOCUS_04510 24836 27328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 >Feature sequence021 126 1868 gene locus_tag LOCUS_04520 126 1868 CDS product trehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973556.1 protein_id gnl|my_center|LOCUS_04520 2123 2578 gene locus_tag LOCUS_04530 gene rplM 2123 2578 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P27 protein_id gnl|my_center|LOCUS_04530 2584 2970 gene locus_tag LOCUS_04540 gene rpsI 2584 2970 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z5 protein_id gnl|my_center|LOCUS_04540 3189 3989 gene locus_tag LOCUS_04550 gene rpsB 3189 3989 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P29 protein_id gnl|my_center|LOCUS_04550 4013 4843 gene locus_tag LOCUS_04560 gene tsf 4013 4843 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_04560 4933 5643 gene locus_tag LOCUS_04570 gene pyrH 4933 5643 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5J7 protein_id gnl|my_center|LOCUS_04570 6923 5760 gene locus_tag LOCUS_04580 6923 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 7354 6920 gene locus_tag LOCUS_04590 7354 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 8695 7415 gene locus_tag LOCUS_04600 8695 7415 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_04600 8824 9222 gene locus_tag LOCUS_04610 8824 9222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 10650 9271 gene locus_tag LOCUS_04620 gene xseA 10650 9271 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_04620 11559 10732 gene locus_tag LOCUS_04630 11559 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 13827 11689 gene locus_tag LOCUS_04640 13827 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 13978 15321 gene locus_tag LOCUS_04650 13978 15321 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A100 protein_id gnl|my_center|LOCUS_04650 15368 15970 gene locus_tag LOCUS_04660 15368 15970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 16236 16149 gene locus_tag LOCUS_t00060 16236 16149 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16512 16784 gene locus_tag LOCUS_04670 16512 16784 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_04670 16880 17551 gene locus_tag LOCUS_04680 gene trmH 16880 17551 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_04680 17618 18343 gene locus_tag LOCUS_04690 17618 18343 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_04690 19883 18594 gene locus_tag LOCUS_04700 gene murF 19883 18594 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1L7 protein_id gnl|my_center|LOCUS_04700 21435 19945 gene locus_tag LOCUS_04710 gene gldJ 21435 19945 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_04710 22461 21469 gene locus_tag LOCUS_04720 22461 21469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 22767 26585 gene locus_tag LOCUS_04730 gene porU 22767 26585 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence022 3158 2409 gene locus_tag LOCUS_04740 3158 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4874 3606 gene locus_tag LOCUS_04750 4874 3606 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_04750 6107 4977 gene locus_tag LOCUS_04760 6107 4977 CDS product saccharopine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_04760 6507 6190 gene locus_tag LOCUS_04770 6507 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 6937 6494 gene locus_tag LOCUS_04780 6937 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 7727 6939 gene locus_tag LOCUS_04790 7727 6939 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK20 protein_id gnl|my_center|LOCUS_04790 10244 7794 gene locus_tag LOCUS_04800 gene pheT 10244 7794 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA39 protein_id gnl|my_center|LOCUS_04800 10344 10432 gene locus_tag LOCUS_t00070 10344 10432 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10837 11913 gene locus_tag LOCUS_04810 10837 11913 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034368.1 protein_id gnl|my_center|LOCUS_04810 12449 12285 gene locus_tag LOCUS_04820 12449 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 12958 12635 gene locus_tag LOCUS_04830 12958 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_04830 17298 12991 gene locus_tag LOCUS_04840 gene rpoC 17298 12991 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ8 protein_id gnl|my_center|LOCUS_04840 21188 17373 gene locus_tag LOCUS_04850 gene rpoB 21188 17373 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ7 protein_id gnl|my_center|LOCUS_04850 21661 21290 gene locus_tag LOCUS_04860 gene rplL 21661 21290 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ6 protein_id gnl|my_center|LOCUS_04860 22214 21696 gene locus_tag LOCUS_04870 22214 21696 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_04870 22985 22290 gene locus_tag LOCUS_04880 gene rplA 22985 22290 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A466 protein_id gnl|my_center|LOCUS_04880 23443 23003 gene locus_tag LOCUS_04890 gene rplK 23443 23003 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A465 protein_id gnl|my_center|LOCUS_04890 24011 23463 gene locus_tag LOCUS_04900 gene nusG 24011 23463 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A464 protein_id gnl|my_center|LOCUS_04900 24240 24028 gene locus_tag LOCUS_04910 24240 24028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 24343 24270 gene locus_tag LOCUS_t00080 24343 24270 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 25612 24425 gene locus_tag LOCUS_04920 gene tuf 25612 24425 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P33165 protein_id gnl|my_center|LOCUS_04920 25742 25670 gene locus_tag LOCUS_t00090 25742 25670 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 25826 25753 gene locus_tag LOCUS_t00100 25826 25753 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25923 25841 gene locus_tag LOCUS_t00110 25923 25841 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence023 3281 8449 gene locus_tag LOCUS_04930 3281 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 8452 9414 gene locus_tag LOCUS_04940 8452 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 9608 11485 gene locus_tag LOCUS_04950 9608 11485 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247314.1 protein_id gnl|my_center|LOCUS_04950 13190 11754 gene locus_tag LOCUS_04960 13190 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 14855 13422 gene locus_tag LOCUS_04970 14855 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 16799 15333 gene locus_tag LOCUS_04980 16799 15333 CDS product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_04980 17306 16893 gene locus_tag LOCUS_04990 17306 16893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 17753 17400 gene locus_tag LOCUS_05000 17753 17400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 18686 17766 gene locus_tag LOCUS_05010 18686 17766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_05010 18854 19699 gene locus_tag LOCUS_05020 18854 19699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_05020 19773 20771 gene locus_tag LOCUS_05030 19773 20771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 20839 23646 gene locus_tag LOCUS_05040 20839 23646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 23716 24483 gene locus_tag LOCUS_05050 23716 24483 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_05050 25384 24518 gene locus_tag LOCUS_05060 25384 24518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence024 395 1735 gene locus_tag LOCUS_05070 395 1735 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_05070 2045 3259 gene locus_tag LOCUS_05080 2045 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4406 3714 gene locus_tag LOCUS_05090 4406 3714 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459526.1 protein_id gnl|my_center|LOCUS_05090 4765 5766 gene locus_tag LOCUS_05100 4765 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 5962 6333 gene locus_tag LOCUS_05110 5962 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6361 7245 gene locus_tag LOCUS_05120 6361 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 7289 8278 gene locus_tag LOCUS_05130 7289 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 8271 9587 gene locus_tag LOCUS_05140 8271 9587 CDS product polysulfide reductase chain C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_05140 9667 10470 gene locus_tag LOCUS_05150 9667 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 10501 10926 gene locus_tag LOCUS_05160 10501 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 11050 11976 gene locus_tag LOCUS_05170 11050 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 11983 12597 gene locus_tag LOCUS_05180 11983 12597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05180 14289 12613 gene locus_tag LOCUS_05190 14289 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 14852 14304 gene locus_tag LOCUS_05200 14852 14304 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_05200 15832 15059 gene locus_tag LOCUS_05210 15832 15059 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_05210 16479 15970 gene locus_tag LOCUS_05220 16479 15970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 17053 16550 gene locus_tag LOCUS_05230 17053 16550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 19439 17457 gene locus_tag LOCUS_05240 19439 17457 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A666 protein_id gnl|my_center|LOCUS_05240 19519 19698 gene locus_tag LOCUS_05250 19519 19698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 19979 21019 gene locus_tag LOCUS_05260 gene phoR 19979 21019 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_05260 21016 22875 gene locus_tag LOCUS_05270 21016 22875 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_05270 22976 23206 gene locus_tag LOCUS_05280 22976 23206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 23217 23633 gene locus_tag LOCUS_05290 23217 23633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_05290 24332 23775 gene locus_tag LOCUS_05300 24332 23775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 25098 24427 gene locus_tag LOCUS_05310 25098 24427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence025 654 355 gene locus_tag LOCUS_05320 gene parE1 654 355 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9T8 protein_id gnl|my_center|LOCUS_05320 902 654 gene locus_tag LOCUS_05330 902 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 3661 1463 gene locus_tag LOCUS_05340 3661 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 5976 3856 gene locus_tag LOCUS_05350 5976 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6173 5994 gene locus_tag LOCUS_05360 6173 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 7031 6228 gene locus_tag LOCUS_05370 7031 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 7553 8689 gene locus_tag LOCUS_05380 gene dinB 7553 8689 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5Q4 protein_id gnl|my_center|LOCUS_05380 10314 8728 gene locus_tag LOCUS_05390 gene ggt 10314 8728 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_05390 11323 10451 gene locus_tag LOCUS_05400 11323 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_05400 12492 11416 gene locus_tag LOCUS_05410 gene buk 12492 11416 CDS product putative butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CK3 protein_id gnl|my_center|LOCUS_05410 13902 12514 gene locus_tag LOCUS_05420 13902 12514 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_05420 14180 15631 gene locus_tag LOCUS_05430 14180 15631 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107891.1 protein_id gnl|my_center|LOCUS_05430 15713 16378 gene locus_tag LOCUS_05440 15713 16378 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_05440 16544 18430 gene locus_tag LOCUS_05450 16544 18430 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108132.1 protein_id gnl|my_center|LOCUS_05450 18519 19763 gene locus_tag LOCUS_05460 18519 19763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_05460 19814 21961 gene locus_tag LOCUS_05470 gene mcm3 19814 21961 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_05470 22062 22658 gene locus_tag LOCUS_05480 22062 22658 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_05480 22648 23925 gene locus_tag LOCUS_05490 22648 23925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 24292 24963 gene locus_tag LOCUS_05500 24292 24963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence026 1300 95 gene locus_tag LOCUS_05510 1300 95 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_05510 2119 1481 gene locus_tag LOCUS_05520 2119 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5324 2166 gene locus_tag LOCUS_05530 5324 2166 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932984.1 protein_id gnl|my_center|LOCUS_05530 5780 5340 gene locus_tag LOCUS_05540 5780 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 6635 5820 gene locus_tag LOCUS_05550 6635 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 6777 8819 gene locus_tag LOCUS_05560 6777 8819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 10033 8891 gene locus_tag LOCUS_05570 10033 8891 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_05570 10192 11379 gene locus_tag LOCUS_05580 10192 11379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 11469 12488 gene locus_tag LOCUS_05590 gene tsaD 11469 12488 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ9 protein_id gnl|my_center|LOCUS_05590 12670 13191 gene locus_tag LOCUS_05600 12670 13191 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_05600 13867 13223 gene locus_tag LOCUS_05610 13867 13223 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_05610 14523 13864 gene locus_tag LOCUS_05620 gene plsY 14523 13864 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MVJ9 protein_id gnl|my_center|LOCUS_05620 14825 17779 gene locus_tag LOCUS_05630 14825 17779 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201890.1 protein_id gnl|my_center|LOCUS_05630 17828 18847 gene locus_tag LOCUS_05640 17828 18847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 18877 20604 gene locus_tag LOCUS_05650 18877 20604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 20609 21868 gene locus_tag LOCUS_05660 20609 21868 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_05660 22141 21878 gene locus_tag LOCUS_05670 22141 21878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 22451 23698 gene locus_tag LOCUS_05680 22451 23698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 24575 23700 gene locus_tag LOCUS_05690 24575 23700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence027 1885 320 gene locus_tag LOCUS_05700 1885 320 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943955.1 protein_id gnl|my_center|LOCUS_05700 3357 1996 gene locus_tag LOCUS_05710 3357 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943954.1 protein_id gnl|my_center|LOCUS_05710 5532 3457 gene locus_tag LOCUS_05720 gene prkA 5532 3457 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943953.1 protein_id gnl|my_center|LOCUS_05720 5875 6588 gene locus_tag LOCUS_05730 5875 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 6598 7278 gene locus_tag LOCUS_05740 6598 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 7390 9897 gene locus_tag LOCUS_05750 7390 9897 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_05750 9971 10654 gene locus_tag LOCUS_05760 9971 10654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 11185 10724 gene locus_tag LOCUS_05770 11185 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_05770 12382 11282 gene locus_tag LOCUS_05780 12382 11282 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_05780 13718 12453 gene locus_tag LOCUS_05790 13718 12453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_05790 15062 13830 gene locus_tag LOCUS_05800 15062 13830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_05800 15875 15198 gene locus_tag LOCUS_05810 15875 15198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 17650 15974 gene locus_tag LOCUS_05820 gene glnS 17650 15974 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_05820 17850 18200 gene locus_tag LOCUS_05830 17850 18200 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PK9 protein_id gnl|my_center|LOCUS_05830 19905 18487 gene locus_tag LOCUS_05840 19905 18487 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_05840 20239 22548 gene locus_tag LOCUS_05850 20239 22548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 22570 23907 gene locus_tag LOCUS_05860 22570 23907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 <24738 24137 gene locus_tag LOCUS_05870 <24738 24137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202850.1:ABC transporter permease >Feature sequence028 2092 674 gene locus_tag LOCUS_05880 2092 674 CDS product MATE efflux family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_05880 3073 2099 gene locus_tag LOCUS_05890 3073 2099 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_05890 3178 3252 gene locus_tag LOCUS_t00120 3178 3252 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3611 5788 gene locus_tag LOCUS_05900 3611 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203169.1 protein_id gnl|my_center|LOCUS_05900 5864 6442 gene locus_tag LOCUS_05910 5864 6442 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_05910 6555 7043 gene locus_tag LOCUS_05920 gene rnhA 6555 7043 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_05920 7071 7847 gene locus_tag LOCUS_05930 7071 7847 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_05930 7885 8721 gene locus_tag LOCUS_05940 gene cheR 7885 8721 CDS product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_05940 8759 9343 gene locus_tag LOCUS_05950 gene cheB2 8759 9343 CDS product putative chemotaxis protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D8 protein_id gnl|my_center|LOCUS_05950 9392 10177 gene locus_tag LOCUS_05960 9392 10177 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021858.1 protein_id gnl|my_center|LOCUS_05960 12369 10183 gene locus_tag LOCUS_05970 12369 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 15128 12372 gene locus_tag LOCUS_05980 15128 12372 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_05980 16220 15276 gene locus_tag LOCUS_05990 16220 15276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 16486 18435 gene locus_tag LOCUS_06000 16486 18435 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108263.1 protein_id gnl|my_center|LOCUS_06000 18488 20317 gene locus_tag LOCUS_06010 18488 20317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 21343 20393 gene locus_tag LOCUS_06020 21343 20393 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_06020 21995 21414 gene locus_tag LOCUS_06030 21995 21414 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_06030 23127 22000 gene locus_tag LOCUS_06040 gene porR 23127 22000 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_06040 23423 23611 gene locus_tag LOCUS_06050 23423 23611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 23697 24329 gene locus_tag LOCUS_06060 23697 24329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence029 87 1088 gene locus_tag LOCUS_06070 87 1088 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_06070 1155 2102 gene locus_tag LOCUS_06080 gene hbd 1155 2102 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418897.1 protein_id gnl|my_center|LOCUS_06080 2176 3381 gene locus_tag LOCUS_06090 gene ackA 2176 3381 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G8 protein_id gnl|my_center|LOCUS_06090 3402 4304 gene locus_tag LOCUS_06100 gene ptb2 3402 4304 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_06100 4326 5408 gene locus_tag LOCUS_06110 gene buk 4326 5408 CDS product putative butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CK3 protein_id gnl|my_center|LOCUS_06110 5448 6227 gene locus_tag LOCUS_06120 gene crt 5448 6227 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_06120 6385 6651 gene locus_tag LOCUS_06130 6385 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6728 6979 gene locus_tag LOCUS_06140 6728 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 7437 7362 gene locus_tag LOCUS_t00130 7437 7362 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7615 8349 gene locus_tag LOCUS_06150 7615 8349 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_06150 8395 9738 gene locus_tag LOCUS_06160 gene pyrC1 8395 9738 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_06160 9881 11143 gene locus_tag LOCUS_06170 gene deaD-2 9881 11143 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_06170 11255 11914 gene locus_tag LOCUS_06180 11255 11914 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_06180 12570 12851 gene locus_tag LOCUS_06190 12570 12851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 13272 15698 gene locus_tag LOCUS_06200 13272 15698 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107279.1 protein_id gnl|my_center|LOCUS_06200 16196 17365 gene locus_tag LOCUS_06210 16196 17365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582731.1 protein_id gnl|my_center|LOCUS_06210 17616 17756 gene locus_tag LOCUS_06220 17616 17756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 17784 17981 gene locus_tag LOCUS_06230 17784 17981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06230 17978 18292 gene locus_tag LOCUS_06240 17978 18292 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_06240 18446 19807 gene locus_tag LOCUS_06250 18446 19807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 19932 20945 gene locus_tag LOCUS_06260 19932 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 21423 23888 gene locus_tag LOCUS_06270 21423 23888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 >Feature sequence030 3342 1915 gene locus_tag LOCUS_06280 3342 1915 CDS product glutamyl-tRNA(Gln) amidotransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_06280 5386 3413 gene locus_tag LOCUS_06290 5386 3413 CDS product glutamyl-tRNA(Gln) amidotransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_06290 5796 10715 gene locus_tag LOCUS_06300 5796 10715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 10829 14497 gene locus_tag LOCUS_06310 10829 14497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 14875 17442 gene locus_tag LOCUS_06320 14875 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 17456 18316 gene locus_tag LOCUS_06330 17456 18316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 18359 19843 gene locus_tag LOCUS_06340 18359 19843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 19950 21200 gene locus_tag LOCUS_06350 19950 21200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 21596 22615 gene locus_tag LOCUS_06360 21596 22615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 22641 23036 gene locus_tag LOCUS_06370 22641 23036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 23089 23637 gene locus_tag LOCUS_06380 23089 23637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence031 632 198 gene locus_tag LOCUS_06390 632 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1778 801 gene locus_tag LOCUS_06400 1778 801 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z22 protein_id gnl|my_center|LOCUS_06400 2250 1780 gene locus_tag LOCUS_06410 2250 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 2527 2252 gene locus_tag LOCUS_06420 2527 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 4872 2536 gene locus_tag LOCUS_06430 4872 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 5514 5107 gene locus_tag LOCUS_06440 5514 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 5892 6830 gene locus_tag LOCUS_06450 gene mdh 5892 6830 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_06450 9238 6920 gene locus_tag LOCUS_06460 9238 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 10068 9787 gene locus_tag LOCUS_06470 10068 9787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 10633 10358 gene locus_tag LOCUS_06480 10633 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 11192 10842 gene locus_tag LOCUS_06490 11192 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 13772 11289 gene locus_tag LOCUS_06500 gene clpA 13772 11289 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_06500 14499 17063 gene locus_tag LOCUS_06510 gene gyrA 14499 17063 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TL9 protein_id gnl|my_center|LOCUS_06510 17147 18409 gene locus_tag LOCUS_06520 17147 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_06520 18922 18500 gene locus_tag LOCUS_06530 18922 18500 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793753.1 protein_id gnl|my_center|LOCUS_06530 20815 19847 gene locus_tag LOCUS_06540 gene fmt 20815 19847 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0S6 protein_id gnl|my_center|LOCUS_06540 21124 21933 gene locus_tag LOCUS_06550 21124 21933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 22323 21952 gene locus_tag LOCUS_06560 22323 21952 CDS product iron-molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582909.1 protein_id gnl|my_center|LOCUS_06560 22805 22347 gene locus_tag LOCUS_06570 22805 22347 CDS product UPF0251 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHY2 protein_id gnl|my_center|LOCUS_06570 23251 22853 gene locus_tag LOCUS_06580 23251 22853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence032 622 3318 gene locus_tag LOCUS_06590 622 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3455 3528 gene locus_tag LOCUS_t00140 3455 3528 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3604 4617 gene locus_tag LOCUS_06600 3604 4617 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_06600 7274 4614 gene locus_tag LOCUS_06610 7274 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 7627 9426 gene locus_tag LOCUS_06620 7627 9426 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082447.1 protein_id gnl|my_center|LOCUS_06620 9452 10156 gene locus_tag LOCUS_06630 9452 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 10170 10718 gene locus_tag LOCUS_06640 10170 10718 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_06640 10730 12184 gene locus_tag LOCUS_06650 10730 12184 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_06650 12290 12787 gene locus_tag LOCUS_06660 12290 12787 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582503.1 protein_id gnl|my_center|LOCUS_06660 13097 12909 gene locus_tag LOCUS_06670 13097 12909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 13885 14598 gene locus_tag LOCUS_06680 13885 14598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 16195 14669 gene locus_tag LOCUS_06690 16195 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_06690 17954 16359 gene locus_tag LOCUS_06700 17954 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 19132 17984 gene locus_tag LOCUS_06710 gene capA 19132 17984 CDS product PGA biosynthesis protein CapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96738 protein_id gnl|my_center|LOCUS_06710 19447 21852 gene locus_tag LOCUS_06720 19447 21852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 21895 22656 gene locus_tag LOCUS_06730 21895 22656 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence033 874 239 gene locus_tag LOCUS_06740 874 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 1242 1084 gene locus_tag LOCUS_06750 1242 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 1762 1325 gene locus_tag LOCUS_06760 gene tadA 1762 1325 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_06760 2761 1778 gene locus_tag LOCUS_06770 2761 1778 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932637.1 protein_id gnl|my_center|LOCUS_06770 5683 3050 gene locus_tag LOCUS_06780 5683 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_06780 5792 6967 gene locus_tag LOCUS_06790 5792 6967 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759762.1 protein_id gnl|my_center|LOCUS_06790 7030 8325 gene locus_tag LOCUS_06800 7030 8325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 8378 9415 gene locus_tag LOCUS_06810 gene aroB 8378 9415 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL6 protein_id gnl|my_center|LOCUS_06810 9393 10037 gene locus_tag LOCUS_06820 9393 10037 CDS product 3-dehydroquinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870974.1 protein_id gnl|my_center|LOCUS_06820 10135 11004 gene locus_tag LOCUS_06830 10135 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 11136 12392 gene locus_tag LOCUS_06840 gene aroA 11136 12392 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187E3 protein_id gnl|my_center|LOCUS_06840 12402 13382 gene locus_tag LOCUS_06850 gene aroC 12402 13382 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187E5 protein_id gnl|my_center|LOCUS_06850 13549 15909 gene locus_tag LOCUS_06860 13549 15909 CDS product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870178.1 protein_id gnl|my_center|LOCUS_06860 15911 16819 gene locus_tag LOCUS_06870 15911 16819 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053645.1 protein_id gnl|my_center|LOCUS_06870 16906 17976 gene locus_tag LOCUS_06880 16906 17976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 18014 18460 gene locus_tag LOCUS_06890 18014 18460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 18578 20605 gene locus_tag LOCUS_06900 18578 20605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 20741 21148 gene locus_tag LOCUS_06910 20741 21148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 21702 22148 gene locus_tag LOCUS_06920 21702 22148 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence034 123 644 gene locus_tag LOCUS_06930 123 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 820 1935 gene locus_tag LOCUS_06940 820 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 2036 4069 gene locus_tag LOCUS_06950 2036 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 4131 6200 gene locus_tag LOCUS_06960 4131 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 6322 6876 gene locus_tag LOCUS_06970 6322 6876 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020384.1 protein_id gnl|my_center|LOCUS_06970 7587 6892 gene locus_tag LOCUS_06980 gene radC 7587 6892 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_06980 7986 7735 gene locus_tag LOCUS_06990 gene rpsT 7986 7735 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A276 protein_id gnl|my_center|LOCUS_06990 8093 8021 gene locus_tag LOCUS_t00150 8093 8021 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9180 8206 gene locus_tag LOCUS_07000 gene hldD 9180 8206 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_07000 9179 9730 gene locus_tag LOCUS_07010 9179 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 9762 11204 gene locus_tag LOCUS_07020 gene pepD2 9762 11204 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643748.1 protein_id gnl|my_center|LOCUS_07020 11351 12373 gene locus_tag LOCUS_07030 11351 12373 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_07030 12546 12752 gene locus_tag LOCUS_07040 12546 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 12743 13000 gene locus_tag LOCUS_07050 gene relE 12743 13000 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769718.1 protein_id gnl|my_center|LOCUS_07050 15106 13079 gene locus_tag LOCUS_07060 15106 13079 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404041.1 protein_id gnl|my_center|LOCUS_07060 15956 15144 gene locus_tag LOCUS_07070 15956 15144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 18808 15977 gene locus_tag LOCUS_07080 18808 15977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143241.1 protein_id gnl|my_center|LOCUS_07080 19446 18793 gene locus_tag LOCUS_07090 19446 18793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 20209 19529 gene locus_tag LOCUS_07100 20209 19529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_07100 20562 22253 gene locus_tag LOCUS_07110 20562 22253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence035 888 91 gene locus_tag LOCUS_07120 888 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 1106 1288 gene locus_tag LOCUS_07130 1106 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2798 1275 gene locus_tag LOCUS_07140 2798 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 4121 2964 gene locus_tag LOCUS_07150 gene aslB 4121 2964 CDS product anaerobic sulfatase maturase AslB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941499.1 protein_id gnl|my_center|LOCUS_07150 6076 4133 gene locus_tag LOCUS_07160 6076 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 6663 7184 gene locus_tag LOCUS_07170 6663 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 7177 7572 gene locus_tag LOCUS_07180 7177 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 7679 7903 gene locus_tag LOCUS_07190 7679 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 8100 8291 gene locus_tag LOCUS_07200 8100 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 8742 9908 gene locus_tag LOCUS_07210 8742 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 10478 10179 gene locus_tag LOCUS_07220 10478 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 12675 10639 gene locus_tag LOCUS_07230 12675 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 14779 12725 gene locus_tag LOCUS_07240 14779 12725 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767256.1 protein_id gnl|my_center|LOCUS_07240 16253 14835 gene locus_tag LOCUS_07250 16253 14835 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_07250 17867 16389 gene locus_tag LOCUS_07260 17867 16389 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_07260 18886 17888 gene locus_tag LOCUS_07270 18886 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_07270 21282 18928 gene locus_tag LOCUS_07280 21282 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence036 1144 1611 gene locus_tag LOCUS_07290 1144 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2737 1679 gene locus_tag LOCUS_07300 2737 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963738.1 protein_id gnl|my_center|LOCUS_07300 4570 2894 gene locus_tag LOCUS_07310 4570 2894 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_07310 4918 5874 gene locus_tag LOCUS_07320 4918 5874 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A146 protein_id gnl|my_center|LOCUS_07320 6834 5890 gene locus_tag LOCUS_07330 6834 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 8266 6938 gene locus_tag LOCUS_07340 8266 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 9144 8383 gene locus_tag LOCUS_07350 9144 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 10706 9210 gene locus_tag LOCUS_07360 10706 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 10852 11055 gene locus_tag LOCUS_07370 10852 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 11152 13506 gene locus_tag LOCUS_07380 11152 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 13625 15952 gene locus_tag LOCUS_07390 13625 15952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 16105 16947 gene locus_tag LOCUS_07400 16105 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964178.1 protein_id gnl|my_center|LOCUS_07400 18852 17086 gene locus_tag LOCUS_07410 18852 17086 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_07410 19291 20802 gene locus_tag LOCUS_07420 19291 20802 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_07420 20919 22121 gene locus_tag LOCUS_07430 20919 22121 CDS product DUF4831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764542.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence037 <1 1640 gene locus_tag LOCUS_07440 <1 1640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207643.1:two-component sensor histidine kinase 3748 1946 gene locus_tag LOCUS_07450 gene argS 3748 1946 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_07450 4886 3771 gene locus_tag LOCUS_07460 4886 3771 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966190.1 protein_id gnl|my_center|LOCUS_07460 6256 4886 gene locus_tag LOCUS_07470 6256 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 6774 6334 gene locus_tag LOCUS_07480 6774 6334 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_07480 7743 6877 gene locus_tag LOCUS_07490 7743 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993022.1 protein_id gnl|my_center|LOCUS_07490 8593 7853 gene locus_tag LOCUS_07500 8593 7853 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013490.1 protein_id gnl|my_center|LOCUS_07500 9350 8772 gene locus_tag LOCUS_07510 9350 8772 CDS product aromatic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869594.1 protein_id gnl|my_center|LOCUS_07510 9464 10306 gene locus_tag LOCUS_07520 9464 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 10466 11203 gene locus_tag LOCUS_07530 10466 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_07530 12173 11220 gene locus_tag LOCUS_07540 12173 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 12973 12581 gene locus_tag LOCUS_07550 12973 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 13610 13383 gene locus_tag LOCUS_07560 13610 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 13981 14514 gene locus_tag LOCUS_07570 13981 14514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 16707 14758 gene locus_tag LOCUS_07580 gene ispG 16707 14758 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N34 protein_id gnl|my_center|LOCUS_07580 17805 16750 gene locus_tag LOCUS_07590 17805 16750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 18785 17991 gene locus_tag LOCUS_07600 18785 17991 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_07600 18920 19582 gene locus_tag LOCUS_07610 18920 19582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_07610 19645 20892 gene locus_tag LOCUS_07620 19645 20892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence038 <1 1405 gene locus_tag LOCUS_07630 <1 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963148.1:peptidase S41 1395 2291 gene locus_tag LOCUS_07640 1395 2291 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802593.1 protein_id gnl|my_center|LOCUS_07640 2323 3111 gene locus_tag LOCUS_07650 2323 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3235 4194 gene locus_tag LOCUS_07660 3235 4194 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_07660 4232 4675 gene locus_tag LOCUS_07670 4232 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 4827 5456 gene locus_tag LOCUS_07680 4827 5456 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690423.1 protein_id gnl|my_center|LOCUS_07680 5797 7899 gene locus_tag LOCUS_07690 5797 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 8582 8403 gene locus_tag LOCUS_07700 8582 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 9945 8944 gene locus_tag LOCUS_07710 gene argF 9945 8944 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LF9 protein_id gnl|my_center|LOCUS_07710 10937 9993 gene locus_tag LOCUS_07720 10937 9993 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH43 protein_id gnl|my_center|LOCUS_07720 11207 12028 gene locus_tag LOCUS_07730 11207 12028 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_07730 12021 13313 gene locus_tag LOCUS_07740 12021 13313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_07740 13324 15177 gene locus_tag LOCUS_07750 gene glmS 13324 15177 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_07750 15408 15869 gene locus_tag LOCUS_07760 15408 15869 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_07760 15905 17536 gene locus_tag LOCUS_07770 15905 17536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 17720 19846 gene locus_tag LOCUS_07780 17720 19846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence039 218 2986 gene locus_tag LOCUS_07790 218 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3024 5015 gene locus_tag LOCUS_07800 3024 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 5028 7052 gene locus_tag LOCUS_07810 5028 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 7083 7562 gene locus_tag LOCUS_07820 7083 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 7552 10224 gene locus_tag LOCUS_07830 7552 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 10261 12903 gene locus_tag LOCUS_07840 10261 12903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 12842 13363 gene locus_tag LOCUS_07850 12842 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 13420 14118 gene locus_tag LOCUS_07860 gene terY 13420 14118 CDS product tellurium resistance protein TerY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210395.1 protein_id gnl|my_center|LOCUS_07860 14144 15076 gene locus_tag LOCUS_07870 14144 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 15078 16577 gene locus_tag LOCUS_07880 15078 16577 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210399.1 protein_id gnl|my_center|LOCUS_07880 16672 17910 gene locus_tag LOCUS_07890 16672 17910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 17916 21191 gene locus_tag LOCUS_07900 17916 21191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence040 172 1602 gene locus_tag LOCUS_07910 gene dnaA 172 1602 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_07910 4876 1769 gene locus_tag LOCUS_07920 4876 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 5576 4929 gene locus_tag LOCUS_07930 gene rpe 5576 4929 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_07930 7083 5668 gene locus_tag LOCUS_07940 7083 5668 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_07940 7916 7083 gene locus_tag LOCUS_07950 7916 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 8103 8762 gene locus_tag LOCUS_07960 8103 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 11909 8841 gene locus_tag LOCUS_07970 11909 8841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 13139 12150 gene locus_tag LOCUS_07980 13139 12150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 14709 13189 gene locus_tag LOCUS_07990 14709 13189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_07990 15509 14790 gene locus_tag LOCUS_08000 15509 14790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404002.1 protein_id gnl|my_center|LOCUS_08000 16467 15538 gene locus_tag LOCUS_08010 16467 15538 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_08010 16687 17343 gene locus_tag LOCUS_08020 16687 17343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 17333 20656 gene locus_tag LOCUS_08030 17333 20656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence041 295 4557 gene locus_tag LOCUS_08040 295 4557 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107756.1 protein_id gnl|my_center|LOCUS_08040 4747 5484 gene locus_tag LOCUS_08050 4747 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 6048 5605 gene locus_tag LOCUS_08060 6048 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 6122 7363 gene locus_tag LOCUS_08070 6122 7363 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_08070 7508 9055 gene locus_tag LOCUS_08080 7508 9055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 9829 9149 gene locus_tag LOCUS_08090 gene ung2 9829 9149 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_08090 10578 9832 gene locus_tag LOCUS_08100 10578 9832 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_08100 12963 10618 gene locus_tag LOCUS_08110 12963 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 13113 13559 gene locus_tag LOCUS_08120 gene moaC 13113 13559 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U9C6 protein_id gnl|my_center|LOCUS_08120 13597 14115 gene locus_tag LOCUS_08130 gene moaB 13597 14115 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97HL7 protein_id gnl|my_center|LOCUS_08130 16863 14173 gene locus_tag LOCUS_08140 16863 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 18016 17024 gene locus_tag LOCUS_08150 18016 17024 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_08150 <20648 18153 gene locus_tag LOCUS_08160 <20648 18153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase >Feature sequence042 231 1199 gene locus_tag LOCUS_08170 gene rlmF 231 1199 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YP0 protein_id gnl|my_center|LOCUS_08170 2259 1564 gene locus_tag LOCUS_08180 2259 1564 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022315.1 protein_id gnl|my_center|LOCUS_08180 4068 2449 gene locus_tag LOCUS_08190 4068 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 4237 4165 gene locus_tag LOCUS_t00160 4237 4165 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5293 4262 gene locus_tag LOCUS_08200 5293 4262 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_08200 5496 6248 gene locus_tag LOCUS_08210 5496 6248 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_08210 6372 7112 gene locus_tag LOCUS_08220 6372 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 7117 8736 gene locus_tag LOCUS_08230 7117 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 9811 8801 gene locus_tag LOCUS_08240 9811 8801 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815896.1 protein_id gnl|my_center|LOCUS_08240 9948 11399 gene locus_tag LOCUS_08250 gene asnS 9948 11399 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_08250 11435 12673 gene locus_tag LOCUS_08260 11435 12673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 12817 13941 gene locus_tag LOCUS_08270 gene lpxK 12817 13941 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K1 protein_id gnl|my_center|LOCUS_08270 13886 14698 gene locus_tag LOCUS_08280 13886 14698 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN5 protein_id gnl|my_center|LOCUS_08280 14743 16146 gene locus_tag LOCUS_08290 14743 16146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 17027 16197 gene locus_tag LOCUS_08300 gene cobB 17027 16197 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3Z6 protein_id gnl|my_center|LOCUS_08300 17802 17014 gene locus_tag LOCUS_08310 gene cutC 17802 17014 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q87 protein_id gnl|my_center|LOCUS_08310 19004 17895 gene locus_tag LOCUS_08320 19004 17895 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_08320 <20544 19038 gene locus_tag LOCUS_08330 <20544 19038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NLV3:histidine kinase >Feature sequence043 141 4667 gene locus_tag LOCUS_08340 141 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4746 7487 gene locus_tag LOCUS_08350 4746 7487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 7988 7563 gene locus_tag LOCUS_08360 gene moaE 7988 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057200.1 protein_id gnl|my_center|LOCUS_08360 8279 8046 gene locus_tag LOCUS_08370 8279 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 8856 8281 gene locus_tag LOCUS_08380 gene mobA 8856 8281 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGH6 protein_id gnl|my_center|LOCUS_08380 9229 8975 gene locus_tag LOCUS_08390 gene purS 9229 8975 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCS4 protein_id gnl|my_center|LOCUS_08390 9965 9240 gene locus_tag LOCUS_08400 9965 9240 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_08400 10451 9981 gene locus_tag LOCUS_08410 10451 9981 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_08410 11047 10451 gene locus_tag LOCUS_08420 gene lspA 11047 10451 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U05 protein_id gnl|my_center|LOCUS_08420 11435 11058 gene locus_tag LOCUS_08430 11435 11058 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_08430 14837 11478 gene locus_tag LOCUS_08440 gene ileS 14837 11478 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U07 protein_id gnl|my_center|LOCUS_08440 15495 16949 gene locus_tag LOCUS_08450 15495 16949 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_08450 19103 17016 gene locus_tag LOCUS_08460 19103 17016 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_08460 19460 19732 gene locus_tag LOCUS_08470 19460 19732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 19736 20344 gene locus_tag LOCUS_08480 19736 20344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence044 514 894 gene locus_tag LOCUS_08490 gene rplP 514 894 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A483 protein_id gnl|my_center|LOCUS_08490 901 1104 gene locus_tag LOCUS_08500 901 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1116 1373 gene locus_tag LOCUS_08510 gene rpsQ 1116 1373 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_08510 1376 1744 gene locus_tag LOCUS_08520 gene rplN 1376 1744 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_08520 1763 2089 gene locus_tag LOCUS_08530 gene rplX 1763 2089 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_08530 2089 2643 gene locus_tag LOCUS_08540 gene rplE 2089 2643 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM0 protein_id gnl|my_center|LOCUS_08540 2649 2918 gene locus_tag LOCUS_08550 gene rpsN 2649 2918 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_08550 2961 3356 gene locus_tag LOCUS_08560 gene rpsH 2961 3356 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A490 protein_id gnl|my_center|LOCUS_08560 3375 3929 gene locus_tag LOCUS_08570 gene rplF 3375 3929 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM3 protein_id gnl|my_center|LOCUS_08570 3950 4309 gene locus_tag LOCUS_08580 gene rplR 3950 4309 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A492 protein_id gnl|my_center|LOCUS_08580 4315 4824 gene locus_tag LOCUS_08590 gene rpsE 4315 4824 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_08590 4871 5050 gene locus_tag LOCUS_08600 gene rpmD 4871 5050 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM6 protein_id gnl|my_center|LOCUS_08600 5074 5520 gene locus_tag LOCUS_08610 gene rplO 5074 5520 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A495 protein_id gnl|my_center|LOCUS_08610 5525 6862 gene locus_tag LOCUS_08620 gene secY 5525 6862 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM8 protein_id gnl|my_center|LOCUS_08620 6885 7661 gene locus_tag LOCUS_08630 gene map 6885 7661 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM9 protein_id gnl|my_center|LOCUS_08630 7673 7894 gene locus_tag LOCUS_08640 gene infA 7673 7894 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_08640 8091 8471 gene locus_tag LOCUS_08650 gene rpsM 8091 8471 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 protein_id gnl|my_center|LOCUS_08650 8484 8876 gene locus_tag LOCUS_08660 gene rpsK 8484 8876 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A0 protein_id gnl|my_center|LOCUS_08660 8931 9539 gene locus_tag LOCUS_08670 gene rpsD 8931 9539 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN4 protein_id gnl|my_center|LOCUS_08670 9599 10594 gene locus_tag LOCUS_08680 gene rpoA 9599 10594 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_08680 10706 11242 gene locus_tag LOCUS_08690 10706 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 11338 12621 gene locus_tag LOCUS_08700 gene eno 11338 12621 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37869 protein_id gnl|my_center|LOCUS_08700 13505 12828 gene locus_tag LOCUS_08710 13505 12828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 13860 13660 gene locus_tag LOCUS_08720 13860 13660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 13751 19855 gene locus_tag LOCUS_08730 13751 19855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence045 1043 294 gene locus_tag LOCUS_08740 1043 294 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938991.1 protein_id gnl|my_center|LOCUS_08740 1396 1043 gene locus_tag LOCUS_08750 1396 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_08750 4652 1428 gene locus_tag LOCUS_08760 4652 1428 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938992.1 protein_id gnl|my_center|LOCUS_08760 5952 4867 gene locus_tag LOCUS_08770 5952 4867 CDS product adenosine monophosphate-protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4R5 protein_id gnl|my_center|LOCUS_08770 6402 5983 gene locus_tag LOCUS_08780 6402 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_08780 7879 6413 gene locus_tag LOCUS_08790 7879 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 8735 7869 gene locus_tag LOCUS_08800 gene dinD 8735 7869 CDS product DNA-damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001377125.1 protein_id gnl|my_center|LOCUS_08800 10341 8749 gene locus_tag LOCUS_08810 gene hsdM 10341 8749 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_08810 10904 10347 gene locus_tag LOCUS_08820 10904 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 11186 11731 gene locus_tag LOCUS_08830 11186 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 11904 13052 gene locus_tag LOCUS_08840 11904 13052 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 protein_id gnl|my_center|LOCUS_08840 13096 13638 gene locus_tag LOCUS_08850 13096 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 13887 15836 gene locus_tag LOCUS_08860 13887 15836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 16022 17977 gene locus_tag LOCUS_08870 16022 17977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 18124 19824 gene locus_tag LOCUS_08880 18124 19824 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence046 5150 1851 gene locus_tag LOCUS_08890 5150 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 6707 5217 gene locus_tag LOCUS_08900 gene cpsL 6707 5217 CDS product phage capsid assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093056.1 protein_id gnl|my_center|LOCUS_08900 7470 6748 gene locus_tag LOCUS_08910 7470 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 8370 7480 gene locus_tag LOCUS_08920 8370 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 9572 8385 gene locus_tag LOCUS_08930 9572 8385 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987001.1 protein_id gnl|my_center|LOCUS_08930 10872 9802 gene locus_tag LOCUS_08940 10872 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 12221 10866 gene locus_tag LOCUS_08950 12221 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 13314 12334 gene locus_tag LOCUS_08960 13314 12334 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A382 protein_id gnl|my_center|LOCUS_08960 13462 14343 gene locus_tag LOCUS_08970 13462 14343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 15162 14359 gene locus_tag LOCUS_08980 15162 14359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790656.1 protein_id gnl|my_center|LOCUS_08980 15505 16179 gene locus_tag LOCUS_08990 15505 16179 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_08990 16311 17501 gene locus_tag LOCUS_09000 gene hflX 16311 17501 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I1 protein_id gnl|my_center|LOCUS_09000 17745 17984 gene locus_tag LOCUS_09010 17745 17984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence047 893 171 gene locus_tag LOCUS_09020 893 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_09020 2398 1394 gene locus_tag LOCUS_09030 2398 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2735 3823 gene locus_tag LOCUS_09040 gene pdhA 2735 3823 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21881 protein_id gnl|my_center|LOCUS_09040 3802 4797 gene locus_tag LOCUS_09050 gene pdhB 3802 4797 CDS product pyruvate dehydrogenase E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P75391 protein_id gnl|my_center|LOCUS_09050 4801 6087 gene locus_tag LOCUS_09060 gene pdhC 4801 6087 CDS product dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21883 protein_id gnl|my_center|LOCUS_09060 6102 7457 gene locus_tag LOCUS_09070 gene acoL 6102 7457 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2A4 protein_id gnl|my_center|LOCUS_09070 7778 8398 gene locus_tag LOCUS_09080 7778 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 8405 8662 gene locus_tag LOCUS_09090 8405 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 8684 9988 gene locus_tag LOCUS_09100 gene der 8684 9988 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV3 protein_id gnl|my_center|LOCUS_09100 10108 10548 gene locus_tag LOCUS_09110 10108 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 12857 10797 gene locus_tag LOCUS_09120 gene fusA2 12857 10797 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_09120 13199 19285 gene locus_tag LOCUS_09130 13199 19285 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence048 712 389 gene locus_tag LOCUS_09140 712 389 CDS product dksA/traR C4-type zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_09140 1751 1032 gene locus_tag LOCUS_09150 1751 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2086 1754 gene locus_tag LOCUS_09160 2086 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3377 2070 gene locus_tag LOCUS_09170 3377 2070 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJE6 protein_id gnl|my_center|LOCUS_09170 3710 4723 gene locus_tag LOCUS_09180 3710 4723 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_09180 4765 5367 gene locus_tag LOCUS_09190 4765 5367 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_09190 5408 5920 gene locus_tag LOCUS_09200 5408 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 6746 6006 gene locus_tag LOCUS_09210 6746 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 7766 6918 gene locus_tag LOCUS_09220 7766 6918 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230430.1 protein_id gnl|my_center|LOCUS_09220 7945 8415 gene locus_tag LOCUS_09230 7945 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 8405 8569 gene locus_tag LOCUS_09240 8405 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 9711 8599 gene locus_tag LOCUS_09250 9711 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 10499 9837 gene locus_tag LOCUS_09260 10499 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 11735 10506 gene locus_tag LOCUS_09270 11735 10506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 11855 12673 gene locus_tag LOCUS_09280 11855 12673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 12775 13716 gene locus_tag LOCUS_09290 12775 13716 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_09290 13803 14693 gene locus_tag LOCUS_09300 13803 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_09300 14680 14925 gene locus_tag LOCUS_09310 14680 14925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 14980 16713 gene locus_tag LOCUS_09320 14980 16713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 16732 17238 gene locus_tag LOCUS_09330 16732 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 17235 18659 gene locus_tag LOCUS_09340 17235 18659 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861449.1 protein_id gnl|my_center|LOCUS_09340 18863 19303 gene locus_tag LOCUS_09350 18863 19303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence049 >Feature sequence050 601 1737 gene locus_tag LOCUS_09360 601 1737 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_09360 1896 3170 gene locus_tag LOCUS_09370 1896 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_09370 3232 3897 gene locus_tag LOCUS_09380 3232 3897 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_09380 3956 4231 gene locus_tag LOCUS_09390 3956 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_09390 4228 4608 gene locus_tag LOCUS_09400 4228 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 4741 5922 gene locus_tag LOCUS_09410 4741 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_09410 9653 5982 gene locus_tag LOCUS_09420 gene metH 9653 5982 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_09420 9831 10652 gene locus_tag LOCUS_09430 9831 10652 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868257.1 protein_id gnl|my_center|LOCUS_09430 10735 11727 gene locus_tag LOCUS_09440 10735 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 11746 13551 gene locus_tag LOCUS_09450 11746 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 13655 14581 gene locus_tag LOCUS_09460 13655 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 14802 15551 gene locus_tag LOCUS_09470 14802 15551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963648.1 protein_id gnl|my_center|LOCUS_09470 15553 16407 gene locus_tag LOCUS_09480 15553 16407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963647.1 protein_id gnl|my_center|LOCUS_09480 16411 17184 gene locus_tag LOCUS_09490 16411 17184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence051 946 98 gene locus_tag LOCUS_09500 gene mvaB 946 98 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_09500 1455 2129 gene locus_tag LOCUS_09510 1455 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2837 2166 gene locus_tag LOCUS_09520 2837 2166 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_09520 3985 2897 gene locus_tag LOCUS_09530 gene mnmA 3985 2897 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZN9 protein_id gnl|my_center|LOCUS_09530 5503 3989 gene locus_tag LOCUS_09540 gene sppA 5503 3989 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_09540 5755 5546 gene locus_tag LOCUS_09550 5755 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 8254 5885 gene locus_tag LOCUS_09560 8254 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 8526 9074 gene locus_tag LOCUS_09570 8526 9074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 9613 10071 gene locus_tag LOCUS_09580 9613 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 10092 12803 gene locus_tag LOCUS_09590 10092 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 12803 13765 gene locus_tag LOCUS_09600 12803 13765 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_09600 15389 13929 gene locus_tag LOCUS_09610 15389 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 16238 15393 gene locus_tag LOCUS_09620 gene dinD 16238 15393 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_09620 18382 16235 gene locus_tag LOCUS_09630 18382 16235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence052 417 34 gene locus_tag LOCUS_09640 417 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 810 2000 gene locus_tag LOCUS_09650 810 2000 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_09650 2148 4568 gene locus_tag LOCUS_09660 gene lon 2148 4568 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_09660 4569 5771 gene locus_tag LOCUS_09670 4569 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 5854 6492 gene locus_tag LOCUS_09680 5854 6492 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_09680 7837 6533 gene locus_tag LOCUS_09690 7837 6533 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_09690 7997 8230 gene locus_tag LOCUS_09700 7997 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 8322 9236 gene locus_tag LOCUS_09710 8322 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 9379 11175 gene locus_tag LOCUS_09720 9379 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 11172 11750 gene locus_tag LOCUS_09730 11172 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 11780 12493 gene locus_tag LOCUS_09740 11780 12493 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_09740 12632 14452 gene locus_tag LOCUS_09750 gene ogt 12632 14452 CDS product O-GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_09750 <18599 14465 gene locus_tag LOCUS_09760 <18599 14465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107692.1:alpha-glucan phosphorylase >Feature sequence053 322 2466 gene locus_tag LOCUS_09770 322 2466 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107669.1 protein_id gnl|my_center|LOCUS_09770 2671 3237 gene locus_tag LOCUS_09780 gene efp 2671 3237 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_09780 3376 4602 gene locus_tag LOCUS_09790 3376 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 4776 7250 gene locus_tag LOCUS_09800 4776 7250 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_09800 7262 8545 gene locus_tag LOCUS_09810 7262 8545 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_09810 8641 9915 gene locus_tag LOCUS_09820 8641 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 10193 10387 gene locus_tag LOCUS_09830 10193 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 10479 10646 gene locus_tag LOCUS_09840 10479 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 10727 12010 gene locus_tag LOCUS_09850 gene tyrS 10727 12010 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K7 protein_id gnl|my_center|LOCUS_09850 12344 12138 gene locus_tag LOCUS_09860 12344 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 12322 13143 gene locus_tag LOCUS_09870 12322 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 13405 13262 gene locus_tag LOCUS_09880 13405 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 13743 14624 gene locus_tag LOCUS_09890 13743 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 15300 14659 gene locus_tag LOCUS_09900 gene nth 15300 14659 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R69 protein_id gnl|my_center|LOCUS_09900 17521 15374 gene locus_tag LOCUS_09910 17521 15374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence054 2203 323 gene locus_tag LOCUS_09920 2203 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 6855 2242 gene locus_tag LOCUS_09930 6855 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 6818 7087 gene locus_tag LOCUS_09940 6818 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 10515 7183 gene locus_tag LOCUS_09950 10515 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 14463 11140 gene locus_tag LOCUS_09960 14463 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 15673 14720 gene locus_tag LOCUS_09970 15673 14720 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_09970 17143 15731 gene locus_tag LOCUS_09980 17143 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence055 2786 261 gene locus_tag LOCUS_09990 2786 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 3397 2891 gene locus_tag LOCUS_10000 3397 2891 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAE4 protein_id gnl|my_center|LOCUS_10000 3743 4348 gene locus_tag LOCUS_10010 gene lpxF 3743 4348 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M3 protein_id gnl|my_center|LOCUS_10010 4400 6724 gene locus_tag LOCUS_10020 4400 6724 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA08 protein_id gnl|my_center|LOCUS_10020 7415 6786 gene locus_tag LOCUS_10030 7415 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 8837 7419 gene locus_tag LOCUS_10040 8837 7419 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_10040 9937 8900 gene locus_tag LOCUS_10050 gene adhP 9937 8900 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053082.1 protein_id gnl|my_center|LOCUS_10050 10940 10026 gene locus_tag LOCUS_10060 10940 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_10060 11388 13391 gene locus_tag LOCUS_10070 11388 13391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 13555 14916 gene locus_tag LOCUS_10080 gene metK 13555 14916 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_10080 14997 15584 gene locus_tag LOCUS_10090 14997 15584 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_10090 15822 17627 gene locus_tag LOCUS_10100 15822 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence056 1981 1646 gene locus_tag LOCUS_10110 1981 1646 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962894.1 protein_id gnl|my_center|LOCUS_10110 4005 2164 gene locus_tag LOCUS_10120 4005 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 4861 4037 gene locus_tag LOCUS_10130 4861 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 4785 4997 gene locus_tag LOCUS_10140 4785 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5888 5337 gene locus_tag LOCUS_10150 5888 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 6923 5961 gene locus_tag LOCUS_10160 6923 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7037 8419 gene locus_tag LOCUS_10170 7037 8419 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109034.1 protein_id gnl|my_center|LOCUS_10170 8710 8907 gene locus_tag LOCUS_10180 8710 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 8879 9037 gene locus_tag LOCUS_10190 8879 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 9427 9744 gene locus_tag LOCUS_10200 9427 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9741 10139 gene locus_tag LOCUS_10210 9741 10139 CDS product UPF0332 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X095 protein_id gnl|my_center|LOCUS_10210 11268 10540 gene locus_tag LOCUS_10220 11268 10540 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_10220 12500 11493 gene locus_tag LOCUS_10230 12500 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 12718 13788 gene locus_tag LOCUS_10240 12718 13788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888985.1 protein_id gnl|my_center|LOCUS_10240 13901 16279 gene locus_tag LOCUS_10250 13901 16279 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_10250 16492 17202 gene locus_tag LOCUS_10260 16492 17202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 17351 17539 gene locus_tag LOCUS_10270 17351 17539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence057 <1 1250 gene locus_tag LOCUS_10280 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A8M0:glycine dehydrogenase (decarboxylating) 3238 1310 gene locus_tag LOCUS_10290 3238 1310 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_10290 3545 4003 gene locus_tag LOCUS_10300 3545 4003 CDS product UPF0306 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBE9 protein_id gnl|my_center|LOCUS_10300 4178 5194 gene locus_tag LOCUS_10310 4178 5194 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765717.1 protein_id gnl|my_center|LOCUS_10310 7196 5253 gene locus_tag LOCUS_10320 7196 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 13652 7212 gene locus_tag LOCUS_10330 13652 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 13920 13847 gene locus_tag LOCUS_t00170 13920 13847 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14256 17303 gene locus_tag LOCUS_10340 14256 17303 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_10340 17907 17410 gene locus_tag LOCUS_10350 17907 17410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence058 187 2328 gene locus_tag LOCUS_10360 187 2328 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_10360 4094 2457 gene locus_tag LOCUS_10370 gene groL 4094 2457 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QU2 protein_id gnl|my_center|LOCUS_10370 4426 4148 gene locus_tag LOCUS_10380 gene groS 4426 4148 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6P7 protein_id gnl|my_center|LOCUS_10380 5128 4766 gene locus_tag LOCUS_10390 5128 4766 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_10390 6075 5140 gene locus_tag LOCUS_10400 6075 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_10400 6653 6144 gene locus_tag LOCUS_10410 6653 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_10410 8010 6769 gene locus_tag LOCUS_10420 8010 6769 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_10420 8243 9466 gene locus_tag LOCUS_10430 gene ald 8243 9466 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_10430 9485 9838 gene locus_tag LOCUS_10440 9485 9838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_10440 9915 10457 gene locus_tag LOCUS_10450 9915 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 10589 11179 gene locus_tag LOCUS_10460 10589 11179 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence059 336 668 gene locus_tag LOCUS_10470 336 668 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962894.1 protein_id gnl|my_center|LOCUS_10470 665 1609 gene locus_tag LOCUS_10480 665 1609 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YN8 protein_id gnl|my_center|LOCUS_10480 1584 2579 gene locus_tag LOCUS_10490 1584 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 3064 2991 gene locus_tag LOCUS_t00180 3064 2991 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3731 4153 gene locus_tag LOCUS_10500 3731 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765125.1 protein_id gnl|my_center|LOCUS_10500 4164 5114 gene locus_tag LOCUS_10510 4164 5114 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_10510 5187 6518 gene locus_tag LOCUS_10520 5187 6518 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA47 protein_id gnl|my_center|LOCUS_10520 6551 7546 gene locus_tag LOCUS_10530 6551 7546 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T33 protein_id gnl|my_center|LOCUS_10530 7586 7984 gene locus_tag LOCUS_10540 7586 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 8035 8613 gene locus_tag LOCUS_10550 8035 8613 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T34 protein_id gnl|my_center|LOCUS_10550 8664 9248 gene locus_tag LOCUS_10560 8664 9248 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T35 protein_id gnl|my_center|LOCUS_10560 9260 9853 gene locus_tag LOCUS_10570 9260 9853 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T36 protein_id gnl|my_center|LOCUS_10570 11694 10381 gene locus_tag LOCUS_10580 11694 10381 CDS product Fe-S-cluster-containing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_10580 12648 11722 gene locus_tag LOCUS_10590 12648 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 13142 14668 gene locus_tag LOCUS_10600 gene gpmI 13142 14668 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A287 protein_id gnl|my_center|LOCUS_10600 14698 15291 gene locus_tag LOCUS_10610 14698 15291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_10610 <17825 15388 gene locus_tag LOCUS_10620 <17825 15388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783669.1:membrane protein >Feature sequence060 381 7 gene locus_tag LOCUS_10630 381 7 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_10630 653 2749 gene locus_tag LOCUS_10640 653 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2777 3391 gene locus_tag LOCUS_10650 2777 3391 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_10650 3464 4723 gene locus_tag LOCUS_10660 3464 4723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_10660 5515 5015 gene locus_tag LOCUS_10670 5515 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 5813 6145 gene locus_tag LOCUS_10680 5813 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 8088 6409 gene locus_tag LOCUS_10690 8088 6409 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_10690 8249 10204 gene locus_tag LOCUS_10700 gene tetP/tetQ 8249 10204 CDS product tetracycline resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_10700 10263 11210 gene locus_tag LOCUS_10710 10263 11210 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222236.1 protein_id gnl|my_center|LOCUS_10710 11299 12069 gene locus_tag LOCUS_10720 11299 12069 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_10720 12232 12963 gene locus_tag LOCUS_10730 12232 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 13026 14321 gene locus_tag LOCUS_10740 gene hemN 13026 14321 CDS product putative coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269211.1 protein_id gnl|my_center|LOCUS_10740 14354 16612 gene locus_tag LOCUS_10750 14354 16612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence061 <1 1603 gene locus_tag LOCUS_10760 <1 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544913.1:DNA repair ATPase 1683 1946 gene locus_tag LOCUS_10770 1683 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1939 2238 gene locus_tag LOCUS_10780 1939 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2240 3508 gene locus_tag LOCUS_10790 2240 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157499.1 protein_id gnl|my_center|LOCUS_10790 4046 3531 gene locus_tag LOCUS_10800 4046 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 5801 4233 gene locus_tag LOCUS_10810 5801 4233 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2X1 protein_id gnl|my_center|LOCUS_10810 6272 8920 gene locus_tag LOCUS_10820 6272 8920 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence062 2304 1414 gene locus_tag LOCUS_10830 2304 1414 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_10830 2486 3922 gene locus_tag LOCUS_10840 2486 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3982 4935 gene locus_tag LOCUS_10850 gene tktC 3982 4935 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_10850 5041 5598 gene locus_tag LOCUS_10860 5041 5598 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_10860 5642 6073 gene locus_tag LOCUS_10870 5642 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 6123 6599 gene locus_tag LOCUS_10880 6123 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_10880 8361 6718 gene locus_tag LOCUS_10890 gene pckA 8361 6718 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109906.1 protein_id gnl|my_center|LOCUS_10890 8601 8936 gene locus_tag LOCUS_10900 8601 8936 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_10900 9027 10250 gene locus_tag LOCUS_10910 9027 10250 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_10910 10356 10865 gene locus_tag LOCUS_10920 10356 10865 CDS product RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272637.1 protein_id gnl|my_center|LOCUS_10920 10849 11277 gene locus_tag LOCUS_10930 10849 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 11381 11866 gene locus_tag LOCUS_10940 11381 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 11871 12353 gene locus_tag LOCUS_10950 11871 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 12343 13242 gene locus_tag LOCUS_10960 12343 13242 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_10960 13304 14065 gene locus_tag LOCUS_10970 13304 14065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 14140 14679 gene locus_tag LOCUS_10980 14140 14679 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_10980 14848 15069 gene locus_tag LOCUS_10990 14848 15069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 15164 16405 gene locus_tag LOCUS_11000 15164 16405 CDS product succinoglycan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036232.1 protein_id gnl|my_center|LOCUS_11000 16616 17248 gene locus_tag LOCUS_11010 16616 17248 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397598.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence063 419 1888 gene locus_tag LOCUS_11020 gene rhaB 419 1888 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05262 protein_id gnl|my_center|LOCUS_11020 1875 3656 gene locus_tag LOCUS_11030 gene fucI 1875 3656 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZS4 protein_id gnl|my_center|LOCUS_11030 3727 5010 gene locus_tag LOCUS_11040 gene fucP 3727 5010 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44776 protein_id gnl|my_center|LOCUS_11040 5037 6821 gene locus_tag LOCUS_11050 gene aorA 5037 6821 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986475.1 protein_id gnl|my_center|LOCUS_11050 6831 7448 gene locus_tag LOCUS_11060 gene fucA 6831 7448 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225341.1 protein_id gnl|my_center|LOCUS_11060 7595 9217 gene locus_tag LOCUS_11070 7595 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 9412 10302 gene locus_tag LOCUS_11080 9412 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 12373 10343 gene locus_tag LOCUS_11090 12373 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 14507 12558 gene locus_tag LOCUS_11100 gene selB 14507 12558 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546044.1 protein_id gnl|my_center|LOCUS_11100 15986 14589 gene locus_tag LOCUS_11110 gene selA 15986 14589 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I656 protein_id gnl|my_center|LOCUS_11110 16687 17226 gene locus_tag LOCUS_11120 16687 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence064 985 1149 gene locus_tag LOCUS_11130 985 1149 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73NV0 protein_id gnl|my_center|LOCUS_11130 1164 1637 gene locus_tag LOCUS_11140 1164 1637 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_11140 1675 3084 gene locus_tag LOCUS_11150 1675 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_11150 3092 3895 gene locus_tag LOCUS_11160 gene fpr 3092 3895 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_11160 4050 4505 gene locus_tag LOCUS_11170 4050 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4940 5116 gene locus_tag LOCUS_11180 gene ccoS 4940 5116 CDS product cytochrome oxidase maturation protein Cbb3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963292.1 protein_id gnl|my_center|LOCUS_11180 5128 7560 gene locus_tag LOCUS_11190 gene ccoN/ccoO 5128 7560 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_11190 7563 7757 gene locus_tag LOCUS_11200 7563 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 7775 8368 gene locus_tag LOCUS_11210 7775 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 8551 9930 gene locus_tag LOCUS_11220 gene ccoG 8551 9930 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_11220 9971 10417 gene locus_tag LOCUS_11230 gene ccoH 9971 10417 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_11230 10452 11216 gene locus_tag LOCUS_11240 10452 11216 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_11240 11209 13608 gene locus_tag LOCUS_11250 gene ccoI 11209 13608 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_11250 15034 13655 gene locus_tag LOCUS_11260 15034 13655 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202535.1 protein_id gnl|my_center|LOCUS_11260 15731 15099 gene locus_tag LOCUS_11270 15731 15099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 17006 15906 gene locus_tag LOCUS_11280 17006 15906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence065 220 1377 gene locus_tag LOCUS_11290 220 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1789 3258 gene locus_tag LOCUS_11300 gene guaB 1789 3258 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW5 protein_id gnl|my_center|LOCUS_11300 3312 5336 gene locus_tag LOCUS_11310 3312 5336 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_11310 5422 6282 gene locus_tag LOCUS_11320 5422 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 6294 7649 gene locus_tag LOCUS_11330 6294 7649 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_11330 7787 8263 gene locus_tag LOCUS_11340 7787 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 8956 8252 gene locus_tag LOCUS_11350 8956 8252 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_11350 10239 8980 gene locus_tag LOCUS_11360 10239 8980 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGZ5 protein_id gnl|my_center|LOCUS_11360 10675 10283 gene locus_tag LOCUS_11370 10675 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 14250 10996 gene locus_tag LOCUS_11380 14250 10996 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_11380 14869 14429 gene locus_tag LOCUS_11390 14869 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 15760 15080 gene locus_tag LOCUS_11400 15760 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 17179 15800 gene locus_tag LOCUS_11410 gene mnmE 17179 15800 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_11410 >Feature sequence066 1030 173 gene locus_tag LOCUS_11420 1030 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1184 4870 gene locus_tag LOCUS_11430 1184 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 4897 6666 gene locus_tag LOCUS_11440 4897 6666 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RL0 protein_id gnl|my_center|LOCUS_11440 7656 6688 gene locus_tag LOCUS_11450 gene ribD 7656 6688 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_11450 8072 7794 gene locus_tag LOCUS_11460 8072 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 9021 8131 gene locus_tag LOCUS_11470 9021 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_11470 9179 9892 gene locus_tag LOCUS_11480 9179 9892 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957548.1 protein_id gnl|my_center|LOCUS_11480 9907 11004 gene locus_tag LOCUS_11490 gene ychF 9907 11004 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_11490 12959 11055 gene locus_tag LOCUS_11500 12959 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 13059 14051 gene locus_tag LOCUS_11510 gene rfaE 13059 14051 CDS product RfaE bifunctional protein, domain I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_11510 14487 14999 gene locus_tag LOCUS_11520 14487 14999 CDS product transcription termination factor NusG domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_11520 15164 15433 gene locus_tag LOCUS_11530 15164 15433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 15426 16037 gene locus_tag LOCUS_11540 15426 16037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 16048 17067 gene locus_tag LOCUS_11550 16048 17067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence067 146 1666 gene locus_tag LOCUS_11560 146 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 3082 1886 gene locus_tag LOCUS_11570 3082 1886 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_11570 3596 3339 gene locus_tag LOCUS_11580 3596 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4564 4490 gene locus_tag LOCUS_t00190 4564 4490 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5465 4668 gene locus_tag LOCUS_11590 5465 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 6686 5520 gene locus_tag LOCUS_11600 6686 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143632.1 protein_id gnl|my_center|LOCUS_11600 7712 6807 gene locus_tag LOCUS_11610 7712 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 7877 10132 gene locus_tag LOCUS_11620 7877 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 10159 11499 gene locus_tag LOCUS_11630 10159 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 11724 12701 gene locus_tag LOCUS_11640 11724 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 12921 13088 gene locus_tag LOCUS_11650 12921 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 13746 13117 gene locus_tag LOCUS_11660 13746 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 16626 13816 gene locus_tag LOCUS_11670 16626 13816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence068 1773 43 gene locus_tag LOCUS_11680 1773 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2429 2040 gene locus_tag LOCUS_11690 2429 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 3225 2821 gene locus_tag LOCUS_11700 3225 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 5442 3274 gene locus_tag LOCUS_11710 5442 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5928 10442 gene locus_tag LOCUS_11720 5928 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 12089 10566 gene locus_tag LOCUS_11730 12089 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 12705 12241 gene locus_tag LOCUS_11740 12705 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 13386 12739 gene locus_tag LOCUS_11750 13386 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 13861 15954 gene locus_tag LOCUS_11760 13861 15954 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_11760 15976 16326 gene locus_tag LOCUS_11770 15976 16326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence069 1039 227 gene locus_tag LOCUS_11780 1039 227 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_11780 1574 1128 gene locus_tag LOCUS_11790 1574 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 2848 1712 gene locus_tag LOCUS_11800 2848 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103420.1 protein_id gnl|my_center|LOCUS_11800 4708 3002 gene locus_tag LOCUS_11810 4708 3002 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181735.1 protein_id gnl|my_center|LOCUS_11810 6477 4711 gene locus_tag LOCUS_11820 6477 4711 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974287.1 protein_id gnl|my_center|LOCUS_11820 7755 6748 gene locus_tag LOCUS_11830 gene yngG 7755 6748 CDS product hydroxymethylglutaryl-CoA lyase YngG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34873 protein_id gnl|my_center|LOCUS_11830 8450 7794 gene locus_tag LOCUS_11840 gene atoA 8450 7794 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_11840 9371 8679 gene locus_tag LOCUS_11850 gene atoD 9371 8679 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_11850 10334 9423 gene locus_tag LOCUS_11860 10334 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 11104 10379 gene locus_tag LOCUS_11870 11104 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 13275 11119 gene locus_tag LOCUS_11880 13275 11119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 14092 13304 gene locus_tag LOCUS_11890 14092 13304 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_11890 14710 14159 gene locus_tag LOCUS_11900 14710 14159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 16337 14730 gene locus_tag LOCUS_11910 16337 14730 CDS product propionyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257900.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence070 1650 109 gene locus_tag LOCUS_11920 1650 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 4086 1900 gene locus_tag LOCUS_11930 gene pnp 4086 1900 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N73 protein_id gnl|my_center|LOCUS_11930 4525 4256 gene locus_tag LOCUS_11940 gene rpsO 4525 4256 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_11940 4830 6131 gene locus_tag LOCUS_11950 4830 6131 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865056.1 protein_id gnl|my_center|LOCUS_11950 7445 6189 gene locus_tag LOCUS_11960 gene purA 7445 6189 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QR7 protein_id gnl|my_center|LOCUS_11960 8638 7466 gene locus_tag LOCUS_11970 8638 7466 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_11970 9413 8772 gene locus_tag LOCUS_11980 9413 8772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 9897 9493 gene locus_tag LOCUS_11990 9897 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 12109 10019 gene locus_tag LOCUS_12000 12109 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_12000 12942 12196 gene locus_tag LOCUS_12010 12942 12196 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_12010 13912 12977 gene locus_tag LOCUS_12020 13912 12977 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_12020 14709 13978 gene locus_tag LOCUS_12030 14709 13978 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801362.1 protein_id gnl|my_center|LOCUS_12030 15878 14814 gene locus_tag LOCUS_12040 15878 14814 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence071 669 508 gene locus_tag LOCUS_12050 669 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 862 1452 gene locus_tag LOCUS_12060 862 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1464 1754 gene locus_tag LOCUS_12070 1464 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1798 2682 gene locus_tag LOCUS_12080 1798 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2666 3916 gene locus_tag LOCUS_12090 2666 3916 CDS product aminoacetone oxidase family FAD-binding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_12090 4058 5701 gene locus_tag LOCUS_12100 4058 5701 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_12100 5913 7871 gene locus_tag LOCUS_12110 5913 7871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 8078 9796 gene locus_tag LOCUS_12120 8078 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 10036 12501 gene locus_tag LOCUS_12130 gene mur/alr 10036 12501 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 protein_id gnl|my_center|LOCUS_12130 12605 13351 gene locus_tag LOCUS_12140 12605 13351 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_12140 13393 14478 gene locus_tag LOCUS_12150 13393 14478 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940450.1 protein_id gnl|my_center|LOCUS_12150 14555 15730 gene locus_tag LOCUS_12160 14555 15730 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887074.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence072 643 2598 gene locus_tag LOCUS_12170 643 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3004 3798 gene locus_tag LOCUS_12180 3004 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 4045 4596 gene locus_tag LOCUS_12190 4045 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 4619 6262 gene locus_tag LOCUS_12200 4619 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 6294 7799 gene locus_tag LOCUS_12210 6294 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 7835 9460 gene locus_tag LOCUS_12220 7835 9460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 9517 14676 gene locus_tag LOCUS_12230 9517 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 14682 15842 gene locus_tag LOCUS_12240 14682 15842 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence073 1813 3087 gene locus_tag LOCUS_12250 1813 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3225 3767 gene locus_tag LOCUS_12260 3225 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3764 4306 gene locus_tag LOCUS_12270 3764 4306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4309 5364 gene locus_tag LOCUS_12280 4309 5364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6133 5477 gene locus_tag LOCUS_12290 6133 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 8379 6253 gene locus_tag LOCUS_12300 8379 6253 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_12300 8704 9336 gene locus_tag LOCUS_12310 8704 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 9776 10972 gene locus_tag LOCUS_12320 9776 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 10979 11989 gene locus_tag LOCUS_12330 10979 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 12101 15763 gene locus_tag LOCUS_12340 12101 15763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence074 <1 12141 gene locus_tag LOCUS_12350 <1 12141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391785.1:glycosyl hydrolase 14055 12268 gene locus_tag LOCUS_12360 14055 12268 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939228.1 protein_id gnl|my_center|LOCUS_12360 14279 15298 gene locus_tag LOCUS_12370 14279 15298 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence075 203 487 gene locus_tag LOCUS_12380 203 487 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_12380 843 682 gene locus_tag LOCUS_12390 843 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1110 2663 gene locus_tag LOCUS_12400 1110 2663 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_12400 5178 2773 gene locus_tag LOCUS_12410 5178 2773 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_12410 5501 7609 gene locus_tag LOCUS_12420 5501 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 8719 7640 gene locus_tag LOCUS_12430 8719 7640 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_12430 9992 8766 gene locus_tag LOCUS_12440 9992 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_12440 10696 10100 gene locus_tag LOCUS_12450 10696 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203534.1 protein_id gnl|my_center|LOCUS_12450 10767 11681 gene locus_tag LOCUS_12460 10767 11681 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_12460 11777 12559 gene locus_tag LOCUS_12470 11777 12559 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_12470 12582 13439 gene locus_tag LOCUS_12480 12582 13439 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_12480 13535 14581 gene locus_tag LOCUS_12490 13535 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_12490 14630 15559 gene locus_tag LOCUS_12500 14630 15559 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence076 <1 1462 gene locus_tag LOCUS_12510 <1 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582823.1:lipoprotein 2676 1552 gene locus_tag LOCUS_12520 2676 1552 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123368.1 protein_id gnl|my_center|LOCUS_12520 3256 2945 gene locus_tag LOCUS_12530 3256 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545454.1 protein_id gnl|my_center|LOCUS_12530 4430 3315 gene locus_tag LOCUS_12540 4430 3315 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_12540 5288 4470 gene locus_tag LOCUS_12550 gene dapD 5288 4470 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_12550 6140 5352 gene locus_tag LOCUS_12560 6140 5352 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583447.1 protein_id gnl|my_center|LOCUS_12560 6341 7402 gene locus_tag LOCUS_12570 6341 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 7945 7394 gene locus_tag LOCUS_12580 7945 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965296.1 protein_id gnl|my_center|LOCUS_12580 8109 11072 gene locus_tag LOCUS_12590 8109 11072 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_12590 11249 12022 gene locus_tag LOCUS_12600 11249 12022 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091113.1 protein_id gnl|my_center|LOCUS_12600 13422 12055 gene locus_tag LOCUS_12610 13422 12055 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence077 27 1448 gene locus_tag LOCUS_12620 27 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1843 5073 gene locus_tag LOCUS_12630 1843 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 5434 6225 gene locus_tag LOCUS_12640 gene rgpCc 5434 6225 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A0G3 protein_id gnl|my_center|LOCUS_12640 6229 6993 gene locus_tag LOCUS_12650 6229 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 7000 7794 gene locus_tag LOCUS_12660 7000 7794 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389033.1 protein_id gnl|my_center|LOCUS_12660 7982 9502 gene locus_tag LOCUS_12670 7982 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 9528 10625 gene locus_tag LOCUS_12680 9528 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_12680 10622 11713 gene locus_tag LOCUS_12690 10622 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 13395 11923 gene locus_tag LOCUS_12700 13395 11923 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257485.1 protein_id gnl|my_center|LOCUS_12700 14678 13392 gene locus_tag LOCUS_12710 14678 13392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 15432 14908 gene locus_tag LOCUS_12720 15432 14908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence078 107 6937 gene locus_tag LOCUS_12730 107 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 7077 8084 gene locus_tag LOCUS_12740 gene fbp 7077 8084 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJT2 protein_id gnl|my_center|LOCUS_12740 10091 8148 gene locus_tag LOCUS_12750 10091 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 10459 10184 gene locus_tag LOCUS_12760 gene kaiB 10459 10184 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V61 protein_id gnl|my_center|LOCUS_12760 10838 10470 gene locus_tag LOCUS_12770 10838 10470 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272792.1 protein_id gnl|my_center|LOCUS_12770 13648 11054 gene locus_tag LOCUS_12780 13648 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 14849 13758 gene locus_tag LOCUS_12790 14849 13758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 15264 15103 gene locus_tag LOCUS_12800 15264 15103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence079 220 444 gene locus_tag LOCUS_12810 220 444 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760626.1 protein_id gnl|my_center|LOCUS_12810 478 1560 gene locus_tag LOCUS_12820 478 1560 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_12820 1601 2377 gene locus_tag LOCUS_12830 1601 2377 CDS product 2-oxoglutarate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786495.1 protein_id gnl|my_center|LOCUS_12830 2417 2965 gene locus_tag LOCUS_12840 2417 2965 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760622.1 protein_id gnl|my_center|LOCUS_12840 3178 4038 gene locus_tag LOCUS_12850 3178 4038 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546640.1 protein_id gnl|my_center|LOCUS_12850 4088 4579 gene locus_tag LOCUS_12860 4088 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 4576 4941 gene locus_tag LOCUS_12870 4576 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 5318 4959 gene locus_tag LOCUS_12880 5318 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 6063 5464 gene locus_tag LOCUS_12890 gene napB 6063 5464 CDS product periplasmic nitrate reductase, electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAA7 protein_id gnl|my_center|LOCUS_12890 6895 6095 gene locus_tag LOCUS_12900 gene napH 6895 6095 CDS product quinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891886.1 protein_id gnl|my_center|LOCUS_12900 7694 6888 gene locus_tag LOCUS_12910 gene napG 7694 6888 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852504.1 protein_id gnl|my_center|LOCUS_12910 10496 7707 gene locus_tag LOCUS_12920 gene napA 10496 7707 CDS product periplasmic nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPD9 protein_id gnl|my_center|LOCUS_12920 11423 10530 gene locus_tag LOCUS_12930 11423 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 13920 11866 gene locus_tag LOCUS_12940 13920 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 14609 13929 gene locus_tag LOCUS_12950 14609 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553305.1 protein_id gnl|my_center|LOCUS_12950 15024 14752 gene locus_tag LOCUS_12960 15024 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence080 606 121 gene locus_tag LOCUS_12970 606 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1015 641 gene locus_tag LOCUS_12980 1015 641 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_12980 1209 2531 gene locus_tag LOCUS_12990 1209 2531 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817149.1 protein_id gnl|my_center|LOCUS_12990 2687 3628 gene locus_tag LOCUS_13000 2687 3628 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_13000 3729 4622 gene locus_tag LOCUS_13010 gene rfbA 3729 4622 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32EG4 protein_id gnl|my_center|LOCUS_13010 4661 5224 gene locus_tag LOCUS_13020 gene rfbC 4661 5224 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_13020 5267 6142 gene locus_tag LOCUS_13030 5267 6142 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_13030 7329 6145 gene locus_tag LOCUS_13040 7329 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_13040 8546 7326 gene locus_tag LOCUS_13050 8546 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_13050 10612 8717 gene locus_tag LOCUS_13060 10612 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 11443 10760 gene locus_tag LOCUS_13070 11443 10760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_13070 12674 11499 gene locus_tag LOCUS_13080 12674 11499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_13080 13985 12765 gene locus_tag LOCUS_13090 13985 12765 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 protein_id gnl|my_center|LOCUS_13090 14790 14029 gene locus_tag LOCUS_13100 14790 14029 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_13100 15076 14843 gene locus_tag LOCUS_13110 15076 14843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence081 1860 3104 gene locus_tag LOCUS_13120 1860 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4128 3118 gene locus_tag LOCUS_13130 4128 3118 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203440.1 protein_id gnl|my_center|LOCUS_13130 4779 4243 gene locus_tag LOCUS_13140 4779 4243 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_13140 5486 4830 gene locus_tag LOCUS_13150 5486 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 6138 5623 gene locus_tag LOCUS_13160 6138 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 7022 6159 gene locus_tag LOCUS_13170 gene rpoD 7022 6159 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_13170 7498 9447 gene locus_tag LOCUS_13180 gene rho 7498 9447 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RC3 protein_id gnl|my_center|LOCUS_13180 12573 9505 gene locus_tag LOCUS_13190 12573 9505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 12713 13912 gene locus_tag LOCUS_13200 12713 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 <15243 13933 gene locus_tag LOCUS_13210 <15243 13933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H092:valine--tRNA ligase >Feature sequence082 1382 249 gene locus_tag LOCUS_13220 1382 249 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_13220 1550 2935 gene locus_tag LOCUS_13230 1550 2935 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228400.1 protein_id gnl|my_center|LOCUS_13230 2958 3380 gene locus_tag LOCUS_13240 2958 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 5003 3402 gene locus_tag LOCUS_13250 5003 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 5124 6545 gene locus_tag LOCUS_13260 5124 6545 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716485.1 protein_id gnl|my_center|LOCUS_13260 6822 7343 gene locus_tag LOCUS_13270 6822 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 7349 9127 gene locus_tag LOCUS_13280 7349 9127 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_13280 9164 12856 gene locus_tag LOCUS_13290 gene fdhF 9164 12856 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263145.1 protein_id gnl|my_center|LOCUS_13290 13427 13179 gene locus_tag LOCUS_13300 13427 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence083 <1 6979 gene locus_tag LOCUS_13310 <1 6979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039262.1:hemagglutinin 7519 11598 gene locus_tag LOCUS_13320 7519 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 13003 11693 gene locus_tag LOCUS_13330 gene gltA 13003 11693 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_13330 14447 13080 gene locus_tag LOCUS_13340 gene icd 14447 13080 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39126 protein_id gnl|my_center|LOCUS_13340 >Feature sequence084 316 62 gene locus_tag LOCUS_13350 316 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1076 309 gene locus_tag LOCUS_13360 1076 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 2162 1461 gene locus_tag LOCUS_13370 gene aat 2162 1461 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC5 protein_id gnl|my_center|LOCUS_13370 4409 2220 gene locus_tag LOCUS_13380 gene glnA 4409 2220 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15623 protein_id gnl|my_center|LOCUS_13380 5881 4661 gene locus_tag LOCUS_13390 gene rocD 5881 4661 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_13390 6053 6631 gene locus_tag LOCUS_13400 gene rbr 6053 6631 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397458.1 protein_id gnl|my_center|LOCUS_13400 6671 7963 gene locus_tag LOCUS_13410 gene gluP 6671 7963 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_13410 8443 9609 gene locus_tag LOCUS_13420 8443 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 10644 9667 gene locus_tag LOCUS_13430 10644 9667 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_13430 10718 11095 gene locus_tag LOCUS_13440 10718 11095 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_13440 11255 12142 gene locus_tag LOCUS_13450 11255 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 12312 13103 gene locus_tag LOCUS_13460 gene surE 12312 13103 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_13460 13087 13380 gene locus_tag LOCUS_13470 13087 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 13435 14553 gene locus_tag LOCUS_13480 gene lpxB 13435 14553 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence085 858 2759 gene locus_tag LOCUS_13490 858 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 10789 2885 gene locus_tag LOCUS_13500 10789 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 11126 10836 gene locus_tag LOCUS_13510 11126 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 13311 11365 gene locus_tag LOCUS_13520 13311 11365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 14278 13505 gene locus_tag LOCUS_13530 14278 13505 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941331.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence086 <1 1400 gene locus_tag LOCUS_13540 <1 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0L4:ATP-dependent zinc metalloprotease FtsH 1431 2057 gene locus_tag LOCUS_13550 1431 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2069 2269 gene locus_tag LOCUS_13560 2069 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2704 3117 gene locus_tag LOCUS_13570 2704 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 3158 3820 gene locus_tag LOCUS_13580 gene psd 3158 3820 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_13580 3936 5642 gene locus_tag LOCUS_13590 gene pepF 3936 5642 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189365.1 protein_id gnl|my_center|LOCUS_13590 5999 5655 gene locus_tag LOCUS_13600 5999 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 6498 6196 gene locus_tag LOCUS_13610 6498 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 6517 7611 gene locus_tag LOCUS_13620 6517 7611 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807789.1 protein_id gnl|my_center|LOCUS_13620 7716 8489 gene locus_tag LOCUS_13630 7716 8489 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_13630 8665 11940 gene locus_tag LOCUS_13640 8665 11940 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109349.1 protein_id gnl|my_center|LOCUS_13640 11950 13410 gene locus_tag LOCUS_13650 gene mloB 11950 13410 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_13650 13548 14612 gene locus_tag LOCUS_13660 13548 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence087 3066 2281 gene locus_tag LOCUS_13670 gene prfB 3066 2281 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_13670 4206 3445 gene locus_tag LOCUS_13680 4206 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 4408 5079 gene locus_tag LOCUS_13690 4408 5079 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU3 protein_id gnl|my_center|LOCUS_13690 5138 5794 gene locus_tag LOCUS_13700 5138 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 6350 5823 gene locus_tag LOCUS_13710 6350 5823 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107875.1 protein_id gnl|my_center|LOCUS_13710 8541 6580 gene locus_tag LOCUS_13720 8541 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 9365 8568 gene locus_tag LOCUS_13730 9365 8568 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_13730 10740 9415 gene locus_tag LOCUS_13740 10740 9415 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_13740 11316 11116 gene locus_tag LOCUS_13750 11316 11116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 12085 11309 gene locus_tag LOCUS_13760 12085 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 12338 12712 gene locus_tag LOCUS_13770 12338 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 12825 13397 gene locus_tag LOCUS_13780 12825 13397 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_13780 13410 13856 gene locus_tag LOCUS_13790 13410 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 13914 14483 gene locus_tag LOCUS_13800 13914 14483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence088 <1 842 gene locus_tag LOCUS_13810 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H192:cell division protein FtsA 880 2340 gene locus_tag LOCUS_13820 880 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2414 3805 gene locus_tag LOCUS_13830 2414 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 4627 4001 gene locus_tag LOCUS_13840 4627 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 7683 4630 gene locus_tag LOCUS_13850 7683 4630 CDS product type I endonuclease-methyltransferase fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_13850 9335 8142 gene locus_tag LOCUS_13860 9335 8142 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932730.1 protein_id gnl|my_center|LOCUS_13860 9526 9359 gene locus_tag LOCUS_13870 9526 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 9740 11059 gene locus_tag LOCUS_13880 9740 11059 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202711.1 protein_id gnl|my_center|LOCUS_13880 11134 12006 gene locus_tag LOCUS_13890 11134 12006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 12063 12368 gene locus_tag LOCUS_13900 12063 12368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 12739 13599 gene locus_tag LOCUS_13910 12739 13599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 13826 13900 gene locus_tag LOCUS_t00200 13826 13900 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence089 8 1387 gene locus_tag LOCUS_13920 8 1387 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_13920 1455 2444 gene locus_tag LOCUS_13930 1455 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 2582 3718 gene locus_tag LOCUS_13940 2582 3718 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 protein_id gnl|my_center|LOCUS_13940 6295 3794 gene locus_tag LOCUS_13950 6295 3794 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_13950 6879 6376 gene locus_tag LOCUS_13960 gene dfrA 6879 6376 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_13960 7735 6941 gene locus_tag LOCUS_13970 gene thyA 7735 6941 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_13970 10122 7942 gene locus_tag LOCUS_13980 10122 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 11098 10142 gene locus_tag LOCUS_13990 11098 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 <14621 11098 gene locus_tag LOCUS_14000 <14621 11098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105890.1:RTX toxin >Feature sequence090 216 1097 gene locus_tag LOCUS_14010 gene folD 216 1097 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_14010 2394 1156 gene locus_tag LOCUS_14020 gene kdtA 2394 1156 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_14020 3219 2473 gene locus_tag LOCUS_14030 3219 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4155 3226 gene locus_tag LOCUS_14040 4155 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 4682 5989 gene locus_tag LOCUS_14050 gene gltA 4682 5989 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_14050 6433 6233 gene locus_tag LOCUS_14060 6433 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 6613 7233 gene locus_tag LOCUS_14070 6613 7233 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_14070 7233 8600 gene locus_tag LOCUS_14080 7233 8600 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_14080 8613 9788 gene locus_tag LOCUS_14090 8613 9788 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933016.1 protein_id gnl|my_center|LOCUS_14090 9859 10086 gene locus_tag LOCUS_14100 9859 10086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 10083 10457 gene locus_tag LOCUS_14110 10083 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 10652 14125 gene locus_tag LOCUS_14120 10652 14125 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence091 663 313 gene locus_tag LOCUS_14130 663 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 832 617 gene locus_tag LOCUS_14140 832 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1020 1649 gene locus_tag LOCUS_14150 1020 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3142 1685 gene locus_tag LOCUS_14160 gene gatB 3142 1685 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66766 protein_id gnl|my_center|LOCUS_14160 3262 3834 gene locus_tag LOCUS_14170 3262 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 3872 5707 gene locus_tag LOCUS_14180 3872 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 5720 6265 gene locus_tag LOCUS_14190 gene ruvC 5720 6265 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_14190 7424 12061 gene locus_tag LOCUS_14200 7424 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 12225 12704 gene locus_tag LOCUS_14210 12225 12704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 12767 13696 gene locus_tag LOCUS_14220 gene cas1 12767 13696 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_14220 13754 14092 gene locus_tag LOCUS_14230 gene cas2 13754 14092 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_14230 14282 >14470 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq actgtgttcaatatttcaaagatacaaaatgaaagca >Feature sequence092 263 81 gene locus_tag LOCUS_14240 263 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1675 428 gene locus_tag LOCUS_14250 1675 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_14250 2646 1723 gene locus_tag LOCUS_14260 2646 1723 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_14260 3734 2664 gene locus_tag LOCUS_14270 gene serC 3734 2664 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L4 protein_id gnl|my_center|LOCUS_14270 5202 3865 gene locus_tag LOCUS_14280 5202 3865 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_14280 5630 5409 gene locus_tag LOCUS_14290 5630 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_14290 6307 5765 gene locus_tag LOCUS_14300 6307 5765 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_14300 7146 6439 gene locus_tag LOCUS_14310 7146 6439 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_14310 7659 8039 gene locus_tag LOCUS_14320 gene rpsL 7659 8039 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_14320 8062 8538 gene locus_tag LOCUS_14330 gene rpsG 8062 8538 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK5 protein_id gnl|my_center|LOCUS_14330 8556 10664 gene locus_tag LOCUS_14340 gene fusA 8556 10664 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A474 protein_id gnl|my_center|LOCUS_14340 10679 10984 gene locus_tag LOCUS_14350 gene rpsJ 10679 10984 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A475 protein_id gnl|my_center|LOCUS_14350 11036 11656 gene locus_tag LOCUS_14360 gene rplC 11036 11656 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ99 protein_id gnl|my_center|LOCUS_14360 11656 12285 gene locus_tag LOCUS_14370 gene rplD 11656 12285 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK9 protein_id gnl|my_center|LOCUS_14370 12294 12584 gene locus_tag LOCUS_14380 gene rplW 12294 12584 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A478 protein_id gnl|my_center|LOCUS_14380 12636 13457 gene locus_tag LOCUS_14390 gene rplB 12636 13457 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A479 protein_id gnl|my_center|LOCUS_14390 13499 13765 gene locus_tag LOCUS_14400 gene rpsS 13499 13765 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_14400 13792 14205 gene locus_tag LOCUS_14410 gene rplV 13792 14205 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL3 protein_id gnl|my_center|LOCUS_14410 >Feature sequence093 635 288 gene locus_tag LOCUS_14420 635 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4277 660 gene locus_tag LOCUS_14430 4277 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 4564 7215 gene locus_tag LOCUS_14440 4564 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 7308 7772 gene locus_tag LOCUS_14450 7308 7772 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025711.1 protein_id gnl|my_center|LOCUS_14450 7870 10242 gene locus_tag LOCUS_14460 7870 10242 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_14460 11244 10255 gene locus_tag LOCUS_14470 gene trpS 11244 10255 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I756 protein_id gnl|my_center|LOCUS_14470 11659 13593 gene locus_tag LOCUS_14480 11659 13593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 14130 13639 gene locus_tag LOCUS_14490 14130 13639 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108911.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence094 5011 1418 gene locus_tag LOCUS_14500 5011 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 8767 5252 gene locus_tag LOCUS_14510 8767 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 9270 8803 gene locus_tag LOCUS_14520 9270 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 9579 13754 gene locus_tag LOCUS_14530 9579 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence095 552 1271 gene locus_tag LOCUS_14540 552 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1769 2533 gene locus_tag LOCUS_14550 1769 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2589 3539 gene locus_tag LOCUS_14560 2589 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 3864 7196 gene locus_tag LOCUS_14570 3864 7196 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_14570 7323 8642 gene locus_tag LOCUS_14580 7323 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_14580 8741 9547 gene locus_tag LOCUS_14590 8741 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 9654 9989 gene locus_tag LOCUS_14600 9654 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 10089 10970 gene locus_tag LOCUS_14610 10089 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 11886 11173 gene locus_tag LOCUS_14620 11886 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 12681 11905 gene locus_tag LOCUS_14630 12681 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 13397 12711 gene locus_tag LOCUS_14640 13397 12711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence096 549 16 gene locus_tag LOCUS_14650 549 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1N7 protein_id gnl|my_center|LOCUS_14650 868 1740 gene locus_tag LOCUS_14660 868 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1844 2668 gene locus_tag LOCUS_14670 1844 2668 CDS product ferredoxin-NADP+ reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_14670 2746 4530 gene locus_tag LOCUS_14680 gene gltA 2746 4530 CDS product glutamate synthase (NADPH), homotetrameric inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_14680 5989 4628 gene locus_tag LOCUS_14690 5989 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 6960 6058 gene locus_tag LOCUS_14700 6960 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 7356 8084 gene locus_tag LOCUS_14710 7356 8084 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888542.1 protein_id gnl|my_center|LOCUS_14710 8227 9783 gene locus_tag LOCUS_14720 gene porX 8227 9783 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_14720 9810 10247 gene locus_tag LOCUS_14730 9810 10247 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_14730 10302 11570 gene locus_tag LOCUS_14740 10302 11570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 12285 11605 gene locus_tag LOCUS_14750 12285 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 13481 12225 gene locus_tag LOCUS_14760 13481 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140647.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14760 >Feature sequence097 <1 759 gene locus_tag LOCUS_14770 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962267.1:glycosyl hydrolase 2719 821 gene locus_tag LOCUS_14780 2719 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 8396 2952 gene locus_tag LOCUS_14790 8396 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 8842 13683 gene locus_tag LOCUS_14800 8842 13683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence098 1735 260 gene locus_tag LOCUS_14810 1735 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204288.1 protein_id gnl|my_center|LOCUS_14810 1964 2347 gene locus_tag LOCUS_14820 gene mgsA 1964 2347 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51339 protein_id gnl|my_center|LOCUS_14820 2403 3179 gene locus_tag LOCUS_14830 2403 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3302 4825 gene locus_tag LOCUS_14840 gene purH 3302 4825 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NT9 protein_id gnl|my_center|LOCUS_14840 4882 5904 gene locus_tag LOCUS_14850 4882 5904 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792050.1 protein_id gnl|my_center|LOCUS_14850 6028 6855 gene locus_tag LOCUS_14860 6028 6855 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_14860 8105 7368 gene locus_tag LOCUS_14870 8105 7368 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203535.1 protein_id gnl|my_center|LOCUS_14870 8645 8238 gene locus_tag LOCUS_14880 8645 8238 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_14880 9358 8669 gene locus_tag LOCUS_14890 9358 8669 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_14890 9496 10374 gene locus_tag LOCUS_14900 gene era 9496 10374 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A136 protein_id gnl|my_center|LOCUS_14900 10387 10983 gene locus_tag LOCUS_14910 10387 10983 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_14910 11631 11179 gene locus_tag LOCUS_14920 gene fur 11631 11179 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_14920 13428 11755 gene locus_tag LOCUS_14930 13428 11755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence099 671 1516 gene locus_tag LOCUS_14940 gene tktA 671 1516 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_14940 1766 2365 gene locus_tag LOCUS_14950 gene engB 1766 2365 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_14950 2621 3616 gene locus_tag LOCUS_14960 gene prsA 2621 3616 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_14960 5130 3631 gene locus_tag LOCUS_14970 5130 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5500 7434 gene locus_tag LOCUS_14980 5500 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 7531 8691 gene locus_tag LOCUS_14990 gene iadA 7531 8691 CDS product isoaspartyl dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y1L2 protein_id gnl|my_center|LOCUS_14990 9040 9918 gene locus_tag LOCUS_15000 9040 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 10905 10033 gene locus_tag LOCUS_15010 gene mltR 10905 10033 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762608.1 protein_id gnl|my_center|LOCUS_15010 11119 11706 gene locus_tag LOCUS_15020 11119 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 11891 11703 gene locus_tag LOCUS_15030 11891 11703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 12671 13063 gene locus_tag LOCUS_15040 12671 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15040 13291 13593 gene locus_tag LOCUS_15050 13291 13593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence100 1101 502 gene locus_tag LOCUS_15060 1101 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1261 2058 gene locus_tag LOCUS_15070 1261 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2838 2113 gene locus_tag LOCUS_15080 2838 2113 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_15080 3532 2906 gene locus_tag LOCUS_15090 gene udk 3532 2906 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABC6 protein_id gnl|my_center|LOCUS_15090 3601 3903 gene locus_tag LOCUS_15100 3601 3903 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_15100 3953 4930 gene locus_tag LOCUS_15110 3953 4930 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_15110 5306 5049 gene locus_tag LOCUS_15120 5306 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 5609 5358 gene locus_tag LOCUS_15130 5609 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6390 5674 gene locus_tag LOCUS_15140 6390 5674 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815942.1 protein_id gnl|my_center|LOCUS_15140 7410 6475 gene locus_tag LOCUS_15150 7410 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 8790 7477 gene locus_tag LOCUS_15160 8790 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 9528 8809 gene locus_tag LOCUS_15170 9528 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 10305 9529 gene locus_tag LOCUS_15180 10305 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 10546 12591 gene locus_tag LOCUS_15190 10546 12591 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_15190 12608 13438 gene locus_tag LOCUS_15200 12608 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence101 881 231 gene locus_tag LOCUS_15210 881 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1535 1092 gene locus_tag LOCUS_15220 1535 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 1740 3668 gene locus_tag LOCUS_15230 gene dnaK 1740 3668 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YW6 protein_id gnl|my_center|LOCUS_15230 4122 3775 gene locus_tag LOCUS_15240 gene rplS 4122 3775 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_15240 4451 5125 gene locus_tag LOCUS_15250 4451 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 5122 6864 gene locus_tag LOCUS_15260 5122 6864 CDS product restriction endonuclease NspV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 protein_id gnl|my_center|LOCUS_15260 7034 9145 gene locus_tag LOCUS_15270 gene yyaL 7034 9145 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_15270 9342 11645 gene locus_tag LOCUS_15280 9342 11645 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202268.1 protein_id gnl|my_center|LOCUS_15280 11719 12297 gene locus_tag LOCUS_15290 11719 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785524.1 protein_id gnl|my_center|LOCUS_15290 13393 12785 gene locus_tag LOCUS_15300 13393 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence102 3339 487 gene locus_tag LOCUS_15310 3339 487 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_15310 4167 3628 gene locus_tag LOCUS_15320 4167 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 5007 4198 gene locus_tag LOCUS_15330 5007 4198 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_15330 5126 5710 gene locus_tag LOCUS_15340 gene gmhA 5126 5710 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63222 protein_id gnl|my_center|LOCUS_15340 5715 6068 gene locus_tag LOCUS_15350 5715 6068 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_15350 6075 7343 gene locus_tag LOCUS_15360 gene purD 6075 7343 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_15360 9662 8637 gene locus_tag LOCUS_15370 9662 8637 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_15370 10656 9772 gene locus_tag LOCUS_15380 10656 9772 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_15380 10869 11963 gene locus_tag LOCUS_15390 gene atpB 10869 11963 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA8 protein_id gnl|my_center|LOCUS_15390 12012 12269 gene locus_tag LOCUS_15400 12012 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 12352 12846 gene locus_tag LOCUS_15410 gene atpF 12352 12846 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_15410 >Feature sequence103 1297 134 gene locus_tag LOCUS_15420 1297 134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_15420 2354 1311 gene locus_tag LOCUS_15430 2354 1311 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T01 protein_id gnl|my_center|LOCUS_15430 3167 2421 gene locus_tag LOCUS_15440 3167 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 4077 3157 gene locus_tag LOCUS_15450 4077 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 4973 4089 gene locus_tag LOCUS_15460 4973 4089 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_15460 6241 4988 gene locus_tag LOCUS_15470 6241 4988 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_15470 6915 6304 gene locus_tag LOCUS_15480 6915 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 7903 7007 gene locus_tag LOCUS_15490 7903 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 8222 8773 gene locus_tag LOCUS_15500 8222 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 8895 9242 gene locus_tag LOCUS_15510 8895 9242 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence104 <1 4526 gene locus_tag LOCUS_15520 <1 4526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 4682 5623 gene locus_tag LOCUS_15530 4682 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962849.1 protein_id gnl|my_center|LOCUS_15530 5986 7695 gene locus_tag LOCUS_15540 5986 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_15540 10266 7774 gene locus_tag LOCUS_15550 gene mutS2 10266 7774 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WV9 protein_id gnl|my_center|LOCUS_15550 11033 10377 gene locus_tag LOCUS_15560 11033 10377 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_15560 11114 11791 gene locus_tag LOCUS_15570 gene ispD 11114 11791 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U8 protein_id gnl|my_center|LOCUS_15570 11837 12262 gene locus_tag LOCUS_15580 11837 12262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 <13265 12399 gene locus_tag LOCUS_15590 <13265 12399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CRU3:glutamyl-tRNA(Gln) amidotransferase subunit A >Feature sequence105 637 2061 gene locus_tag LOCUS_15600 637 2061 CDS product polyvinyl alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122626.1 protein_id gnl|my_center|LOCUS_15600 3794 2073 gene locus_tag LOCUS_15610 3794 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 4199 3846 gene locus_tag LOCUS_15620 4199 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 7429 4223 gene locus_tag LOCUS_15630 7429 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_15630 7636 7839 gene locus_tag LOCUS_15640 7636 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 7839 8537 gene locus_tag LOCUS_15650 7839 8537 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_15650 8777 8610 gene locus_tag LOCUS_15660 8777 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 9049 9642 gene locus_tag LOCUS_15670 9049 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 9825 11225 gene locus_tag LOCUS_15680 9825 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261765.1 protein_id gnl|my_center|LOCUS_15680 11278 12903 gene locus_tag LOCUS_15690 gene lnt 11278 12903 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCC4 protein_id gnl|my_center|LOCUS_15690 >Feature sequence106 2976 1534 gene locus_tag LOCUS_15700 2976 1534 CDS product sodium/iodide co-transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201997.1 protein_id gnl|my_center|LOCUS_15700 4430 3072 gene locus_tag LOCUS_15710 4430 3072 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729850.1 protein_id gnl|my_center|LOCUS_15710 5893 4490 gene locus_tag LOCUS_15720 5893 4490 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765875.1 protein_id gnl|my_center|LOCUS_15720 7344 5953 gene locus_tag LOCUS_15730 gene lpdA2 7344 5953 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_15730 7948 7469 gene locus_tag LOCUS_15740 7948 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 8725 8147 gene locus_tag LOCUS_15750 8725 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 9662 8814 gene locus_tag LOCUS_15760 9662 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 11281 9698 gene locus_tag LOCUS_15770 11281 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 11855 12694 gene locus_tag LOCUS_15780 11855 12694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814517.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence107 6464 5715 gene locus_tag LOCUS_15790 6464 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 6569 7774 gene locus_tag LOCUS_15800 6569 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 7799 8866 gene locus_tag LOCUS_15810 7799 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 8867 9652 gene locus_tag LOCUS_15820 8867 9652 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836734.1 protein_id gnl|my_center|LOCUS_15820 9655 10341 gene locus_tag LOCUS_15830 9655 10341 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065331.1 protein_id gnl|my_center|LOCUS_15830 10581 10384 gene locus_tag LOCUS_15840 10581 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 10580 11179 gene locus_tag LOCUS_15850 10580 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 11807 11196 gene locus_tag LOCUS_15860 11807 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 12317 11811 gene locus_tag LOCUS_15870 12317 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence108 852 181 gene locus_tag LOCUS_15880 852 181 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948859.1 protein_id gnl|my_center|LOCUS_15880 2074 854 gene locus_tag LOCUS_15890 2074 854 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017093.1 protein_id gnl|my_center|LOCUS_15890 2829 2086 gene locus_tag LOCUS_15900 2829 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 3992 3231 gene locus_tag LOCUS_15910 3992 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_15910 5623 4166 gene locus_tag LOCUS_15920 5623 4166 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 protein_id gnl|my_center|LOCUS_15920 6524 5853 gene locus_tag LOCUS_15930 6524 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 7861 6527 gene locus_tag LOCUS_15940 7861 6527 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 protein_id gnl|my_center|LOCUS_15940 10138 8054 gene locus_tag LOCUS_15950 10138 8054 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764740.1 protein_id gnl|my_center|LOCUS_15950 12005 10224 gene locus_tag LOCUS_15960 12005 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 12404 12048 gene locus_tag LOCUS_15970 12404 12048 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_15970 12703 12395 gene locus_tag LOCUS_15980 12703 12395 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence109 133 5682 gene locus_tag LOCUS_15990 133 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_15990 5715 8081 gene locus_tag LOCUS_16000 gene pbpC 5715 8081 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_16000 8250 9104 gene locus_tag LOCUS_16010 8250 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 9097 10035 gene locus_tag LOCUS_16020 9097 10035 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYG3 protein_id gnl|my_center|LOCUS_16020 10165 10734 gene locus_tag LOCUS_16030 10165 10734 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_16030 10792 11916 gene locus_tag LOCUS_16040 10792 11916 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence110 530 745 gene locus_tag LOCUS_16050 530 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 739 1266 gene locus_tag LOCUS_16060 739 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1298 1765 gene locus_tag LOCUS_16070 1298 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2360 4681 gene locus_tag LOCUS_16080 gene topA 2360 4681 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MY0 protein_id gnl|my_center|LOCUS_16080 4683 5873 gene locus_tag LOCUS_16090 gene fjo29 4683 5873 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_16090 6136 7077 gene locus_tag LOCUS_16100 6136 7077 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_16100 7105 8487 gene locus_tag LOCUS_16110 gene gldK 7105 8487 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_16110 8526 9371 gene locus_tag LOCUS_16120 8526 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 9424 11076 gene locus_tag LOCUS_16130 gene gldM 9424 11076 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_16130 11088 11987 gene locus_tag LOCUS_16140 gene gldN 11088 11987 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_16140 <13096 12058 gene locus_tag LOCUS_16150 <13096 12058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791384.1:mannose-1-phosphate guanylyltransferase >Feature sequence111 1678 200 gene locus_tag LOCUS_16160 1678 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2132 2377 gene locus_tag LOCUS_16170 2132 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2388 2750 gene locus_tag LOCUS_16180 2388 2750 CDS product DNA repair protein HhH-GPD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667012.1 protein_id gnl|my_center|LOCUS_16180 4972 2960 gene locus_tag LOCUS_16190 gene uvrB 4972 2960 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA95 protein_id gnl|my_center|LOCUS_16190 6206 4986 gene locus_tag LOCUS_16200 6206 4986 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZQ8 protein_id gnl|my_center|LOCUS_16200 7683 6325 gene locus_tag LOCUS_16210 7683 6325 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_16210 8530 7781 gene locus_tag LOCUS_16220 8530 7781 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_16220 10061 8613 gene locus_tag LOCUS_16230 10061 8613 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769206.1 protein_id gnl|my_center|LOCUS_16230 10203 11225 gene locus_tag LOCUS_16240 gene thiL 10203 11225 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6J9 protein_id gnl|my_center|LOCUS_16240 <13061 11292 gene locus_tag LOCUS_16250 <13061 11292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207643.1:two-component sensor histidine kinase >Feature sequence112 4010 2856 gene locus_tag LOCUS_16260 4010 2856 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VS5 protein_id gnl|my_center|LOCUS_16260 5645 4014 gene locus_tag LOCUS_16270 gene yidK 5645 4014 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_16270 6691 5648 gene locus_tag LOCUS_16280 gene galM 6691 5648 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_16280 7749 6688 gene locus_tag LOCUS_16290 7749 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_16290 8639 7740 gene locus_tag LOCUS_16300 8639 7740 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_16300 11797 8648 gene locus_tag LOCUS_16310 gene lacZ 11797 8648 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56307 protein_id gnl|my_center|LOCUS_16310 >Feature sequence113 5725 338 gene locus_tag LOCUS_16320 5725 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 8037 6220 gene locus_tag LOCUS_16330 8037 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 9118 8195 gene locus_tag LOCUS_16340 9118 8195 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461587.1 protein_id gnl|my_center|LOCUS_16340 11481 9298 gene locus_tag LOCUS_16350 gene pepX1 11481 9298 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_16350 12214 11561 gene locus_tag LOCUS_16360 12214 11561 CDS product isoprenoid biosynthesis protein ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390979.1 protein_id gnl|my_center|LOCUS_16360 12281 12763 gene locus_tag LOCUS_16370 12281 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence114 <1 1432 gene locus_tag LOCUS_16380 <1 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259063.1:sugar-binding protein 1426 1971 gene locus_tag LOCUS_16390 1426 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2156 2623 gene locus_tag LOCUS_16400 2156 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3076 3435 gene locus_tag LOCUS_16410 gene rpsF 3076 3435 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH7 protein_id gnl|my_center|LOCUS_16410 3439 3708 gene locus_tag LOCUS_16420 gene rpsR 3439 3708 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S6 protein_id gnl|my_center|LOCUS_16420 3725 4171 gene locus_tag LOCUS_16430 gene rplI 3725 4171 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_16430 7420 4655 gene locus_tag LOCUS_16440 7420 4655 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_16440 9981 7570 gene locus_tag LOCUS_16450 9981 7570 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_16450 12595 10325 gene locus_tag LOCUS_16460 12595 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence115 2316 445 gene locus_tag LOCUS_16470 2316 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3394 2426 gene locus_tag LOCUS_16480 3394 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3618 4892 gene locus_tag LOCUS_16490 3618 4892 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_16490 4885 5574 gene locus_tag LOCUS_16500 4885 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 5642 6952 gene locus_tag LOCUS_16510 gene pabB 5642 6952 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_16510 6970 8289 gene locus_tag LOCUS_16520 gene tilS 6970 8289 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_16520 9075 8290 gene locus_tag LOCUS_16530 9075 8290 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_16530 10325 9192 gene locus_tag LOCUS_16540 10325 9192 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64S02 protein_id gnl|my_center|LOCUS_16540 11753 10509 gene locus_tag LOCUS_16550 11753 10509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_16550 12574 11792 gene locus_tag LOCUS_16560 12574 11792 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence116 289 2007 gene locus_tag LOCUS_16570 289 2007 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600173.1 protein_id gnl|my_center|LOCUS_16570 2372 9301 gene locus_tag LOCUS_16580 2372 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 9433 10917 gene locus_tag LOCUS_16590 9433 10917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence117 11915 6834 gene locus_tag LOCUS_16600 11915 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 12190 12038 gene locus_tag LOCUS_16610 12190 12038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence118 397 2418 gene locus_tag LOCUS_16620 397 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2901 7085 gene locus_tag LOCUS_16630 2901 7085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 8621 7131 gene locus_tag LOCUS_16640 gene rprX 8621 7131 CDS product sensor protein RprX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08408 protein_id gnl|my_center|LOCUS_16640 <12496 8851 gene locus_tag LOCUS_16650 <12496 8851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence119 398 856 gene locus_tag LOCUS_16660 398 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 853 1839 gene locus_tag LOCUS_16670 853 1839 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765456.1 protein_id gnl|my_center|LOCUS_16670 1880 2083 gene locus_tag LOCUS_16680 1880 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2154 4502 gene locus_tag LOCUS_16690 2154 4502 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_16690 4533 6116 gene locus_tag LOCUS_16700 4533 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 6158 7276 gene locus_tag LOCUS_16710 6158 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 10533 7345 gene locus_tag LOCUS_16720 10533 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 11402 11052 gene locus_tag LOCUS_16730 11402 11052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence120 3937 95 gene locus_tag LOCUS_16740 3937 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 6325 3989 gene locus_tag LOCUS_16750 6325 3989 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_16750 6532 8253 gene locus_tag LOCUS_16760 6532 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 8755 10668 gene locus_tag LOCUS_16770 8755 10668 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202268.1 protein_id gnl|my_center|LOCUS_16770 10649 11215 gene locus_tag LOCUS_16780 10649 11215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 11259 12209 gene locus_tag LOCUS_16790 11259 12209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence121 949 2136 gene locus_tag LOCUS_16800 949 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2176 3186 gene locus_tag LOCUS_16810 2176 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3266 4378 gene locus_tag LOCUS_16820 3266 4378 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071388.1 protein_id gnl|my_center|LOCUS_16820 4407 5648 gene locus_tag LOCUS_16830 4407 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 5976 8384 gene locus_tag LOCUS_16840 gene hppA 5976 8384 CDS product K(+)-insensitive pyrophosphate-energized proton pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDT8 protein_id gnl|my_center|LOCUS_16840 8683 9378 gene locus_tag LOCUS_16850 gene purQ 8683 9378 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S567 protein_id gnl|my_center|LOCUS_16850 11261 9474 gene locus_tag LOCUS_16860 11261 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence122 1631 627 gene locus_tag LOCUS_16870 1631 627 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP0 protein_id gnl|my_center|LOCUS_16870 2665 1775 gene locus_tag LOCUS_16880 2665 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3096 6176 gene locus_tag LOCUS_16890 3096 6176 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_16890 6638 7762 gene locus_tag LOCUS_16900 6638 7762 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_16900 8723 8079 gene locus_tag LOCUS_16910 gene pcm 8723 8079 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_16910 9485 8802 gene locus_tag LOCUS_16920 9485 8802 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759973.1 protein_id gnl|my_center|LOCUS_16920 9857 12142 gene locus_tag LOCUS_16930 9857 12142 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790429.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence123 1493 474 gene locus_tag LOCUS_16940 gene pheS 1493 474 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A756 protein_id gnl|my_center|LOCUS_16940 2401 1571 gene locus_tag LOCUS_16950 2401 1571 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NS7 protein_id gnl|my_center|LOCUS_16950 2499 2858 gene locus_tag LOCUS_16960 2499 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2874 3242 gene locus_tag LOCUS_16970 2874 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3675 4346 gene locus_tag LOCUS_16980 gene grpE 3675 4346 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 protein_id gnl|my_center|LOCUS_16980 4436 5581 gene locus_tag LOCUS_16990 gene dnaJ 4436 5581 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VI7 protein_id gnl|my_center|LOCUS_16990 6012 5599 gene locus_tag LOCUS_17000 6012 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 7221 6772 gene locus_tag LOCUS_17010 7221 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 8087 7311 gene locus_tag LOCUS_17020 8087 7311 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_17020 8221 9165 gene locus_tag LOCUS_17030 gene phoH 8221 9165 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_17030 9783 9211 gene locus_tag LOCUS_17040 gene nadD 9783 9211 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_17040 10401 9838 gene locus_tag LOCUS_17050 gene gmk 10401 9838 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY1 protein_id gnl|my_center|LOCUS_17050 11758 10574 gene locus_tag LOCUS_17060 11758 10574 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence124 557 4066 gene locus_tag LOCUS_17070 557 4066 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767767.1 protein_id gnl|my_center|LOCUS_17070 4154 6817 gene locus_tag LOCUS_17080 4154 6817 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766590.1 protein_id gnl|my_center|LOCUS_17080 6820 8148 gene locus_tag LOCUS_17090 6820 8148 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 protein_id gnl|my_center|LOCUS_17090 8457 10004 gene locus_tag LOCUS_17100 8457 10004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 10439 11593 gene locus_tag LOCUS_17110 10439 11593 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence125 1260 4 gene locus_tag LOCUS_17120 1260 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2987 1257 gene locus_tag LOCUS_17130 2987 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 4558 3161 gene locus_tag LOCUS_17140 4558 3161 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_17140 5057 4701 gene locus_tag LOCUS_17150 5057 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 5401 5078 gene locus_tag LOCUS_17160 5401 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 5979 5482 gene locus_tag LOCUS_17170 5979 5482 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570773.1 protein_id gnl|my_center|LOCUS_17170 6230 5976 gene locus_tag LOCUS_17180 6230 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 6445 7080 gene locus_tag LOCUS_17190 6445 7080 CDS product RNA polymerase ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361994.1 protein_id gnl|my_center|LOCUS_17190 7147 8754 gene locus_tag LOCUS_17200 7147 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence126 910 260 gene locus_tag LOCUS_17210 910 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1119 2120 gene locus_tag LOCUS_17220 1119 2120 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UVH8 protein_id gnl|my_center|LOCUS_17220 3861 2341 gene locus_tag LOCUS_17230 3861 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 4106 7543 gene locus_tag LOCUS_17240 4106 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 7971 8768 gene locus_tag LOCUS_17250 7971 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_17250 8843 9781 gene locus_tag LOCUS_17260 8843 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 9898 10395 gene locus_tag LOCUS_17270 9898 10395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 10509 11528 gene locus_tag LOCUS_17280 10509 11528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence127 140 556 gene locus_tag LOCUS_17290 140 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 757 3717 gene locus_tag LOCUS_17300 757 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 6053 3807 gene locus_tag LOCUS_17310 6053 3807 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107588.1 protein_id gnl|my_center|LOCUS_17310 <12030 6140 gene locus_tag LOCUS_17320 <12030 6140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence128 >Feature sequence129 <1 5833 gene locus_tag LOCUS_17330 <1 5833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963937.1:T9SS C-terminal target domain-containing protein 7025 6120 gene locus_tag LOCUS_17340 gene dapA 7025 6120 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C0 protein_id gnl|my_center|LOCUS_17340 7644 7108 gene locus_tag LOCUS_17350 7644 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 9673 7673 gene locus_tag LOCUS_17360 gene ligA 9673 7673 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM7 protein_id gnl|my_center|LOCUS_17360 11663 9792 gene locus_tag LOCUS_17370 11663 9792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence130 281 466 gene locus_tag LOCUS_17380 281 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2517 607 gene locus_tag LOCUS_17390 2517 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3053 2667 gene locus_tag LOCUS_17400 3053 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 4391 3300 gene locus_tag LOCUS_17410 gene yhaZ 4391 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07541 protein_id gnl|my_center|LOCUS_17410 4660 4403 gene locus_tag LOCUS_17420 4660 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 5331 4948 gene locus_tag LOCUS_17430 5331 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 5550 5338 gene locus_tag LOCUS_17440 5550 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 5932 5516 gene locus_tag LOCUS_17450 5932 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_17450 6573 6106 gene locus_tag LOCUS_17460 6573 6106 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_17460 7217 6576 gene locus_tag LOCUS_17470 7217 6576 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_17470 7780 7280 gene locus_tag LOCUS_17480 7780 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 8616 7783 gene locus_tag LOCUS_17490 8616 7783 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_17490 8772 8682 gene locus_tag LOCUS_t00210 8772 8682 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9538 9056 gene locus_tag LOCUS_17500 gene coaD 9538 9056 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_17500 10235 9672 gene locus_tag LOCUS_17510 10235 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 11427 10393 gene locus_tag LOCUS_17520 gene selD 11427 10393 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q182I1 protein_id gnl|my_center|LOCUS_17520 11659 11435 gene locus_tag LOCUS_17530 11659 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence131 1479 865 gene locus_tag LOCUS_17540 1479 865 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461608.1 protein_id gnl|my_center|LOCUS_17540 4081 1481 gene locus_tag LOCUS_17550 4081 1481 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272623.1 protein_id gnl|my_center|LOCUS_17550 5226 4099 gene locus_tag LOCUS_17560 5226 4099 CDS product Hdr menaquinol oxidoreductase integral membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_17560 6072 5239 gene locus_tag LOCUS_17570 6072 5239 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461607.1 protein_id gnl|my_center|LOCUS_17570 7287 6286 gene locus_tag LOCUS_17580 7287 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 9161 7815 gene locus_tag LOCUS_17590 9161 7815 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941974.1 protein_id gnl|my_center|LOCUS_17590 10694 9186 gene locus_tag LOCUS_17600 10694 9186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 11535 10687 gene locus_tag LOCUS_17610 11535 10687 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272622.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence132 945 247 gene locus_tag LOCUS_17620 945 247 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_17620 2433 1402 gene locus_tag LOCUS_17630 2433 1402 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462028.1 protein_id gnl|my_center|LOCUS_17630 2886 2437 gene locus_tag LOCUS_17640 2886 2437 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107123.1 protein_id gnl|my_center|LOCUS_17640 3206 2880 gene locus_tag LOCUS_17650 3206 2880 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_17650 4109 3327 gene locus_tag LOCUS_17660 4109 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4891 4109 gene locus_tag LOCUS_17670 4891 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 5855 4896 gene locus_tag LOCUS_17680 5855 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 6277 5858 gene locus_tag LOCUS_17690 6277 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 6805 6284 gene locus_tag LOCUS_17700 6805 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 7265 6789 gene locus_tag LOCUS_17710 7265 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 7988 7266 gene locus_tag LOCUS_17720 7988 7266 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876530.1 protein_id gnl|my_center|LOCUS_17720 9126 8014 gene locus_tag LOCUS_17730 9126 8014 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255928.1 protein_id gnl|my_center|LOCUS_17730 9343 9119 gene locus_tag LOCUS_17740 9343 9119 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932830.1 protein_id gnl|my_center|LOCUS_17740 9979 9347 gene locus_tag LOCUS_17750 9979 9347 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107126.1 protein_id gnl|my_center|LOCUS_17750 10486 10052 gene locus_tag LOCUS_17760 10486 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 10762 10499 gene locus_tag LOCUS_17770 10762 10499 CDS product redox-active disulfide protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943587.1 protein_id gnl|my_center|LOCUS_17770 11127 10828 gene locus_tag LOCUS_17780 11127 10828 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107450.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence133 2364 697 gene locus_tag LOCUS_17790 2364 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 4004 2463 gene locus_tag LOCUS_17800 gene crnA 4004 2463 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_17800 4751 4080 gene locus_tag LOCUS_17810 gene narI 4751 4080 CDS product nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191967.1 protein_id gnl|my_center|LOCUS_17810 5445 4843 gene locus_tag LOCUS_17820 5445 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 6950 5496 gene locus_tag LOCUS_17830 gene narH 6950 5496 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692685.1 protein_id gnl|my_center|LOCUS_17830 10654 7034 gene locus_tag LOCUS_17840 gene narG 10654 7034 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 protein_id gnl|my_center|LOCUS_17840 <11548 10722 gene locus_tag LOCUS_17850 <11548 10722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962543.1:cytochrome c >Feature sequence134 718 551 gene locus_tag LOCUS_17860 718 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 7548 1063 gene locus_tag LOCUS_17870 7548 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 7736 10363 gene locus_tag LOCUS_17880 7736 10363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 11186 10440 gene locus_tag LOCUS_17890 11186 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence135 236 3910 gene locus_tag LOCUS_17900 236 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 3949 8082 gene locus_tag LOCUS_17910 3949 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 8118 9182 gene locus_tag LOCUS_17920 8118 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence136 3327 1462 gene locus_tag LOCUS_17930 3327 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 4223 3483 gene locus_tag LOCUS_17940 4223 3483 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6F4 protein_id gnl|my_center|LOCUS_17940 6297 4513 gene locus_tag LOCUS_17950 6297 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 6551 7951 gene locus_tag LOCUS_17960 gene miaB 6551 7951 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650P7 protein_id gnl|my_center|LOCUS_17960 8107 8895 gene locus_tag LOCUS_17970 8107 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 11129 8979 gene locus_tag LOCUS_17980 11129 8979 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence137 3443 321 gene locus_tag LOCUS_17990 3443 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 6579 3643 gene locus_tag LOCUS_18000 6579 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125416.1 protein_id gnl|my_center|LOCUS_18000 6761 8299 gene locus_tag LOCUS_18010 6761 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 9462 10727 gene locus_tag LOCUS_18020 9462 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 10751 11380 gene locus_tag LOCUS_18030 gene rsmG 10751 11380 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_18030 >Feature sequence138 516 1571 gene locus_tag LOCUS_18040 516 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1597 2124 gene locus_tag LOCUS_18050 1597 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 2179 4227 gene locus_tag LOCUS_18060 gene metG 2179 4227 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MP7 protein_id gnl|my_center|LOCUS_18060 5667 4327 gene locus_tag LOCUS_18070 5667 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 6675 5749 gene locus_tag LOCUS_18080 6675 5749 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_18080 7454 6717 gene locus_tag LOCUS_18090 gene ste14 7454 6717 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_18090 7588 7662 gene locus_tag LOCUS_t00220 7588 7662 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10217 8475 gene locus_tag LOCUS_18100 10217 8475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 11364 10471 gene locus_tag LOCUS_18110 11364 10471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence139 2503 218 gene locus_tag LOCUS_18120 2503 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 4307 2622 gene locus_tag LOCUS_18130 4307 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 5845 4304 gene locus_tag LOCUS_18140 5845 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 6468 6923 gene locus_tag LOCUS_18150 6468 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 7038 8480 gene locus_tag LOCUS_18160 gene pepA 7038 8480 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD74 protein_id gnl|my_center|LOCUS_18160 8470 9570 gene locus_tag LOCUS_18170 gene pdxA 8470 9570 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_18170 9905 9645 gene locus_tag LOCUS_18180 9905 9645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 9787 11181 gene locus_tag LOCUS_18190 9787 11181 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence140 <1 749 gene locus_tag LOCUS_18200 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405176.1:arsenite S-adenosylmethyltransferase 893 2437 gene locus_tag LOCUS_18210 893 2437 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_18210 2515 2844 gene locus_tag LOCUS_18220 2515 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 3743 2910 gene locus_tag LOCUS_18230 gene ispE 3743 2910 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T40 protein_id gnl|my_center|LOCUS_18230 4076 6733 gene locus_tag LOCUS_18240 4076 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 6842 9544 gene locus_tag LOCUS_18250 6842 9544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 9617 10003 gene locus_tag LOCUS_18260 9617 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence141 3942 184 gene locus_tag LOCUS_18270 3942 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 4985 4206 gene locus_tag LOCUS_18280 4985 4206 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_18280 6063 5002 gene locus_tag LOCUS_18290 6063 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 6885 6067 gene locus_tag LOCUS_18300 6885 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 7723 7046 gene locus_tag LOCUS_18310 7723 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 9006 7720 gene locus_tag LOCUS_18320 9006 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105320.1 protein_id gnl|my_center|LOCUS_18320 <11227 9116 gene locus_tag LOCUS_18330 <11227 9116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWM2:Asp/Glu-specific dipeptidyl-peptidase >Feature sequence142 290 9712 gene locus_tag LOCUS_18340 290 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 9794 11158 gene locus_tag LOCUS_18350 gene hisS 9794 11158 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N7 protein_id gnl|my_center|LOCUS_18350 >Feature sequence143 121 1305 gene locus_tag LOCUS_18360 121 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1344 2897 gene locus_tag LOCUS_18370 1344 2897 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_18370 3046 3270 gene locus_tag LOCUS_18380 3046 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3296 3802 gene locus_tag LOCUS_18390 3296 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 4266 6131 gene locus_tag LOCUS_18400 4266 6131 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810859.1 protein_id gnl|my_center|LOCUS_18400 6468 7430 gene locus_tag LOCUS_18410 gene pyrD 6468 7430 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_18410 7613 8200 gene locus_tag LOCUS_18420 7613 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 8306 9952 gene locus_tag LOCUS_18430 8306 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence144 463 128 gene locus_tag LOCUS_18440 463 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1340 570 gene locus_tag LOCUS_18450 1340 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_18450 2439 1345 gene locus_tag LOCUS_18460 2439 1345 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 protein_id gnl|my_center|LOCUS_18460 2811 2476 gene locus_tag LOCUS_18470 2811 2476 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_18470 5034 3532 gene locus_tag LOCUS_18480 5034 3532 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_18480 6371 5172 gene locus_tag LOCUS_18490 6371 5172 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_18490 7056 6580 gene locus_tag LOCUS_18500 7056 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 8271 7114 gene locus_tag LOCUS_18510 8271 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 9160 8312 gene locus_tag LOCUS_18520 gene cphB 9160 8312 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360578.1 protein_id gnl|my_center|LOCUS_18520 9789 10838 gene locus_tag LOCUS_18530 9789 10838 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence145 1564 590 gene locus_tag LOCUS_18540 1564 590 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_18540 1699 3936 gene locus_tag LOCUS_18550 1699 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 3954 4586 gene locus_tag LOCUS_18560 3954 4586 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_18560 6120 4702 gene locus_tag LOCUS_18570 gene ahcY 6120 4702 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A407 protein_id gnl|my_center|LOCUS_18570 6281 6206 gene locus_tag LOCUS_t00230 6281 6206 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6828 6412 gene locus_tag LOCUS_18580 6828 6412 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_18580 7020 7718 gene locus_tag LOCUS_18590 7020 7718 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_18590 9815 7800 gene locus_tag LOCUS_18600 9815 7800 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203427.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence146 651 929 gene locus_tag LOCUS_18610 651 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 926 4186 gene locus_tag LOCUS_18620 926 4186 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109349.1 protein_id gnl|my_center|LOCUS_18620 4266 5084 gene locus_tag LOCUS_18630 4266 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_18630 5084 8695 gene locus_tag LOCUS_18640 5084 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 8697 9248 gene locus_tag LOCUS_18650 8697 9248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 9253 10608 gene locus_tag LOCUS_18660 9253 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence147 2179 680 gene locus_tag LOCUS_18670 2179 680 CDS product all-trans-retinol 13,14-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_18670 3670 2180 gene locus_tag LOCUS_18680 3670 2180 CDS product all-trans-retinol 13,14-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_18680 7503 3667 gene locus_tag LOCUS_18690 7503 3667 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964346.1 protein_id gnl|my_center|LOCUS_18690 8682 7510 gene locus_tag LOCUS_18700 8682 7510 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_18700 9052 8684 gene locus_tag LOCUS_18710 9052 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 9684 9052 gene locus_tag LOCUS_18720 9684 9052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 10282 9647 gene locus_tag LOCUS_18730 10282 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 11099 10341 gene locus_tag LOCUS_18740 11099 10341 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence148 347 832 gene locus_tag LOCUS_18750 347 832 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824008.1 protein_id gnl|my_center|LOCUS_18750 845 2044 gene locus_tag LOCUS_18760 845 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2591 3805 gene locus_tag LOCUS_18770 2591 3805 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P3 protein_id gnl|my_center|LOCUS_18770 4966 3824 gene locus_tag LOCUS_18780 4966 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 6125 5052 gene locus_tag LOCUS_18790 6125 5052 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_18790 6494 6135 gene locus_tag LOCUS_18800 gene ychN 6494 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070692.1 protein_id gnl|my_center|LOCUS_18800 7901 6537 gene locus_tag LOCUS_18810 7901 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_18810 <11055 8074 gene locus_tag LOCUS_18820 <11055 8074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Y2:Fused isobutyryl-CoA mutase >Feature sequence149 230 48 gene locus_tag LOCUS_18830 230 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 256 1950 gene locus_tag LOCUS_18840 256 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2412 4466 gene locus_tag LOCUS_18850 gene dsbD 2412 4466 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_18850 4498 5466 gene locus_tag LOCUS_18860 gene kdsD 4498 5466 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_18860 5506 6330 gene locus_tag LOCUS_18870 gene tatC 5506 6330 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_18870 6459 9899 gene locus_tag LOCUS_18880 6459 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 <10937 10029 gene locus_tag LOCUS_18890 <10937 10029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence150 1377 2552 gene locus_tag LOCUS_18900 1377 2552 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_18900 2846 3706 gene locus_tag LOCUS_18910 2846 3706 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_18910 4665 3778 gene locus_tag LOCUS_18920 gene fjo11 4665 3778 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_18920 6469 4805 gene locus_tag LOCUS_18930 6469 4805 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_18930 6886 6548 gene locus_tag LOCUS_18940 6886 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 8908 6935 gene locus_tag LOCUS_18950 gene gyrB 8908 6935 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN0 protein_id gnl|my_center|LOCUS_18950 10705 9728 gene locus_tag LOCUS_18960 10705 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence151 1583 141 gene locus_tag LOCUS_18970 1583 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1790 2809 gene locus_tag LOCUS_18980 gene ruvB 1790 2809 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2M0 protein_id gnl|my_center|LOCUS_18980 3085 4701 gene locus_tag LOCUS_18990 3085 4701 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861369.1 protein_id gnl|my_center|LOCUS_18990 4694 5935 gene locus_tag LOCUS_19000 4694 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889821.1 protein_id gnl|my_center|LOCUS_19000 5868 6851 gene locus_tag LOCUS_19010 5868 6851 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_19010 6859 6987 gene locus_tag LOCUS_19020 6859 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 6995 10348 gene locus_tag LOCUS_19030 gene mfd 6995 10348 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_19030 >Feature sequence152 2224 4095 gene locus_tag LOCUS_19040 2224 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4131 4754 gene locus_tag LOCUS_19050 4131 4754 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887630.1 protein_id gnl|my_center|LOCUS_19050 5160 6461 gene locus_tag LOCUS_19060 5160 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 6500 8197 gene locus_tag LOCUS_19070 6500 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 8365 8850 gene locus_tag LOCUS_19080 8365 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 9775 9927 gene locus_tag LOCUS_19090 9775 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence153 <1 2007 gene locus_tag LOCUS_19100 <1 2007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120353.1:helicase 2404 2781 gene locus_tag LOCUS_19110 2404 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_19110 2956 5277 gene locus_tag LOCUS_19120 2956 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 5292 8237 gene locus_tag LOCUS_19130 5292 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence154 >Feature sequence155 1572 310 gene locus_tag LOCUS_19140 gene nqrF 1572 310 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_19140 2210 1662 gene locus_tag LOCUS_19150 gene nqrE 2210 1662 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 protein_id gnl|my_center|LOCUS_19150 2932 2303 gene locus_tag LOCUS_19160 gene nqrD 2932 2303 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_19160 3695 2976 gene locus_tag LOCUS_19170 gene nqrC 3695 2976 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_19170 4854 3700 gene locus_tag LOCUS_19180 gene nqrB 4854 3700 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_19180 6289 4940 gene locus_tag LOCUS_19190 gene nqrA 6289 4940 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_19190 6623 7978 gene locus_tag LOCUS_19200 6623 7978 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence156 678 325 gene locus_tag LOCUS_19210 678 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2164 800 gene locus_tag LOCUS_19220 2164 800 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_19220 2484 2858 gene locus_tag LOCUS_19230 2484 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2858 3358 gene locus_tag LOCUS_19240 2858 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 3413 3598 gene locus_tag LOCUS_19250 3413 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 3537 4127 gene locus_tag LOCUS_19260 3537 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 4563 4488 gene locus_tag LOCUS_t00240 4563 4488 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6007 4718 gene locus_tag LOCUS_19270 gene folC 6007 4718 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_19270 6071 7408 gene locus_tag LOCUS_19280 6071 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 8894 7470 gene locus_tag LOCUS_19290 8894 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 9590 9039 gene locus_tag LOCUS_19300 9590 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 9858 10208 gene locus_tag LOCUS_19310 9858 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence157 1571 2707 gene locus_tag LOCUS_19320 1571 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2780 4747 gene locus_tag LOCUS_19330 2780 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 7027 4883 gene locus_tag LOCUS_19340 7027 4883 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_19340 7759 9852 gene locus_tag LOCUS_19350 7759 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence158 447 632 gene locus_tag LOCUS_19360 gene rpmF 447 632 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A138 protein_id gnl|my_center|LOCUS_19360 661 1608 gene locus_tag LOCUS_19370 gene plsX 661 1608 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y4 protein_id gnl|my_center|LOCUS_19370 1601 2587 gene locus_tag LOCUS_19380 gene fabH 1601 2587 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV1 protein_id gnl|my_center|LOCUS_19380 2717 3508 gene locus_tag LOCUS_19390 2717 3508 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_19390 3531 5918 gene locus_tag LOCUS_19400 3531 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 8626 6068 gene locus_tag LOCUS_19410 8626 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 9235 10059 gene locus_tag LOCUS_19420 9235 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence159 80 1909 gene locus_tag LOCUS_19430 80 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 1933 6477 gene locus_tag LOCUS_19440 1933 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 6587 7048 gene locus_tag LOCUS_19450 6587 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 7063 7545 gene locus_tag LOCUS_19460 7063 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 8142 7570 gene locus_tag LOCUS_19470 gene gmhB 8142 7570 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EQ5 protein_id gnl|my_center|LOCUS_19470 8619 8158 gene locus_tag LOCUS_19480 8619 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 9867 8674 gene locus_tag LOCUS_19490 9867 8674 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT2 protein_id gnl|my_center|LOCUS_19490 >Feature sequence160 1472 996 gene locus_tag LOCUS_19500 1472 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 1700 2206 gene locus_tag LOCUS_19510 1700 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2661 2221 gene locus_tag LOCUS_19520 2661 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 4138 2717 gene locus_tag LOCUS_19530 4138 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 6833 4146 gene locus_tag LOCUS_19540 6833 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 7167 8405 gene locus_tag LOCUS_19550 gene ribBA 7167 8405 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 protein_id gnl|my_center|LOCUS_19550 8489 9769 gene locus_tag LOCUS_19560 gene glyA 8489 9769 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U78 protein_id gnl|my_center|LOCUS_19560 >Feature sequence161 118 1401 gene locus_tag LOCUS_19570 118 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786554.1 protein_id gnl|my_center|LOCUS_19570 1420 2625 gene locus_tag LOCUS_19580 1420 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2699 3469 gene locus_tag LOCUS_19590 2699 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 3484 6663 gene locus_tag LOCUS_19600 3484 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 7115 6735 gene locus_tag LOCUS_19610 7115 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_19610 7688 7134 gene locus_tag LOCUS_19620 7688 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_19620 <9983 7941 gene locus_tag LOCUS_19630 <9983 7941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64R05:pyruvate-flavodoxin oxidoreductase >Feature sequence162 244 68 gene locus_tag LOCUS_19640 244 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 394 1038 gene locus_tag LOCUS_19650 394 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1198 1515 gene locus_tag LOCUS_19660 1198 1515 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763131.1 protein_id gnl|my_center|LOCUS_19660 1719 2138 gene locus_tag LOCUS_19670 1719 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2508 2305 gene locus_tag LOCUS_19680 2508 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3054 4472 gene locus_tag LOCUS_19690 gene hsdM 3054 4472 CDS product type I restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851467.1 protein_id gnl|my_center|LOCUS_19690 4597 5493 gene locus_tag LOCUS_19700 4597 5493 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201977.1 protein_id gnl|my_center|LOCUS_19700 5486 6616 gene locus_tag LOCUS_19710 gene hsdS 5486 6616 CDS product specificity protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968693.1 protein_id gnl|my_center|LOCUS_19710 6621 7307 gene locus_tag LOCUS_19720 6621 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 7285 8232 gene locus_tag LOCUS_19730 7285 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 8377 9075 gene locus_tag LOCUS_19740 gene rflA 8377 9075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_19740 9079 9567 gene locus_tag LOCUS_19750 gene rflB 9079 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073933.1 protein_id gnl|my_center|LOCUS_19750 9671 9847 gene locus_tag LOCUS_19760 9671 9847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence163 932 126 gene locus_tag LOCUS_19770 gene zupT 932 126 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AU0 protein_id gnl|my_center|LOCUS_19770 2552 1047 gene locus_tag LOCUS_19780 gene mtrF 2552 1047 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224966.1 protein_id gnl|my_center|LOCUS_19780 5619 2965 gene locus_tag LOCUS_19790 5619 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 6510 6151 gene locus_tag LOCUS_19800 6510 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 7313 6882 gene locus_tag LOCUS_19810 7313 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071321.1 protein_id gnl|my_center|LOCUS_19810 7756 7322 gene locus_tag LOCUS_19820 gene phnB 7756 7322 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_19820 8821 8108 gene locus_tag LOCUS_19830 8821 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 9325 8831 gene locus_tag LOCUS_19840 9325 8831 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_19840 9619 9350 gene locus_tag LOCUS_19850 9619 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence164 1206 19 gene locus_tag LOCUS_19860 1206 19 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_19860 1803 1273 gene locus_tag LOCUS_19870 1803 1273 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872574.1 protein_id gnl|my_center|LOCUS_19870 2404 1862 gene locus_tag LOCUS_19880 2404 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277765.1 protein_id gnl|my_center|LOCUS_19880 3749 2397 gene locus_tag LOCUS_19890 gene actC 3749 2397 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_19890 6844 3845 gene locus_tag LOCUS_19900 gene actB 6844 3845 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_19900 8037 6883 gene locus_tag LOCUS_19910 gene actA 8037 6883 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_19910 8577 8771 gene locus_tag LOCUS_19920 8577 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 9685 8789 gene locus_tag LOCUS_19930 gene miaA1 9685 8789 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XX2 protein_id gnl|my_center|LOCUS_19930 >Feature sequence165 917 1474 gene locus_tag LOCUS_19940 917 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 1484 2182 gene locus_tag LOCUS_19950 1484 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 2257 3663 gene locus_tag LOCUS_19960 2257 3663 CDS product 2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097917.1 protein_id gnl|my_center|LOCUS_19960 3823 4803 gene locus_tag LOCUS_19970 3823 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 5705 5091 gene locus_tag LOCUS_19980 gene yjdF 5705 5091 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_19980 7092 5830 gene locus_tag LOCUS_19990 7092 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 7807 7163 gene locus_tag LOCUS_20000 7807 7163 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_20000 9604 7814 gene locus_tag LOCUS_20010 gene lepA 9604 7814 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA33 protein_id gnl|my_center|LOCUS_20010 >Feature sequence166 1944 1141 gene locus_tag LOCUS_20020 1944 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2781 2146 gene locus_tag LOCUS_20030 2781 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3427 2837 gene locus_tag LOCUS_20040 3427 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 4068 3532 gene locus_tag LOCUS_20050 4068 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 5078 4137 gene locus_tag LOCUS_20060 5078 4137 CDS product NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544981.1 protein_id gnl|my_center|LOCUS_20060 5709 5173 gene locus_tag LOCUS_20070 5709 5173 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_20070 7946 5706 gene locus_tag LOCUS_20080 7946 5706 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_20080 8441 9406 gene locus_tag LOCUS_20090 8441 9406 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_20090 >Feature sequence167 308 745 gene locus_tag LOCUS_20100 308 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 862 1584 gene locus_tag LOCUS_20110 gene menG 862 1584 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_20110 1947 2639 gene locus_tag LOCUS_20120 1947 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2701 4257 gene locus_tag LOCUS_20130 2701 4257 CDS product NAD-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_20130 4594 6999 gene locus_tag LOCUS_20140 4594 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 7032 9824 gene locus_tag LOCUS_20150 7032 9824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence168 608 1984 gene locus_tag LOCUS_20160 gene tnaA 608 1984 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_20160 2210 2136 gene locus_tag LOCUS_t00250 2210 2136 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2419 2760 gene locus_tag LOCUS_20170 gene hypA 2419 2760 CDS product putative hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G73 protein_id gnl|my_center|LOCUS_20170 4478 2775 gene locus_tag LOCUS_20180 4478 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 6690 4552 gene locus_tag LOCUS_20190 gene rnr 6690 4552 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A378 protein_id gnl|my_center|LOCUS_20190 8142 6787 gene locus_tag LOCUS_20200 8142 6787 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_20200 9499 8132 gene locus_tag LOCUS_20210 9499 8132 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202702.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence169 1945 1049 gene locus_tag LOCUS_20220 1945 1049 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272622.1 protein_id gnl|my_center|LOCUS_20220 3873 2599 gene locus_tag LOCUS_20230 3873 2599 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_20230 4412 4074 gene locus_tag LOCUS_20240 4412 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 4757 4446 gene locus_tag LOCUS_20250 4757 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence170 <1 926 gene locus_tag LOCUS_20260 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KFL8:dTDP-glucose 4,6-dehydratase 1038 2012 gene locus_tag LOCUS_20270 1038 2012 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_20270 2132 4087 gene locus_tag LOCUS_20280 gene ogt 2132 4087 CDS product O-GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_20280 4152 5183 gene locus_tag LOCUS_20290 4152 5183 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EL0 protein_id gnl|my_center|LOCUS_20290 5822 7696 gene locus_tag LOCUS_20300 5822 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 8427 8891 gene locus_tag LOCUS_20310 8427 8891 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948363.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence171 1195 131 gene locus_tag LOCUS_20320 1195 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1683 1219 gene locus_tag LOCUS_20330 1683 1219 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_20330 3780 1927 gene locus_tag LOCUS_20340 3780 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 4314 3955 gene locus_tag LOCUS_20350 4314 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 6586 4367 gene locus_tag LOCUS_20360 6586 4367 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_20360 7244 6810 gene locus_tag LOCUS_20370 7244 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 7500 8711 gene locus_tag LOCUS_20380 7500 8711 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence172 1147 116 gene locus_tag LOCUS_20390 1147 116 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_20390 1640 1230 gene locus_tag LOCUS_20400 1640 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 2361 1732 gene locus_tag LOCUS_20410 gene pyrE 2361 1732 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D5 protein_id gnl|my_center|LOCUS_20410 2363 2974 gene locus_tag LOCUS_20420 2363 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 3195 5216 gene locus_tag LOCUS_20430 3195 5216 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_20430 5339 6511 gene locus_tag LOCUS_20440 gene purM 5339 6511 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_20440 6620 7696 gene locus_tag LOCUS_20450 gene prfA 6620 7696 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW5 protein_id gnl|my_center|LOCUS_20450 7919 8734 gene locus_tag LOCUS_20460 gene pyrF 7919 8734 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_20460 8754 9104 gene locus_tag LOCUS_20470 8754 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence173 3258 667 gene locus_tag LOCUS_20480 3258 667 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_20480 3988 3518 gene locus_tag LOCUS_20490 3988 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 4955 4191 gene locus_tag LOCUS_20500 4955 4191 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_20500 8469 5071 gene locus_tag LOCUS_20510 8469 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766599.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence174 >Feature sequence175 6972 1858 gene locus_tag LOCUS_20520 6972 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 7544 8740 gene locus_tag LOCUS_20530 7544 8740 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_20530 8752 9303 gene locus_tag LOCUS_20540 8752 9303 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence176 140 589 gene locus_tag LOCUS_20550 140 589 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_20550 785 1786 gene locus_tag LOCUS_20560 785 1786 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949099.1 protein_id gnl|my_center|LOCUS_20560 1783 2565 gene locus_tag LOCUS_20570 1783 2565 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358645.1 protein_id gnl|my_center|LOCUS_20570 2682 3353 gene locus_tag LOCUS_20580 gene queC 2682 3353 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRJ5 protein_id gnl|my_center|LOCUS_20580 3365 3694 gene locus_tag LOCUS_20590 3365 3694 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q92 protein_id gnl|my_center|LOCUS_20590 3743 4330 gene locus_tag LOCUS_20600 gene queE 3743 4330 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45097 protein_id gnl|my_center|LOCUS_20600 5029 4421 gene locus_tag LOCUS_20610 5029 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 5269 8544 gene locus_tag LOCUS_20620 gene secA 5269 8544 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL5 protein_id gnl|my_center|LOCUS_20620 9449 8625 gene locus_tag LOCUS_20630 9449 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 >Feature sequence177 1014 427 gene locus_tag LOCUS_20640 1014 427 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_20640 1270 1031 gene locus_tag LOCUS_20650 1270 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 1819 1304 gene locus_tag LOCUS_20660 gene yceI 1819 1304 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_20660 2396 1965 gene locus_tag LOCUS_20670 2396 1965 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366740.1 protein_id gnl|my_center|LOCUS_20670 3361 2780 gene locus_tag LOCUS_20680 3361 2780 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_20680 5009 3396 gene locus_tag LOCUS_20690 5009 3396 CDS product indolepyruvate oxidoreductase subunit IorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN4 protein_id gnl|my_center|LOCUS_20690 5728 5210 gene locus_tag LOCUS_20700 gene rimM 5728 5210 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_20700 6084 8906 gene locus_tag LOCUS_20710 6084 8906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 9203 9045 gene locus_tag LOCUS_20720 9203 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 9363 9178 gene locus_tag LOCUS_20730 9363 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence178 2125 1754 gene locus_tag LOCUS_20740 2125 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2425 2153 gene locus_tag LOCUS_20750 2425 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 4247 2430 gene locus_tag LOCUS_20760 4247 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 5488 4259 gene locus_tag LOCUS_20770 5488 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 9293 5478 gene locus_tag LOCUS_20780 9293 5478 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence179 458 102 gene locus_tag LOCUS_20790 458 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 1747 518 gene locus_tag LOCUS_20800 1747 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 4100 1731 gene locus_tag LOCUS_20810 4100 1731 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963253.1 protein_id gnl|my_center|LOCUS_20810 5135 4188 gene locus_tag LOCUS_20820 5135 4188 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056913.1 protein_id gnl|my_center|LOCUS_20820 6430 5132 gene locus_tag LOCUS_20830 6430 5132 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403692.1 protein_id gnl|my_center|LOCUS_20830 6943 6560 gene locus_tag LOCUS_20840 6943 6560 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902347.1 protein_id gnl|my_center|LOCUS_20840 8394 7735 gene locus_tag LOCUS_20850 8394 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 9390 8839 gene locus_tag LOCUS_20860 9390 8839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence180 1047 2234 gene locus_tag LOCUS_20870 gene pgk 1047 2234 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R68 protein_id gnl|my_center|LOCUS_20870 3820 2288 gene locus_tag LOCUS_20880 3820 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 4757 3987 gene locus_tag LOCUS_20890 4757 3987 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_20890 4931 5536 gene locus_tag LOCUS_20900 4931 5536 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_20900 5903 8095 gene locus_tag LOCUS_20910 5903 8095 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_20910 9237 8116 gene locus_tag LOCUS_20920 9237 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 9425 9243 gene locus_tag LOCUS_20930 9425 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence181 66 932 gene locus_tag LOCUS_20940 66 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 1007 1819 gene locus_tag LOCUS_20950 1007 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 4791 1960 gene locus_tag LOCUS_20960 4791 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 5107 7260 gene locus_tag LOCUS_20970 5107 7260 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_20970 7802 7353 gene locus_tag LOCUS_20980 gene smpB 7802 7353 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_20980 8435 7875 gene locus_tag LOCUS_20990 8435 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence182 671 234 gene locus_tag LOCUS_21000 671 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2842 683 gene locus_tag LOCUS_21010 2842 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3752 3438 gene locus_tag LOCUS_21020 3752 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 4286 4002 gene locus_tag LOCUS_21030 4286 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 4470 4396 gene locus_tag LOCUS_t00260 4470 4396 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4550 7315 gene locus_tag LOCUS_21040 gene leuS 4550 7315 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG4 protein_id gnl|my_center|LOCUS_21040 >Feature sequence183 1529 84 gene locus_tag LOCUS_21050 1529 84 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_21050 2335 1571 gene locus_tag LOCUS_21060 2335 1571 CDS product xanthine dehydrogenase accessory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 protein_id gnl|my_center|LOCUS_21060 2588 3253 gene locus_tag LOCUS_21070 2588 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_21070 3338 4570 gene locus_tag LOCUS_21080 3338 4570 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_21080 4792 6243 gene locus_tag LOCUS_21090 gene mloB 4792 6243 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_21090 6670 8997 gene locus_tag LOCUS_21100 6670 8997 CDS product sugar hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203497.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence184 2466 709 gene locus_tag LOCUS_21110 2466 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 4339 3092 gene locus_tag LOCUS_21120 4339 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 7651 4412 gene locus_tag LOCUS_21130 7651 4412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121231.1 protein_id gnl|my_center|LOCUS_21130 8435 7758 gene locus_tag LOCUS_21140 gene lolD 8435 7758 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FV90 protein_id gnl|my_center|LOCUS_21140 9243 8842 gene locus_tag LOCUS_21150 9243 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence185 243 647 gene locus_tag LOCUS_21160 243 647 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_21160 896 2455 gene locus_tag LOCUS_21170 896 2455 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_21170 2456 2836 gene locus_tag LOCUS_21180 2456 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2851 3273 gene locus_tag LOCUS_21190 2851 3273 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_21190 3277 4626 gene locus_tag LOCUS_21200 3277 4626 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789543.1 protein_id gnl|my_center|LOCUS_21200 7237 4679 gene locus_tag LOCUS_21210 7237 4679 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869184.1 protein_id gnl|my_center|LOCUS_21210 7415 8785 gene locus_tag LOCUS_21220 7415 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence186 9312 4150 gene locus_tag LOCUS_21230 9312 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence187 1894 1325 gene locus_tag LOCUS_21240 1894 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 3335 1995 gene locus_tag LOCUS_21250 3335 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109224.1 protein_id gnl|my_center|LOCUS_21250 4651 3347 gene locus_tag LOCUS_21260 4651 3347 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_21260 5462 4740 gene locus_tag LOCUS_21270 gene coaX 5462 4740 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_21270 5637 6368 gene locus_tag LOCUS_21280 5637 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 6390 6647 gene locus_tag LOCUS_21290 6390 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 6644 8236 gene locus_tag LOCUS_21300 6644 8236 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106635.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence188 1492 2718 gene locus_tag LOCUS_21310 1492 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 7983 2893 gene locus_tag LOCUS_21320 7983 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 >Feature sequence189 190 501 gene locus_tag LOCUS_21330 190 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 900 1100 gene locus_tag LOCUS_21340 900 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 1177 2490 gene locus_tag LOCUS_21350 1177 2490 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_21350 2802 3836 gene locus_tag LOCUS_21360 2802 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 4626 3895 gene locus_tag LOCUS_21370 gene lipB 4626 3895 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UP8 protein_id gnl|my_center|LOCUS_21370 4775 6067 gene locus_tag LOCUS_21380 4775 6067 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_21380 6169 9018 gene locus_tag LOCUS_21390 6169 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence190 1780 32 gene locus_tag LOCUS_21400 1780 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_21400 2078 2866 gene locus_tag LOCUS_21410 gene lgt 2078 2866 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_21410 2982 3806 gene locus_tag LOCUS_21420 2982 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 3809 4732 gene locus_tag LOCUS_21430 3809 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 4834 5892 gene locus_tag LOCUS_21440 4834 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 6006 8213 gene locus_tag LOCUS_21450 6006 8213 CDS product prolyl oligopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_21450 8241 8876 gene locus_tag LOCUS_21460 8241 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_21460 9016 9091 gene locus_tag LOCUS_t00270 9016 9091 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence191 216 1889 gene locus_tag LOCUS_21470 216 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 1919 2920 gene locus_tag LOCUS_21480 1919 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence192 1607 462 gene locus_tag LOCUS_21490 1607 462 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_21490 2096 1611 gene locus_tag LOCUS_21500 2096 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21500 3435 2488 gene locus_tag LOCUS_21510 3435 2488 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_21510 4027 3485 gene locus_tag LOCUS_21520 4027 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 4834 4064 gene locus_tag LOCUS_21530 4834 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 5082 4998 gene locus_tag LOCUS_t00280 5082 4998 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6730 5261 gene locus_tag LOCUS_21540 6730 5261 CDS product pyridoxal-5'-phosphate-dependent protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_21540 7598 6762 gene locus_tag LOCUS_21550 gene mqnD 7598 6762 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FZ8 protein_id gnl|my_center|LOCUS_21550 9013 7616 gene locus_tag LOCUS_21560 9013 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence193 <1 724 gene locus_tag LOCUS_21570 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O25711:ATP/GTP phosphatase 729 1355 gene locus_tag LOCUS_21580 729 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763834.1 protein_id gnl|my_center|LOCUS_21580 1373 2917 gene locus_tag LOCUS_21590 1373 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_21590 3111 3716 gene locus_tag LOCUS_21600 3111 3716 CDS product ankyrin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963598.1 protein_id gnl|my_center|LOCUS_21600 3727 4860 gene locus_tag LOCUS_21610 3727 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 5489 6466 gene locus_tag LOCUS_21620 5489 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 6479 6868 gene locus_tag LOCUS_21630 6479 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 6881 7756 gene locus_tag LOCUS_21640 6881 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_21640 7775 8332 gene locus_tag LOCUS_21650 7775 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 8405 8833 gene locus_tag LOCUS_21660 8405 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence194 163 2043 gene locus_tag LOCUS_21670 163 2043 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481540.1 protein_id gnl|my_center|LOCUS_21670 2266 3993 gene locus_tag LOCUS_21680 2266 3993 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_21680 5458 4007 gene locus_tag LOCUS_21690 5458 4007 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_21690 6838 5489 gene locus_tag LOCUS_21700 6838 5489 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_21700 <9081 7010 gene locus_tag LOCUS_21710 <9081 7010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203504.1:competence protein >Feature sequence195 221 2485 gene locus_tag LOCUS_21720 221 2485 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_21720 2607 4136 gene locus_tag LOCUS_21730 gene guaA 2607 4136 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_21730 4259 5086 gene locus_tag LOCUS_21740 4259 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 5132 5413 gene locus_tag LOCUS_21750 5132 5413 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884R6 protein_id gnl|my_center|LOCUS_21750 5521 6447 gene locus_tag LOCUS_21760 5521 6447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 protein_id gnl|my_center|LOCUS_21760 6450 7685 gene locus_tag LOCUS_21770 6450 7685 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123325.1 protein_id gnl|my_center|LOCUS_21770 7895 8443 gene locus_tag LOCUS_21780 7895 8443 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_21780 8699 8965 gene locus_tag LOCUS_21790 8699 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence196 283 804 gene locus_tag LOCUS_21800 283 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 1327 920 gene locus_tag LOCUS_21810 1327 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2750 1500 gene locus_tag LOCUS_21820 gene pepC 2750 1500 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_21820 3182 2784 gene locus_tag LOCUS_21830 gene ndk 3182 2784 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43802 protein_id gnl|my_center|LOCUS_21830 3300 4319 gene locus_tag LOCUS_21840 3300 4319 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_21840 4312 4845 gene locus_tag LOCUS_21850 4312 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 4915 5610 gene locus_tag LOCUS_21860 gene phoP 4915 5610 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_21860 5683 6534 gene locus_tag LOCUS_21870 5683 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107829.1 protein_id gnl|my_center|LOCUS_21870 6571 8964 gene locus_tag LOCUS_21880 6571 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence197 613 2124 gene locus_tag LOCUS_21890 613 2124 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_21890 2255 3889 gene locus_tag LOCUS_21900 2255 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 5058 3949 gene locus_tag LOCUS_21910 5058 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 5246 7366 gene locus_tag LOCUS_21920 5246 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 7379 8530 gene locus_tag LOCUS_21930 gene celE 7379 8530 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence198 1480 3816 gene locus_tag LOCUS_21940 1480 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 3970 4728 gene locus_tag LOCUS_21950 gene lpxH 3970 4728 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_21950 5539 4787 gene locus_tag LOCUS_21960 5539 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 8355 5674 gene locus_tag LOCUS_21970 8355 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 8950 8483 gene locus_tag LOCUS_21980 8950 8483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence199 357 133 gene locus_tag LOCUS_21990 357 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 509 360 gene locus_tag LOCUS_22000 509 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 931 563 gene locus_tag LOCUS_22010 931 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 1122 928 gene locus_tag LOCUS_22020 1122 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 2037 1366 gene locus_tag LOCUS_22030 gene rsmI 2037 1366 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL7 protein_id gnl|my_center|LOCUS_22030 3313 2039 gene locus_tag LOCUS_22040 3313 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 4481 3378 gene locus_tag LOCUS_22050 4481 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 4595 5173 gene locus_tag LOCUS_22060 gene tdk 4595 5173 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G4 protein_id gnl|my_center|LOCUS_22060 5203 6645 gene locus_tag LOCUS_22070 5203 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 7675 6890 gene locus_tag LOCUS_22080 7675 6890 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_22080 <8859 7769 gene locus_tag LOCUS_22090 <8859 7769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Z9:urocanate hydratase >Feature sequence200 241 168 gene locus_tag LOCUS_t00290 241 168 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 461 868 gene locus_tag LOCUS_22100 461 868 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_22100 885 1958 gene locus_tag LOCUS_22110 885 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601810.1 protein_id gnl|my_center|LOCUS_22110 2034 2435 gene locus_tag LOCUS_22120 2034 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788667.1 protein_id gnl|my_center|LOCUS_22120 6953 3285 gene locus_tag LOCUS_22130 6953 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 >Feature sequence201 707 96 gene locus_tag LOCUS_22140 707 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784817.1 protein_id gnl|my_center|LOCUS_22140 827 2230 gene locus_tag LOCUS_22150 827 2230 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_22150 3026 2343 gene locus_tag LOCUS_22160 gene rprY 3026 2343 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_22160 4492 3023 gene locus_tag LOCUS_22170 4492 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 7460 4695 gene locus_tag LOCUS_22180 7460 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 8730 7513 gene locus_tag LOCUS_22190 8730 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence202 1259 147 gene locus_tag LOCUS_22200 gene capI 1259 147 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_22200 3018 1288 gene locus_tag LOCUS_22210 3018 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 5996 3108 gene locus_tag LOCUS_22220 5996 3108 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T17 protein_id gnl|my_center|LOCUS_22220 6987 6016 gene locus_tag LOCUS_22230 6987 6016 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_22230 7872 7285 gene locus_tag LOCUS_22240 7872 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 >Feature sequence203 1042 2319 gene locus_tag LOCUS_22250 1042 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2712 3746 gene locus_tag LOCUS_22260 gene gmd 2712 3746 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066186.1 protein_id gnl|my_center|LOCUS_22260 4041 5456 gene locus_tag LOCUS_22270 4041 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 5474 6193 gene locus_tag LOCUS_22280 gene neuA 5474 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_22280 6193 7503 gene locus_tag LOCUS_22290 6193 7503 CDS product aminotransferase class III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_22290 7548 8342 gene locus_tag LOCUS_22300 gene ptmA 7548 8342 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261008.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence204 4064 510 gene locus_tag LOCUS_22310 4064 510 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964399.1 protein_id gnl|my_center|LOCUS_22310 7491 4120 gene locus_tag LOCUS_22320 7491 4120 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964399.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence205 1821 2189 gene locus_tag LOCUS_22330 1821 2189 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIB8 protein_id gnl|my_center|LOCUS_22330 2254 4188 gene locus_tag LOCUS_22340 2254 4188 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_22340 4234 4377 gene locus_tag LOCUS_22350 4234 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 4374 5663 gene locus_tag LOCUS_22360 4374 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 5663 6448 gene locus_tag LOCUS_22370 5663 6448 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence206 668 1474 gene locus_tag LOCUS_22380 668 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1549 2151 gene locus_tag LOCUS_22390 1549 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 3701 2463 gene locus_tag LOCUS_22400 gene queA 3701 2463 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_22400 4180 3728 gene locus_tag LOCUS_22410 4180 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 4446 4931 gene locus_tag LOCUS_22420 4446 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 5387 5100 gene locus_tag LOCUS_22430 5387 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 6418 5639 gene locus_tag LOCUS_22440 gene dapF 6418 5639 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_22440 6541 7302 gene locus_tag LOCUS_22450 gene phnP 6541 7302 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence207 381 118 gene locus_tag LOCUS_22460 381 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1409 528 gene locus_tag LOCUS_22470 gene nadK 1409 528 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_22470 2167 1499 gene locus_tag LOCUS_22480 2167 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_22480 2263 2976 gene locus_tag LOCUS_22490 gene pdxJ 2263 2976 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0V3 protein_id gnl|my_center|LOCUS_22490 3656 3084 gene locus_tag LOCUS_22500 gene rpsP 3656 3084 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RQ15 protein_id gnl|my_center|LOCUS_22500 4518 3982 gene locus_tag LOCUS_22510 4518 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 4803 4946 gene locus_tag LOCUS_22520 4803 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 5704 7887 gene locus_tag LOCUS_22530 5704 7887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 >Feature sequence208 3746 2331 gene locus_tag LOCUS_22540 3746 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 6700 4781 gene locus_tag LOCUS_22550 6700 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence209 655 347 gene locus_tag LOCUS_22560 655 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1213 707 gene locus_tag LOCUS_22570 gene bar 1213 707 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642421.1 protein_id gnl|my_center|LOCUS_22570 1846 1391 gene locus_tag LOCUS_22580 1846 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2138 5146 gene locus_tag LOCUS_22590 2138 5146 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292032.1 protein_id gnl|my_center|LOCUS_22590 5204 7459 gene locus_tag LOCUS_22600 5204 7459 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence210 1559 1933 gene locus_tag LOCUS_22610 1559 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2101 2607 gene locus_tag LOCUS_22620 2101 2607 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766216.1 protein_id gnl|my_center|LOCUS_22620 5032 2651 gene locus_tag LOCUS_22630 5032 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962609.1 protein_id gnl|my_center|LOCUS_22630 5183 6469 gene locus_tag LOCUS_22640 5183 6469 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence211 1053 697 gene locus_tag LOCUS_22650 1053 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 1975 1055 gene locus_tag LOCUS_22660 gene rsmH 1975 1055 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL4 protein_id gnl|my_center|LOCUS_22660 2441 1995 gene locus_tag LOCUS_22670 gene mraZ 2441 1995 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45056 protein_id gnl|my_center|LOCUS_22670 2884 5085 gene locus_tag LOCUS_22680 gene cphA 2884 5085 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144309.1 protein_id gnl|my_center|LOCUS_22680 5657 5262 gene locus_tag LOCUS_22690 5657 5262 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_22690 6148 5675 gene locus_tag LOCUS_22700 gene greA 6148 5675 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N75 protein_id gnl|my_center|LOCUS_22700 >Feature sequence212 1050 40 gene locus_tag LOCUS_22710 1050 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3560 1077 gene locus_tag LOCUS_22720 3560 1077 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120353.1 protein_id gnl|my_center|LOCUS_22720 5134 3863 gene locus_tag LOCUS_22730 5134 3863 CDS product UDP-glucose/GDP-mannose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_22730 5548 5234 gene locus_tag LOCUS_22740 5548 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_22740 6720 5677 gene locus_tag LOCUS_22750 6720 5677 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_22750 7581 7012 gene locus_tag LOCUS_22760 7581 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 7916 7590 gene locus_tag LOCUS_22770 7916 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence213 295 1764 gene locus_tag LOCUS_22780 gene murE 295 1764 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_22780 1789 3039 gene locus_tag LOCUS_22790 gene mraY 1789 3039 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_22790 3070 4428 gene locus_tag LOCUS_22800 gene murD 3070 4428 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_22800 4469 5596 gene locus_tag LOCUS_22810 gene ftsW 4469 5596 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_22810 5593 6705 gene locus_tag LOCUS_22820 gene murG 5593 6705 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A258 protein_id gnl|my_center|LOCUS_22820 6713 8083 gene locus_tag LOCUS_22830 6713 8083 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A259 protein_id gnl|my_center|LOCUS_22830 >Feature sequence214 991 1191 gene locus_tag LOCUS_22840 991 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 1261 2529 gene locus_tag LOCUS_22850 1261 2529 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_22850 7779 2587 gene locus_tag LOCUS_22860 7779 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence215 3742 2741 gene locus_tag LOCUS_22870 3742 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3900 6053 gene locus_tag LOCUS_22880 3900 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 6040 6813 gene locus_tag LOCUS_22890 6040 6813 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_22890 7707 6922 gene locus_tag LOCUS_22900 7707 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence216 >Feature sequence217 1226 159 gene locus_tag LOCUS_22910 1226 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 2037 1252 gene locus_tag LOCUS_22920 2037 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2291 3178 gene locus_tag LOCUS_22930 2291 3178 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_22930 3318 3953 gene locus_tag LOCUS_22940 3318 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 4153 5562 gene locus_tag LOCUS_22950 4153 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 5565 6512 gene locus_tag LOCUS_22960 5565 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 6544 7395 gene locus_tag LOCUS_22970 6544 7395 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_22970 7709 8038 gene locus_tag LOCUS_22980 7709 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence218 130 2901 gene locus_tag LOCUS_22990 130 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 4111 3011 gene locus_tag LOCUS_23000 gene pfk-1 4111 3011 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CH0 protein_id gnl|my_center|LOCUS_23000 6563 4407 gene locus_tag LOCUS_23010 6563 4407 CDS product prolyl tripeptidyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201860.1 protein_id gnl|my_center|LOCUS_23010 7265 6693 gene locus_tag LOCUS_23020 7265 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence219 20 1108 gene locus_tag LOCUS_23030 gene gcvT 20 1108 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WS3 protein_id gnl|my_center|LOCUS_23030 1450 2643 gene locus_tag LOCUS_23040 gene ygeW 1450 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46803 protein_id gnl|my_center|LOCUS_23040 2755 3390 gene locus_tag LOCUS_23050 gene folE 2755 3390 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U0 protein_id gnl|my_center|LOCUS_23050 3459 5693 gene locus_tag LOCUS_23060 3459 5693 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_23060 6044 5859 gene locus_tag LOCUS_23070 6044 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 <8098 6141 gene locus_tag LOCUS_23080 <8098 6141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107787.1:hybrid sensor histidine kinase/response regulator >Feature sequence220 178 480 gene locus_tag LOCUS_23090 178 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 1140 586 gene locus_tag LOCUS_23100 1140 586 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798510.1 protein_id gnl|my_center|LOCUS_23100 1480 4389 gene locus_tag LOCUS_23110 1480 4389 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_23110 4411 6012 gene locus_tag LOCUS_23120 4411 6012 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_23120 6039 7067 gene locus_tag LOCUS_23130 6039 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 7197 7922 gene locus_tag LOCUS_23140 7197 7922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence221 484 2802 gene locus_tag LOCUS_23150 484 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794512.1 protein_id gnl|my_center|LOCUS_23150 2815 4155 gene locus_tag LOCUS_23160 2815 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 4307 5845 gene locus_tag LOCUS_23170 4307 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 6032 6730 gene locus_tag LOCUS_23180 6032 6730 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_23180 7481 6744 gene locus_tag LOCUS_23190 7481 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence222 642 884 gene locus_tag LOCUS_23200 gene rpmB 642 884 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A999 protein_id gnl|my_center|LOCUS_23200 902 1084 gene locus_tag LOCUS_23210 gene rpmG 902 1084 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A0 protein_id gnl|my_center|LOCUS_23210 1096 1251 gene locus_tag LOCUS_23220 1096 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 4107 1477 gene locus_tag LOCUS_23230 4107 1477 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_23230 5264 4137 gene locus_tag LOCUS_23240 5264 4137 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_23240 6453 5503 gene locus_tag LOCUS_23250 6453 5503 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_23250 6673 7794 gene locus_tag LOCUS_23260 6673 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence223 <1 703 gene locus_tag LOCUS_23270 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0V0:peptidyl-prolyl cis-trans isomerase 761 1552 gene locus_tag LOCUS_23280 761 1552 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ8 protein_id gnl|my_center|LOCUS_23280 2515 1616 gene locus_tag LOCUS_23290 2515 1616 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_23290 3521 2598 gene locus_tag LOCUS_23300 3521 2598 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_23300 5935 4010 gene locus_tag LOCUS_23310 5935 4010 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259450.1 protein_id gnl|my_center|LOCUS_23310 7315 6032 gene locus_tag LOCUS_23320 7315 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence224 293 2002 gene locus_tag LOCUS_23330 293 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2343 2630 gene locus_tag LOCUS_23340 2343 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2643 5495 gene locus_tag LOCUS_23350 2643 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence225 7202 7801 gene locus_tag LOCUS_23360 7202 7801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence226 212 1546 gene locus_tag LOCUS_23370 212 1546 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_23370 2112 3410 gene locus_tag LOCUS_23380 2112 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 3696 4358 gene locus_tag LOCUS_23390 3696 4358 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_23390 4378 4665 gene locus_tag LOCUS_23400 4378 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 6908 4776 gene locus_tag LOCUS_23410 6908 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_23410 7785 7006 gene locus_tag LOCUS_23420 7785 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence227 720 115 gene locus_tag LOCUS_23430 720 115 CDS product SirA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391672.1 protein_id gnl|my_center|LOCUS_23430 1901 756 gene locus_tag LOCUS_23440 1901 756 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_23440 2536 1958 gene locus_tag LOCUS_23450 2536 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 2911 4149 gene locus_tag LOCUS_23460 2911 4149 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_23460 4932 4177 gene locus_tag LOCUS_23470 4932 4177 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766786.1 protein_id gnl|my_center|LOCUS_23470 5554 5000 gene locus_tag LOCUS_23480 gene def 5554 5000 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93LE9 protein_id gnl|my_center|LOCUS_23480 5968 7725 gene locus_tag LOCUS_23490 5968 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence228 3334 875 gene locus_tag LOCUS_23500 3334 875 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107414.1 protein_id gnl|my_center|LOCUS_23500 4129 3434 gene locus_tag LOCUS_23510 4129 3434 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence229 219 1652 gene locus_tag LOCUS_23520 219 1652 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_23520 1722 3053 gene locus_tag LOCUS_23530 1722 3053 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_23530 3189 3896 gene locus_tag LOCUS_23540 3189 3896 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_23540 3911 4762 gene locus_tag LOCUS_23550 3911 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 4898 5689 gene locus_tag LOCUS_23560 4898 5689 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760917.1 protein_id gnl|my_center|LOCUS_23560 5811 6797 gene locus_tag LOCUS_23570 5811 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 6794 7024 gene locus_tag LOCUS_23580 6794 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence230 212 691 gene locus_tag LOCUS_23590 212 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 920 3016 gene locus_tag LOCUS_23600 920 3016 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_23600 3668 3036 gene locus_tag LOCUS_23610 gene smtA 3668 3036 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124968.1 protein_id gnl|my_center|LOCUS_23610 4766 3738 gene locus_tag LOCUS_23620 4766 3738 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_23620 5305 4841 gene locus_tag LOCUS_23630 5305 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 6534 5323 gene locus_tag LOCUS_23640 6534 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203582.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence231 1713 178 gene locus_tag LOCUS_23650 1713 178 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766267.1 protein_id gnl|my_center|LOCUS_23650 2302 1793 gene locus_tag LOCUS_23660 2302 1793 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790282.1 protein_id gnl|my_center|LOCUS_23660 3911 2406 gene locus_tag LOCUS_23670 3911 2406 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790279.1 protein_id gnl|my_center|LOCUS_23670 5352 4354 gene locus_tag LOCUS_23680 5352 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 5525 6793 gene locus_tag LOCUS_23690 5525 6793 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_23690 7359 6790 gene locus_tag LOCUS_23700 gene purN 7359 6790 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV6 protein_id gnl|my_center|LOCUS_23700 >Feature sequence232 1584 919 gene locus_tag LOCUS_23710 1584 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 1895 3079 gene locus_tag LOCUS_23720 1895 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 3076 5469 gene locus_tag LOCUS_23730 3076 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 5538 7070 gene locus_tag LOCUS_23740 5538 7070 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_23740 7575 7102 gene locus_tag LOCUS_23750 gene rlmH 7575 7102 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA8 protein_id gnl|my_center|LOCUS_23750 >Feature sequence233 623 1465 gene locus_tag LOCUS_23760 623 1465 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_23760 1570 2499 gene locus_tag LOCUS_23770 gene yfkH 1570 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_23770 2617 3432 gene locus_tag LOCUS_23780 2617 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 5035 3611 gene locus_tag LOCUS_23790 5035 3611 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_23790 6845 5019 gene locus_tag LOCUS_23800 gene pbpA 6845 5019 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence234 4226 180 gene locus_tag LOCUS_23810 4226 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 4399 4250 gene locus_tag LOCUS_23820 4399 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 6296 4551 gene locus_tag LOCUS_23830 6296 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence235 2056 857 gene locus_tag LOCUS_23840 2056 857 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_23840 4214 2268 gene locus_tag LOCUS_23850 4214 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 5324 4548 gene locus_tag LOCUS_23860 5324 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 5953 5321 gene locus_tag LOCUS_23870 5953 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 6339 5965 gene locus_tag LOCUS_23880 6339 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 7291 6308 gene locus_tag LOCUS_23890 7291 6308 CDS product UNC-44 ankyrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence236 2710 2075 gene locus_tag LOCUS_23900 gene nreC 2710 2075 CDS product oxygen regulatory protein NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CN75 protein_id gnl|my_center|LOCUS_23900 4891 2807 gene locus_tag LOCUS_23910 4891 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 6997 5003 gene locus_tag LOCUS_23920 6997 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence237 869 537 gene locus_tag LOCUS_23930 869 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2001 1294 gene locus_tag LOCUS_23940 2001 1294 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_23940 2163 4274 gene locus_tag LOCUS_23950 2163 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 6063 4396 gene locus_tag LOCUS_23960 6063 4396 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_23960 6837 6127 gene locus_tag LOCUS_23970 6837 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence238 382 1083 gene locus_tag LOCUS_23980 382 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 1451 2158 gene locus_tag LOCUS_23990 1451 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2136 2390 gene locus_tag LOCUS_24000 2136 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2530 3846 gene locus_tag LOCUS_24010 2530 3846 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_24010 3962 5005 gene locus_tag LOCUS_24020 3962 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 5035 5424 gene locus_tag LOCUS_24030 5035 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 5468 7069 gene locus_tag LOCUS_24040 5468 7069 CDS product short-chain fatty acids transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202272.1 protein_id gnl|my_center|LOCUS_24040 7287 7075 gene locus_tag LOCUS_24050 7287 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence239 546 1109 gene locus_tag LOCUS_24060 gene frr 546 1109 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_24060 1180 1887 gene locus_tag LOCUS_24070 gene pepE 1180 1887 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83PB5 protein_id gnl|my_center|LOCUS_24070 1966 2565 gene locus_tag LOCUS_24080 1966 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2641 3588 gene locus_tag LOCUS_24090 gene natA 2641 3588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_24090 3609 4940 gene locus_tag LOCUS_24100 gene natB 3609 4940 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_24100 5032 5235 gene locus_tag LOCUS_24110 5032 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 6893 5346 gene locus_tag LOCUS_24120 gene glyQS 6893 5346 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZB5 protein_id gnl|my_center|LOCUS_24120 >Feature sequence240 671 1909 gene locus_tag LOCUS_24130 671 1909 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_24130 1976 3499 gene locus_tag LOCUS_24140 gene hutH1 1976 3499 CDS product histidine ammonia-lyase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFC2 protein_id gnl|my_center|LOCUS_24140 3587 5029 gene locus_tag LOCUS_24150 3587 5029 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_24150 5244 5681 gene locus_tag LOCUS_24160 5244 5681 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_24160 5729 6109 gene locus_tag LOCUS_24170 5729 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 6452 6907 gene locus_tag LOCUS_24180 6452 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 6968 7129 gene locus_tag LOCUS_24190 6968 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence241 1291 485 gene locus_tag LOCUS_24200 1291 485 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY9 protein_id gnl|my_center|LOCUS_24200 3227 1515 gene locus_tag LOCUS_24210 3227 1515 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_24210 4305 3286 gene locus_tag LOCUS_24220 4305 3286 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_24220 5216 4353 gene locus_tag LOCUS_24230 5216 4353 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_24230 6736 5402 gene locus_tag LOCUS_24240 gene gdhB 6736 5402 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94316 protein_id gnl|my_center|LOCUS_24240 7108 7233 gene locus_tag LOCUS_24250 7108 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence242 2169 2465 gene locus_tag LOCUS_24260 2169 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 5520 3016 gene locus_tag LOCUS_24270 5520 3016 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7D2 protein_id gnl|my_center|LOCUS_24270 5977 6744 gene locus_tag LOCUS_24280 5977 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 6759 7055 gene locus_tag LOCUS_24290 6759 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082906.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence243 2513 2259 gene locus_tag LOCUS_24300 2513 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 2536 3255 gene locus_tag LOCUS_24310 2536 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 3288 4166 gene locus_tag LOCUS_24320 3288 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 4383 5249 gene locus_tag LOCUS_24330 4383 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 5254 5700 gene locus_tag LOCUS_24340 5254 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 6456 5758 gene locus_tag LOCUS_24350 gene rprY 6456 5758 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_24350 <7272 6446 gene locus_tag LOCUS_24360 <7272 6446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963934.1:two-component sensor histidine kinase >Feature sequence244 1282 2199 gene locus_tag LOCUS_24370 1282 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2214 2435 gene locus_tag LOCUS_24380 2214 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2657 2989 gene locus_tag LOCUS_24390 2657 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 3160 4104 gene locus_tag LOCUS_24400 3160 4104 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108261.1 protein_id gnl|my_center|LOCUS_24400 4336 4755 gene locus_tag LOCUS_24410 4336 4755 CDS product acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791034.1 protein_id gnl|my_center|LOCUS_24410 6635 4806 gene locus_tag LOCUS_24420 6635 4806 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence245 270 563 gene locus_tag LOCUS_24430 270 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 981 697 gene locus_tag LOCUS_24440 981 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 2177 1062 gene locus_tag LOCUS_24450 2177 1062 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X6 protein_id gnl|my_center|LOCUS_24450 4692 2650 gene locus_tag LOCUS_24460 4692 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 5589 4726 gene locus_tag LOCUS_24470 5589 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 <7214 5663 gene locus_tag LOCUS_24480 <7214 5663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence246 3455 1833 gene locus_tag LOCUS_24490 3455 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 6542 3495 gene locus_tag LOCUS_24500 6542 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 >Feature sequence247 276 1457 gene locus_tag LOCUS_24510 276 1457 CDS product L-methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDT4 protein_id gnl|my_center|LOCUS_24510 1655 3094 gene locus_tag LOCUS_24520 1655 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 4229 3261 gene locus_tag LOCUS_24530 4229 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 5708 4404 gene locus_tag LOCUS_24540 5708 4404 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325333.1 protein_id gnl|my_center|LOCUS_24540 <7110 5870 gene locus_tag LOCUS_24550 <7110 5870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q650K6:tricorn protease >Feature sequence248 3122 1461 gene locus_tag LOCUS_24560 3122 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256471.1 protein_id gnl|my_center|LOCUS_24560 3353 3195 gene locus_tag LOCUS_24570 3353 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 4172 3378 gene locus_tag LOCUS_24580 4172 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 5877 4441 gene locus_tag LOCUS_24590 5877 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842480.1 protein_id gnl|my_center|LOCUS_24590 6691 6116 gene locus_tag LOCUS_24600 6691 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence249 334 2289 gene locus_tag LOCUS_24610 gene thrS 334 2289 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP2 protein_id gnl|my_center|LOCUS_24610 2392 2895 gene locus_tag LOCUS_24620 gene infC 2392 2895 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP1 protein_id gnl|my_center|LOCUS_24620 3059 3247 gene locus_tag LOCUS_24630 gene rpmI 3059 3247 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP0 protein_id gnl|my_center|LOCUS_24630 3349 3693 gene locus_tag LOCUS_24640 gene rplT 3349 3693 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_24640 3922 4635 gene locus_tag LOCUS_24650 3922 4635 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_24650 4650 6443 gene locus_tag LOCUS_24660 4650 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 6697 6870 gene locus_tag LOCUS_24670 6697 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence250 2644 284 gene locus_tag LOCUS_24680 2644 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 3647 2793 gene locus_tag LOCUS_24690 3647 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 5070 4072 gene locus_tag LOCUS_24700 5070 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 6760 5141 gene locus_tag LOCUS_24710 gene gldG 6760 5141 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence251 191 1006 gene locus_tag LOCUS_24720 191 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 1025 2821 gene locus_tag LOCUS_24730 1025 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_24730 2834 3613 gene locus_tag LOCUS_24740 2834 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_24740 5461 3779 gene locus_tag LOCUS_24750 5461 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 6756 5506 gene locus_tag LOCUS_24760 gene hutI 6756 5506 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_24760 >Feature sequence252 4822 3011 gene locus_tag LOCUS_24770 gene lamA 4822 3011 CDS product endo-1,3-beta-glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036385.1 protein_id gnl|my_center|LOCUS_24770 7043 5022 gene locus_tag LOCUS_24780 7043 5022 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943956.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence253 2054 405 gene locus_tag LOCUS_24790 gene hcp1 2054 405 CDS product hydroxylamine reductase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FI7 protein_id gnl|my_center|LOCUS_24790 2179 2859 gene locus_tag LOCUS_24800 2179 2859 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765568.1 protein_id gnl|my_center|LOCUS_24800 3557 2901 gene locus_tag LOCUS_24810 3557 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 4055 3723 gene locus_tag LOCUS_24820 4055 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 4504 4265 gene locus_tag LOCUS_24830 4504 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4999 4805 gene locus_tag LOCUS_24840 4999 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 4916 5245 gene locus_tag LOCUS_24850 4916 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 5317 6516 gene locus_tag LOCUS_24860 5317 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence254 310 392 gene locus_tag LOCUS_t00300 310 392 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 504 1919 gene locus_tag LOCUS_24870 504 1919 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764110.1 protein_id gnl|my_center|LOCUS_24870 1974 2654 gene locus_tag LOCUS_24880 gene clpP 1974 2654 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW2 protein_id gnl|my_center|LOCUS_24880 2735 3952 gene locus_tag LOCUS_24890 gene clpX 2735 3952 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A128 protein_id gnl|my_center|LOCUS_24890 4005 4679 gene locus_tag LOCUS_24900 4005 4679 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_24900 4709 5413 gene locus_tag LOCUS_24910 4709 5413 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence255 1168 311 gene locus_tag LOCUS_24920 1168 311 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403636.1 protein_id gnl|my_center|LOCUS_24920 2151 1471 gene locus_tag LOCUS_24930 2151 1471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763958.1 protein_id gnl|my_center|LOCUS_24930 2458 2129 gene locus_tag LOCUS_24940 2458 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 4240 2717 gene locus_tag LOCUS_24950 4240 2717 CDS product SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022102.1 protein_id gnl|my_center|LOCUS_24950 4606 4292 gene locus_tag LOCUS_24960 4606 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 6028 4640 gene locus_tag LOCUS_24970 6028 4640 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_24970 6643 6035 gene locus_tag LOCUS_24980 6643 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence256 3099 1546 gene locus_tag LOCUS_24990 gene dnaB 3099 1546 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_24990 4539 3259 gene locus_tag LOCUS_25000 4539 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 4846 4998 gene locus_tag LOCUS_25010 4846 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence257 387 2048 gene locus_tag LOCUS_25020 387 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence258 2322 1702 gene locus_tag LOCUS_25030 2322 1702 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257512.1 protein_id gnl|my_center|LOCUS_25030 3339 2377 gene locus_tag LOCUS_25040 3339 2377 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202693.1 protein_id gnl|my_center|LOCUS_25040 4193 3369 gene locus_tag LOCUS_25050 4193 3369 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107256.1 protein_id gnl|my_center|LOCUS_25050 5393 4206 gene locus_tag LOCUS_25060 gene sucC 5393 4206 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_25060 5509 6042 gene locus_tag LOCUS_25070 5509 6042 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_25070 >Feature sequence259 1773 919 gene locus_tag LOCUS_25080 gene fdnH 1773 919 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_25080 4820 1785 gene locus_tag LOCUS_25090 gene fdnG 4820 1785 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 transl_except (pos:complement(4254..4256),aa:Sec) note codon on position 189 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_25090 5415 5507 gene locus_tag LOCUS_t00310 5415 5507 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 5601 5840 gene locus_tag LOCUS_25100 5601 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 6141 6632 gene locus_tag LOCUS_25110 6141 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 >Feature sequence260 495 2486 gene locus_tag LOCUS_25120 495 2486 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_25120 2499 3719 gene locus_tag LOCUS_25130 2499 3719 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796883.1 protein_id gnl|my_center|LOCUS_25130 3902 4315 gene locus_tag LOCUS_25140 3902 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202918.1 protein_id gnl|my_center|LOCUS_25140 6610 4757 gene locus_tag LOCUS_25150 6610 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence261 2233 1448 gene locus_tag LOCUS_25160 2233 1448 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_25160 3983 2256 gene locus_tag LOCUS_25170 gene lysS 3983 2256 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_25170 5087 4206 gene locus_tag LOCUS_25180 gene atpG 5087 4206 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_25180 6773 5199 gene locus_tag LOCUS_25190 gene atpA 6773 5199 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_25190 >Feature sequence262 4464 3226 gene locus_tag LOCUS_25200 4464 3226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202489.1 protein_id gnl|my_center|LOCUS_25200 4551 5702 gene locus_tag LOCUS_25210 4551 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence263 317 114 gene locus_tag LOCUS_25220 317 114 CDS product PspC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767912.1 protein_id gnl|my_center|LOCUS_25220 541 1824 gene locus_tag LOCUS_25230 541 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 1834 2673 gene locus_tag LOCUS_25240 1834 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478815.1 protein_id gnl|my_center|LOCUS_25240 2769 3833 gene locus_tag LOCUS_25250 2769 3833 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_25250 3968 4780 gene locus_tag LOCUS_25260 3968 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 4981 5580 gene locus_tag LOCUS_25270 4981 5580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108681.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence264 267 1133 gene locus_tag LOCUS_25280 267 1133 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071881.1 protein_id gnl|my_center|LOCUS_25280 1147 4794 gene locus_tag LOCUS_25290 1147 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402959.1 protein_id gnl|my_center|LOCUS_25290 <6796 4860 gene locus_tag LOCUS_25300 <6796 4860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A8W3:DNA helicase >Feature sequence265 76 312 gene locus_tag LOCUS_25310 76 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 1239 955 gene locus_tag LOCUS_25320 1239 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 1259 2020 gene locus_tag LOCUS_25330 1259 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25330 2001 4772 gene locus_tag LOCUS_25340 2001 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 5276 6010 gene locus_tag LOCUS_25350 5276 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence266 1411 5757 gene locus_tag LOCUS_25360 1411 5757 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107519.1 protein_id gnl|my_center|LOCUS_25360 6411 5854 gene locus_tag LOCUS_25370 6411 5854 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704905.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence267 1369 209 gene locus_tag LOCUS_25380 gene porY 1369 209 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_25380 4005 1411 gene locus_tag LOCUS_25390 4005 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 5571 4156 gene locus_tag LOCUS_25400 5571 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 6158 5568 gene locus_tag LOCUS_25410 6158 5568 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_25410 6385 6597 gene locus_tag LOCUS_25420 6385 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence268 3897 193 gene locus_tag LOCUS_25430 3897 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 4092 5519 gene locus_tag LOCUS_25440 4092 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 6052 5549 gene locus_tag LOCUS_25450 6052 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 6479 6063 gene locus_tag LOCUS_25460 6479 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence269 659 243 gene locus_tag LOCUS_25470 659 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1349 954 gene locus_tag LOCUS_25480 1349 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 1647 1459 gene locus_tag LOCUS_25490 1647 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 1649 1882 gene locus_tag LOCUS_25500 1649 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 4118 2004 gene locus_tag LOCUS_25510 4118 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 5887 4190 gene locus_tag LOCUS_25520 5887 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence270 51 452 gene locus_tag LOCUS_25530 51 452 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538531.1 protein_id gnl|my_center|LOCUS_25530 545 919 gene locus_tag LOCUS_25540 545 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1000 1485 gene locus_tag LOCUS_25550 1000 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_25550 1550 1885 gene locus_tag LOCUS_25560 1550 1885 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_25560 2237 3166 gene locus_tag LOCUS_25570 2237 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 3166 3759 gene locus_tag LOCUS_25580 gene coaE 3166 3759 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY6 protein_id gnl|my_center|LOCUS_25580 3764 4483 gene locus_tag LOCUS_25590 3764 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 4949 6463 gene locus_tag LOCUS_25600 gene atpD 4949 6463 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_25600 >Feature sequence271 1150 122 gene locus_tag LOCUS_25610 1150 122 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932103.1 protein_id gnl|my_center|LOCUS_25610 1272 2153 gene locus_tag LOCUS_25620 gene sucD 1272 2153 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_25620 3450 2302 gene locus_tag LOCUS_25630 3450 2302 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_25630 6180 3541 gene locus_tag LOCUS_25640 6180 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence272 6164 1971 gene locus_tag LOCUS_25650 6164 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence273 6376 3992 gene locus_tag LOCUS_25660 6376 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 >Feature sequence274 134 1225 gene locus_tag LOCUS_25670 134 1225 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108877.1 protein_id gnl|my_center|LOCUS_25670 4164 1450 gene locus_tag LOCUS_25680 4164 1450 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_25680 4750 4430 gene locus_tag LOCUS_25690 4750 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 6479 4779 gene locus_tag LOCUS_25700 6479 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140819.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence275 495 3071 gene locus_tag LOCUS_25710 495 3071 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107787.1 protein_id gnl|my_center|LOCUS_25710 3241 6192 gene locus_tag LOCUS_25720 3241 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence276 74 520 gene locus_tag LOCUS_25730 74 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 1291 533 gene locus_tag LOCUS_25740 gene truA 1291 533 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV0 protein_id gnl|my_center|LOCUS_25740 1419 2429 gene locus_tag LOCUS_25750 1419 2429 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_25750 2522 3385 gene locus_tag LOCUS_25760 2522 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_25760 3485 4456 gene locus_tag LOCUS_25770 3485 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_25770 4580 5515 gene locus_tag LOCUS_25780 4580 5515 CDS product aerotolerance protein BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence277 887 1522 gene locus_tag LOCUS_25790 887 1522 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761733.1 protein_id gnl|my_center|LOCUS_25790 1566 3503 gene locus_tag LOCUS_25800 1566 3503 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_25800 3510 4253 gene locus_tag LOCUS_25810 gene sdhB 3510 4253 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_25810 4346 4861 gene locus_tag LOCUS_25820 4346 4861 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX66 protein_id gnl|my_center|LOCUS_25820 6206 5163 gene locus_tag LOCUS_25830 6206 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201898.1 protein_id gnl|my_center|LOCUS_25830 >Feature sequence278 8 2365 gene locus_tag LOCUS_25840 8 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 4297 2699 gene locus_tag LOCUS_25850 4297 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 6311 4287 gene locus_tag LOCUS_25860 6311 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701839.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence279 4632 1732 gene locus_tag LOCUS_25870 4632 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 6201 4756 gene locus_tag LOCUS_25880 6201 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 >Feature sequence280 2706 1525 gene locus_tag LOCUS_25890 2706 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 6189 2716 gene locus_tag LOCUS_25900 6189 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence281 202 1314 gene locus_tag LOCUS_25910 202 1314 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_25910 1443 3215 gene locus_tag LOCUS_25920 1443 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 4049 3303 gene locus_tag LOCUS_25930 4049 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 5090 4332 gene locus_tag LOCUS_25940 gene fabG 5090 4332 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250412.1 protein_id gnl|my_center|LOCUS_25940 5573 5118 gene locus_tag LOCUS_25950 5573 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence282 231 1433 gene locus_tag LOCUS_25960 231 1433 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_25960 1908 2906 gene locus_tag LOCUS_25970 1908 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 3076 4680 gene locus_tag LOCUS_25980 3076 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 4880 5998 gene locus_tag LOCUS_25990 4880 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 >Feature sequence283 4677 907 gene locus_tag LOCUS_26000 4677 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence284 285 434 gene locus_tag LOCUS_26010 285 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 739 1194 gene locus_tag LOCUS_26020 739 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1485 6302 gene locus_tag LOCUS_26030 1485 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence285 2664 343 gene locus_tag LOCUS_26040 2664 343 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_26040 4903 2981 gene locus_tag LOCUS_26050 4903 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26050 6045 4927 gene locus_tag LOCUS_26060 6045 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence286 121 1203 gene locus_tag LOCUS_26070 gene fabH1 121 1203 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_26070 >Feature sequence287 238 1158 gene locus_tag LOCUS_26080 238 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 1217 3292 gene locus_tag LOCUS_26090 1217 3292 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932114.1 protein_id gnl|my_center|LOCUS_26090 5357 3444 gene locus_tag LOCUS_26100 5357 3444 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123461.1 protein_id gnl|my_center|LOCUS_26100 5635 5360 gene locus_tag LOCUS_26110 5635 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 5938 6198 gene locus_tag LOCUS_26120 5938 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence288 3195 3677 gene locus_tag LOCUS_26130 3195 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 4837 3710 gene locus_tag LOCUS_26140 4837 3710 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_26140 5360 4890 gene locus_tag LOCUS_26150 5360 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 5498 6058 gene locus_tag LOCUS_26160 gene def 5498 6058 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_26160 >Feature sequence289 579 1064 gene locus_tag LOCUS_26170 579 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1126 1890 gene locus_tag LOCUS_26180 1126 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2076 2450 gene locus_tag LOCUS_26190 2076 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2598 3500 gene locus_tag LOCUS_26200 2598 3500 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_26200 3737 4645 gene locus_tag LOCUS_26210 3737 4645 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_26210 5106 6152 gene locus_tag LOCUS_26220 5106 6152 CDS product (p)ppGpp synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943079.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence290 306 971 gene locus_tag LOCUS_26230 306 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1176 3992 gene locus_tag LOCUS_26240 1176 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 4346 5182 gene locus_tag LOCUS_26250 4346 5182 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784029.1 protein_id gnl|my_center|LOCUS_26250 5257 6186 gene locus_tag LOCUS_26260 5257 6186 CDS product hemolysin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence291 2823 433 gene locus_tag LOCUS_26270 2823 433 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_26270 2981 4021 gene locus_tag LOCUS_26280 2981 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 5142 4159 gene locus_tag LOCUS_26290 5142 4159 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339192.1 protein_id gnl|my_center|LOCUS_26290 6063 5308 gene locus_tag LOCUS_26300 gene mqnA 6063 5308 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT25 protein_id gnl|my_center|LOCUS_26300 >Feature sequence292 <1 1218 gene locus_tag LOCUS_26310 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948160.1:PAS domain-containing sensor histidine kinase 1225 1653 gene locus_tag LOCUS_26320 1225 1653 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326711.1 protein_id gnl|my_center|LOCUS_26320 1699 3678 gene locus_tag LOCUS_26330 1699 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 4550 3768 gene locus_tag LOCUS_26340 gene lpxA 4550 3768 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_26340 5953 4565 gene locus_tag LOCUS_26350 5953 4565 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW9 protein_id gnl|my_center|LOCUS_26350 >Feature sequence293 164 2245 gene locus_tag LOCUS_26360 164 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2247 4982 gene locus_tag LOCUS_26370 2247 4982 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202674.1 protein_id gnl|my_center|LOCUS_26370 5016 5678 gene locus_tag LOCUS_26380 5016 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26380 5597 6031 gene locus_tag LOCUS_26390 5597 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26390 >Feature sequence294 <1 534 gene locus_tag LOCUS_26400 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TK4:signal recognition particle receptor FtsY 1052 1933 gene locus_tag LOCUS_26410 1052 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 1938 3086 gene locus_tag LOCUS_26420 gene bdh 1938 3086 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_26420 3174 4067 gene locus_tag LOCUS_26430 3174 4067 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650I0 protein_id gnl|my_center|LOCUS_26430 4835 4083 gene locus_tag LOCUS_26440 4835 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 5427 4837 gene locus_tag LOCUS_26450 5427 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_26450 6126 5467 gene locus_tag LOCUS_26460 6126 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence295 3023 39 gene locus_tag LOCUS_26470 3023 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 4869 3148 gene locus_tag LOCUS_26480 4869 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence296 2205 445 gene locus_tag LOCUS_26490 gene aspS 2205 445 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9E3 protein_id gnl|my_center|LOCUS_26490 >Feature sequence297 97 1365 gene locus_tag LOCUS_26500 97 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 2991 1474 gene locus_tag LOCUS_26510 2991 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 3577 3122 gene locus_tag LOCUS_26520 3577 3122 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087061.1 protein_id gnl|my_center|LOCUS_26520 5636 3681 gene locus_tag LOCUS_26530 5636 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence298 2515 164 gene locus_tag LOCUS_26540 2515 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 5332 2555 gene locus_tag LOCUS_26550 5332 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence299 673 1356 gene locus_tag LOCUS_26560 673 1356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795152.1 protein_id gnl|my_center|LOCUS_26560 1362 1619 gene locus_tag LOCUS_26570 1362 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 2446 1649 gene locus_tag LOCUS_26580 2446 1649 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_26580 3158 2643 gene locus_tag LOCUS_26590 3158 2643 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791506.1 protein_id gnl|my_center|LOCUS_26590 4033 3254 gene locus_tag LOCUS_26600 gene tdeIIIR 4033 3254 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682206.1 protein_id gnl|my_center|LOCUS_26600 4235 4038 gene locus_tag LOCUS_26610 4235 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 5815 4238 gene locus_tag LOCUS_26620 gene tdeIIIM 5815 4238 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682204.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence300 <5917 1850 gene locus_tag LOCUS_26630 <5917 1850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962197.1:T9SS C-terminal target domain-containing protein >Feature sequence301 392 925 gene locus_tag LOCUS_26640 392 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1998 1024 gene locus_tag LOCUS_26650 1998 1024 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_26650 3805 2129 gene locus_tag LOCUS_26660 3805 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26660 4987 3923 gene locus_tag LOCUS_26670 4987 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26670 5755 5198 gene locus_tag LOCUS_26680 5755 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence302 257 54 gene locus_tag LOCUS_26690 257 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 518 327 gene locus_tag LOCUS_26700 518 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 1954 563 gene locus_tag LOCUS_26710 1954 563 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_26710 2331 4022 gene locus_tag LOCUS_26720 2331 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 5753 4227 gene locus_tag LOCUS_26730 5753 4227 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887720.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence303 2512 2036 gene locus_tag LOCUS_26740 2512 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 <5853 2875 gene locus_tag LOCUS_26750 <5853 2875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence304 3868 1829 gene locus_tag LOCUS_26760 3868 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 <5851 4058 gene locus_tag LOCUS_26770 <5851 4058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402900.1:T9SS C-terminal target domain-containing protein >Feature sequence305 779 552 gene locus_tag LOCUS_26780 779 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 1058 2188 gene locus_tag LOCUS_26790 gene tgt 1058 2188 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_26790 2281 3048 gene locus_tag LOCUS_26800 2281 3048 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_26800 3076 4155 gene locus_tag LOCUS_26810 3076 4155 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_26810 4643 4353 gene locus_tag LOCUS_26820 4643 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 <5806 4730 gene locus_tag LOCUS_26830 <5806 4730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XR8:DNA replication and repair protein RecF >Feature sequence306 2906 84 gene locus_tag LOCUS_26840 2906 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 <5787 3181 gene locus_tag LOCUS_26850 <5787 3181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence307 1087 5562 gene locus_tag LOCUS_26860 1087 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence308 <5780 4808 gene locus_tag LOCUS_26870 <5780 4808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943259.1:cell division protein >Feature sequence309 295 1176 gene locus_tag LOCUS_26880 295 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 1593 3698 gene locus_tag LOCUS_26890 1593 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 <5775 3825 gene locus_tag LOCUS_26900 <5775 3825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962197.1:T9SS C-terminal target domain-containing protein >Feature sequence310 1164 2252 gene locus_tag LOCUS_26910 1164 2252 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_26910 2245 2826 gene locus_tag LOCUS_26920 2245 2826 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_26920 3257 2823 gene locus_tag LOCUS_26930 3257 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 4299 3277 gene locus_tag LOCUS_26940 gene murB 4299 3277 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_26940 5556 4327 gene locus_tag LOCUS_26950 5556 4327 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_26950 >Feature sequence311 176 4309 gene locus_tag LOCUS_26960 176 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 4338 5603 gene locus_tag LOCUS_26970 4338 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence312 487 780 gene locus_tag LOCUS_26980 487 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 1089 2426 gene locus_tag LOCUS_26990 1089 2426 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_26990 2649 4454 gene locus_tag LOCUS_27000 2649 4454 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_27000 5544 4444 gene locus_tag LOCUS_27010 gene mtnA 5544 4444 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89VT4 protein_id gnl|my_center|LOCUS_27010 >Feature sequence313 <1 5633 gene locus_tag LOCUS_27020 <1 5633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence314 2416 68 gene locus_tag LOCUS_27030 2416 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 5388 2515 gene locus_tag LOCUS_27040 5388 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence315 1430 471 gene locus_tag LOCUS_27050 1430 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2553 1552 gene locus_tag LOCUS_27060 2553 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3147 2611 gene locus_tag LOCUS_27070 3147 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 3455 3192 gene locus_tag LOCUS_27080 3455 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 3653 4351 gene locus_tag LOCUS_27090 3653 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 5488 4994 gene locus_tag LOCUS_27100 5488 4994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence316 700 284 gene locus_tag LOCUS_27110 700 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 1768 881 gene locus_tag LOCUS_27120 1768 881 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLG6 protein_id gnl|my_center|LOCUS_27120 3044 1932 gene locus_tag LOCUS_27130 3044 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 3573 3079 gene locus_tag LOCUS_27140 3573 3079 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938036.1 protein_id gnl|my_center|LOCUS_27140 4223 3627 gene locus_tag LOCUS_27150 gene mobA 4223 3627 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGH6 protein_id gnl|my_center|LOCUS_27150 5118 4225 gene locus_tag LOCUS_27160 5118 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 >Feature sequence317 340 513 gene locus_tag LOCUS_27170 340 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 774 2687 gene locus_tag LOCUS_27180 774 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2822 3130 gene locus_tag LOCUS_27190 2822 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 3155 4351 gene locus_tag LOCUS_27200 3155 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence318 1046 255 gene locus_tag LOCUS_27210 1046 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 1384 1854 gene locus_tag LOCUS_27220 1384 1854 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107328.1 protein_id gnl|my_center|LOCUS_27220 2208 4154 gene locus_tag LOCUS_27230 2208 4154 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_27230 4212 5495 gene locus_tag LOCUS_27240 4212 5495 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence319 2465 2274 gene locus_tag LOCUS_27250 2465 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2484 3776 gene locus_tag LOCUS_27260 2484 3776 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118182.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence320 876 112 gene locus_tag LOCUS_27270 876 112 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328575.1 protein_id gnl|my_center|LOCUS_27270 2410 881 gene locus_tag LOCUS_27280 2410 881 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557282.1 protein_id gnl|my_center|LOCUS_27280 <5576 2475 gene locus_tag LOCUS_27290 <5576 2475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869176.1:putative selenate reductase subunit YgfK >Feature sequence321 2434 50 gene locus_tag LOCUS_27300 2434 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 2819 3133 gene locus_tag LOCUS_27310 2819 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 4690 3356 gene locus_tag LOCUS_27320 4690 3356 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_27320 5445 4966 gene locus_tag LOCUS_27330 5445 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence322 4205 2118 gene locus_tag LOCUS_27340 4205 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence323 446 1120 gene locus_tag LOCUS_27350 446 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 1404 2819 gene locus_tag LOCUS_27360 1404 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 2832 3266 gene locus_tag LOCUS_27370 2832 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 3271 4587 gene locus_tag LOCUS_27380 3271 4587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 4648 5412 gene locus_tag LOCUS_27390 4648 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence324 <1 897 gene locus_tag LOCUS_27400 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021090.1:polysaccharide biosynthesis protein 906 2108 gene locus_tag LOCUS_27410 906 2108 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_27410 2945 2115 gene locus_tag LOCUS_27420 2945 2115 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454798.1 protein_id gnl|my_center|LOCUS_27420 5281 2969 gene locus_tag LOCUS_27430 gene xdhB 5281 2969 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence325 1264 332 gene locus_tag LOCUS_27440 gene trxB3 1264 332 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q185M7 protein_id gnl|my_center|LOCUS_27440 1621 1274 gene locus_tag LOCUS_27450 1621 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 2015 1668 gene locus_tag LOCUS_27460 2015 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 2335 3003 gene locus_tag LOCUS_27470 2335 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 3857 5368 gene locus_tag LOCUS_27480 gene malT 3857 5368 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence326 1671 739 gene locus_tag LOCUS_27490 gene ribF 1671 739 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_27490 2477 1743 gene locus_tag LOCUS_27500 2477 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 2554 3840 gene locus_tag LOCUS_27510 2554 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 4859 3993 gene locus_tag LOCUS_27520 4859 3993 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460965.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence327 1982 783 gene locus_tag LOCUS_27530 1982 783 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763759.1 protein_id gnl|my_center|LOCUS_27530 3397 2033 gene locus_tag LOCUS_27540 3397 2033 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_27540 5263 3794 gene locus_tag LOCUS_27550 gene metY 5263 3794 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207853.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence328 82 873 gene locus_tag LOCUS_27560 82 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 870 1085 gene locus_tag LOCUS_27570 870 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 1086 3284 gene locus_tag LOCUS_27580 1086 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 3286 3795 gene locus_tag LOCUS_27590 3286 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 3803 5131 gene locus_tag LOCUS_27600 3803 5131 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022343.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence329 1724 2791 gene locus_tag LOCUS_27610 1724 2791 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_27610 2861 3529 gene locus_tag LOCUS_27620 2861 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 5184 4096 gene locus_tag LOCUS_27630 gene mqnC 5184 4096 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT24 protein_id gnl|my_center|LOCUS_27630 >Feature sequence330 289 122 gene locus_tag LOCUS_27640 289 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 288 704 gene locus_tag LOCUS_27650 288 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 725 2212 gene locus_tag LOCUS_27660 gene nrfA 725 2212 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7V7 protein_id gnl|my_center|LOCUS_27660 2230 3483 gene locus_tag LOCUS_27670 2230 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_27670 3606 4889 gene locus_tag LOCUS_27680 3606 4889 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813632.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence331 2804 849 gene locus_tag LOCUS_27690 gene dnaG 2804 849 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P92 protein_id gnl|my_center|LOCUS_27690 4253 2862 gene locus_tag LOCUS_27700 gene fumC 4253 2862 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71384 protein_id gnl|my_center|LOCUS_27700 >Feature sequence332 <1 3070 gene locus_tag LOCUS_27710 <1 3070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005803351.1:multidrug transporter AcrB 3181 4377 gene locus_tag LOCUS_27720 3181 4377 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790620.1 protein_id gnl|my_center|LOCUS_27720 4426 4980 gene locus_tag LOCUS_27730 4426 4980 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_27730 4984 5250 gene locus_tag LOCUS_27740 4984 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 >Feature sequence333 240 791 gene locus_tag LOCUS_27750 240 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 792 962 gene locus_tag LOCUS_27760 792 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 1047 1388 gene locus_tag LOCUS_27770 1047 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2245 1406 gene locus_tag LOCUS_27780 2245 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2907 2263 gene locus_tag LOCUS_27790 2907 2263 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_27790 3220 3522 gene locus_tag LOCUS_27800 3220 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 3519 3896 gene locus_tag LOCUS_27810 3519 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 4164 3967 gene locus_tag LOCUS_27820 4164 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence334 509 940 gene locus_tag LOCUS_27830 509 940 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_27830 1036 2160 gene locus_tag LOCUS_27840 1036 2160 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_27840 2153 2764 gene locus_tag LOCUS_27850 2153 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_27850 2761 3021 gene locus_tag LOCUS_27860 2761 3021 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_27860 3042 4235 gene locus_tag LOCUS_27870 3042 4235 CDS product beta-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964355.1 protein_id gnl|my_center|LOCUS_27870 >Feature sequence335 1 363 gene locus_tag LOCUS_27880 1 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 457 3354 gene locus_tag LOCUS_27890 457 3354 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_27890 >Feature sequence336 3382 659 gene locus_tag LOCUS_27900 3382 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 <5205 3532 gene locus_tag LOCUS_27910 <5205 3532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023163.1:cell surface protein >Feature sequence337 773 1549 gene locus_tag LOCUS_27920 773 1549 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_27920 1641 2672 gene locus_tag LOCUS_27930 1641 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 2705 3466 gene locus_tag LOCUS_27940 2705 3466 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_27940 3874 3482 gene locus_tag LOCUS_27950 3874 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 4906 3890 gene locus_tag LOCUS_27960 4906 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence338 4605 3517 gene locus_tag LOCUS_27970 4605 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 4816 5157 gene locus_tag LOCUS_27980 4816 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence339 >Feature sequence340 <5161 3298 gene locus_tag LOCUS_27990 <5161 3298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence341 417 4949 gene locus_tag LOCUS_28000 417 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence342 415 3411 gene locus_tag LOCUS_28010 415 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 3472 3942 gene locus_tag LOCUS_28020 3472 3942 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876084.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence343 230 523 gene locus_tag LOCUS_28030 230 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 787 2349 gene locus_tag LOCUS_28040 gene rny 787 2349 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZG0 protein_id gnl|my_center|LOCUS_28040 2521 2901 gene locus_tag LOCUS_28050 2521 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_28050 3233 4630 gene locus_tag LOCUS_28060 3233 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence344 >Feature sequence345 113 1747 gene locus_tag LOCUS_28070 113 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 1909 2646 gene locus_tag LOCUS_28080 gene lytR 1909 2646 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921829.1 protein_id gnl|my_center|LOCUS_28080 2919 3527 gene locus_tag LOCUS_28090 gene cysC 2919 3527 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_28090 3552 4457 gene locus_tag LOCUS_28100 gene cysD 3552 4457 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_28100 >Feature sequence346 4984 398 gene locus_tag LOCUS_28110 4984 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence347 1047 895 gene locus_tag LOCUS_28120 1047 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 1449 1051 gene locus_tag LOCUS_28130 1449 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_28130 4326 1501 gene locus_tag LOCUS_28140 4326 1501 CDS product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence348 616 23 gene locus_tag LOCUS_28150 616 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 1341 616 gene locus_tag LOCUS_28160 1341 616 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107904.1 protein_id gnl|my_center|LOCUS_28160 2802 1372 gene locus_tag LOCUS_28170 2802 1372 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_28170 4561 2828 gene locus_tag LOCUS_28180 4561 2828 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence349 <1 566 gene locus_tag LOCUS_28190 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H162:release factor glutamine methyltransferase 577 1041 gene locus_tag LOCUS_28200 577 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784379.1 protein_id gnl|my_center|LOCUS_28200 2556 1135 gene locus_tag LOCUS_28210 2556 1135 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_28210 2819 3052 gene locus_tag LOCUS_28220 2819 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 3055 3405 gene locus_tag LOCUS_28230 3055 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 4198 4821 gene locus_tag LOCUS_28240 4198 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence350 1331 462 gene locus_tag LOCUS_28250 gene ispH 1331 462 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 protein_id gnl|my_center|LOCUS_28250 2040 1345 gene locus_tag LOCUS_28260 gene cmk 2040 1345 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU2 protein_id gnl|my_center|LOCUS_28260 3520 2150 gene locus_tag LOCUS_28270 3520 2150 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y98 protein_id gnl|my_center|LOCUS_28270 4341 3517 gene locus_tag LOCUS_28280 gene rsmA 4341 3517 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0H8 protein_id gnl|my_center|LOCUS_28280 >Feature sequence351 337 852 gene locus_tag LOCUS_28290 337 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 950 2653 gene locus_tag LOCUS_28300 950 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2746 3633 gene locus_tag LOCUS_28310 2746 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 3786 4511 gene locus_tag LOCUS_28320 3786 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 >Feature sequence352 <4746 3821 gene locus_tag LOCUS_28330 <4746 3821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402900.1:T9SS C-terminal target domain-containing protein >Feature sequence353 189 1091 gene locus_tag LOCUS_28340 189 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 1088 2218 gene locus_tag LOCUS_28350 1088 2218 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 protein_id gnl|my_center|LOCUS_28350 2275 3792 gene locus_tag LOCUS_28360 2275 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_28360 3809 4510 gene locus_tag LOCUS_28370 3809 4510 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_28370 >Feature sequence354 184 576 gene locus_tag LOCUS_28380 184 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 610 1530 gene locus_tag LOCUS_28390 610 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 2962 1904 gene locus_tag LOCUS_28400 2962 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 3857 3681 gene locus_tag LOCUS_28410 3857 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 4336 3872 gene locus_tag LOCUS_28420 4336 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence355 530 2005 gene locus_tag LOCUS_28430 530 2005 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_28430 3124 2114 gene locus_tag LOCUS_28440 3124 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763527.1 protein_id gnl|my_center|LOCUS_28440 >Feature sequence356 <1 1123 gene locus_tag LOCUS_28450 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108484.1:membrane protein 1354 3066 gene locus_tag LOCUS_28460 gene ogt 1354 3066 CDS product O-GlcNAc transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_28460 >Feature sequence357 395 1126 gene locus_tag LOCUS_28470 gene gldF 395 1126 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_28470 1372 1178 gene locus_tag LOCUS_28480 1372 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 2171 1581 gene locus_tag LOCUS_28490 2171 1581 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence358 241 3186 gene locus_tag LOCUS_28500 241 3186 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5D7 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28500 >Feature sequence359 1780 3531 gene locus_tag LOCUS_28510 1780 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 3993 3592 gene locus_tag LOCUS_28520 3993 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 <4585 4082 gene locus_tag LOCUS_28530 <4585 4082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389562.1:RNA polymerase subunit sigma-24 >Feature sequence360 2510 141 gene locus_tag LOCUS_28540 2510 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 4468 2615 gene locus_tag LOCUS_28550 4468 2615 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence361 302 2359 gene locus_tag LOCUS_28560 gene htpG 302 2359 CDS product chaperone protein htpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CJ84 protein_id gnl|my_center|LOCUS_28560 <4569 2452 gene locus_tag LOCUS_28570 <4569 2452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963937.1:T9SS C-terminal target domain-containing protein >Feature sequence362 2157 1195 gene locus_tag LOCUS_28580 2157 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 3446 2160 gene locus_tag LOCUS_28590 3446 2160 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence363 786 223 gene locus_tag LOCUS_28600 786 223 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28600 1834 1430 gene locus_tag LOCUS_28610 1834 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 >Feature sequence364 2853 3701 gene locus_tag LOCUS_28620 2853 3701 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979021.1 protein_id gnl|my_center|LOCUS_28620 3914 4252 gene locus_tag LOCUS_28630 3914 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877543.1 protein_id gnl|my_center|LOCUS_28630 >Feature sequence365 4350 3955 gene locus_tag LOCUS_28640 4350 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence366 2869 98 gene locus_tag LOCUS_28650 2869 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 3063 4277 gene locus_tag LOCUS_28660 3063 4277 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_28660 >Feature sequence367 <1 1074 gene locus_tag LOCUS_28670 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582994.1:CRISPR-associated helicase/endonuclease Cas3 1125 1913 gene locus_tag LOCUS_28680 1125 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 2257 2679 gene locus_tag LOCUS_28690 2257 2679 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_28690 2828 3832 gene locus_tag LOCUS_28700 gene cas1 2828 3832 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T86 protein_id gnl|my_center|LOCUS_28700 3848 4111 gene locus_tag LOCUS_28710 gene cas2 3848 4111 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T87 protein_id gnl|my_center|LOCUS_28710 >Feature sequence368 574 212 gene locus_tag LOCUS_28720 574 212 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_28720 1104 658 gene locus_tag LOCUS_28730 1104 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3882 1426 gene locus_tag LOCUS_28740 3882 1426 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_28740 >Feature sequence369 273 446 gene locus_tag LOCUS_28750 273 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 505 1443 gene locus_tag LOCUS_28760 505 1443 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223904.1 protein_id gnl|my_center|LOCUS_28760 1865 4066 gene locus_tag LOCUS_28770 1865 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109271.1 protein_id gnl|my_center|LOCUS_28770 >Feature sequence370 1266 31 gene locus_tag LOCUS_28780 1266 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 3868 1283 gene locus_tag LOCUS_28790 3868 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 4308 3865 gene locus_tag LOCUS_28800 4308 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence371 295 1026 gene locus_tag LOCUS_28810 295 1026 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276400.1 protein_id gnl|my_center|LOCUS_28810 1552 2040 gene locus_tag LOCUS_28820 1552 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence372 100 1245 gene locus_tag LOCUS_28830 100 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_28830 1248 2087 gene locus_tag LOCUS_28840 1248 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 2301 3701 gene locus_tag LOCUS_28850 2301 3701 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence373 1313 3124 gene locus_tag LOCUS_28860 1313 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence374 380 2521 gene locus_tag LOCUS_28870 380 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 2533 3132 gene locus_tag LOCUS_28880 2533 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 <4299 3475 gene locus_tag LOCUS_28890 <4299 3475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404651.1:DNA-binding protein >Feature sequence375 <1 993 gene locus_tag LOCUS_28900 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:oxidoreductase 2347 1097 gene locus_tag LOCUS_28910 2347 1097 CDS product serpin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405065.1 protein_id gnl|my_center|LOCUS_28910 3253 2672 gene locus_tag LOCUS_28920 3253 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3429 3845 gene locus_tag LOCUS_28930 3429 3845 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_28930 >Feature sequence376 519 1037 gene locus_tag LOCUS_28940 519 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 1197 2657 gene locus_tag LOCUS_28950 1197 2657 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_28950 2775 3971 gene locus_tag LOCUS_28960 2775 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 >Feature sequence377 975 2162 gene locus_tag LOCUS_28970 975 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 3740 2133 gene locus_tag LOCUS_28980 3740 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 3951 3751 gene locus_tag LOCUS_28990 3951 3751 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence378 3182 2997 gene locus_tag LOCUS_29000 3182 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 3360 3172 gene locus_tag LOCUS_29010 3360 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 >Feature sequence379 1886 147 gene locus_tag LOCUS_29020 1886 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 2962 1868 gene locus_tag LOCUS_29030 2962 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_29030 3753 3238 gene locus_tag LOCUS_29040 3753 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence380 286 558 gene locus_tag LOCUS_29050 286 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 555 971 gene locus_tag LOCUS_29060 555 971 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence381 71 607 gene locus_tag LOCUS_29070 71 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 873 1502 gene locus_tag LOCUS_29080 873 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 1592 2020 gene locus_tag LOCUS_29090 1592 2020 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_29090 2096 2458 gene locus_tag LOCUS_29100 2096 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108936.1 protein_id gnl|my_center|LOCUS_29100 2511 3422 gene locus_tag LOCUS_29110 gene queG 2511 3422 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_29110 3699 3448 gene locus_tag LOCUS_29120 3699 3448 CDS product translation repressor RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971059.1 protein_id gnl|my_center|LOCUS_29120 3893 3696 gene locus_tag LOCUS_29130 3893 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 >Feature sequence382 <4058 507 gene locus_tag LOCUS_29140 <4058 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085984875.1:cell surface protein >Feature sequence383 >Feature sequence384 945 55 gene locus_tag LOCUS_29150 945 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 1435 977 gene locus_tag LOCUS_29160 1435 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 2739 1456 gene locus_tag LOCUS_29170 2739 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 3845 3096 gene locus_tag LOCUS_29180 3845 3096 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_29180 >Feature sequence385 37 3180 gene locus_tag LOCUS_29190 37 3180 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_29190 3243 3920 gene locus_tag LOCUS_29200 3243 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence386 <4013 667 gene locus_tag LOCUS_29210 <4013 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107787.1:hybrid sensor histidine kinase/response regulator >Feature sequence387 3013 1733 gene locus_tag LOCUS_29220 3013 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 3383 3081 gene locus_tag LOCUS_29230 3383 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 3613 3380 gene locus_tag LOCUS_29240 3613 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence388 3819 1156 gene locus_tag LOCUS_29250 3819 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence389 2326 365 gene locus_tag LOCUS_29260 2326 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 2748 2341 gene locus_tag LOCUS_29270 2748 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 3473 2748 gene locus_tag LOCUS_29280 3473 2748 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021473.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence390 >Feature sequence391 838 1653 gene locus_tag LOCUS_29290 838 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1730 3544 gene locus_tag LOCUS_29300 1730 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 >Feature sequence392 1031 117 gene locus_tag LOCUS_29310 1031 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 2651 1041 gene locus_tag LOCUS_29320 2651 1041 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963679.1 protein_id gnl|my_center|LOCUS_29320 <3973 2638 gene locus_tag LOCUS_29330 <3973 2638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963680.1:adenine methyltransferase >Feature sequence393 77 460 gene locus_tag LOCUS_29340 77 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 460 909 gene locus_tag LOCUS_29350 460 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 906 2762 gene locus_tag LOCUS_29360 906 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530178.1 protein_id gnl|my_center|LOCUS_29360 2775 3803 gene locus_tag LOCUS_29370 2775 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721366.1 protein_id gnl|my_center|LOCUS_29370 >Feature sequence394 1036 116 gene locus_tag LOCUS_29380 gene yrbG 1036 116 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_29380 2024 1023 gene locus_tag LOCUS_29390 2024 1023 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_29390 2324 2055 gene locus_tag LOCUS_29400 2324 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence395 691 2160 gene locus_tag LOCUS_29410 691 2160 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803769.1 protein_id gnl|my_center|LOCUS_29410 2166 3698 gene locus_tag LOCUS_29420 2166 3698 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_29420 >Feature sequence396 3859 3530 gene locus_tag LOCUS_29430 3859 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 >Feature sequence397 <1 3371 gene locus_tag LOCUS_29440 <1 3371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962421.1:type II endonuclease-methyltransferasefusion protein >Feature sequence398 1705 641 gene locus_tag LOCUS_29450 1705 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 <3904 1905 gene locus_tag LOCUS_29460 <3904 1905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence399 921 451 gene locus_tag LOCUS_29470 921 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 1501 1346 gene locus_tag LOCUS_29480 1501 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 2034 1498 gene locus_tag LOCUS_29490 2034 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 3417 2416 gene locus_tag LOCUS_29500 3417 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 >Feature sequence400 46 996 gene locus_tag LOCUS_29510 46 996 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_29510 987 1430 gene locus_tag LOCUS_29520 987 1430 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP6 protein_id gnl|my_center|LOCUS_29520 3337 1496 gene locus_tag LOCUS_29530 gene parE 3337 1496 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_29530 >Feature sequence401 1675 1532 gene locus_tag LOCUS_29540 1675 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2063 1680 gene locus_tag LOCUS_29550 2063 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2652 2266 gene locus_tag LOCUS_29560 2652 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 3664 2837 gene locus_tag LOCUS_29570 3664 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence402 543 3446 gene locus_tag LOCUS_29580 543 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 >Feature sequence403 1364 114 gene locus_tag LOCUS_29590 1364 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_29590 2242 1466 gene locus_tag LOCUS_29600 2242 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_29600 2824 2477 gene locus_tag LOCUS_29610 2824 2477 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_29610 <3848 2936 gene locus_tag LOCUS_29620 <3848 2936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014208107.1:RND transporter >Feature sequence404 2412 1399 gene locus_tag LOCUS_29630 2412 1399 CDS product protein NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706568.1 protein_id gnl|my_center|LOCUS_29630 2976 2443 gene locus_tag LOCUS_29640 2976 2443 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_29640 <3842 2973 gene locus_tag LOCUS_29650 <3842 2973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546592.1:nitrate reductase >Feature sequence405 >Feature sequence406 1389 883 gene locus_tag LOCUS_29660 1389 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 2384 1473 gene locus_tag LOCUS_29670 gene lpxD 2384 1473 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZED3 protein_id gnl|my_center|LOCUS_29670 3081 2377 gene locus_tag LOCUS_29680 3081 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 <3799 3096 gene locus_tag LOCUS_29690 <3799 3096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003119728.1:LPS biosynthesis protein WbpG >Feature sequence407 330 1379 gene locus_tag LOCUS_29700 330 1379 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_29700 1451 2503 gene locus_tag LOCUS_29710 1451 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence408 1427 204 gene locus_tag LOCUS_29720 1427 204 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_29720 1563 2039 gene locus_tag LOCUS_29730 1563 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 2171 2245 gene locus_tag LOCUS_t00320 2171 2245 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2733 2470 gene locus_tag LOCUS_29740 2733 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 3198 2836 gene locus_tag LOCUS_29750 3198 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence409 <1 1354 gene locus_tag LOCUS_29760 <1 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261604.1:serine hydrolase 1839 2702 gene locus_tag LOCUS_29770 1839 2702 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020826.1 protein_id gnl|my_center|LOCUS_29770 >Feature sequence410 888 49 gene locus_tag LOCUS_29780 888 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 <3686 965 gene locus_tag LOCUS_29790 <3686 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883927.1:DNA methyltransferase >Feature sequence411 1287 655 gene locus_tag LOCUS_29800 1287 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 2593 1817 gene locus_tag LOCUS_29810 2593 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 >Feature sequence412 2532 1744 gene locus_tag LOCUS_29820 2532 1744 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761475.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence413 <1 1380 gene locus_tag LOCUS_29830 <1 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962454.1:peptidase M36 <3598 1437 gene locus_tag LOCUS_29840 <3598 1437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KD17:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence414 >Feature sequence415 1420 731 gene locus_tag LOCUS_29850 1420 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 1731 1438 gene locus_tag LOCUS_29860 1731 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 2963 1734 gene locus_tag LOCUS_29870 2963 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 >Feature sequence416 <1 1557 gene locus_tag LOCUS_29880 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SH19:3-isopropylmalate dehydratase large subunit 1618 3396 gene locus_tag LOCUS_29890 1618 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 >Feature sequence417 1795 1043 gene locus_tag LOCUS_29900 1795 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 >Feature sequence418 409 1347 gene locus_tag LOCUS_29910 gene rsgA2 409 1347 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I9 protein_id gnl|my_center|LOCUS_29910 >Feature sequence419 1495 917 gene locus_tag LOCUS_29920 1495 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 1910 1488 gene locus_tag LOCUS_29930 1910 1488 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_29930 2264 3340 gene locus_tag LOCUS_29940 2264 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence420 2622 2170 gene locus_tag LOCUS_29950 2622 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 >Feature sequence421 1622 99 gene locus_tag LOCUS_29960 gene gltX 1622 99 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A455 protein_id gnl|my_center|LOCUS_29960 2283 1912 gene locus_tag LOCUS_29970 2283 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 2375 2737 gene locus_tag LOCUS_29980 2375 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 2744 3145 gene locus_tag LOCUS_29990 2744 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 >Feature sequence422 136 2742 gene locus_tag LOCUS_30000 gene sprE 136 2742 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_30000 2820 3254 gene locus_tag LOCUS_30010 2820 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002249008.2 protein_id gnl|my_center|LOCUS_30010 >Feature sequence423 389 87 gene locus_tag LOCUS_30020 389 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 695 931 gene locus_tag LOCUS_30030 gene acpP 695 931 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_30030 955 2208 gene locus_tag LOCUS_30040 955 2208 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV8 protein_id gnl|my_center|LOCUS_30040 2353 3054 gene locus_tag LOCUS_30050 gene rnc 2353 3054 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E8 protein_id gnl|my_center|LOCUS_30050 >Feature sequence424 70 1368 gene locus_tag LOCUS_30060 gene rimO 70 1368 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK5 protein_id gnl|my_center|LOCUS_30060 2181 1489 gene locus_tag LOCUS_30070 2181 1489 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_30070 3184 2258 gene locus_tag LOCUS_30080 3184 2258 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_30080 >Feature sequence425 1524 1222 gene locus_tag LOCUS_30090 1524 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 2749 1967 gene locus_tag LOCUS_30100 2749 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 3354 2743 gene locus_tag LOCUS_30110 3354 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence426 506 1786 gene locus_tag LOCUS_30120 gene arsA 506 1786 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_30120 2243 3073 gene locus_tag LOCUS_30130 gene lgt 2243 3073 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG9 protein_id gnl|my_center|LOCUS_30130 >Feature sequence427 1133 2011 gene locus_tag LOCUS_30140 1133 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 1993 3207 gene locus_tag LOCUS_30150 1993 3207 CDS product putative transposase y4qJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55631 protein_id gnl|my_center|LOCUS_30150 >Feature sequence428 170 1828 gene locus_tag LOCUS_30160 170 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 2359 2544 gene locus_tag LOCUS_30170 2359 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 2566 2814 gene locus_tag LOCUS_30180 gene parD-1 2566 2814 CDS product antitoxin ParD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 protein_id gnl|my_center|LOCUS_30180 2807 3106 gene locus_tag LOCUS_30190 gene parE-1 2807 3106 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 protein_id gnl|my_center|LOCUS_30190 >Feature sequence429 <1 764 gene locus_tag LOCUS_30200 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108721.1:sensor histidine kinase 1028 1282 gene locus_tag LOCUS_30210 1028 1282 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964534.1 protein_id gnl|my_center|LOCUS_30210 1279 1536 gene locus_tag LOCUS_30220 1279 1536 CDS product toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_30220 1574 2152 gene locus_tag LOCUS_30230 1574 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 2472 3296 gene locus_tag LOCUS_30240 2472 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence430 >Feature sequence431 185 550 gene locus_tag LOCUS_30250 185 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 711 2222 gene locus_tag LOCUS_30260 gene pafA 711 2222 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_30260 2259 3086 gene locus_tag LOCUS_30270 2259 3086 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_30270 >Feature sequence432 2137 2976 gene locus_tag LOCUS_30280 2137 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence433 <1 3221 gene locus_tag LOCUS_30290 <1 3221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761136.1:phosphoenolpyruvate synthase >Feature sequence434 1100 87 gene locus_tag LOCUS_30300 1100 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 2743 1154 gene locus_tag LOCUS_30310 2743 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence435 945 592 gene locus_tag LOCUS_30320 945 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 1326 1042 gene locus_tag LOCUS_30330 1326 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 2379 1453 gene locus_tag LOCUS_30340 2379 1453 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361993.1 protein_id gnl|my_center|LOCUS_30340 2696 3250 gene locus_tag LOCUS_30350 2696 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 >Feature sequence436 200 880 gene locus_tag LOCUS_30360 200 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 1835 957 gene locus_tag LOCUS_30370 1835 957 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24918 protein_id gnl|my_center|LOCUS_30370 2368 1841 gene locus_tag LOCUS_30380 2368 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 3114 2443 gene locus_tag LOCUS_30390 3114 2443 CDS product type II restriction endonuclease MboI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788527.1 protein_id gnl|my_center|LOCUS_30390 >Feature sequence437 >Feature sequence438 269 2509 gene locus_tag LOCUS_30400 269 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence439 1286 447 gene locus_tag LOCUS_30410 1286 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879799.1 protein_id gnl|my_center|LOCUS_30410 2153 1302 gene locus_tag LOCUS_30420 2153 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 <3211 2155 gene locus_tag LOCUS_30430 <3211 2155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963532.1:O-acyltransferase >Feature sequence440 774 1913 gene locus_tag LOCUS_30440 774 1913 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_30440 2030 3049 gene locus_tag LOCUS_30450 gene recA 2030 3049 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_30450 >Feature sequence441 >Feature sequence442 1243 359 gene locus_tag LOCUS_30460 1243 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459264.1 protein_id gnl|my_center|LOCUS_30460 <3185 1233 gene locus_tag LOCUS_30470 <3185 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962444.1:ABC transporter substrate-binding protein >Feature sequence443 1059 370 gene locus_tag LOCUS_30480 1059 370 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_30480 2545 1046 gene locus_tag LOCUS_30490 2545 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 >Feature sequence444 1211 48 gene locus_tag LOCUS_30500 1211 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 1595 1293 gene locus_tag LOCUS_30510 1595 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 2448 1843 gene locus_tag LOCUS_30520 2448 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3020 2394 gene locus_tag LOCUS_30530 3020 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 >Feature sequence445 282 1445 gene locus_tag LOCUS_30540 gene capB 282 1445 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_30540 1438 1890 gene locus_tag LOCUS_30550 gene capC 1438 1890 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_30550 1939 3093 gene locus_tag LOCUS_30560 1939 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 >Feature sequence446 458 970 gene locus_tag LOCUS_30570 458 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 1065 2672 gene locus_tag LOCUS_30580 gene gldM 1065 2672 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_30580 >Feature sequence447 488 1582 gene locus_tag LOCUS_30590 488 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021093.1 protein_id gnl|my_center|LOCUS_30590 1583 2758 gene locus_tag LOCUS_30600 1583 2758 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence448 504 926 gene locus_tag LOCUS_30610 504 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 1842 1126 gene locus_tag LOCUS_30620 1842 1126 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_30620 2984 1839 gene locus_tag LOCUS_30630 2984 1839 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107986.1 protein_id gnl|my_center|LOCUS_30630 >Feature sequence449 680 2557 gene locus_tag LOCUS_30640 gene glaA 680 2557 CDS product alpha-1,3-galactosidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MU6 protein_id gnl|my_center|LOCUS_30640 >Feature sequence450 794 1825 gene locus_tag LOCUS_30650 794 1825 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_30650 1832 2809 gene locus_tag LOCUS_30660 gene ddl 1832 2809 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z37 protein_id gnl|my_center|LOCUS_30660 >Feature sequence451 <1 1618 gene locus_tag LOCUS_30670 <1 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402900.1:T9SS C-terminal target domain-containing protein 1913 2143 gene locus_tag LOCUS_30680 1913 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 2154 2351 gene locus_tag LOCUS_30690 2154 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 2324 2638 gene locus_tag LOCUS_30700 2324 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence452 631 254 gene locus_tag LOCUS_30710 631 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence453 302 1669 gene locus_tag LOCUS_30720 302 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1659 2921 gene locus_tag LOCUS_30730 1659 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence454 1034 426 gene locus_tag LOCUS_30740 1034 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 1819 1334 gene locus_tag LOCUS_30750 1819 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 2556 2137 gene locus_tag LOCUS_30760 2556 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence455 >Feature sequence456 2474 327 gene locus_tag LOCUS_30770 2474 327 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_30770 >Feature sequence457 264 698 gene locus_tag LOCUS_30780 264 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence458 1806 874 gene locus_tag LOCUS_30790 1806 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 2859 2167 gene locus_tag LOCUS_30800 2859 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 >Feature sequence459 <1 651 gene locus_tag LOCUS_30810 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966347.1:glycosyl transferase 678 1289 gene locus_tag LOCUS_30820 678 1289 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202967.1 protein_id gnl|my_center|LOCUS_30820 1585 2775 gene locus_tag LOCUS_30830 1585 2775 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence460 476 1255 gene locus_tag LOCUS_30840 476 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 1266 1880 gene locus_tag LOCUS_30850 1266 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 >Feature sequence461 >Feature sequence462 <1 575 gene locus_tag LOCUS_30860 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962267.1:glycosyl hydrolase 1794 604 gene locus_tag LOCUS_30870 1794 604 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047945.1 protein_id gnl|my_center|LOCUS_30870 2256 2660 gene locus_tag LOCUS_30880 2256 2660 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583901.1 protein_id gnl|my_center|LOCUS_30880 >Feature sequence463 474 1745 gene locus_tag LOCUS_30890 474 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 2136 2399 gene locus_tag LOCUS_30900 2136 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 >Feature sequence464 372 1277 gene locus_tag LOCUS_30910 372 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 <2895 1360 gene locus_tag LOCUS_30920 <2895 1360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105890.1:RTX toxin >Feature sequence465 <1 739 gene locus_tag LOCUS_30930 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0U7:ATP-dependent DNA helicase RecG 802 1284 gene locus_tag LOCUS_30940 802 1284 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 protein_id gnl|my_center|LOCUS_30940 2510 1344 gene locus_tag LOCUS_30950 2510 1344 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108671.1 protein_id gnl|my_center|LOCUS_30950 >Feature sequence466 1295 75 gene locus_tag LOCUS_30960 1295 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 2292 1381 gene locus_tag LOCUS_30970 2292 1381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_30970 >Feature sequence467 2 640 gene locus_tag LOCUS_30980 2 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence468 95 991 gene locus_tag LOCUS_30990 95 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 975 1370 gene locus_tag LOCUS_31000 975 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence469 <2837 713 gene locus_tag LOCUS_31010 <2837 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase >Feature sequence470 >Feature sequence471 1989 391 gene locus_tag LOCUS_31020 1989 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 >Feature sequence472 >Feature sequence473 2524 1793 gene locus_tag LOCUS_31030 2524 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence474 128 535 gene locus_tag LOCUS_31040 128 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 550 705 gene locus_tag LOCUS_31050 550 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 718 1899 gene locus_tag LOCUS_31060 718 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 >Feature sequence475 181 2604 gene locus_tag LOCUS_31070 181 2604 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_31070 >Feature sequence476 2251 326 gene locus_tag LOCUS_31080 2251 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 >Feature sequence477 >Feature sequence478 1770 601 gene locus_tag LOCUS_31090 1770 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 2484 1951 gene locus_tag LOCUS_31100 2484 1951 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_31100 >Feature sequence479 >Feature sequence480 >Feature sequence481 170 1903 gene locus_tag LOCUS_31110 170 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 1913 2503 gene locus_tag LOCUS_31120 1913 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence482 972 2246 gene locus_tag LOCUS_31130 972 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 2661 2362 gene locus_tag LOCUS_31140 2661 2362 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_31140 >Feature sequence483 950 2422 gene locus_tag LOCUS_31150 950 2422 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_31150 >Feature sequence484 2264 450 gene locus_tag LOCUS_31160 2264 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974286.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence485 801 241 gene locus_tag LOCUS_31170 801 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 2603 1011 gene locus_tag LOCUS_31180 2603 1011 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_31180 >Feature sequence486 <1 1868 gene locus_tag LOCUS_31190 <1 1868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202950.1:sensor histidine kinase 2214 2023 gene locus_tag LOCUS_31200 2214 2023 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_31200 2645 2481 gene locus_tag LOCUS_31210 2645 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence487 1838 90 gene locus_tag LOCUS_31220 1838 90 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108748.1 protein_id gnl|my_center|LOCUS_31220 2359 2114 gene locus_tag LOCUS_31230 2359 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 >Feature sequence488 1463 207 gene locus_tag LOCUS_31240 1463 207 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993821.1 protein_id gnl|my_center|LOCUS_31240 2531 1527 gene locus_tag LOCUS_31250 2531 1527 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence489 44 667 gene locus_tag LOCUS_31260 44 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence490 <1 970 gene locus_tag LOCUS_31270 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202225.1:membrane protein 1070 2077 gene locus_tag LOCUS_31280 1070 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 >Feature sequence491 <1 634 gene locus_tag LOCUS_31290 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761972.1:uracil phosphoribosyltransferase >Feature sequence492 <2615 269 gene locus_tag LOCUS_31300 <2615 269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein >Feature sequence493 >Feature sequence494 2347 1649 gene locus_tag LOCUS_31310 2347 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 >Feature sequence495 961 1371 gene locus_tag LOCUS_31320 961 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 2528 1770 gene locus_tag LOCUS_31330 2528 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 >Feature sequence496 201 959 gene locus_tag LOCUS_31340 201 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 1365 1072 gene locus_tag LOCUS_31350 1365 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 1550 1413 gene locus_tag LOCUS_31360 1550 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 2344 1547 gene locus_tag LOCUS_31370 2344 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence497 <1 2550 gene locus_tag LOCUS_31380 <1 2550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107334.1:peptidase M23 >Feature sequence498 2411 243 gene locus_tag LOCUS_31390 2411 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 >Feature sequence499 <1 562 gene locus_tag LOCUS_31400 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64R17:UvrABC system protein A 723 2063 gene locus_tag LOCUS_31410 gene gdhA 723 2063 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_31410 >Feature sequence500 1860 1426 gene locus_tag LOCUS_31420 1860 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence501 674 2392 gene locus_tag LOCUS_31430 674 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 >Feature sequence502 1031 519 gene locus_tag LOCUS_31440 1031 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963109.1 protein_id gnl|my_center|LOCUS_31440 1480 1091 gene locus_tag LOCUS_31450 1480 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 >Feature sequence503 223 537 gene locus_tag LOCUS_31460 223 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 663 1097 gene locus_tag LOCUS_31470 663 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 >Feature sequence504 215 78 gene locus_tag LOCUS_31480 215 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2318 465 gene locus_tag LOCUS_31490 2318 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence505 1388 2506 gene locus_tag LOCUS_31500 1388 2506 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202397.1 protein_id gnl|my_center|LOCUS_31500 >Feature sequence506 542 2458 gene locus_tag LOCUS_31510 542 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 >Feature sequence507 743 201 gene locus_tag LOCUS_31520 743 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 1935 745 gene locus_tag LOCUS_31530 1935 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_31530 >Feature sequence508 <1 1866 gene locus_tag LOCUS_31540 <1 1866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence509 269 601 gene locus_tag LOCUS_31550 269 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 619 921 gene locus_tag LOCUS_31560 619 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 926 1168 gene locus_tag LOCUS_31570 926 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 1510 1908 gene locus_tag LOCUS_31580 1510 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 1901 2101 gene locus_tag LOCUS_31590 1901 2101 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879124.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence510 1594 113 gene locus_tag LOCUS_31600 1594 113 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947783.1 protein_id gnl|my_center|LOCUS_31600 >Feature sequence511 811 1749 gene locus_tag LOCUS_31610 811 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_31610 1758 2372 gene locus_tag LOCUS_31620 1758 2372 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence512 2148 397 gene locus_tag LOCUS_31630 2148 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence513 2079 589 gene locus_tag LOCUS_31640 2079 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence514 662 180 gene locus_tag LOCUS_31650 662 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 1304 837 gene locus_tag LOCUS_31660 1304 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence515 2267 600 gene locus_tag LOCUS_31670 2267 600 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228000.1 protein_id gnl|my_center|LOCUS_31670 >Feature sequence516 1472 264 gene locus_tag LOCUS_31680 1472 264 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888209.1 protein_id gnl|my_center|LOCUS_31680 2161 1460 gene locus_tag LOCUS_31690 2161 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence517 572 1078 gene locus_tag LOCUS_31700 572 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence518 >Feature sequence519 307 993 gene locus_tag LOCUS_31710 307 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 1271 2113 gene locus_tag LOCUS_31720 1271 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence520 1168 266 gene locus_tag LOCUS_31730 1168 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_31730 1787 1539 gene locus_tag LOCUS_31740 1787 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 >Feature sequence521 <1 519 gene locus_tag LOCUS_31750 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963075.1:TetR family transcriptional regulator 528 866 gene locus_tag LOCUS_31760 528 866 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence522 1805 513 gene locus_tag LOCUS_31770 1805 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence523 >Feature sequence524 >Feature sequence525 584 57 gene locus_tag LOCUS_31780 584 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 796 662 gene locus_tag LOCUS_31790 796 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 2157 901 gene locus_tag LOCUS_31800 2157 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 >Feature sequence526 >Feature sequence527 <1 1759 gene locus_tag LOCUS_31810 <1 1759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence528 94 867 gene locus_tag LOCUS_31820 94 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 872 2068 gene locus_tag LOCUS_31830 872 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 >Feature sequence529 88 1188 gene locus_tag LOCUS_31840 88 1188 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861873.1 protein_id gnl|my_center|LOCUS_31840 1437 1703 gene locus_tag LOCUS_31850 1437 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 1762 2157 gene locus_tag LOCUS_31860 1762 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 >Feature sequence530 1929 1138 gene locus_tag LOCUS_31870 1929 1138 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_31870 >Feature sequence531 >Feature sequence532 1670 444 gene locus_tag LOCUS_31880 1670 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence533 671 1012 gene locus_tag LOCUS_31890 671 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31890 1500 1805 gene locus_tag LOCUS_31900 1500 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence534 <1 1212 gene locus_tag LOCUS_31910 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764493.1:alpha-amylase <2304 1269 gene locus_tag LOCUS_31920 <2304 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402900.1:T9SS C-terminal target domain-containing protein >Feature sequence535 212 1342 gene locus_tag LOCUS_31930 212 1342 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202397.1 protein_id gnl|my_center|LOCUS_31930 1670 2023 gene locus_tag LOCUS_31940 1670 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 >Feature sequence536 968 1600 gene locus_tag LOCUS_31950 968 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 1764 2273 gene locus_tag LOCUS_31960 1764 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence537 619 1197 gene locus_tag LOCUS_31970 619 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 1133 1312 gene locus_tag LOCUS_31980 1133 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 >Feature sequence538 >Feature sequence539 934 2031 gene locus_tag LOCUS_31990 gene mqnC-2 934 2031 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G11 protein_id gnl|my_center|LOCUS_31990 >Feature sequence540 >Feature sequence541 150 1190 gene locus_tag LOCUS_32000 150 1190 CDS product perosamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957833.1 protein_id gnl|my_center|LOCUS_32000 1192 2145 gene locus_tag LOCUS_32010 1192 2145 CDS product NDP-sugar dehydratase or epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_32010 >Feature sequence542 >Feature sequence543 24 401 gene locus_tag LOCUS_32020 24 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 540 1703 gene locus_tag LOCUS_32030 540 1703 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_32030 1788 2153 gene locus_tag LOCUS_32040 1788 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 >Feature sequence544 1817 1035 gene locus_tag LOCUS_32050 1817 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 >Feature sequence545 908 1138 gene locus_tag LOCUS_32060 908 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 1145 1384 gene locus_tag LOCUS_32070 1145 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_32070 1362 1625 gene locus_tag LOCUS_32080 1362 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 1663 1914 gene locus_tag LOCUS_32090 1663 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 >Feature sequence546 2154 412 gene locus_tag LOCUS_32100 2154 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 >Feature sequence547 2007 1372 gene locus_tag LOCUS_32110 2007 1372 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PF3 protein_id gnl|my_center|LOCUS_32110 >Feature sequence548 >Feature sequence549 1309 692 gene locus_tag LOCUS_32120 gene wecD 1309 692 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_32120 <2162 1302 gene locus_tag LOCUS_32130 <2162 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0P8T1:N,N'-diacetyllegionaminic acid synthase >Feature sequence550 164 1303 gene locus_tag LOCUS_32140 164 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 1308 1814 gene locus_tag LOCUS_32150 1308 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence551 942 1136 gene locus_tag LOCUS_32160 942 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 1810 1340 gene locus_tag LOCUS_32170 1810 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_32170 >Feature sequence552 >Feature sequence553 >Feature sequence554 1745 1945 gene locus_tag LOCUS_32180 1745 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 >Feature sequence555 777 127 gene locus_tag LOCUS_32190 777 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 1905 985 gene locus_tag LOCUS_32200 1905 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence556 1100 966 gene locus_tag LOCUS_32210 1100 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence557 >Feature sequence558 376 1851 gene locus_tag LOCUS_32220 376 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence559 1282 512 gene locus_tag LOCUS_32230 1282 512 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_32230 1838 1302 gene locus_tag LOCUS_32240 1838 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_32240 >Feature sequence560 1570 77 gene locus_tag LOCUS_32250 1570 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 >Feature sequence561 >Feature sequence562 >Feature sequence563 1772 228 gene locus_tag LOCUS_32260 1772 228 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_32260 >Feature sequence564 1756 107 gene locus_tag LOCUS_32270 1756 107 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_32270 >Feature sequence565 1174 1881 gene locus_tag LOCUS_32280 1174 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 >Feature sequence566 >Feature sequence567 >Feature sequence568 193 885 gene locus_tag LOCUS_32290 193 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 1322 1594 gene locus_tag LOCUS_32300 1322 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 >Feature sequence569 275 1303 gene locus_tag LOCUS_32310 275 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 >Feature sequence570 <1 1846 gene locus_tag LOCUS_32320 <1 1846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459240.1:transposase >Feature sequence571 >Feature sequence572 410 1558 gene locus_tag LOCUS_32330 410 1558 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_32330 >Feature sequence573 >Feature sequence574 >Feature sequence575 1316 771 gene locus_tag LOCUS_32340 1316 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence576 1231 356 gene locus_tag LOCUS_32350 1231 356 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_32350 >Feature sequence577 203 463 gene locus_tag LOCUS_32360 203 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence578 <1 1153 gene locus_tag LOCUS_32370 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790471.1:phosphoenolpyruvate synthase >Feature sequence579 633 13 gene locus_tag LOCUS_32380 633 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32380 1141 680 gene locus_tag LOCUS_32390 1141 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32390 1753 1259 gene locus_tag LOCUS_32400 1753 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence580 <1 810 gene locus_tag LOCUS_32410 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767446.1:type IV secretion protein Rhs 824 1411 gene locus_tag LOCUS_32420 824 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence581 >Feature sequence582 >Feature sequence583 462 25 gene locus_tag LOCUS_32430 462 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 549 1733 gene locus_tag LOCUS_32440 549 1733 CDS product ISAs1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014966182.1 protein_id gnl|my_center|LOCUS_32440 >Feature sequence584 >Feature sequence585 1706 1200 gene locus_tag LOCUS_32450 1706 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence586 135 1298 gene locus_tag LOCUS_32460 135 1298 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367899.1 protein_id gnl|my_center|LOCUS_32460 1494 1649 gene locus_tag LOCUS_32470 1494 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence587 1613 870 gene locus_tag LOCUS_32480 gene etfB 1613 870 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_32480 >Feature sequence588 43 1149 gene locus_tag LOCUS_32490 43 1149 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423246.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence589 639 1232 gene locus_tag LOCUS_32500 639 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 1337 1759 gene locus_tag LOCUS_32510 1337 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence590 >Feature sequence591 1391 372 gene locus_tag LOCUS_32520 1391 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 >Feature sequence592 1543 224 gene locus_tag LOCUS_32530 1543 224 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_32530 >Feature sequence593 >Feature sequence594 56 1777 gene locus_tag LOCUS_32540 56 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence595 984 154 gene locus_tag LOCUS_32550 984 154 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZQ5 protein_id gnl|my_center|LOCUS_32550 <1745 1032 gene locus_tag LOCUS_32560 <1745 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EYJ5:sulfate adenylyltransferase subunit 1 >Feature sequence596 315 1349 gene locus_tag LOCUS_32570 315 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence597 3 1019 gene locus_tag LOCUS_32580 3 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 1397 1585 gene locus_tag LOCUS_32590 1397 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence598 1346 993 gene locus_tag LOCUS_32600 gene rsfS 1346 993 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_32600 >Feature sequence599 112 1041 gene locus_tag LOCUS_32610 112 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 1043 1612 gene locus_tag LOCUS_32620 1043 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 >Feature sequence600 1062 496 gene locus_tag LOCUS_32630 1062 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 1693 1181 gene locus_tag LOCUS_32640 1693 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 >Feature sequence601 656 63 gene locus_tag LOCUS_32650 656 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 1468 662 gene locus_tag LOCUS_32660 1468 662 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817720.1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence602 1271 33 gene locus_tag LOCUS_32670 1271 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence603 1162 893 gene locus_tag LOCUS_32680 1162 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 >Feature sequence604 314 817 gene locus_tag LOCUS_32690 314 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 977 1555 gene locus_tag LOCUS_32700 977 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 >Feature sequence605 >Feature sequence606 979 248 gene locus_tag LOCUS_32710 979 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 >Feature sequence607 451 1563 gene locus_tag LOCUS_32720 451 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence608 >Feature sequence609 447 133 gene locus_tag LOCUS_32730 447 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 1387 746 gene locus_tag LOCUS_32740 1387 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 1275 1511 gene locus_tag LOCUS_32750 1275 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 >Feature sequence610 1069 95 gene locus_tag LOCUS_32760 1069 95 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107714.1 protein_id gnl|my_center|LOCUS_32760 1614 1111 gene locus_tag LOCUS_32770 1614 1111 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_32770 >Feature sequence611 25 915 gene locus_tag LOCUS_32780 25 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 924 1391 gene locus_tag LOCUS_32790 924 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 >Feature sequence612 957 466 gene locus_tag LOCUS_32800 957 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 1399 1073 gene locus_tag LOCUS_32810 1399 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence613 >Feature sequence614 <1 842 gene locus_tag LOCUS_32820 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NI8:tyrosine recombinase XerC 861 1160 gene locus_tag LOCUS_32830 gene yhbH 861 1160 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021962.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence615 >Feature sequence616 166 1431 gene locus_tag LOCUS_32840 166 1431 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767676.1 protein_id gnl|my_center|LOCUS_32840 >Feature sequence617 233 949 gene locus_tag LOCUS_32850 233 949 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956832.1 protein_id gnl|my_center|LOCUS_32850 955 1452 gene locus_tag LOCUS_32860 955 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 >Feature sequence618 <1612 805 gene locus_tag LOCUS_32870 <1612 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462892.1:prolyl endopeptidase >Feature sequence619 >Feature sequence620 1343 75 gene locus_tag LOCUS_32880 1343 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence621 <1597 115 gene locus_tag LOCUS_32890 <1597 115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207643.1:two-component sensor histidine kinase >Feature sequence622 507 16 gene locus_tag LOCUS_32900 gene ispF 507 16 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P34 protein_id gnl|my_center|LOCUS_32900 >Feature sequence623 >Feature sequence624 1544 255 gene locus_tag LOCUS_32910 gene ptr2 1544 255 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338309.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence625 310 633 gene locus_tag LOCUS_32920 310 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 >Feature sequence626 1186 503 gene locus_tag LOCUS_32930 1186 503 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_32930 >Feature sequence627 121 1254 gene locus_tag LOCUS_32940 121 1254 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_32940 >Feature sequence628 544 422 gene locus_tag LOCUS_32950 544 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 1359 553 gene locus_tag LOCUS_32960 1359 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 >Feature sequence629 >Feature sequence630 <1 960 gene locus_tag LOCUS_32970 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963200.1:glycosyl transferase family 2 1505 981 gene locus_tag LOCUS_32980 1505 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence631 <1 1171 gene locus_tag LOCUS_32990 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021092.1:capsular polysaccharide biosynthesis protein >Feature sequence632 1001 429 gene locus_tag LOCUS_33000 1001 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence633 760 239 gene locus_tag LOCUS_33010 760 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_33010 1242 814 gene locus_tag LOCUS_33020 1242 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 1374 1246 gene locus_tag LOCUS_33030 1374 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 >Feature sequence634 <1 765 gene locus_tag LOCUS_33040 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963759.1:DNA-binding response regulator >Feature sequence635 >Feature sequence636