>Feature sequence001 <1 1709 gene locus_tag LOCUS_00010 <1 1709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202761.1:ABC transporter permease 2354 1782 gene locus_tag LOCUS_00020 gene sodB 2354 1782 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31108 protein_id gnl|my_center|LOCUS_00020 2565 4409 gene locus_tag LOCUS_00030 gene glmS 2565 4409 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAB1 protein_id gnl|my_center|LOCUS_00030 4631 5398 gene locus_tag LOCUS_00040 4631 5398 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657484.1 protein_id gnl|my_center|LOCUS_00040 5413 6636 gene locus_tag LOCUS_00050 5413 6636 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 protein_id gnl|my_center|LOCUS_00050 6638 7483 gene locus_tag LOCUS_00060 6638 7483 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203423.1 protein_id gnl|my_center|LOCUS_00060 8451 7552 gene locus_tag LOCUS_00070 8451 7552 CDS product meso-diaminopimelate D-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ8 protein_id gnl|my_center|LOCUS_00070 8623 9219 gene locus_tag LOCUS_00080 gene ruvA 8623 9219 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ9 protein_id gnl|my_center|LOCUS_00080 9448 10275 gene locus_tag LOCUS_00090 gene lgt 9448 10275 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3W5 protein_id gnl|my_center|LOCUS_00090 10455 12797 gene locus_tag LOCUS_00100 10455 12797 CDS product 2,6-beta-D-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203244.1 protein_id gnl|my_center|LOCUS_00100 12925 14796 gene locus_tag LOCUS_00110 12925 14796 CDS product 2,6-beta-D-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203243.1 protein_id gnl|my_center|LOCUS_00110 14818 17010 gene locus_tag LOCUS_00120 14818 17010 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201924.1 protein_id gnl|my_center|LOCUS_00120 17051 18211 gene locus_tag LOCUS_00130 17051 18211 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_00130 18216 19097 gene locus_tag LOCUS_00140 18216 19097 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_00140 19040 19264 gene locus_tag LOCUS_00150 19040 19264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19422 22199 gene locus_tag LOCUS_00160 19422 22199 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107962.1 protein_id gnl|my_center|LOCUS_00160 22270 22938 gene locus_tag LOCUS_00170 22270 22938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202200.1 protein_id gnl|my_center|LOCUS_00170 23251 24129 gene locus_tag LOCUS_00180 23251 24129 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760846.1 protein_id gnl|my_center|LOCUS_00180 24274 24816 gene locus_tag LOCUS_00190 24274 24816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203534.1 protein_id gnl|my_center|LOCUS_00190 24806 26122 gene locus_tag LOCUS_00200 24806 26122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_00200 26147 26902 gene locus_tag LOCUS_00210 gene tpiA 26147 26902 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0U2 protein_id gnl|my_center|LOCUS_00210 27025 27486 gene locus_tag LOCUS_00220 27025 27486 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791114.1 protein_id gnl|my_center|LOCUS_00220 27486 28082 gene locus_tag LOCUS_00230 gene folE 27486 28082 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P85 protein_id gnl|my_center|LOCUS_00230 30261 28132 gene locus_tag LOCUS_00240 gene dnaG 30261 28132 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0T9 protein_id gnl|my_center|LOCUS_00240 31707 30313 gene locus_tag LOCUS_00250 31707 30313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33103 32102 gene locus_tag LOCUS_00260 33103 32102 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_00260 33680 34969 gene locus_tag LOCUS_00270 33680 34969 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203419.1 protein_id gnl|my_center|LOCUS_00270 35073 36203 gene locus_tag LOCUS_00280 35073 36203 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_00280 36210 36536 gene locus_tag LOCUS_00290 36210 36536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00290 36552 37607 gene locus_tag LOCUS_00300 36552 37607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00300 37594 38145 gene locus_tag LOCUS_00310 37594 38145 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799202.1 protein_id gnl|my_center|LOCUS_00310 39537 38080 gene locus_tag LOCUS_00320 39537 38080 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_00320 41368 39518 gene locus_tag LOCUS_00330 41368 39518 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_00330 41865 41368 gene locus_tag LOCUS_00340 41865 41368 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_00340 42747 41896 gene locus_tag LOCUS_00350 42747 41896 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU1 protein_id gnl|my_center|LOCUS_00350 43858 42836 gene locus_tag LOCUS_00360 43858 42836 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_00360 44524 43931 gene locus_tag LOCUS_00370 44524 43931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 44769 47063 gene locus_tag LOCUS_00380 44769 47063 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A666 protein_id gnl|my_center|LOCUS_00380 47437 47123 gene locus_tag LOCUS_00390 47437 47123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 >Feature sequence002 4446 1396 gene locus_tag LOCUS_00400 4446 1396 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108255.1 protein_id gnl|my_center|LOCUS_00400 5285 4653 gene locus_tag LOCUS_00410 5285 4653 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_00410 6358 5384 gene locus_tag LOCUS_00420 6358 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00420 7693 6365 gene locus_tag LOCUS_00430 7693 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00430 10213 7754 gene locus_tag LOCUS_00440 10213 7754 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_00440 11341 10445 gene locus_tag LOCUS_00450 11341 10445 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203754.1 protein_id gnl|my_center|LOCUS_00450 14245 11411 gene locus_tag LOCUS_00460 gene leuS 14245 11411 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A329 protein_id gnl|my_center|LOCUS_00460 14386 16824 gene locus_tag LOCUS_00470 14386 16824 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_00470 19927 16898 gene locus_tag LOCUS_00480 19927 16898 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108444.1 protein_id gnl|my_center|LOCUS_00480 20698 23835 gene locus_tag LOCUS_00490 20698 23835 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_00490 23850 25976 gene locus_tag LOCUS_00500 23850 25976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 26128 29385 gene locus_tag LOCUS_00510 26128 29385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764390.1 protein_id gnl|my_center|LOCUS_00510 31544 29472 gene locus_tag LOCUS_00520 31544 29472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 31735 32358 gene locus_tag LOCUS_00530 31735 32358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109133.1 protein_id gnl|my_center|LOCUS_00530 32355 33794 gene locus_tag LOCUS_00540 32355 33794 CDS product exo-poly-alpha-D-galacturonosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_00540 33835 35748 gene locus_tag LOCUS_00550 33835 35748 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764392.1 protein_id gnl|my_center|LOCUS_00550 35779 37929 gene locus_tag LOCUS_00560 35779 37929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 39503 38007 gene locus_tag LOCUS_00570 39503 38007 CDS product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797086.1 protein_id gnl|my_center|LOCUS_00570 39894 39547 gene locus_tag LOCUS_00580 39894 39547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 40017 41390 gene locus_tag LOCUS_00590 gene miaB 40017 41390 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650P7 protein_id gnl|my_center|LOCUS_00590 41795 41601 gene locus_tag LOCUS_00600 41795 41601 CDS product PspC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767912.1 protein_id gnl|my_center|LOCUS_00600 41994 42830 gene locus_tag LOCUS_00610 41994 42830 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108704.1 protein_id gnl|my_center|LOCUS_00610 42837 43706 gene locus_tag LOCUS_00620 42837 43706 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650M1 protein_id gnl|my_center|LOCUS_00620 43735 43992 gene locus_tag LOCUS_00630 43735 43992 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_00630 43992 44849 gene locus_tag LOCUS_00640 gene uppP 43992 44849 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H239 protein_id gnl|my_center|LOCUS_00640 44849 45553 gene locus_tag LOCUS_00650 gene truB 44849 45553 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L8 protein_id gnl|my_center|LOCUS_00650 45571 46626 gene locus_tag LOCUS_00660 gene queA 45571 46626 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L7 protein_id gnl|my_center|LOCUS_00660 >Feature sequence003 511 1806 gene locus_tag LOCUS_00670 gene metK 511 1806 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L4 protein_id gnl|my_center|LOCUS_00670 2022 2609 gene locus_tag LOCUS_00680 2022 2609 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2T1 protein_id gnl|my_center|LOCUS_00680 3421 4167 gene locus_tag LOCUS_00690 3421 4167 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_00690 4242 4637 gene locus_tag LOCUS_00700 4242 4637 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L0 protein_id gnl|my_center|LOCUS_00700 4870 5526 gene locus_tag LOCUS_00710 4870 5526 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767460.1 protein_id gnl|my_center|LOCUS_00710 5606 6898 gene locus_tag LOCUS_00720 gene tyrS 5606 6898 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K7 protein_id gnl|my_center|LOCUS_00720 10473 7222 gene locus_tag LOCUS_00730 10473 7222 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7W6 protein_id gnl|my_center|LOCUS_00730 10604 10675 gene locus_tag LOCUS_t00010 10604 10675 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 11351 12118 gene locus_tag LOCUS_00740 11351 12118 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797826.1 protein_id gnl|my_center|LOCUS_00740 12477 12244 gene locus_tag LOCUS_00750 12477 12244 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202039.1 protein_id gnl|my_center|LOCUS_00750 12570 13199 gene locus_tag LOCUS_00760 12570 13199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 13196 14581 gene locus_tag LOCUS_00770 13196 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 14583 14990 gene locus_tag LOCUS_00780 14583 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_00780 15106 15435 gene locus_tag LOCUS_00790 15106 15435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 15432 16013 gene locus_tag LOCUS_00800 15432 16013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 17277 16042 gene locus_tag LOCUS_00810 17277 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822199.1 protein_id gnl|my_center|LOCUS_00810 18574 17255 gene locus_tag LOCUS_00820 18574 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107179.1 protein_id gnl|my_center|LOCUS_00820 18867 18580 gene locus_tag LOCUS_00830 18867 18580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 20334 18991 gene locus_tag LOCUS_00840 20334 18991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 21724 20315 gene locus_tag LOCUS_00850 21724 20315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 22827 23123 gene locus_tag LOCUS_00860 22827 23123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 26314 23828 gene locus_tag LOCUS_00870 26314 23828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791960.1 protein_id gnl|my_center|LOCUS_00870 27979 26318 gene locus_tag LOCUS_00880 27979 26318 CDS product glycosyl hydrolase family 109 protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZX8 protein_id gnl|my_center|LOCUS_00880 28199 28008 gene locus_tag LOCUS_00890 28199 28008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 28758 28327 gene locus_tag LOCUS_00900 28758 28327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 29839 28760 gene locus_tag LOCUS_00910 29839 28760 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_00910 31604 29856 gene locus_tag LOCUS_00920 gene glaA 31604 29856 CDS product alpha-1,3-galactosidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MU6 protein_id gnl|my_center|LOCUS_00920 32308 31829 gene locus_tag LOCUS_00930 32308 31829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791963.1 protein_id gnl|my_center|LOCUS_00930 34209 32338 gene locus_tag LOCUS_00940 34209 32338 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203703.1 protein_id gnl|my_center|LOCUS_00940 37328 34227 gene locus_tag LOCUS_00950 37328 34227 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797388.1 protein_id gnl|my_center|LOCUS_00950 37937 37746 gene locus_tag LOCUS_00960 37937 37746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 38529 38086 gene locus_tag LOCUS_00970 38529 38086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00970 38846 38526 gene locus_tag LOCUS_00980 38846 38526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00980 39798 38878 gene locus_tag LOCUS_00990 39798 38878 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107624.1 protein_id gnl|my_center|LOCUS_00990 40096 39803 gene locus_tag LOCUS_01000 40096 39803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01000 40780 40403 gene locus_tag LOCUS_01010 40780 40403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 41413 41685 gene locus_tag LOCUS_01020 41413 41685 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295307.1 protein_id gnl|my_center|LOCUS_01020 41692 41964 gene locus_tag LOCUS_01030 41692 41964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 42019 42339 gene locus_tag LOCUS_01040 42019 42339 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295308.1 protein_id gnl|my_center|LOCUS_01040 43254 42862 gene locus_tag LOCUS_01050 43254 42862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 43853 43293 gene locus_tag LOCUS_01060 43853 43293 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295311.1 protein_id gnl|my_center|LOCUS_01060 45363 44560 gene locus_tag LOCUS_01070 45363 44560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_01070 <46543 45856 gene locus_tag LOCUS_01080 <46543 45856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107629.1:transposase >Feature sequence004 3690 2326 gene locus_tag LOCUS_01090 3690 2326 CDS product UPF0210 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3E8G8 protein_id gnl|my_center|LOCUS_01090 4028 3708 gene locus_tag LOCUS_01100 4028 3708 CDS product UPF0237 protein BL1209.1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G509 protein_id gnl|my_center|LOCUS_01100 4909 4124 gene locus_tag LOCUS_01110 gene mazG 4909 4124 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 protein_id gnl|my_center|LOCUS_01110 5456 4962 gene locus_tag LOCUS_01120 5456 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 7740 5518 gene locus_tag LOCUS_01130 7740 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918421.1 protein_id gnl|my_center|LOCUS_01130 9554 7926 gene locus_tag LOCUS_01140 9554 7926 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975065.1 protein_id gnl|my_center|LOCUS_01140 10244 9867 gene locus_tag LOCUS_01150 10244 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458981.1 protein_id gnl|my_center|LOCUS_01150 10416 13094 gene locus_tag LOCUS_01160 gene valS 10416 13094 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZM4 protein_id gnl|my_center|LOCUS_01160 14731 13733 gene locus_tag LOCUS_01170 14731 13733 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765092.1 protein_id gnl|my_center|LOCUS_01170 15192 14743 gene locus_tag LOCUS_01180 15192 14743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785439.1 protein_id gnl|my_center|LOCUS_01180 16241 15252 gene locus_tag LOCUS_01190 16241 15252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785441.1 protein_id gnl|my_center|LOCUS_01190 19682 16386 gene locus_tag LOCUS_01200 gene secA 19682 16386 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XF8 protein_id gnl|my_center|LOCUS_01200 21356 19773 gene locus_tag LOCUS_01210 21356 19773 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785445.1 protein_id gnl|my_center|LOCUS_01210 22465 21356 gene locus_tag LOCUS_01220 22465 21356 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_01220 22692 23471 gene locus_tag LOCUS_01230 gene coaX 22692 23471 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 protein_id gnl|my_center|LOCUS_01230 23461 24732 gene locus_tag LOCUS_01240 23461 24732 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_01240 24772 26133 gene locus_tag LOCUS_01250 24772 26133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785453.1 protein_id gnl|my_center|LOCUS_01250 26138 26758 gene locus_tag LOCUS_01260 26138 26758 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109225.1 protein_id gnl|my_center|LOCUS_01260 26769 28025 gene locus_tag LOCUS_01270 26769 28025 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_01270 28128 30266 gene locus_tag LOCUS_01280 28128 30266 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_01280 31589 30369 gene locus_tag LOCUS_01290 31589 30369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203235.1 protein_id gnl|my_center|LOCUS_01290 32017 32655 gene locus_tag LOCUS_01300 32017 32655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763127.1 protein_id gnl|my_center|LOCUS_01300 32772 33128 gene locus_tag LOCUS_01310 32772 33128 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763126.1 protein_id gnl|my_center|LOCUS_01310 33174 34568 gene locus_tag LOCUS_01320 33174 34568 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAC1 protein_id gnl|my_center|LOCUS_01320 34621 36810 gene locus_tag LOCUS_01330 34621 36810 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_01330 37516 39309 gene locus_tag LOCUS_01340 37516 39309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 40249 39683 gene locus_tag LOCUS_01350 40249 39683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 40378 41196 gene locus_tag LOCUS_01360 40378 41196 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203124.1 protein_id gnl|my_center|LOCUS_01360 41268 41888 gene locus_tag LOCUS_01370 41268 41888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 43457 41910 gene locus_tag LOCUS_01380 43457 41910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 44001 43462 gene locus_tag LOCUS_01390 44001 43462 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_01390 44568 44020 gene locus_tag LOCUS_01400 44568 44020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 44964 44572 gene locus_tag LOCUS_01410 44964 44572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941231.1 protein_id gnl|my_center|LOCUS_01410 45484 44948 gene locus_tag LOCUS_01420 45484 44948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 >Feature sequence005 2565 1333 gene locus_tag LOCUS_01430 2565 1333 CDS product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108782.1 protein_id gnl|my_center|LOCUS_01430 5492 2658 gene locus_tag LOCUS_01440 5492 2658 CDS product chondroitin sulfate ABC lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2F5 protein_id gnl|my_center|LOCUS_01440 5591 5782 gene locus_tag LOCUS_01450 5591 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5790 9722 gene locus_tag LOCUS_01460 5790 9722 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108776.1 protein_id gnl|my_center|LOCUS_01460 9753 11294 gene locus_tag LOCUS_01470 9753 11294 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108775.1 protein_id gnl|my_center|LOCUS_01470 11766 11428 gene locus_tag LOCUS_01480 11766 11428 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_01480 11898 12530 gene locus_tag LOCUS_01490 gene rex 11898 12530 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P32 protein_id gnl|my_center|LOCUS_01490 12535 13152 gene locus_tag LOCUS_01500 12535 13152 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_01500 13149 13628 gene locus_tag LOCUS_01510 gene ispF 13149 13628 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P34 protein_id gnl|my_center|LOCUS_01510 13642 14637 gene locus_tag LOCUS_01520 13642 14637 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_01520 14698 15387 gene locus_tag LOCUS_01530 14698 15387 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_01530 15410 15793 gene locus_tag LOCUS_01540 15410 15793 CDS product Fe-S assembly SUF system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_01540 15804 16577 gene locus_tag LOCUS_01550 15804 16577 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_01550 17711 16671 gene locus_tag LOCUS_01560 17711 16671 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793314.1 protein_id gnl|my_center|LOCUS_01560 19063 17864 gene locus_tag LOCUS_01570 gene ackA 19063 17864 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z48 protein_id gnl|my_center|LOCUS_01570 20170 19163 gene locus_tag LOCUS_01580 20170 19163 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_01580 20407 20757 gene locus_tag LOCUS_01590 20407 20757 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108934.1 protein_id gnl|my_center|LOCUS_01590 20738 21433 gene locus_tag LOCUS_01600 20738 21433 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762629.1 protein_id gnl|my_center|LOCUS_01600 21529 22422 gene locus_tag LOCUS_01610 21529 22422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_01610 22419 23444 gene locus_tag LOCUS_01620 22419 23444 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108932.1 protein_id gnl|my_center|LOCUS_01620 24226 23447 gene locus_tag LOCUS_01630 24226 23447 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202009.1 protein_id gnl|my_center|LOCUS_01630 25122 24259 gene locus_tag LOCUS_01640 25122 24259 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_01640 25313 25388 gene locus_tag LOCUS_t00020 25313 25388 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25427 25503 gene locus_tag LOCUS_t00030 25427 25503 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25524 25599 gene locus_tag LOCUS_t00040 25524 25599 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25632 25707 gene locus_tag LOCUS_t00050 25632 25707 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 25759 26400 gene locus_tag LOCUS_01650 25759 26400 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760474.1 protein_id gnl|my_center|LOCUS_01650 27353 26406 gene locus_tag LOCUS_01660 27353 26406 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MH4 protein_id gnl|my_center|LOCUS_01660 27539 27466 gene locus_tag LOCUS_t00060 27539 27466 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27627 27554 gene locus_tag LOCUS_t00070 27627 27554 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27867 28475 gene locus_tag LOCUS_01670 27867 28475 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792010.1 protein_id gnl|my_center|LOCUS_01670 28492 29238 gene locus_tag LOCUS_01680 28492 29238 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_01680 29321 29992 gene locus_tag LOCUS_01690 29321 29992 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_01690 31636 30284 gene locus_tag LOCUS_01700 31636 30284 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_01700 34205 31677 gene locus_tag LOCUS_01710 34205 31677 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792029.1 protein_id gnl|my_center|LOCUS_01710 35534 34209 gene locus_tag LOCUS_01720 35534 34209 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804263.1 protein_id gnl|my_center|LOCUS_01720 36769 35531 gene locus_tag LOCUS_01730 36769 35531 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_01730 37540 36782 gene locus_tag LOCUS_01740 37540 36782 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NS7 protein_id gnl|my_center|LOCUS_01740 38328 37687 gene locus_tag LOCUS_01750 38328 37687 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764753.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence006 454 3876 gene locus_tag LOCUS_01760 454 3876 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784823.1 protein_id gnl|my_center|LOCUS_01760 3896 5662 gene locus_tag LOCUS_01770 3896 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784821.1 protein_id gnl|my_center|LOCUS_01770 5809 8025 gene locus_tag LOCUS_01780 5809 8025 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658550.1 protein_id gnl|my_center|LOCUS_01780 8083 10326 gene locus_tag LOCUS_01790 8083 10326 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109052.1 protein_id gnl|my_center|LOCUS_01790 10354 12579 gene locus_tag LOCUS_01800 10354 12579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_01800 12745 16092 gene locus_tag LOCUS_01810 12745 16092 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202201.1 protein_id gnl|my_center|LOCUS_01810 18623 16644 gene locus_tag LOCUS_01820 18623 16644 CDS product alpha-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_01820 18961 23061 gene locus_tag LOCUS_01830 18961 23061 CDS product two-component system sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107220.1 protein_id gnl|my_center|LOCUS_01830 23327 25081 gene locus_tag LOCUS_01840 23327 25081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 25160 28222 gene locus_tag LOCUS_01850 25160 28222 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_01850 28312 30048 gene locus_tag LOCUS_01860 28312 30048 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760650.1 protein_id gnl|my_center|LOCUS_01860 30066 33263 gene locus_tag LOCUS_01870 30066 33263 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107217.1 protein_id gnl|my_center|LOCUS_01870 33277 35088 gene locus_tag LOCUS_01880 33277 35088 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_01880 35123 37060 gene locus_tag LOCUS_01890 35123 37060 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107215.1 protein_id gnl|my_center|LOCUS_01890 37149 38153 gene locus_tag LOCUS_01900 gene abnA 37149 38153 CDS product extracellular endo-alpha-(1->5)-L-arabinanase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94522 protein_id gnl|my_center|LOCUS_01900 >Feature sequence007 1130 483 gene locus_tag LOCUS_01910 1130 483 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791874.1 protein_id gnl|my_center|LOCUS_01910 3109 1202 gene locus_tag LOCUS_01920 3109 1202 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_01920 6347 3789 gene locus_tag LOCUS_01930 6347 3789 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A065 protein_id gnl|my_center|LOCUS_01930 6932 9661 gene locus_tag LOCUS_01940 6932 9661 CDS product glycosyl hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_01940 11221 9683 gene locus_tag LOCUS_01950 11221 9683 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_01950 12262 11246 gene locus_tag LOCUS_01960 12262 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765298.1 protein_id gnl|my_center|LOCUS_01960 14077 12401 gene locus_tag LOCUS_01970 14077 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203713.1 protein_id gnl|my_center|LOCUS_01970 15134 14223 gene locus_tag LOCUS_01980 gene xerC 15134 14223 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3W1 protein_id gnl|my_center|LOCUS_01980 15200 15631 gene locus_tag LOCUS_01990 gene aroQ 15200 15631 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR7 protein_id gnl|my_center|LOCUS_01990 15642 17102 gene locus_tag LOCUS_02000 15642 17102 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3W3 protein_id gnl|my_center|LOCUS_02000 17105 17743 gene locus_tag LOCUS_02010 17105 17743 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_02010 17753 18088 gene locus_tag LOCUS_02020 17753 18088 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_02020 18222 19418 gene locus_tag LOCUS_02030 18222 19418 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_02030 20031 19342 gene locus_tag LOCUS_02040 20031 19342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 20780 23623 gene locus_tag LOCUS_02050 20780 23623 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107165.1 protein_id gnl|my_center|LOCUS_02050 23639 25153 gene locus_tag LOCUS_02060 23639 25153 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107166.1 protein_id gnl|my_center|LOCUS_02060 25177 26073 gene locus_tag LOCUS_02070 25177 26073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107167.1 protein_id gnl|my_center|LOCUS_02070 26099 27628 gene locus_tag LOCUS_02080 26099 27628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 27628 30216 gene locus_tag LOCUS_02090 27628 30216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766221.1 protein_id gnl|my_center|LOCUS_02090 30274 32160 gene locus_tag LOCUS_02100 30274 32160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766220.1 protein_id gnl|my_center|LOCUS_02100 32271 34316 gene locus_tag LOCUS_02110 32271 34316 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766219.1 protein_id gnl|my_center|LOCUS_02110 34353 35129 gene locus_tag LOCUS_02120 34353 35129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766218.1 protein_id gnl|my_center|LOCUS_02120 35200 35622 gene locus_tag LOCUS_02130 35200 35622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766217.1 protein_id gnl|my_center|LOCUS_02130 >Feature sequence008 289 1428 gene locus_tag LOCUS_02140 289 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107749.1 protein_id gnl|my_center|LOCUS_02140 1595 2539 gene locus_tag LOCUS_02150 1595 2539 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_02150 2569 3759 gene locus_tag LOCUS_02160 2569 3759 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795977.1 protein_id gnl|my_center|LOCUS_02160 4710 3844 gene locus_tag LOCUS_02170 4710 3844 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_02170 5353 4742 gene locus_tag LOCUS_02180 5353 4742 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761010.1 protein_id gnl|my_center|LOCUS_02180 7403 5403 gene locus_tag LOCUS_02190 7403 5403 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785291.1 protein_id gnl|my_center|LOCUS_02190 7976 9343 gene locus_tag LOCUS_02200 7976 9343 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108266.1 protein_id gnl|my_center|LOCUS_02200 9733 10299 gene locus_tag LOCUS_02210 9733 10299 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_02210 10395 11546 gene locus_tag LOCUS_02220 10395 11546 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784109.1 protein_id gnl|my_center|LOCUS_02220 11820 15779 gene locus_tag LOCUS_02230 11820 15779 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108846.1 protein_id gnl|my_center|LOCUS_02230 16149 19262 gene locus_tag LOCUS_02240 16149 19262 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789829.1 protein_id gnl|my_center|LOCUS_02240 19276 20889 gene locus_tag LOCUS_02250 19276 20889 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_02250 20905 21936 gene locus_tag LOCUS_02260 20905 21936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 22023 25451 gene locus_tag LOCUS_02270 22023 25451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 25480 28074 gene locus_tag LOCUS_02280 25480 28074 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202630.1 protein_id gnl|my_center|LOCUS_02280 28174 30375 gene locus_tag LOCUS_02290 28174 30375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 protein_id gnl|my_center|LOCUS_02290 32625 30466 gene locus_tag LOCUS_02300 32625 30466 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_02300 32772 33449 gene locus_tag LOCUS_02310 32772 33449 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_02310 33532 34896 gene locus_tag LOCUS_02320 gene hisS 33532 34896 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QS2 protein_id gnl|my_center|LOCUS_02320 35026 36435 gene locus_tag LOCUS_02330 gene rmuC 35026 36435 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072114.1 protein_id gnl|my_center|LOCUS_02330 >Feature sequence009 1171 629 gene locus_tag LOCUS_02340 1171 629 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_02340 2292 1321 gene locus_tag LOCUS_02350 gene fmt 2292 1321 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 protein_id gnl|my_center|LOCUS_02350 4107 2308 gene locus_tag LOCUS_02360 4107 2308 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_02360 4686 4120 gene locus_tag LOCUS_02370 4686 4120 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_02370 4811 5917 gene locus_tag LOCUS_02380 gene dinB 4811 5917 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X95 protein_id gnl|my_center|LOCUS_02380 7455 6358 gene locus_tag LOCUS_02390 7455 6358 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X6 protein_id gnl|my_center|LOCUS_02390 8232 7474 gene locus_tag LOCUS_02400 gene trmB 8232 7474 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X7 protein_id gnl|my_center|LOCUS_02400 8335 10053 gene locus_tag LOCUS_02410 8335 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 10123 10992 gene locus_tag LOCUS_02420 10123 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_02420 11050 12420 gene locus_tag LOCUS_02430 11050 12420 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_02430 12559 14052 gene locus_tag LOCUS_02440 12559 14052 CDS product alkaline protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_02440 14062 15045 gene locus_tag LOCUS_02450 14062 15045 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_02450 15052 16227 gene locus_tag LOCUS_02460 15052 16227 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760823.1 protein_id gnl|my_center|LOCUS_02460 16240 17496 gene locus_tag LOCUS_02470 16240 17496 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203542.1 protein_id gnl|my_center|LOCUS_02470 17625 18938 gene locus_tag LOCUS_02480 17625 18938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 18963 20537 gene locus_tag LOCUS_02490 18963 20537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02490 20565 21161 gene locus_tag LOCUS_02500 20565 21161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02500 21238 22089 gene locus_tag LOCUS_02510 gene lipA 21238 22089 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ0 protein_id gnl|my_center|LOCUS_02510 22142 23125 gene locus_tag LOCUS_02520 22142 23125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 23834 23130 gene locus_tag LOCUS_02530 23834 23130 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764403.1 protein_id gnl|my_center|LOCUS_02530 24845 23853 gene locus_tag LOCUS_02540 24845 23853 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202220.1 protein_id gnl|my_center|LOCUS_02540 25709 24852 gene locus_tag LOCUS_02550 25709 24852 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ4 protein_id gnl|my_center|LOCUS_02550 26075 27250 gene locus_tag LOCUS_02560 26075 27250 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109160.1 protein_id gnl|my_center|LOCUS_02560 28281 27307 gene locus_tag LOCUS_02570 28281 27307 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_02570 28430 29149 gene locus_tag LOCUS_02580 28430 29149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_02580 29160 30410 gene locus_tag LOCUS_02590 29160 30410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_02590 30413 31657 gene locus_tag LOCUS_02600 30413 31657 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_02600 31694 32791 gene locus_tag LOCUS_02610 31694 32791 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_02610 32795 34129 gene locus_tag LOCUS_02620 32795 34129 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769333.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence010 1493 855 gene locus_tag LOCUS_02630 1493 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765529.1 protein_id gnl|my_center|LOCUS_02630 2147 1620 gene locus_tag LOCUS_02640 2147 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788062.1 protein_id gnl|my_center|LOCUS_02640 2402 2208 gene locus_tag LOCUS_02650 2402 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3026 2409 gene locus_tag LOCUS_02660 3026 2409 CDS product metalloendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760060.1 protein_id gnl|my_center|LOCUS_02660 3696 3028 gene locus_tag LOCUS_02670 3696 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_02670 4519 3719 gene locus_tag LOCUS_02680 4519 3719 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA4 protein_id gnl|my_center|LOCUS_02680 5703 4519 gene locus_tag LOCUS_02690 gene obg 5703 4519 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA5 protein_id gnl|my_center|LOCUS_02690 6327 5758 gene locus_tag LOCUS_02700 gene adk 6327 5758 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ0 protein_id gnl|my_center|LOCUS_02700 6945 6352 gene locus_tag LOCUS_02710 6945 6352 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_02710 7046 8563 gene locus_tag LOCUS_02720 7046 8563 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XD8 protein_id gnl|my_center|LOCUS_02720 8560 9609 gene locus_tag LOCUS_02730 8560 9609 CDS product DUF4831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202253.1 protein_id gnl|my_center|LOCUS_02730 12032 9690 gene locus_tag LOCUS_02740 12032 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 14378 12126 gene locus_tag LOCUS_02750 14378 12126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767539.1 protein_id gnl|my_center|LOCUS_02750 16813 14543 gene locus_tag LOCUS_02760 16813 14543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 18847 16886 gene locus_tag LOCUS_02770 18847 16886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 19761 18877 gene locus_tag LOCUS_02780 19761 18877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 21861 19774 gene locus_tag LOCUS_02790 21861 19774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108771.1 protein_id gnl|my_center|LOCUS_02790 23031 21871 gene locus_tag LOCUS_02800 23031 21871 CDS product DUF5017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108772.1 protein_id gnl|my_center|LOCUS_02800 24933 23068 gene locus_tag LOCUS_02810 24933 23068 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_02810 28126 24965 gene locus_tag LOCUS_02820 28126 24965 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_02820 28633 29328 gene locus_tag LOCUS_02830 gene psd 28633 29328 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YG8 protein_id gnl|my_center|LOCUS_02830 29383 30087 gene locus_tag LOCUS_02840 29383 30087 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_02840 30142 30429 gene locus_tag LOCUS_02850 30142 30429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 30868 30434 gene locus_tag LOCUS_02860 gene tadA 30868 30434 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YH1 protein_id gnl|my_center|LOCUS_02860 31105 30872 gene locus_tag LOCUS_02870 31105 30872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784731.1 protein_id gnl|my_center|LOCUS_02870 31179 31547 gene locus_tag LOCUS_02880 31179 31547 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5K3 protein_id gnl|my_center|LOCUS_02880 31568 32305 gene locus_tag LOCUS_02890 31568 32305 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 protein_id gnl|my_center|LOCUS_02890 32302 33618 gene locus_tag LOCUS_02900 32302 33618 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence011 103 1725 gene locus_tag LOCUS_02910 103 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790465.1 protein_id gnl|my_center|LOCUS_02910 1922 2548 gene locus_tag LOCUS_02920 1922 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02920 3933 2599 gene locus_tag LOCUS_02930 3933 2599 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q81 protein_id gnl|my_center|LOCUS_02930 6663 4378 gene locus_tag LOCUS_02940 6663 4378 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790429.1 protein_id gnl|my_center|LOCUS_02940 7046 8212 gene locus_tag LOCUS_02950 7046 8212 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108777.1 protein_id gnl|my_center|LOCUS_02950 8293 11523 gene locus_tag LOCUS_02960 8293 11523 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767547.1 protein_id gnl|my_center|LOCUS_02960 11532 12929 gene locus_tag LOCUS_02970 11532 12929 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_02970 12937 13704 gene locus_tag LOCUS_02980 12937 13704 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2G9 protein_id gnl|my_center|LOCUS_02980 13713 14354 gene locus_tag LOCUS_02990 13713 14354 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_02990 14494 15870 gene locus_tag LOCUS_03000 14494 15870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108446.1 protein_id gnl|my_center|LOCUS_03000 15857 16825 gene locus_tag LOCUS_03010 15857 16825 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203596.1 protein_id gnl|my_center|LOCUS_03010 16791 18293 gene locus_tag LOCUS_03020 16791 18293 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_03020 18458 18530 gene locus_tag LOCUS_t00080 18458 18530 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18812 19561 gene locus_tag LOCUS_03030 gene cutC 18812 19561 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZG1 protein_id gnl|my_center|LOCUS_03030 22181 19545 gene locus_tag LOCUS_03040 22181 19545 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_03040 24283 22298 gene locus_tag LOCUS_03050 24283 22298 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RM0 protein_id gnl|my_center|LOCUS_03050 25086 24295 gene locus_tag LOCUS_03060 gene nagB 25086 24295 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A094 protein_id gnl|my_center|LOCUS_03060 25276 26481 gene locus_tag LOCUS_03070 25276 26481 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_03070 27287 26547 gene locus_tag LOCUS_03080 27287 26547 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_03080 28761 27412 gene locus_tag LOCUS_03090 gene pgi 28761 27412 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM7 protein_id gnl|my_center|LOCUS_03090 29745 28777 gene locus_tag LOCUS_03100 29745 28777 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM8 protein_id gnl|my_center|LOCUS_03100 31572 29845 gene locus_tag LOCUS_03110 gene lysS 31572 29845 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 protein_id gnl|my_center|LOCUS_03110 31927 32700 gene locus_tag LOCUS_03120 31927 32700 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_03120 >Feature sequence012 418 218 gene locus_tag LOCUS_03130 418 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 658 1974 gene locus_tag LOCUS_03140 658 1974 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_03140 1971 2993 gene locus_tag LOCUS_03150 1971 2993 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_03150 3586 2990 gene locus_tag LOCUS_03160 3586 2990 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R56 protein_id gnl|my_center|LOCUS_03160 4114 3596 gene locus_tag LOCUS_03170 4114 3596 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_03170 4930 4133 gene locus_tag LOCUS_03180 4930 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_03180 5262 4927 gene locus_tag LOCUS_03190 5262 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789521.1 protein_id gnl|my_center|LOCUS_03190 5759 5262 gene locus_tag LOCUS_03200 5759 5262 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767848.1 protein_id gnl|my_center|LOCUS_03200 5874 6842 gene locus_tag LOCUS_03210 5874 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661159.1 protein_id gnl|my_center|LOCUS_03210 7008 7412 gene locus_tag LOCUS_03220 7008 7412 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789532.1 protein_id gnl|my_center|LOCUS_03220 7462 9015 gene locus_tag LOCUS_03230 7462 9015 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_03230 9030 9647 gene locus_tag LOCUS_03240 9030 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03240 9644 9970 gene locus_tag LOCUS_03250 9644 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03250 9993 10421 gene locus_tag LOCUS_03260 9993 10421 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_03260 10424 11584 gene locus_tag LOCUS_03270 10424 11584 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_03270 12114 13478 gene locus_tag LOCUS_03280 12114 13478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_03280 13501 14685 gene locus_tag LOCUS_03290 13501 14685 CDS product peptidase M75 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680409.1 protein_id gnl|my_center|LOCUS_03290 14868 16208 gene locus_tag LOCUS_03300 14868 16208 CDS product thiol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680411.1 protein_id gnl|my_center|LOCUS_03300 16235 17449 gene locus_tag LOCUS_03310 16235 17449 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007748002.1 protein_id gnl|my_center|LOCUS_03310 17466 18188 gene locus_tag LOCUS_03320 17466 18188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680413.1 protein_id gnl|my_center|LOCUS_03320 18202 19365 gene locus_tag LOCUS_03330 18202 19365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_03330 19371 21464 gene locus_tag LOCUS_03340 19371 21464 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680415.1 protein_id gnl|my_center|LOCUS_03340 21554 22123 gene locus_tag LOCUS_03350 21554 22123 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763102.1 protein_id gnl|my_center|LOCUS_03350 22120 22968 gene locus_tag LOCUS_03360 22120 22968 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787242.1 protein_id gnl|my_center|LOCUS_03360 24106 23030 gene locus_tag LOCUS_03370 24106 23030 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6G5 protein_id gnl|my_center|LOCUS_03370 24299 24967 gene locus_tag LOCUS_03380 24299 24967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785158.1 protein_id gnl|my_center|LOCUS_03380 24979 25737 gene locus_tag LOCUS_03390 gene truA 24979 25737 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZY4 protein_id gnl|my_center|LOCUS_03390 26501 25734 gene locus_tag LOCUS_03400 26501 25734 CDS product DNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109278.1 protein_id gnl|my_center|LOCUS_03400 26617 27702 gene locus_tag LOCUS_03410 26617 27702 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_03410 29026 27737 gene locus_tag LOCUS_03420 29026 27737 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764634.1 protein_id gnl|my_center|LOCUS_03420 29118 30023 gene locus_tag LOCUS_03430 29118 30023 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_03430 31289 30276 gene locus_tag LOCUS_03440 31289 30276 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_03440 31866 31294 gene locus_tag LOCUS_03450 gene mntP 31866 31294 CDS product putative manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X43 protein_id gnl|my_center|LOCUS_03450 32558 31872 gene locus_tag LOCUS_03460 32558 31872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812917.1 protein_id gnl|my_center|LOCUS_03460 33066 32566 gene locus_tag LOCUS_03470 33066 32566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 <33873 33066 gene locus_tag LOCUS_03480 <33873 33066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785735.1:glycosyl transferase family 2 >Feature sequence013 240 2363 gene locus_tag LOCUS_03490 240 2363 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769220.1 protein_id gnl|my_center|LOCUS_03490 2370 3827 gene locus_tag LOCUS_03500 gene murE 2370 3827 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL7 protein_id gnl|my_center|LOCUS_03500 3845 5113 gene locus_tag LOCUS_03510 gene mraY 3845 5113 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL8 protein_id gnl|my_center|LOCUS_03510 5118 6449 gene locus_tag LOCUS_03520 gene murD 5118 6449 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A256 protein_id gnl|my_center|LOCUS_03520 6479 7729 gene locus_tag LOCUS_03530 6479 7729 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763712.1 protein_id gnl|my_center|LOCUS_03530 7769 8899 gene locus_tag LOCUS_03540 gene murG 7769 8899 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZM1 protein_id gnl|my_center|LOCUS_03540 8889 10265 gene locus_tag LOCUS_03550 8889 10265 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A259 protein_id gnl|my_center|LOCUS_03550 10262 10999 gene locus_tag LOCUS_03560 10262 10999 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784001.1 protein_id gnl|my_center|LOCUS_03560 11003 12580 gene locus_tag LOCUS_03570 11003 12580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 12610 13920 gene locus_tag LOCUS_03580 gene ftsZ 12610 13920 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A262 protein_id gnl|my_center|LOCUS_03580 13954 14409 gene locus_tag LOCUS_03590 13954 14409 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_03590 15225 14500 gene locus_tag LOCUS_03600 gene recO 15225 14500 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A275 protein_id gnl|my_center|LOCUS_03600 15742 15227 gene locus_tag LOCUS_03610 15742 15227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 16120 16192 gene locus_tag LOCUS_t00090 16120 16192 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16316 16489 gene locus_tag LOCUS_03620 16316 16489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 16654 18618 gene locus_tag LOCUS_03630 gene gyrB 16654 18618 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN0 protein_id gnl|my_center|LOCUS_03630 18868 21453 gene locus_tag LOCUS_03640 18868 21453 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_03640 21995 21519 gene locus_tag LOCUS_03650 21995 21519 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107795.1 protein_id gnl|my_center|LOCUS_03650 22435 22214 gene locus_tag LOCUS_03660 22435 22214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_03660 23067 22498 gene locus_tag LOCUS_03670 23067 22498 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_03670 23766 23086 gene locus_tag LOCUS_03680 23766 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770196.1 protein_id gnl|my_center|LOCUS_03680 24408 23923 gene locus_tag LOCUS_03690 24408 23923 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A801 protein_id gnl|my_center|LOCUS_03690 25465 24530 gene locus_tag LOCUS_03700 25465 24530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 25607 25523 gene locus_tag LOCUS_t00100 25607 25523 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27058 25745 gene locus_tag LOCUS_03710 gene der 27058 25745 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A135 protein_id gnl|my_center|LOCUS_03710 27972 27091 gene locus_tag LOCUS_03720 gene era 27972 27091 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A136 protein_id gnl|my_center|LOCUS_03720 29052 28048 gene locus_tag LOCUS_03730 gene fabH 29052 28048 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV1 protein_id gnl|my_center|LOCUS_03730 29342 29157 gene locus_tag LOCUS_03740 gene rpmF 29342 29157 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A138 protein_id gnl|my_center|LOCUS_03740 29934 29359 gene locus_tag LOCUS_03750 29934 29359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770281.1 protein_id gnl|my_center|LOCUS_03750 30267 31433 gene locus_tag LOCUS_03760 30267 31433 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9Z0 protein_id gnl|my_center|LOCUS_03760 31455 32624 gene locus_tag LOCUS_03770 31455 32624 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9Y9 protein_id gnl|my_center|LOCUS_03770 >Feature sequence014 1148 312 gene locus_tag LOCUS_03780 1148 312 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_03780 1315 2184 gene locus_tag LOCUS_03790 1315 2184 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_03790 2904 2254 gene locus_tag LOCUS_03800 gene lolD 2904 2254 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1M1 protein_id gnl|my_center|LOCUS_03800 3636 2911 gene locus_tag LOCUS_03810 3636 2911 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202003.1 protein_id gnl|my_center|LOCUS_03810 5777 3633 gene locus_tag LOCUS_03820 5777 3633 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784260.1 protein_id gnl|my_center|LOCUS_03820 5967 6977 gene locus_tag LOCUS_03830 gene asd 5967 6977 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1M5 protein_id gnl|my_center|LOCUS_03830 9304 7424 gene locus_tag LOCUS_03840 9304 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767024.1 protein_id gnl|my_center|LOCUS_03840 11418 9691 gene locus_tag LOCUS_03850 11418 9691 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_03850 14417 11430 gene locus_tag LOCUS_03860 14417 11430 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_03860 14933 18871 gene locus_tag LOCUS_03870 14933 18871 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_03870 20131 18944 gene locus_tag LOCUS_03880 20131 18944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 21128 20136 gene locus_tag LOCUS_03890 21128 20136 CDS product glycosyl hydrolase family 43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_03890 23566 21257 gene locus_tag LOCUS_03900 23566 21257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 24859 23582 gene locus_tag LOCUS_03910 24859 23582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767016.1 protein_id gnl|my_center|LOCUS_03910 26386 25094 gene locus_tag LOCUS_03920 gene murF 26386 25094 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1L7 protein_id gnl|my_center|LOCUS_03920 27485 26391 gene locus_tag LOCUS_03930 27485 26391 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_03930 27726 30950 gene locus_tag LOCUS_03940 27726 30950 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A105 protein_id gnl|my_center|LOCUS_03940 31594 31118 gene locus_tag LOCUS_03950 31594 31118 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757386.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence015 <1 769 gene locus_tag LOCUS_03960 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108021.1:sulfatase 1421 774 gene locus_tag LOCUS_03970 1421 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 3196 1442 gene locus_tag LOCUS_03980 3196 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203259.1 protein_id gnl|my_center|LOCUS_03980 5029 3425 gene locus_tag LOCUS_03990 gene pckA 5029 3425 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MV4 protein_id gnl|my_center|LOCUS_03990 5303 5962 gene locus_tag LOCUS_04000 gene upp 5303 5962 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_04000 7033 6023 gene locus_tag LOCUS_04010 7033 6023 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_04010 8914 7067 gene locus_tag LOCUS_04020 8914 7067 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108505.1 protein_id gnl|my_center|LOCUS_04020 9413 11173 gene locus_tag LOCUS_04030 9413 11173 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_04030 11189 12289 gene locus_tag LOCUS_04040 gene lpxK 11189 12289 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K1 protein_id gnl|my_center|LOCUS_04040 12291 13055 gene locus_tag LOCUS_04050 12291 13055 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K0 protein_id gnl|my_center|LOCUS_04050 13063 14100 gene locus_tag LOCUS_04060 gene thiL 13063 14100 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN4 protein_id gnl|my_center|LOCUS_04060 14324 14397 gene locus_tag LOCUS_t00110 14324 14397 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 14668 15252 gene locus_tag LOCUS_04070 14668 15252 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108458.1 protein_id gnl|my_center|LOCUS_04070 16330 15347 gene locus_tag LOCUS_04080 16330 15347 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_04080 16422 18884 gene locus_tag LOCUS_04090 gene priA 16422 18884 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 protein_id gnl|my_center|LOCUS_04090 18896 19612 gene locus_tag LOCUS_04100 18896 19612 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_04100 19609 20088 gene locus_tag LOCUS_04110 19609 20088 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765417.1 protein_id gnl|my_center|LOCUS_04110 19979 21340 gene locus_tag LOCUS_04120 gene chuR 19979 21340 CDS product anaerobic sulfatase-maturating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q02550 protein_id gnl|my_center|LOCUS_04120 21745 21380 gene locus_tag LOCUS_04130 21745 21380 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107795.1 protein_id gnl|my_center|LOCUS_04130 21951 21766 gene locus_tag LOCUS_04140 21951 21766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 22114 23058 gene locus_tag LOCUS_04150 22114 23058 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766770.1 protein_id gnl|my_center|LOCUS_04150 23343 23774 gene locus_tag LOCUS_04160 23343 23774 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_04160 23859 24788 gene locus_tag LOCUS_04170 23859 24788 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_04170 24983 25186 gene locus_tag LOCUS_04180 24983 25186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 25190 28609 gene locus_tag LOCUS_04190 25190 28609 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228381.1 protein_id gnl|my_center|LOCUS_04190 28622 30502 gene locus_tag LOCUS_04200 28622 30502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 >Feature sequence016 151 77 gene locus_tag LOCUS_t00120 151 77 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 471 854 gene locus_tag LOCUS_04210 471 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784512.1 protein_id gnl|my_center|LOCUS_04210 1022 2824 gene locus_tag LOCUS_04220 1022 2824 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764095.1 protein_id gnl|my_center|LOCUS_04220 2841 4055 gene locus_tag LOCUS_04230 gene ribBA 2841 4055 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A528 protein_id gnl|my_center|LOCUS_04230 4072 4773 gene locus_tag LOCUS_04240 4072 4773 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966116.1 protein_id gnl|my_center|LOCUS_04240 4858 6051 gene locus_tag LOCUS_04250 4858 6051 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT2 protein_id gnl|my_center|LOCUS_04250 9586 6617 gene locus_tag LOCUS_04260 9586 6617 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202060.1 protein_id gnl|my_center|LOCUS_04260 10443 9601 gene locus_tag LOCUS_04270 10443 9601 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801566.1 protein_id gnl|my_center|LOCUS_04270 11240 10458 gene locus_tag LOCUS_04280 11240 10458 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784454.1 protein_id gnl|my_center|LOCUS_04280 11468 11821 gene locus_tag LOCUS_04290 gene rplS 11468 11821 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YW4 protein_id gnl|my_center|LOCUS_04290 12609 12145 gene locus_tag LOCUS_04300 12609 12145 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_04300 13199 12612 gene locus_tag LOCUS_04310 13199 12612 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_04310 13706 13242 gene locus_tag LOCUS_04320 13706 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790650.1 protein_id gnl|my_center|LOCUS_04320 14515 13715 gene locus_tag LOCUS_04330 14515 13715 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_04330 14665 14577 gene locus_tag LOCUS_t00130 14665 14577 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15593 14802 gene locus_tag LOCUS_04340 15593 14802 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_04340 16581 15598 gene locus_tag LOCUS_04350 16581 15598 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_04350 17345 16659 gene locus_tag LOCUS_04360 17345 16659 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_04360 17763 18461 gene locus_tag LOCUS_04370 gene cmk 17763 18461 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU2 protein_id gnl|my_center|LOCUS_04370 18448 19311 gene locus_tag LOCUS_04380 gene ispH 18448 19311 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU1 protein_id gnl|my_center|LOCUS_04380 19390 20370 gene locus_tag LOCUS_04390 gene pfkA2 19390 20370 CDS product ATP-dependent 6-phosphofructokinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A624 protein_id gnl|my_center|LOCUS_04390 21798 20458 gene locus_tag LOCUS_04400 21798 20458 CDS product spermidine/putrescine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_04400 22586 21795 gene locus_tag LOCUS_04410 22586 21795 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762999.1 protein_id gnl|my_center|LOCUS_04410 23377 22580 gene locus_tag LOCUS_04420 23377 22580 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778456.1 protein_id gnl|my_center|LOCUS_04420 24774 23374 gene locus_tag LOCUS_04430 gene potA 24774 23374 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A883 protein_id gnl|my_center|LOCUS_04430 26001 24895 gene locus_tag LOCUS_04440 26001 24895 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_04440 27050 26010 gene locus_tag LOCUS_04450 27050 26010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence017 2711 747 gene locus_tag LOCUS_04460 2711 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 4258 2744 gene locus_tag LOCUS_04470 4258 2744 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108256.1 protein_id gnl|my_center|LOCUS_04470 7399 4283 gene locus_tag LOCUS_04480 7399 4283 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108199.1 protein_id gnl|my_center|LOCUS_04480 9087 7819 gene locus_tag LOCUS_04490 gene purA 9087 7819 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N4 protein_id gnl|my_center|LOCUS_04490 9575 9117 gene locus_tag LOCUS_04500 9575 9117 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763214.1 protein_id gnl|my_center|LOCUS_04500 10297 9629 gene locus_tag LOCUS_04510 10297 9629 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789797.1 protein_id gnl|my_center|LOCUS_04510 12267 10300 gene locus_tag LOCUS_04520 12267 10300 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203283.1 protein_id gnl|my_center|LOCUS_04520 12442 14277 gene locus_tag LOCUS_04530 12442 14277 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203284.1 protein_id gnl|my_center|LOCUS_04530 15872 14274 gene locus_tag LOCUS_04540 15872 14274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 17321 16086 gene locus_tag LOCUS_04550 17321 16086 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763355.1 protein_id gnl|my_center|LOCUS_04550 19180 17321 gene locus_tag LOCUS_04560 19180 17321 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788675.1 protein_id gnl|my_center|LOCUS_04560 19467 19210 gene locus_tag LOCUS_04570 19467 19210 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763353.1 protein_id gnl|my_center|LOCUS_04570 20115 19612 gene locus_tag LOCUS_04580 20115 19612 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_04580 20788 20129 gene locus_tag LOCUS_04590 20788 20129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107161.1 protein_id gnl|my_center|LOCUS_04590 21263 21093 gene locus_tag LOCUS_04600 21263 21093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 21271 22668 gene locus_tag LOCUS_04610 21271 22668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 24538 22952 gene locus_tag LOCUS_04620 24538 22952 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5Z4 protein_id gnl|my_center|LOCUS_04620 24981 26306 gene locus_tag LOCUS_04630 24981 26306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04630 26475 26831 gene locus_tag LOCUS_04640 26475 26831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04640 26840 28993 gene locus_tag LOCUS_04650 26840 28993 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790883.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence018 554 2488 gene locus_tag LOCUS_04660 554 2488 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_04660 2520 4559 gene locus_tag LOCUS_04670 2520 4559 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_04670 4940 6310 gene locus_tag LOCUS_04680 4940 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 7197 6493 gene locus_tag LOCUS_04690 7197 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04690 7850 7284 gene locus_tag LOCUS_04700 7850 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04700 10381 8312 gene locus_tag LOCUS_04710 10381 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 11016 10378 gene locus_tag LOCUS_04720 11016 10378 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704956.1 protein_id gnl|my_center|LOCUS_04720 11611 12861 gene locus_tag LOCUS_04730 11611 12861 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107542.1 protein_id gnl|my_center|LOCUS_04730 12872 14428 gene locus_tag LOCUS_04740 12872 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 14407 14814 gene locus_tag LOCUS_04750 14407 14814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 14923 14759 gene locus_tag LOCUS_04760 14923 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 15060 15410 gene locus_tag LOCUS_04770 15060 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 15416 16627 gene locus_tag LOCUS_04780 15416 16627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 17190 17798 gene locus_tag LOCUS_04790 17190 17798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 17944 18297 gene locus_tag LOCUS_04800 17944 18297 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313937.1 protein_id gnl|my_center|LOCUS_04800 18278 19219 gene locus_tag LOCUS_04810 18278 19219 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107624.1 protein_id gnl|my_center|LOCUS_04810 19242 19511 gene locus_tag LOCUS_04820 19242 19511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 19652 19936 gene locus_tag LOCUS_04830 19652 19936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 20585 19992 gene locus_tag LOCUS_04840 20585 19992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 21504 20605 gene locus_tag LOCUS_04850 21504 20605 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_04850 21970 21527 gene locus_tag LOCUS_04860 21970 21527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 22134 22928 gene locus_tag LOCUS_04870 22134 22928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 23374 22913 gene locus_tag LOCUS_04880 23374 22913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 25797 23509 gene locus_tag LOCUS_04890 25797 23509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 26789 25899 gene locus_tag LOCUS_04900 26789 25899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 26945 27790 gene locus_tag LOCUS_04910 26945 27790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 27859 28614 gene locus_tag LOCUS_04920 27859 28614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence019 1649 105 gene locus_tag LOCUS_04930 1649 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767614.1 protein_id gnl|my_center|LOCUS_04930 3414 1666 gene locus_tag LOCUS_04940 3414 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 3615 5261 gene locus_tag LOCUS_04950 3615 5261 CDS product NAD-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108284.1 protein_id gnl|my_center|LOCUS_04950 5274 5861 gene locus_tag LOCUS_04960 5274 5861 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202071.1 protein_id gnl|my_center|LOCUS_04960 7070 5865 gene locus_tag LOCUS_04970 7070 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 7187 9643 gene locus_tag LOCUS_04980 7187 9643 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108285.1 protein_id gnl|my_center|LOCUS_04980 11837 9813 gene locus_tag LOCUS_04990 gene aguA 11837 9813 CDS product xylan alpha-1,2-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3G9 protein_id gnl|my_center|LOCUS_04990 12807 11830 gene locus_tag LOCUS_05000 gene xsa 12807 11830 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_05000 14005 12857 gene locus_tag LOCUS_05010 gene xynA 14005 12857 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3F6 protein_id gnl|my_center|LOCUS_05010 15517 14021 gene locus_tag LOCUS_05020 gene xylP 15517 14021 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039190.1 protein_id gnl|my_center|LOCUS_05020 17149 15527 gene locus_tag LOCUS_05030 17149 15527 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108653.1 protein_id gnl|my_center|LOCUS_05030 17605 21573 gene locus_tag LOCUS_05040 17605 21573 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_05040 22487 21633 gene locus_tag LOCUS_05050 22487 21633 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759854.1 protein_id gnl|my_center|LOCUS_05050 25161 22546 gene locus_tag LOCUS_05060 25161 22546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 26578 25241 gene locus_tag LOCUS_05070 gene xynD 26578 25241 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_05070 <27666 26674 gene locus_tag LOCUS_05080 <27666 26674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890799.1:endo-1,4-beta-xylanase >Feature sequence020 3140 1827 gene locus_tag LOCUS_05090 3140 1827 CDS product chitobiase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203443.1 protein_id gnl|my_center|LOCUS_05090 5170 3197 gene locus_tag LOCUS_05100 5170 3197 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109175.1 protein_id gnl|my_center|LOCUS_05100 8488 5246 gene locus_tag LOCUS_05110 8488 5246 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764447.1 protein_id gnl|my_center|LOCUS_05110 9695 8805 gene locus_tag LOCUS_05120 9695 8805 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203712.1 protein_id gnl|my_center|LOCUS_05120 9889 10533 gene locus_tag LOCUS_05130 9889 10533 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788923.1 protein_id gnl|my_center|LOCUS_05130 11510 10686 gene locus_tag LOCUS_05140 11510 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790485.1 protein_id gnl|my_center|LOCUS_05140 11731 13269 gene locus_tag LOCUS_05150 11731 13269 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_05150 13747 16131 gene locus_tag LOCUS_05160 13747 16131 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790561.1 protein_id gnl|my_center|LOCUS_05160 16149 16610 gene locus_tag LOCUS_05170 16149 16610 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ5 protein_id gnl|my_center|LOCUS_05170 19693 17297 gene locus_tag LOCUS_05180 19693 17297 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405469.1 protein_id gnl|my_center|LOCUS_05180 21142 19802 gene locus_tag LOCUS_05190 21142 19802 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_05190 22357 21182 gene locus_tag LOCUS_05200 gene dxr 22357 21182 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY9 protein_id gnl|my_center|LOCUS_05200 23201 22344 gene locus_tag LOCUS_05210 23201 22344 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_05210 23728 23216 gene locus_tag LOCUS_05220 gene rimM 23728 23216 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A682 protein_id gnl|my_center|LOCUS_05220 25038 23731 gene locus_tag LOCUS_05230 gene murA 25038 23731 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY6 protein_id gnl|my_center|LOCUS_05230 25656 25054 gene locus_tag LOCUS_05240 25656 25054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_05240 26409 25720 gene locus_tag LOCUS_05250 26409 25720 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence021 1480 86 gene locus_tag LOCUS_05260 1480 86 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_05260 2955 1510 gene locus_tag LOCUS_05270 2955 1510 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_05270 3213 7778 gene locus_tag LOCUS_05280 3213 7778 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202866.1 protein_id gnl|my_center|LOCUS_05280 7791 8828 gene locus_tag LOCUS_05290 7791 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_05290 8825 9712 gene locus_tag LOCUS_05300 8825 9712 CDS product beta-ureidopropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660290.1 protein_id gnl|my_center|LOCUS_05300 9977 10501 gene locus_tag LOCUS_05310 9977 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 12019 10514 gene locus_tag LOCUS_05320 12019 10514 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769710.1 protein_id gnl|my_center|LOCUS_05320 12726 13625 gene locus_tag LOCUS_05330 12726 13625 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_05330 13622 14680 gene locus_tag LOCUS_05340 13622 14680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 14664 16190 gene locus_tag LOCUS_05350 14664 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203002.1 protein_id gnl|my_center|LOCUS_05350 16187 17293 gene locus_tag LOCUS_05360 16187 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 18391 19362 gene locus_tag LOCUS_05370 18391 19362 CDS product beta-D-GlcNAc beta-1,3-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261031.1 protein_id gnl|my_center|LOCUS_05370 19372 20409 gene locus_tag LOCUS_05380 19372 20409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799038.1 protein_id gnl|my_center|LOCUS_05380 20421 21734 gene locus_tag LOCUS_05390 20421 21734 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107720.1 protein_id gnl|my_center|LOCUS_05390 21792 22601 gene locus_tag LOCUS_05400 21792 22601 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107948.1 protein_id gnl|my_center|LOCUS_05400 22627 23718 gene locus_tag LOCUS_05410 22627 23718 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767812.1 protein_id gnl|my_center|LOCUS_05410 23733 25220 gene locus_tag LOCUS_05420 23733 25220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_05420 25235 25678 gene locus_tag LOCUS_05430 25235 25678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence022 553 861 gene locus_tag LOCUS_05440 gene clpS 553 861 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGC3 protein_id gnl|my_center|LOCUS_05440 876 3092 gene locus_tag LOCUS_05450 gene clpA 876 3092 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ABH9 protein_id gnl|my_center|LOCUS_05450 3103 3744 gene locus_tag LOCUS_05460 gene aat 3103 3744 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 protein_id gnl|my_center|LOCUS_05460 5311 3821 gene locus_tag LOCUS_05470 gene proS 5311 3821 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A988 protein_id gnl|my_center|LOCUS_05470 6652 5402 gene locus_tag LOCUS_05480 6652 5402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202489.1 protein_id gnl|my_center|LOCUS_05480 7821 6649 gene locus_tag LOCUS_05490 7821 6649 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_05490 8057 9295 gene locus_tag LOCUS_05500 8057 9295 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762299.1 protein_id gnl|my_center|LOCUS_05500 9379 9858 gene locus_tag LOCUS_05510 9379 9858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788684.1 protein_id gnl|my_center|LOCUS_05510 9877 10545 gene locus_tag LOCUS_05520 9877 10545 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_05520 10558 11535 gene locus_tag LOCUS_05530 10558 11535 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_05530 12705 11620 gene locus_tag LOCUS_05540 12705 11620 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794495.1 protein_id gnl|my_center|LOCUS_05540 13395 15725 gene locus_tag LOCUS_05550 13395 15725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_05550 15834 17069 gene locus_tag LOCUS_05560 15834 17069 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203281.1 protein_id gnl|my_center|LOCUS_05560 17495 19819 gene locus_tag LOCUS_05570 17495 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_05570 20014 21747 gene locus_tag LOCUS_05580 20014 21747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107435.1 protein_id gnl|my_center|LOCUS_05580 21918 22394 gene locus_tag LOCUS_05590 21918 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 22488 22901 gene locus_tag LOCUS_05600 22488 22901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_05600 24828 22903 gene locus_tag LOCUS_05610 24828 22903 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108318.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence023 2521 2593 gene locus_tag LOCUS_t00140 2521 2593 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2928 2659 gene locus_tag LOCUS_05620 gene rpsO 2928 2659 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A418 protein_id gnl|my_center|LOCUS_05620 3187 4989 gene locus_tag LOCUS_05630 3187 4989 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_05630 7043 5076 gene locus_tag LOCUS_05640 7043 5076 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107506.1 protein_id gnl|my_center|LOCUS_05640 7129 8517 gene locus_tag LOCUS_05650 7129 8517 CDS product purple acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108151.1 protein_id gnl|my_center|LOCUS_05650 8579 9442 gene locus_tag LOCUS_05660 gene cps1A 8579 9442 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101280.1 protein_id gnl|my_center|LOCUS_05660 10270 9443 gene locus_tag LOCUS_05670 10270 9443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 11196 10240 gene locus_tag LOCUS_05680 11196 10240 CDS product LPS 1,2-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201896.1 protein_id gnl|my_center|LOCUS_05680 12219 11200 gene locus_tag LOCUS_05690 12219 11200 CDS product beta-1,6-galactofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 protein_id gnl|my_center|LOCUS_05690 13333 12224 gene locus_tag LOCUS_05700 gene glf 13333 12224 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272526.1 protein_id gnl|my_center|LOCUS_05700 13566 14711 gene locus_tag LOCUS_05710 13566 14711 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_05710 14708 15463 gene locus_tag LOCUS_05720 14708 15463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 15468 16208 gene locus_tag LOCUS_05730 15468 16208 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203389.1 protein_id gnl|my_center|LOCUS_05730 16205 16963 gene locus_tag LOCUS_05740 16205 16963 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_05740 17873 16965 gene locus_tag LOCUS_05750 17873 16965 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_05750 17945 19831 gene locus_tag LOCUS_05760 17945 19831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_05760 20882 19851 gene locus_tag LOCUS_05770 20882 19851 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_05770 21506 20901 gene locus_tag LOCUS_05780 21506 20901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_05780 21646 22656 gene locus_tag LOCUS_05790 gene pdxB 21646 22656 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV5 protein_id gnl|my_center|LOCUS_05790 22816 23052 gene locus_tag LOCUS_05800 gene acpP 22816 23052 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_05800 23068 24333 gene locus_tag LOCUS_05810 23068 24333 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E7 protein_id gnl|my_center|LOCUS_05810 24337 25356 gene locus_tag LOCUS_05820 gene rnc 24337 25356 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E8 protein_id gnl|my_center|LOCUS_05820 >Feature sequence024 <1 760 gene locus_tag LOCUS_05830 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765636.1:alpha-amylase 887 2545 gene locus_tag LOCUS_05840 887 2545 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_05840 2550 3797 gene locus_tag LOCUS_05850 2550 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786796.1 protein_id gnl|my_center|LOCUS_05850 4432 3836 gene locus_tag LOCUS_05860 4432 3836 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_05860 5326 4439 gene locus_tag LOCUS_05870 5326 4439 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109173.1 protein_id gnl|my_center|LOCUS_05870 5484 6713 gene locus_tag LOCUS_05880 gene dapL 5484 6713 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SY6 protein_id gnl|my_center|LOCUS_05880 6770 8959 gene locus_tag LOCUS_05890 6770 8959 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_05890 9121 10782 gene locus_tag LOCUS_05900 9121 10782 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VB3 protein_id gnl|my_center|LOCUS_05900 10806 12803 gene locus_tag LOCUS_05910 gene fbp 10806 12803 CDS product fructose-1,6-bisphosphatase class 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VB2 protein_id gnl|my_center|LOCUS_05910 15034 12956 gene locus_tag LOCUS_05920 gene yesW 15034 12956 CDS product rhamnogalacturonan endolyase YesW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31526 protein_id gnl|my_center|LOCUS_05920 16832 15081 gene locus_tag LOCUS_05930 16832 15081 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761942.1 protein_id gnl|my_center|LOCUS_05930 19871 16851 gene locus_tag LOCUS_05940 19871 16851 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108499.1 protein_id gnl|my_center|LOCUS_05940 21894 19912 gene locus_tag LOCUS_05950 21894 19912 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761944.1 protein_id gnl|my_center|LOCUS_05950 <24848 21914 gene locus_tag LOCUS_05960 <24848 21914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108498.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence025 3428 2373 gene locus_tag LOCUS_05970 3428 2373 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108909.1 protein_id gnl|my_center|LOCUS_05970 4680 3418 gene locus_tag LOCUS_05980 4680 3418 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767090.1 protein_id gnl|my_center|LOCUS_05980 5616 4693 gene locus_tag LOCUS_05990 5616 4693 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767091.1 protein_id gnl|my_center|LOCUS_05990 6564 5632 gene locus_tag LOCUS_06000 6564 5632 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762562.1 protein_id gnl|my_center|LOCUS_06000 6957 6577 gene locus_tag LOCUS_06010 6957 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767034.1 protein_id gnl|my_center|LOCUS_06010 8573 6972 gene locus_tag LOCUS_06020 8573 6972 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_06020 8830 9684 gene locus_tag LOCUS_06030 8830 9684 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767033.1 protein_id gnl|my_center|LOCUS_06030 11386 9698 gene locus_tag LOCUS_06040 11386 9698 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_06040 11689 11408 gene locus_tag LOCUS_06050 11689 11408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06050 14461 11714 gene locus_tag LOCUS_06060 14461 11714 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785431.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06060 16801 14984 gene locus_tag LOCUS_06070 16801 14984 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767036.1 protein_id gnl|my_center|LOCUS_06070 17250 18653 gene locus_tag LOCUS_06080 17250 18653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202030.1 protein_id gnl|my_center|LOCUS_06080 18681 19412 gene locus_tag LOCUS_06090 18681 19412 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z22 protein_id gnl|my_center|LOCUS_06090 19479 22073 gene locus_tag LOCUS_06100 19479 22073 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_06100 22117 22608 gene locus_tag LOCUS_06110 22117 22608 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_06110 22689 23243 gene locus_tag LOCUS_06120 22689 23243 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784365.1 protein_id gnl|my_center|LOCUS_06120 23347 24192 gene locus_tag LOCUS_06130 gene murI 23347 24192 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E4 protein_id gnl|my_center|LOCUS_06130 >Feature sequence026 2 802 gene locus_tag LOCUS_06140 2 802 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291522.1 protein_id gnl|my_center|LOCUS_06140 805 1380 gene locus_tag LOCUS_06150 805 1380 CDS product conjugal transfer protein TraO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291523.1 protein_id gnl|my_center|LOCUS_06150 1389 2288 gene locus_tag LOCUS_06160 1389 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291524.1 protein_id gnl|my_center|LOCUS_06160 2288 2794 gene locus_tag LOCUS_06170 2288 2794 CDS product conjugal transfer protein TraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291525.1 protein_id gnl|my_center|LOCUS_06170 2794 3318 gene locus_tag LOCUS_06180 2794 3318 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008674060.1 protein_id gnl|my_center|LOCUS_06180 3602 3381 gene locus_tag LOCUS_06190 3602 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203040.1 protein_id gnl|my_center|LOCUS_06190 4027 3719 gene locus_tag LOCUS_06200 4027 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06200 4329 4081 gene locus_tag LOCUS_06210 4329 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4544 4326 gene locus_tag LOCUS_06220 4544 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485418.1 protein_id gnl|my_center|LOCUS_06220 4833 4576 gene locus_tag LOCUS_06230 4833 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291531.1 protein_id gnl|my_center|LOCUS_06230 6123 4858 gene locus_tag LOCUS_06240 6123 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291532.1 protein_id gnl|my_center|LOCUS_06240 6593 6120 gene locus_tag LOCUS_06250 6593 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291533.1 protein_id gnl|my_center|LOCUS_06250 6784 6563 gene locus_tag LOCUS_06260 6784 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 7354 7019 gene locus_tag LOCUS_06270 7354 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323450.1 protein_id gnl|my_center|LOCUS_06270 8424 9410 gene locus_tag LOCUS_06280 8424 9410 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A382 protein_id gnl|my_center|LOCUS_06280 10410 9430 gene locus_tag LOCUS_06290 10410 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761715.1 protein_id gnl|my_center|LOCUS_06290 11411 10401 gene locus_tag LOCUS_06300 11411 10401 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_06300 12318 11416 gene locus_tag LOCUS_06310 12318 11416 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_06310 12467 14617 gene locus_tag LOCUS_06320 gene rnr 12467 14617 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A378 protein_id gnl|my_center|LOCUS_06320 14827 14696 gene locus_tag LOCUS_06330 14827 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 14916 15821 gene locus_tag LOCUS_06340 14916 15821 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_06340 18570 16003 gene locus_tag LOCUS_06350 18570 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 20346 18889 gene locus_tag LOCUS_06360 20346 18889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 22698 20389 gene locus_tag LOCUS_06370 22698 20389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 <24264 22722 gene locus_tag LOCUS_06380 <24264 22722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2Z5:alpha-1,3-galactosidase A >Feature sequence027 <1 771 gene locus_tag LOCUS_06390 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004311260.1:integrase 1129 836 gene locus_tag LOCUS_06400 1129 836 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311261.1 protein_id gnl|my_center|LOCUS_06400 2007 2951 gene locus_tag LOCUS_06410 2007 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 5086 2897 gene locus_tag LOCUS_06420 5086 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 5241 5555 gene locus_tag LOCUS_06430 5241 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 6213 5482 gene locus_tag LOCUS_06440 6213 5482 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766277.1 protein_id gnl|my_center|LOCUS_06440 6404 6676 gene locus_tag LOCUS_06450 6404 6676 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004327090.1 protein_id gnl|my_center|LOCUS_06450 8815 6623 gene locus_tag LOCUS_06460 8815 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008650629.1 protein_id gnl|my_center|LOCUS_06460 11019 8818 gene locus_tag LOCUS_06470 11019 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108060.1 protein_id gnl|my_center|LOCUS_06470 13173 11026 gene locus_tag LOCUS_06480 13173 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311267.1 protein_id gnl|my_center|LOCUS_06480 14793 13231 gene locus_tag LOCUS_06490 14793 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004327091.1 protein_id gnl|my_center|LOCUS_06490 16016 14817 gene locus_tag LOCUS_06500 16016 14817 CDS product DUF4876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008774664.1 protein_id gnl|my_center|LOCUS_06500 19026 16102 gene locus_tag LOCUS_06510 19026 16102 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821497.1 protein_id gnl|my_center|LOCUS_06510 21763 19883 gene locus_tag LOCUS_06520 21763 19883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 23809 23021 gene locus_tag LOCUS_06530 23809 23021 CDS product conjugal transfer protein TraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766284.1 protein_id gnl|my_center|LOCUS_06530 24136 23885 gene locus_tag LOCUS_06540 24136 23885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence028 1450 419 gene locus_tag LOCUS_06550 gene lpxD 1450 419 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW8 protein_id gnl|my_center|LOCUS_06550 2546 1722 gene locus_tag LOCUS_06560 gene pyrF 2546 1722 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A012 protein_id gnl|my_center|LOCUS_06560 3727 2618 gene locus_tag LOCUS_06570 gene prfA 3727 2618 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW5 protein_id gnl|my_center|LOCUS_06570 4475 3972 gene locus_tag LOCUS_06580 4475 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5701 4550 gene locus_tag LOCUS_06590 5701 4550 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_06590 7421 5802 gene locus_tag LOCUS_06600 7421 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107959.1 protein_id gnl|my_center|LOCUS_06600 7639 9069 gene locus_tag LOCUS_06610 7639 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_06610 9158 10378 gene locus_tag LOCUS_06620 9158 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_06620 11874 10447 gene locus_tag LOCUS_06630 11874 10447 CDS product polygalacturonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109141.1 protein_id gnl|my_center|LOCUS_06630 12058 13341 gene locus_tag LOCUS_06640 12058 13341 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_06640 13644 15200 gene locus_tag LOCUS_06650 13644 15200 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109150.1 protein_id gnl|my_center|LOCUS_06650 15212 15526 gene locus_tag LOCUS_06660 gene rhaM 15212 15526 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A044 protein_id gnl|my_center|LOCUS_06660 15622 19932 gene locus_tag LOCUS_06670 15622 19932 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109153.1 protein_id gnl|my_center|LOCUS_06670 20123 20602 gene locus_tag LOCUS_06680 20123 20602 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761061.1 protein_id gnl|my_center|LOCUS_06680 21108 20614 gene locus_tag LOCUS_06690 21108 20614 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A638 protein_id gnl|my_center|LOCUS_06690 21921 21127 gene locus_tag LOCUS_06700 gene thyA 21921 21127 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PV5 protein_id gnl|my_center|LOCUS_06700 >Feature sequence029 1862 927 gene locus_tag LOCUS_06710 1862 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 4545 1879 gene locus_tag LOCUS_06720 4545 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 5651 4743 gene locus_tag LOCUS_06730 5651 4743 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003303.1 protein_id gnl|my_center|LOCUS_06730 7021 5648 gene locus_tag LOCUS_06740 7021 5648 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_06740 8386 7034 gene locus_tag LOCUS_06750 8386 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 10383 8383 gene locus_tag LOCUS_06760 10383 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 11509 10502 gene locus_tag LOCUS_06770 11509 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 13202 11535 gene locus_tag LOCUS_06780 13202 11535 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794975.1 protein_id gnl|my_center|LOCUS_06780 16247 13215 gene locus_tag LOCUS_06790 16247 13215 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_06790 18688 16274 gene locus_tag LOCUS_06800 18688 16274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence030 410 3775 gene locus_tag LOCUS_06810 410 3775 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817018.1 protein_id gnl|my_center|LOCUS_06810 3789 5348 gene locus_tag LOCUS_06820 3789 5348 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795011.1 protein_id gnl|my_center|LOCUS_06820 5446 6924 gene locus_tag LOCUS_06830 5446 6924 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202535.1 protein_id gnl|my_center|LOCUS_06830 6894 7472 gene locus_tag LOCUS_06840 6894 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06840 7560 8954 gene locus_tag LOCUS_06850 7560 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06850 8982 9644 gene locus_tag LOCUS_06860 8982 9644 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_06860 9646 11721 gene locus_tag LOCUS_06870 9646 11721 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202541.1 protein_id gnl|my_center|LOCUS_06870 12971 11808 gene locus_tag LOCUS_06880 12971 11808 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_06880 13471 16677 gene locus_tag LOCUS_06890 13471 16677 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202118.1 protein_id gnl|my_center|LOCUS_06890 16664 18457 gene locus_tag LOCUS_06900 16664 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784783.1 protein_id gnl|my_center|LOCUS_06900 18597 20117 gene locus_tag LOCUS_06910 18597 20117 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence031 2 76 gene locus_tag LOCUS_t00150 2 76 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1015 149 gene locus_tag LOCUS_06920 1015 149 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_06920 1131 1946 gene locus_tag LOCUS_06930 1131 1946 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766741.1 protein_id gnl|my_center|LOCUS_06930 1965 3146 gene locus_tag LOCUS_06940 gene uxuA 1965 3146 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABI1 protein_id gnl|my_center|LOCUS_06940 3984 3148 gene locus_tag LOCUS_06950 3984 3148 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202128.1 protein_id gnl|my_center|LOCUS_06950 4131 5321 gene locus_tag LOCUS_06960 4131 5321 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784833.1 protein_id gnl|my_center|LOCUS_06960 5863 6675 gene locus_tag LOCUS_06970 5863 6675 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786103.1 protein_id gnl|my_center|LOCUS_06970 7021 6833 gene locus_tag LOCUS_06980 7021 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 7767 7174 gene locus_tag LOCUS_06990 7767 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 8378 7992 gene locus_tag LOCUS_07000 8378 7992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 8896 8405 gene locus_tag LOCUS_07010 8896 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 9772 9017 gene locus_tag LOCUS_07020 9772 9017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 10993 10406 gene locus_tag LOCUS_07030 10993 10406 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108557.1 protein_id gnl|my_center|LOCUS_07030 11595 11149 gene locus_tag LOCUS_07040 11595 11149 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 protein_id gnl|my_center|LOCUS_07040 12699 11680 gene locus_tag LOCUS_07050 12699 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108555.1 protein_id gnl|my_center|LOCUS_07050 13844 13035 gene locus_tag LOCUS_07060 13844 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 14341 14168 gene locus_tag LOCUS_07070 14341 14168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 16331 14562 gene locus_tag LOCUS_07080 16331 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107539.1 protein_id gnl|my_center|LOCUS_07080 16759 16328 gene locus_tag LOCUS_07090 16759 16328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107540.1 protein_id gnl|my_center|LOCUS_07090 17342 16818 gene locus_tag LOCUS_07100 17342 16818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 18362 17520 gene locus_tag LOCUS_07110 18362 17520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203297.1 protein_id gnl|my_center|LOCUS_07110 18921 20150 gene locus_tag LOCUS_07120 18921 20150 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109071.1 protein_id gnl|my_center|LOCUS_07120 20164 21384 gene locus_tag LOCUS_07130 20164 21384 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109070.1 protein_id gnl|my_center|LOCUS_07130 21388 21780 gene locus_tag LOCUS_07140 21388 21780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109069.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence032 3433 2111 gene locus_tag LOCUS_07150 3433 2111 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_07150 4989 3520 gene locus_tag LOCUS_07160 4989 3520 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203710.1 protein_id gnl|my_center|LOCUS_07160 6219 5119 gene locus_tag LOCUS_07170 6219 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07170 7050 6259 gene locus_tag LOCUS_07180 7050 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07180 10541 7059 gene locus_tag LOCUS_07190 10541 7059 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813489.1 protein_id gnl|my_center|LOCUS_07190 11874 10789 gene locus_tag LOCUS_07200 11874 10789 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201912.1 protein_id gnl|my_center|LOCUS_07200 12638 12042 gene locus_tag LOCUS_07210 12638 12042 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766239.1 protein_id gnl|my_center|LOCUS_07210 14432 13122 gene locus_tag LOCUS_07220 14432 13122 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991962.1 protein_id gnl|my_center|LOCUS_07220 15262 14429 gene locus_tag LOCUS_07230 15262 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 17043 15259 gene locus_tag LOCUS_07240 17043 15259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_07240 17488 17054 gene locus_tag LOCUS_07250 gene dut 17488 17054 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZK3 protein_id gnl|my_center|LOCUS_07250 17628 18959 gene locus_tag LOCUS_07260 17628 18959 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201931.1 protein_id gnl|my_center|LOCUS_07260 19958 18969 gene locus_tag LOCUS_07270 19958 18969 CDS product hemolysin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_07270 20805 19987 gene locus_tag LOCUS_07280 20805 19987 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784029.1 protein_id gnl|my_center|LOCUS_07280 21072 21986 gene locus_tag LOCUS_07290 gene rsmH 21072 21986 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZL4 protein_id gnl|my_center|LOCUS_07290 >Feature sequence033 3832 68 gene locus_tag LOCUS_07300 3832 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 4274 3822 gene locus_tag LOCUS_07310 4274 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291461.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07310 6528 4438 gene locus_tag LOCUS_07320 6528 4438 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291456.1 protein_id gnl|my_center|LOCUS_07320 8138 6588 gene locus_tag LOCUS_07330 8138 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291455.1 protein_id gnl|my_center|LOCUS_07330 8535 8185 gene locus_tag LOCUS_07340 8535 8185 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291454.1 protein_id gnl|my_center|LOCUS_07340 8880 8539 gene locus_tag LOCUS_07350 8880 8539 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291432.1 protein_id gnl|my_center|LOCUS_07350 9182 9475 gene locus_tag LOCUS_07360 9182 9475 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004339344.1 protein_id gnl|my_center|LOCUS_07360 9515 9820 gene locus_tag LOCUS_07370 9515 9820 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291424.1 protein_id gnl|my_center|LOCUS_07370 10262 9900 gene locus_tag LOCUS_07380 10262 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291423.1 protein_id gnl|my_center|LOCUS_07380 11437 10274 gene locus_tag LOCUS_07390 11437 10274 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291422.1 protein_id gnl|my_center|LOCUS_07390 11902 13368 gene locus_tag LOCUS_07400 11902 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 13388 15808 gene locus_tag LOCUS_07410 13388 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_07410 15917 18181 gene locus_tag LOCUS_07420 15917 18181 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533398.1 protein_id gnl|my_center|LOCUS_07420 18332 19333 gene locus_tag LOCUS_07430 18332 19333 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796125.1 protein_id gnl|my_center|LOCUS_07430 19482 20783 gene locus_tag LOCUS_07440 19482 20783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963488.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence034 <1 1054 gene locus_tag LOCUS_07450 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108263.1:transglutaminase 1091 2728 gene locus_tag LOCUS_07460 1091 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108262.1 protein_id gnl|my_center|LOCUS_07460 2913 4469 gene locus_tag LOCUS_07470 2913 4469 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_07470 4494 5375 gene locus_tag LOCUS_07480 4494 5375 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968795.1 protein_id gnl|my_center|LOCUS_07480 5664 7466 gene locus_tag LOCUS_07490 5664 7466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 7499 8071 gene locus_tag LOCUS_07500 7499 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 8169 8555 gene locus_tag LOCUS_07510 8169 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 8633 8926 gene locus_tag LOCUS_07520 8633 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07520 8942 10531 gene locus_tag LOCUS_07530 8942 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 10640 10822 gene locus_tag LOCUS_07540 10640 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 12972 10867 gene locus_tag LOCUS_07550 12972 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 13918 13064 gene locus_tag LOCUS_07560 13918 13064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 14948 14037 gene locus_tag LOCUS_07570 14948 14037 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_07570 15183 16034 gene locus_tag LOCUS_07580 15183 16034 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_07580 16863 16048 gene locus_tag LOCUS_07590 16863 16048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07590 17204 16869 gene locus_tag LOCUS_07600 17204 16869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07600 18402 17215 gene locus_tag LOCUS_07610 18402 17215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 20829 18730 gene locus_tag LOCUS_07620 20829 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence035 1997 1551 gene locus_tag LOCUS_07630 1997 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795018.1 protein_id gnl|my_center|LOCUS_07630 3255 2017 gene locus_tag LOCUS_07640 3255 2017 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_07640 4478 3294 gene locus_tag LOCUS_07650 4478 3294 CDS product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 protein_id gnl|my_center|LOCUS_07650 5406 4489 gene locus_tag LOCUS_07660 5406 4489 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786611.1 protein_id gnl|my_center|LOCUS_07660 6526 5498 gene locus_tag LOCUS_07670 6526 5498 CDS product mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202544.1 protein_id gnl|my_center|LOCUS_07670 6880 8088 gene locus_tag LOCUS_07680 6880 8088 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_07680 8360 8151 gene locus_tag LOCUS_07690 8360 8151 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_07690 8609 8373 gene locus_tag LOCUS_07700 8609 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 9184 8624 gene locus_tag LOCUS_07710 9184 8624 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791337.1 protein_id gnl|my_center|LOCUS_07710 10134 9301 gene locus_tag LOCUS_07720 10134 9301 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108347.1 protein_id gnl|my_center|LOCUS_07720 10480 10160 gene locus_tag LOCUS_07730 10480 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 10959 11555 gene locus_tag LOCUS_07740 10959 11555 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_07740 11622 12626 gene locus_tag LOCUS_07750 11622 12626 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_07750 12860 16165 gene locus_tag LOCUS_07760 12860 16165 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785431.1 protein_id gnl|my_center|LOCUS_07760 16172 17812 gene locus_tag LOCUS_07770 16172 17812 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 protein_id gnl|my_center|LOCUS_07770 17833 19389 gene locus_tag LOCUS_07780 17833 19389 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795196.1 protein_id gnl|my_center|LOCUS_07780 19697 20626 gene locus_tag LOCUS_07790 19697 20626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence036 2319 481 gene locus_tag LOCUS_07800 2319 481 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_07800 5415 2326 gene locus_tag LOCUS_07810 5415 2326 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_07810 7302 6025 gene locus_tag LOCUS_07820 7302 6025 CDS product voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037141.1 protein_id gnl|my_center|LOCUS_07820 8791 7757 gene locus_tag LOCUS_07830 8791 7757 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_07830 9568 8966 gene locus_tag LOCUS_07840 9568 8966 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA43 protein_id gnl|my_center|LOCUS_07840 10172 9588 gene locus_tag LOCUS_07850 10172 9588 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T35 protein_id gnl|my_center|LOCUS_07850 10841 10185 gene locus_tag LOCUS_07860 10841 10185 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T34 protein_id gnl|my_center|LOCUS_07860 11827 10838 gene locus_tag LOCUS_07870 11827 10838 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA46 protein_id gnl|my_center|LOCUS_07870 13132 11840 gene locus_tag LOCUS_07880 13132 11840 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA47 protein_id gnl|my_center|LOCUS_07880 14179 13211 gene locus_tag LOCUS_07890 14179 13211 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_07890 15961 14765 gene locus_tag LOCUS_07900 15961 14765 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_07900 16580 16074 gene locus_tag LOCUS_07910 16580 16074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 18746 16965 gene locus_tag LOCUS_07920 gene lepA 18746 16965 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T74 protein_id gnl|my_center|LOCUS_07920 18852 19433 gene locus_tag LOCUS_07930 18852 19433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_07930 19542 20369 gene locus_tag LOCUS_07940 19542 20369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764420.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence037 1360 23 gene locus_tag LOCUS_07950 gene trkA 1360 23 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_07950 3264 1357 gene locus_tag LOCUS_07960 gene dxs 3264 1357 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y02 protein_id gnl|my_center|LOCUS_07960 3348 4334 gene locus_tag LOCUS_07970 3348 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_07970 4310 6775 gene locus_tag LOCUS_07980 4310 6775 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202184.1 protein_id gnl|my_center|LOCUS_07980 7470 6868 gene locus_tag LOCUS_07990 7470 6868 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798230.1 protein_id gnl|my_center|LOCUS_07990 7745 7467 gene locus_tag LOCUS_08000 7745 7467 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763960.1 protein_id gnl|my_center|LOCUS_08000 8414 7935 gene locus_tag LOCUS_08010 8414 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796794.1 protein_id gnl|my_center|LOCUS_08010 8913 8404 gene locus_tag LOCUS_08020 8913 8404 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_08020 9752 8979 gene locus_tag LOCUS_08030 gene argB 9752 8979 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_08030 11662 9770 gene locus_tag LOCUS_08040 gene speA 11662 9770 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT8 protein_id gnl|my_center|LOCUS_08040 12218 11694 gene locus_tag LOCUS_08050 gene aroK 12218 11694 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B2 protein_id gnl|my_center|LOCUS_08050 14548 12215 gene locus_tag LOCUS_08060 gene topA 14548 12215 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MY0 protein_id gnl|my_center|LOCUS_08060 14674 15084 gene locus_tag LOCUS_08070 14674 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763662.1 protein_id gnl|my_center|LOCUS_08070 15524 16915 gene locus_tag LOCUS_08080 15524 16915 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_08080 16940 17860 gene locus_tag LOCUS_08090 gene kduI2 16940 17860 CDS product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0B5 protein_id gnl|my_center|LOCUS_08090 18141 19538 gene locus_tag LOCUS_08100 18141 19538 CDS product hexuronate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109100.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence038 1371 46 gene locus_tag LOCUS_08110 1371 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119390.1 protein_id gnl|my_center|LOCUS_08110 3903 1435 gene locus_tag LOCUS_08120 3903 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 6446 4188 gene locus_tag LOCUS_08130 6446 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 7484 6465 gene locus_tag LOCUS_08140 7484 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 9281 7506 gene locus_tag LOCUS_08150 9281 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_08150 12153 9307 gene locus_tag LOCUS_08160 12153 9307 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_08160 14093 12195 gene locus_tag LOCUS_08170 14093 12195 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109121.1 protein_id gnl|my_center|LOCUS_08170 17160 14107 gene locus_tag LOCUS_08180 17160 14107 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_08180 <20093 18020 gene locus_tag LOCUS_08190 <20093 18020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107974.1:xylosidase >Feature sequence039 564 1847 gene locus_tag LOCUS_08200 564 1847 CDS product O-acetylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_08200 3091 1919 gene locus_tag LOCUS_08210 3091 1919 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582733.1 protein_id gnl|my_center|LOCUS_08210 5431 3248 gene locus_tag LOCUS_08220 gene pnp 5431 3248 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4N6 protein_id gnl|my_center|LOCUS_08220 5678 6823 gene locus_tag LOCUS_08230 5678 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791376.1 protein_id gnl|my_center|LOCUS_08230 7110 7574 gene locus_tag LOCUS_08240 gene greA 7110 7574 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N75 protein_id gnl|my_center|LOCUS_08240 7628 8035 gene locus_tag LOCUS_08250 7628 8035 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_08250 8149 10524 gene locus_tag LOCUS_08260 8149 10524 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_08260 11655 10612 gene locus_tag LOCUS_08270 11655 10612 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_08270 11822 11906 gene locus_tag LOCUS_t00160 11822 11906 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12079 12888 gene locus_tag LOCUS_08280 12079 12888 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667016.1 protein_id gnl|my_center|LOCUS_08280 13744 13019 gene locus_tag LOCUS_08290 13744 13019 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108482.1 protein_id gnl|my_center|LOCUS_08290 15569 13929 gene locus_tag LOCUS_08300 15569 13929 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765358.1 protein_id gnl|my_center|LOCUS_08300 16638 15574 gene locus_tag LOCUS_08310 16638 15574 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108483.1 protein_id gnl|my_center|LOCUS_08310 18126 16720 gene locus_tag LOCUS_08320 18126 16720 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765356.1 protein_id gnl|my_center|LOCUS_08320 19759 18560 gene locus_tag LOCUS_08330 19759 18560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence040 <1 540 gene locus_tag LOCUS_08340 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107211.1:glycosyl hydrolase 642 2240 gene locus_tag LOCUS_08350 642 2240 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SU9 protein_id gnl|my_center|LOCUS_08350 2936 2568 gene locus_tag LOCUS_08360 2936 2568 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_08360 4157 2943 gene locus_tag LOCUS_08370 4157 2943 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_08370 4324 5211 gene locus_tag LOCUS_08380 4324 5211 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_08380 5217 6236 gene locus_tag LOCUS_08390 5217 6236 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763251.1 protein_id gnl|my_center|LOCUS_08390 6252 7100 gene locus_tag LOCUS_08400 6252 7100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 7113 8819 gene locus_tag LOCUS_08410 7113 8819 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_08410 8956 12033 gene locus_tag LOCUS_08420 8956 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 12950 12405 gene locus_tag LOCUS_08430 12950 12405 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_08430 13082 13483 gene locus_tag LOCUS_08440 13082 13483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203266.1 protein_id gnl|my_center|LOCUS_08440 13673 14089 gene locus_tag LOCUS_08450 13673 14089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 16721 14337 gene locus_tag LOCUS_08460 16721 14337 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800665.1 protein_id gnl|my_center|LOCUS_08460 19104 16756 gene locus_tag LOCUS_08470 19104 16756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence041 1467 742 gene locus_tag LOCUS_08480 1467 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 protein_id gnl|my_center|LOCUS_08480 3708 1468 gene locus_tag LOCUS_08490 3708 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 4924 3701 gene locus_tag LOCUS_08500 4924 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 7340 4917 gene locus_tag LOCUS_08510 7340 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 7781 10240 gene locus_tag LOCUS_08520 7781 10240 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_08520 10258 11103 gene locus_tag LOCUS_08530 10258 11103 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787242.1 protein_id gnl|my_center|LOCUS_08530 11309 14152 gene locus_tag LOCUS_08540 11309 14152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 14290 16764 gene locus_tag LOCUS_08550 14290 16764 CDS product xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108922.1 protein_id gnl|my_center|LOCUS_08550 18441 16867 gene locus_tag LOCUS_08560 18441 16867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_08560 18991 18377 gene locus_tag LOCUS_08570 18991 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 19633 19061 gene locus_tag LOCUS_08580 19633 19061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence042 741 3599 gene locus_tag LOCUS_08590 741 3599 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_08590 3768 5237 gene locus_tag LOCUS_08600 3768 5237 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_08600 5319 6128 gene locus_tag LOCUS_08610 5319 6128 CDS product beta-glucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822185.1 protein_id gnl|my_center|LOCUS_08610 6325 6516 gene locus_tag LOCUS_08620 6325 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 6702 7511 gene locus_tag LOCUS_08630 6702 7511 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_08630 7508 8626 gene locus_tag LOCUS_08640 7508 8626 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203171.1 protein_id gnl|my_center|LOCUS_08640 8698 10767 gene locus_tag LOCUS_08650 gene ppk 8698 10767 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SY4 protein_id gnl|my_center|LOCUS_08650 10783 11769 gene locus_tag LOCUS_08660 10783 11769 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107314.1 protein_id gnl|my_center|LOCUS_08660 12414 11857 gene locus_tag LOCUS_08670 12414 11857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_08670 12541 15162 gene locus_tag LOCUS_08680 gene mutS 12541 15162 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A334 protein_id gnl|my_center|LOCUS_08680 15175 15954 gene locus_tag LOCUS_08690 15175 15954 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_08690 16366 16022 gene locus_tag LOCUS_08700 16366 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 16753 16448 gene locus_tag LOCUS_08710 16753 16448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 17334 16783 gene locus_tag LOCUS_08720 17334 16783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 17784 18086 gene locus_tag LOCUS_08730 17784 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008777642.1 protein_id gnl|my_center|LOCUS_08730 18272 18198 gene locus_tag LOCUS_t00170 18272 18198 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 <19542 18889 gene locus_tag LOCUS_08740 <19542 18889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MG0:quinolinate synthase A >Feature sequence043 1490 294 gene locus_tag LOCUS_08750 1490 294 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788929.1 protein_id gnl|my_center|LOCUS_08750 2061 3446 gene locus_tag LOCUS_08760 2061 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3858 3583 gene locus_tag LOCUS_08770 3858 3583 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762348.1 protein_id gnl|my_center|LOCUS_08770 5742 3958 gene locus_tag LOCUS_08780 5742 3958 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_08780 6646 5942 gene locus_tag LOCUS_08790 6646 5942 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_08790 7695 6841 gene locus_tag LOCUS_08800 7695 6841 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_08800 8370 7777 gene locus_tag LOCUS_08810 8370 7777 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A607 protein_id gnl|my_center|LOCUS_08810 8669 9604 gene locus_tag LOCUS_08820 8669 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 9785 10561 gene locus_tag LOCUS_08830 9785 10561 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56318 protein_id gnl|my_center|LOCUS_08830 11454 10558 gene locus_tag LOCUS_08840 11454 10558 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108181.1 protein_id gnl|my_center|LOCUS_08840 11580 12878 gene locus_tag LOCUS_08850 11580 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 13750 12857 gene locus_tag LOCUS_08860 13750 12857 CDS product CepA family class A extended-spectrum beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202336.1 protein_id gnl|my_center|LOCUS_08860 14130 13867 gene locus_tag LOCUS_08870 gene rpmA 14130 13867 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XL7 protein_id gnl|my_center|LOCUS_08870 14559 14152 gene locus_tag LOCUS_08880 gene rplU 14559 14152 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XL6 protein_id gnl|my_center|LOCUS_08880 15262 14618 gene locus_tag LOCUS_08890 15262 14618 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759985.1 protein_id gnl|my_center|LOCUS_08890 15775 15269 gene locus_tag LOCUS_08900 gene ogt1 15775 15269 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189E1 protein_id gnl|my_center|LOCUS_08900 17123 15972 gene locus_tag LOCUS_08910 17123 15972 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109373.1 protein_id gnl|my_center|LOCUS_08910 <19137 17253 gene locus_tag LOCUS_08920 <19137 17253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89YQ1:endonuclease MutS2 >Feature sequence044 <1 1131 gene locus_tag LOCUS_08930 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202102.1:alpha-N-acetylglucosaminidase 1167 2234 gene locus_tag LOCUS_08940 1167 2234 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762566.1 protein_id gnl|my_center|LOCUS_08940 2265 5282 gene locus_tag LOCUS_08950 2265 5282 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_08950 5307 5903 gene locus_tag LOCUS_08960 5307 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 5922 6998 gene locus_tag LOCUS_08970 5922 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 7316 9526 gene locus_tag LOCUS_08980 7316 9526 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760881.1 protein_id gnl|my_center|LOCUS_08980 9634 10947 gene locus_tag LOCUS_08990 9634 10947 CDS product polygalacturonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703154.1 protein_id gnl|my_center|LOCUS_08990 12632 11052 gene locus_tag LOCUS_09000 12632 11052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09000 15203 12687 gene locus_tag LOCUS_09010 15203 12687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09010 16388 15216 gene locus_tag LOCUS_09020 16388 15216 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108639.1 protein_id gnl|my_center|LOCUS_09020 17184 16477 gene locus_tag LOCUS_09030 17184 16477 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767602.1 protein_id gnl|my_center|LOCUS_09030 17294 17470 gene locus_tag LOCUS_09040 17294 17470 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_09040 18557 17550 gene locus_tag LOCUS_09050 18557 17550 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence045 1865 279 gene locus_tag LOCUS_09060 1865 279 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2X1 protein_id gnl|my_center|LOCUS_09060 2106 2465 gene locus_tag LOCUS_09070 2106 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2493 2885 gene locus_tag LOCUS_09080 2493 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2910 4250 gene locus_tag LOCUS_09090 2910 4250 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650Q1 protein_id gnl|my_center|LOCUS_09090 4264 5679 gene locus_tag LOCUS_09100 4264 5679 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108699.1 protein_id gnl|my_center|LOCUS_09100 5896 6690 gene locus_tag LOCUS_09110 5896 6690 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783664.1 protein_id gnl|my_center|LOCUS_09110 6779 8014 gene locus_tag LOCUS_09120 6779 8014 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762841.1 protein_id gnl|my_center|LOCUS_09120 8846 8235 gene locus_tag LOCUS_09130 8846 8235 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_09130 12314 8982 gene locus_tag LOCUS_09140 12314 8982 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108712.1 protein_id gnl|my_center|LOCUS_09140 13193 12426 gene locus_tag LOCUS_09150 13193 12426 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108713.1 protein_id gnl|my_center|LOCUS_09150 14075 13209 gene locus_tag LOCUS_09160 14075 13209 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108714.1 protein_id gnl|my_center|LOCUS_09160 14816 14151 gene locus_tag LOCUS_09170 14816 14151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991902.1 protein_id gnl|my_center|LOCUS_09170 15799 14852 gene locus_tag LOCUS_09180 15799 14852 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_09180 16432 15923 gene locus_tag LOCUS_09190 16432 15923 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_09190 17298 16363 gene locus_tag LOCUS_09200 17298 16363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 18576 17302 gene locus_tag LOCUS_09210 gene purD 18576 17302 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2Q2 protein_id gnl|my_center|LOCUS_09210 18734 18600 gene locus_tag LOCUS_09220 18734 18600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence046 560 5194 gene locus_tag LOCUS_09230 560 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203588.1 protein_id gnl|my_center|LOCUS_09230 5172 7499 gene locus_tag LOCUS_09240 5172 7499 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766928.1 protein_id gnl|my_center|LOCUS_09240 7642 8004 gene locus_tag LOCUS_09250 7642 8004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 8117 8467 gene locus_tag LOCUS_09260 gene nuoA 8117 8467 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y06 protein_id gnl|my_center|LOCUS_09260 8458 9039 gene locus_tag LOCUS_09270 gene nuoB 8458 9039 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y07 protein_id gnl|my_center|LOCUS_09270 9060 10301 gene locus_tag LOCUS_09280 9060 10301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09280 10368 10685 gene locus_tag LOCUS_09290 10368 10685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09290 10741 11832 gene locus_tag LOCUS_09300 gene nuoH 10741 11832 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y09 protein_id gnl|my_center|LOCUS_09300 11849 12298 gene locus_tag LOCUS_09310 gene nuoI 11849 12298 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y10 protein_id gnl|my_center|LOCUS_09310 12315 12830 gene locus_tag LOCUS_09320 12315 12830 CDS product NADH dehydrogenase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785044.1 protein_id gnl|my_center|LOCUS_09320 12843 13160 gene locus_tag LOCUS_09330 gene nuoK 12843 13160 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y12 protein_id gnl|my_center|LOCUS_09330 13187 15076 gene locus_tag LOCUS_09340 13187 15076 CDS product NADH dehydrogenase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785040.1 protein_id gnl|my_center|LOCUS_09340 15098 16579 gene locus_tag LOCUS_09350 15098 16579 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785038.1 protein_id gnl|my_center|LOCUS_09350 16604 18022 gene locus_tag LOCUS_09360 gene nuoN 16604 18022 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y15 protein_id gnl|my_center|LOCUS_09360 >Feature sequence047 275 1816 gene locus_tag LOCUS_09370 275 1816 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786530.1 protein_id gnl|my_center|LOCUS_09370 1841 2452 gene locus_tag LOCUS_09380 gene cysC 1841 2452 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAQ1 protein_id gnl|my_center|LOCUS_09380 2465 3376 gene locus_tag LOCUS_09390 gene cysD 2465 3376 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VR0 protein_id gnl|my_center|LOCUS_09390 3389 4894 gene locus_tag LOCUS_09400 gene cysN 3389 4894 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP9 protein_id gnl|my_center|LOCUS_09400 4953 6059 gene locus_tag LOCUS_09410 4953 6059 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_09410 6414 6130 gene locus_tag LOCUS_09420 6414 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 6970 6314 gene locus_tag LOCUS_09430 6970 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09430 7424 6960 gene locus_tag LOCUS_09440 7424 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09440 9968 7947 gene locus_tag LOCUS_09450 9968 7947 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761956.1 protein_id gnl|my_center|LOCUS_09450 13370 9981 gene locus_tag LOCUS_09460 13370 9981 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761957.1 protein_id gnl|my_center|LOCUS_09460 14702 13692 gene locus_tag LOCUS_09470 14702 13692 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_09470 15391 14768 gene locus_tag LOCUS_09480 15391 14768 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_09480 15992 15384 gene locus_tag LOCUS_09490 15992 15384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 16883 16326 gene locus_tag LOCUS_09500 16883 16326 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764140.1 protein_id gnl|my_center|LOCUS_09500 17625 17810 gene locus_tag LOCUS_09510 17625 17810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence048 290 215 gene locus_tag LOCUS_t00180 290 215 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1460 399 gene locus_tag LOCUS_09520 1460 399 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P6 protein_id gnl|my_center|LOCUS_09520 1640 1969 gene locus_tag LOCUS_09530 1640 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 2054 4939 gene locus_tag LOCUS_09540 2054 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_09540 5039 6472 gene locus_tag LOCUS_09550 5039 6472 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YC9 protein_id gnl|my_center|LOCUS_09550 6998 6432 gene locus_tag LOCUS_09560 6998 6432 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_09560 7813 6989 gene locus_tag LOCUS_09570 7813 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769417.1 protein_id gnl|my_center|LOCUS_09570 8432 7818 gene locus_tag LOCUS_09580 8432 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_09580 8599 10020 gene locus_tag LOCUS_09590 8599 10020 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_09590 11312 10122 gene locus_tag LOCUS_09600 gene kbl 11312 10122 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RZ5 protein_id gnl|my_center|LOCUS_09600 11498 12397 gene locus_tag LOCUS_09610 11498 12397 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762406.1 protein_id gnl|my_center|LOCUS_09610 14033 12495 gene locus_tag LOCUS_09620 14033 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 14176 15990 gene locus_tag LOCUS_09630 14176 15990 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_09630 16832 16083 gene locus_tag LOCUS_09640 16832 16083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763834.1 protein_id gnl|my_center|LOCUS_09640 17636 16962 gene locus_tag LOCUS_09650 gene rsmI 17636 16962 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL7 protein_id gnl|my_center|LOCUS_09650 >Feature sequence049 1136 363 gene locus_tag LOCUS_09660 1136 363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_09660 1876 1133 gene locus_tag LOCUS_09670 1876 1133 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764108.1 protein_id gnl|my_center|LOCUS_09670 2016 2834 gene locus_tag LOCUS_09680 2016 2834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782293.1 protein_id gnl|my_center|LOCUS_09680 3532 4716 gene locus_tag LOCUS_09690 3532 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09690 7063 4769 gene locus_tag LOCUS_09700 7063 4769 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203230.1 protein_id gnl|my_center|LOCUS_09700 7871 7149 gene locus_tag LOCUS_09710 7871 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 9546 7903 gene locus_tag LOCUS_09720 9546 7903 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794975.1 protein_id gnl|my_center|LOCUS_09720 12474 9559 gene locus_tag LOCUS_09730 12474 9559 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202547.1 protein_id gnl|my_center|LOCUS_09730 14796 12616 gene locus_tag LOCUS_09740 gene susB 14796 12616 CDS product glucan 1,4-alpha-glucosidase SusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G8JZS4 protein_id gnl|my_center|LOCUS_09740 16828 14975 gene locus_tag LOCUS_09750 gene susA 16828 14975 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_09750 >Feature sequence050 538 873 gene locus_tag LOCUS_09760 538 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 877 1533 gene locus_tag LOCUS_09770 877 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1556 1864 gene locus_tag LOCUS_09780 1556 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1878 2288 gene locus_tag LOCUS_09790 1878 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2443 2766 gene locus_tag LOCUS_09800 2443 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2738 3394 gene locus_tag LOCUS_09810 2738 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3557 4087 gene locus_tag LOCUS_09820 3557 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4084 4482 gene locus_tag LOCUS_09830 4084 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 4493 4696 gene locus_tag LOCUS_09840 4493 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 7493 5460 gene locus_tag LOCUS_09850 7493 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502257.1 protein_id gnl|my_center|LOCUS_09850 9016 7499 gene locus_tag LOCUS_09860 9016 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 9158 9009 gene locus_tag LOCUS_09870 9158 9009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 9749 9393 gene locus_tag LOCUS_09880 9749 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 10113 11396 gene locus_tag LOCUS_09890 10113 11396 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_09890 11460 12746 gene locus_tag LOCUS_09900 11460 12746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 12759 13823 gene locus_tag LOCUS_09910 12759 13823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202348.1 protein_id gnl|my_center|LOCUS_09910 14045 14353 gene locus_tag LOCUS_09920 14045 14353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809723.1 protein_id gnl|my_center|LOCUS_09920 14365 15432 gene locus_tag LOCUS_09930 14365 15432 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816490.1 protein_id gnl|my_center|LOCUS_09930 15644 16600 gene locus_tag LOCUS_09940 15644 16600 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence051 2284 359 gene locus_tag LOCUS_09950 2284 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_09950 3799 2294 gene locus_tag LOCUS_09960 3799 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783832.1 protein_id gnl|my_center|LOCUS_09960 3953 4963 gene locus_tag LOCUS_09970 gene pfkA3 3953 4963 CDS product ATP-dependent 6-phosphofructokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E9 protein_id gnl|my_center|LOCUS_09970 5440 8592 gene locus_tag LOCUS_09980 5440 8592 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764447.1 protein_id gnl|my_center|LOCUS_09980 8606 10540 gene locus_tag LOCUS_09990 8606 10540 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109175.1 protein_id gnl|my_center|LOCUS_09990 10554 11939 gene locus_tag LOCUS_10000 10554 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 12056 14593 gene locus_tag LOCUS_10010 12056 14593 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764444.1 protein_id gnl|my_center|LOCUS_10010 16149 14668 gene locus_tag LOCUS_10020 gene cysS 16149 14668 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZY1 protein_id gnl|my_center|LOCUS_10020 <17442 16246 gene locus_tag LOCUS_10030 <17442 16246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767043.1:alpha-glucosidase >Feature sequence052 1800 649 gene locus_tag LOCUS_10040 1800 649 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_10040 3330 1834 gene locus_tag LOCUS_10050 3330 1834 CDS product cytochrome d ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763430.1 protein_id gnl|my_center|LOCUS_10050 3590 3372 gene locus_tag LOCUS_10060 3590 3372 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786916.1 protein_id gnl|my_center|LOCUS_10060 3733 5076 gene locus_tag LOCUS_10070 3733 5076 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_10070 5089 6306 gene locus_tag LOCUS_10080 5089 6306 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_10080 6319 7065 gene locus_tag LOCUS_10090 6319 7065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763426.1 protein_id gnl|my_center|LOCUS_10090 7089 8309 gene locus_tag LOCUS_10100 7089 8309 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_10100 8824 9525 gene locus_tag LOCUS_10110 8824 9525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 9522 10253 gene locus_tag LOCUS_10120 9522 10253 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_10120 10598 11782 gene locus_tag LOCUS_10130 10598 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 11869 12036 gene locus_tag LOCUS_10140 11869 12036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 12079 12537 gene locus_tag LOCUS_10150 12079 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 13374 12910 gene locus_tag LOCUS_10160 13374 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793705.1 protein_id gnl|my_center|LOCUS_10160 13862 13371 gene locus_tag LOCUS_10170 13862 13371 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766442.1 protein_id gnl|my_center|LOCUS_10170 14308 13859 gene locus_tag LOCUS_10180 14308 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 14817 14305 gene locus_tag LOCUS_10190 14817 14305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 15124 14819 gene locus_tag LOCUS_10200 15124 14819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 15768 15400 gene locus_tag LOCUS_10210 15768 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 17089 15770 gene locus_tag LOCUS_10220 17089 15770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence053 <1 786 gene locus_tag LOCUS_10230 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PM4:aspartate--ammonia ligase 1548 886 gene locus_tag LOCUS_10240 gene ung2 1548 886 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_10240 4329 1567 gene locus_tag LOCUS_10250 4329 1567 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107153.1 protein_id gnl|my_center|LOCUS_10250 4811 4353 gene locus_tag LOCUS_10260 gene smpB 4811 4353 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RD6 protein_id gnl|my_center|LOCUS_10260 5380 4811 gene locus_tag LOCUS_10270 5380 4811 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769654.1 protein_id gnl|my_center|LOCUS_10270 6608 5775 gene locus_tag LOCUS_10280 6608 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 7244 6735 gene locus_tag LOCUS_10290 7244 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789167.1 protein_id gnl|my_center|LOCUS_10290 7536 8237 gene locus_tag LOCUS_10300 7536 8237 CDS product nitrogen-fixing protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_10300 8258 9268 gene locus_tag LOCUS_10310 8258 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760490.1 protein_id gnl|my_center|LOCUS_10310 9631 10710 gene locus_tag LOCUS_10320 9631 10710 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_10320 10939 12327 gene locus_tag LOCUS_10330 10939 12327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109060.1 protein_id gnl|my_center|LOCUS_10330 12332 13177 gene locus_tag LOCUS_10340 12332 13177 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_10340 13197 14849 gene locus_tag LOCUS_10350 13197 14849 CDS product prophage P2a protein 4; AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101783.1 protein_id gnl|my_center|LOCUS_10350 <17323 14992 gene locus_tag LOCUS_10360 <17323 14992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109062.1:restriction endonuclease >Feature sequence054 358 122 gene locus_tag LOCUS_10370 358 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 616 401 gene locus_tag LOCUS_10380 616 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 881 1789 gene locus_tag LOCUS_10390 881 1789 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_10390 2382 1792 gene locus_tag LOCUS_10400 2382 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2541 2747 gene locus_tag LOCUS_10410 2541 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 3182 2814 gene locus_tag LOCUS_10420 3182 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10420 3351 3163 gene locus_tag LOCUS_10430 3351 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3595 4146 gene locus_tag LOCUS_10440 3595 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4150 4848 gene locus_tag LOCUS_10450 4150 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 5036 6586 gene locus_tag LOCUS_10460 5036 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7634 6690 gene locus_tag LOCUS_10470 7634 6690 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810220.1 protein_id gnl|my_center|LOCUS_10470 7875 8762 gene locus_tag LOCUS_10480 7875 8762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_10480 8775 9953 gene locus_tag LOCUS_10490 8775 9953 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_10490 9958 11445 gene locus_tag LOCUS_10500 9958 11445 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_10500 12027 11608 gene locus_tag LOCUS_10510 12027 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 15189 12061 gene locus_tag LOCUS_10520 15189 12061 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_10520 15847 15194 gene locus_tag LOCUS_10530 15847 15194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 <17026 15854 gene locus_tag LOCUS_10540 <17026 15854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015670.1:transporter >Feature sequence055 435 1388 gene locus_tag LOCUS_10550 435 1388 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107259.1 protein_id gnl|my_center|LOCUS_10550 1622 2632 gene locus_tag LOCUS_10560 1622 2632 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZV8 protein_id gnl|my_center|LOCUS_10560 2756 3667 gene locus_tag LOCUS_10570 gene miaA2 2756 3667 CDS product tRNA dimethylallyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZQ3 protein_id gnl|my_center|LOCUS_10570 3674 4606 gene locus_tag LOCUS_10580 3674 4606 CDS product diacylglycerol kinase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759992.1 protein_id gnl|my_center|LOCUS_10580 4608 5411 gene locus_tag LOCUS_10590 4608 5411 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZQ5 protein_id gnl|my_center|LOCUS_10590 5415 6632 gene locus_tag LOCUS_10600 5415 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785545.1 protein_id gnl|my_center|LOCUS_10600 6735 8009 gene locus_tag LOCUS_10610 6735 8009 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_10610 8315 10222 gene locus_tag LOCUS_10620 8315 10222 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109193.1 protein_id gnl|my_center|LOCUS_10620 10238 11509 gene locus_tag LOCUS_10630 10238 11509 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_10630 11524 12894 gene locus_tag LOCUS_10640 11524 12894 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764493.1 protein_id gnl|my_center|LOCUS_10640 14436 12961 gene locus_tag LOCUS_10650 14436 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202229.1 protein_id gnl|my_center|LOCUS_10650 15278 14463 gene locus_tag LOCUS_10660 15278 14463 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992242.1 protein_id gnl|my_center|LOCUS_10660 15536 16381 gene locus_tag LOCUS_10670 gene panC 15536 16381 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XM3 protein_id gnl|my_center|LOCUS_10670 16385 16738 gene locus_tag LOCUS_10680 gene panD 16385 16738 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XM2 protein_id gnl|my_center|LOCUS_10680 >Feature sequence056 <1 630 gene locus_tag LOCUS_10690 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009293016.1:DNA mismatch repair protein MutS 866 702 gene locus_tag LOCUS_10700 866 702 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459942.1 protein_id gnl|my_center|LOCUS_10700 1650 943 gene locus_tag LOCUS_10710 gene cobB 1650 943 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H9 protein_id gnl|my_center|LOCUS_10710 1798 2382 gene locus_tag LOCUS_10720 1798 2382 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MN6 protein_id gnl|my_center|LOCUS_10720 2395 3249 gene locus_tag LOCUS_10730 2395 3249 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H7 protein_id gnl|my_center|LOCUS_10730 3685 6708 gene locus_tag LOCUS_10740 3685 6708 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785209.1 protein_id gnl|my_center|LOCUS_10740 6797 8551 gene locus_tag LOCUS_10750 6797 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785207.1 protein_id gnl|my_center|LOCUS_10750 8682 10460 gene locus_tag LOCUS_10760 gene glaB 8682 10460 CDS product alpha-1,3-galactosidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV2 protein_id gnl|my_center|LOCUS_10760 12267 10573 gene locus_tag LOCUS_10770 12267 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_10770 12421 14022 gene locus_tag LOCUS_10780 12421 14022 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_10780 14097 15578 gene locus_tag LOCUS_10790 14097 15578 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_10790 15588 16268 gene locus_tag LOCUS_10800 15588 16268 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence057 1329 2390 gene locus_tag LOCUS_10810 1329 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2405 3973 gene locus_tag LOCUS_10820 2405 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3973 4359 gene locus_tag LOCUS_10830 3973 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4369 4878 gene locus_tag LOCUS_10840 4369 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 4875 5441 gene locus_tag LOCUS_10850 4875 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5441 6292 gene locus_tag LOCUS_10860 5441 6292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 6289 6483 gene locus_tag LOCUS_10870 6289 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 6534 7058 gene locus_tag LOCUS_10880 6534 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 7055 7246 gene locus_tag LOCUS_10890 7055 7246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 7246 11010 gene locus_tag LOCUS_10900 7246 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 11007 11567 gene locus_tag LOCUS_10910 11007 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 11603 11848 gene locus_tag LOCUS_10920 11603 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 11898 12296 gene locus_tag LOCUS_10930 11898 12296 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108272.1 protein_id gnl|my_center|LOCUS_10930 12443 12742 gene locus_tag LOCUS_10940 12443 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 12744 13088 gene locus_tag LOCUS_10950 12744 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 13209 15197 gene locus_tag LOCUS_10960 13209 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 15199 16032 gene locus_tag LOCUS_10970 15199 16032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence058 2992 2195 gene locus_tag LOCUS_10980 2992 2195 CDS product NADH pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202441.1 protein_id gnl|my_center|LOCUS_10980 5145 3007 gene locus_tag LOCUS_10990 5145 3007 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_10990 5305 7059 gene locus_tag LOCUS_11000 5305 7059 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_11000 7080 7439 gene locus_tag LOCUS_11010 7080 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 7472 9778 gene locus_tag LOCUS_11020 7472 9778 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_11020 10114 11400 gene locus_tag LOCUS_11030 10114 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_11030 11422 11958 gene locus_tag LOCUS_11040 11422 11958 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766462.1 protein_id gnl|my_center|LOCUS_11040 13406 12024 gene locus_tag LOCUS_11050 13406 12024 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766157.1 protein_id gnl|my_center|LOCUS_11050 15974 13425 gene locus_tag LOCUS_11060 15974 13425 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769702.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence059 218 874 gene locus_tag LOCUS_11070 218 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 948 2234 gene locus_tag LOCUS_11080 948 2234 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_11080 2302 3423 gene locus_tag LOCUS_11090 2302 3423 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAU2 protein_id gnl|my_center|LOCUS_11090 3515 4756 gene locus_tag LOCUS_11100 3515 4756 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786507.1 protein_id gnl|my_center|LOCUS_11100 4842 5996 gene locus_tag LOCUS_11110 4842 5996 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VS5 protein_id gnl|my_center|LOCUS_11110 7238 6069 gene locus_tag LOCUS_11120 7238 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 8436 7261 gene locus_tag LOCUS_11130 8436 7261 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786133.1 protein_id gnl|my_center|LOCUS_11130 8903 12031 gene locus_tag LOCUS_11140 8903 12031 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_11140 12126 13313 gene locus_tag LOCUS_11150 12126 13313 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_11150 13742 14239 gene locus_tag LOCUS_11160 13742 14239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 15557 14352 gene locus_tag LOCUS_11170 15557 14352 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_11170 <16096 15571 gene locus_tag LOCUS_11180 <16096 15571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021381.1:HAD family hydrolase >Feature sequence060 498 1904 gene locus_tag LOCUS_11190 498 1904 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WS5 protein_id gnl|my_center|LOCUS_11190 3217 2021 gene locus_tag LOCUS_11200 3217 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202696.1 protein_id gnl|my_center|LOCUS_11200 3438 4667 gene locus_tag LOCUS_11210 gene pepT 3438 4667 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YZ7 protein_id gnl|my_center|LOCUS_11210 4741 5826 gene locus_tag LOCUS_11220 gene gcvT 4741 5826 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WS3 protein_id gnl|my_center|LOCUS_11220 5950 5877 gene locus_tag LOCUS_t00190 5950 5877 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6043 5959 gene locus_tag LOCUS_t00200 6043 5959 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6588 6094 gene locus_tag LOCUS_11230 gene ribH 6588 6094 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZW8 protein_id gnl|my_center|LOCUS_11230 7371 6694 gene locus_tag LOCUS_11240 7371 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_11240 7520 8641 gene locus_tag LOCUS_11250 gene recF 7520 8641 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XR8 protein_id gnl|my_center|LOCUS_11250 8628 8918 gene locus_tag LOCUS_11260 8628 8918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775689.1 protein_id gnl|my_center|LOCUS_11260 9456 8893 gene locus_tag LOCUS_11270 9456 8893 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XR4 protein_id gnl|my_center|LOCUS_11270 11115 9463 gene locus_tag LOCUS_11280 11115 9463 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_11280 11555 11121 gene locus_tag LOCUS_11290 11555 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_11290 12039 11566 gene locus_tag LOCUS_11300 12039 11566 CDS product DUF4847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764457.1 protein_id gnl|my_center|LOCUS_11300 14087 12048 gene locus_tag LOCUS_11310 14087 12048 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_11310 14807 14121 gene locus_tag LOCUS_11320 14807 14121 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759971.1 protein_id gnl|my_center|LOCUS_11320 14991 15590 gene locus_tag LOCUS_11330 14991 15590 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZS5 protein_id gnl|my_center|LOCUS_11330 >Feature sequence061 <1 1538 gene locus_tag LOCUS_11340 <1 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767049.1:beta-galactosidase 1697 3046 gene locus_tag LOCUS_11350 1697 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461086.1 protein_id gnl|my_center|LOCUS_11350 3167 4516 gene locus_tag LOCUS_11360 3167 4516 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P22 protein_id gnl|my_center|LOCUS_11360 4582 5889 gene locus_tag LOCUS_11370 4582 5889 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P23 protein_id gnl|my_center|LOCUS_11370 5973 7376 gene locus_tag LOCUS_11380 gene asnS 5973 7376 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P24 protein_id gnl|my_center|LOCUS_11380 7560 8015 gene locus_tag LOCUS_11390 7560 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760799.1 protein_id gnl|my_center|LOCUS_11390 8300 8761 gene locus_tag LOCUS_11400 gene rplM 8300 8761 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z6 protein_id gnl|my_center|LOCUS_11400 8768 9154 gene locus_tag LOCUS_11410 gene rpsI 8768 9154 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 protein_id gnl|my_center|LOCUS_11410 9442 10203 gene locus_tag LOCUS_11420 gene rpsB 9442 10203 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z4 protein_id gnl|my_center|LOCUS_11420 10325 11317 gene locus_tag LOCUS_11430 gene tsf 10325 11317 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Z3 protein_id gnl|my_center|LOCUS_11430 11506 13020 gene locus_tag LOCUS_11440 gene gpmI 11506 13020 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN5 protein_id gnl|my_center|LOCUS_11440 13376 13215 gene locus_tag LOCUS_11450 gene rpmH 13376 13215 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z40 protein_id gnl|my_center|LOCUS_11450 13567 14133 gene locus_tag LOCUS_11460 gene efp 13567 14133 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P70889 protein_id gnl|my_center|LOCUS_11460 15811 14210 gene locus_tag LOCUS_11470 15811 14210 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767037.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence062 845 3097 gene locus_tag LOCUS_11480 845 3097 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767047.1 protein_id gnl|my_center|LOCUS_11480 3363 4727 gene locus_tag LOCUS_11490 3363 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 4743 6233 gene locus_tag LOCUS_11500 4743 6233 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948839.1 protein_id gnl|my_center|LOCUS_11500 6313 8250 gene locus_tag LOCUS_11510 6313 8250 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107131.1 protein_id gnl|my_center|LOCUS_11510 8457 10052 gene locus_tag LOCUS_11520 8457 10052 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107137.1 protein_id gnl|my_center|LOCUS_11520 10065 11285 gene locus_tag LOCUS_11530 10065 11285 CDS product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_11530 14618 11370 gene locus_tag LOCUS_11540 14618 11370 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P63 protein_id gnl|my_center|LOCUS_11540 14887 14618 gene locus_tag LOCUS_11550 14887 14618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 15260 14892 gene locus_tag LOCUS_11560 15260 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 15540 15337 gene locus_tag LOCUS_11570 15540 15337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760688.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence063 466 756 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttggatataccattcaaaacaataataaaa 2350 872 gene locus_tag LOCUS_11580 2350 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4072 2516 gene locus_tag LOCUS_11590 4072 2516 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107335.1 protein_id gnl|my_center|LOCUS_11590 7169 4173 gene locus_tag LOCUS_11600 7169 4173 CDS product outer membrane assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201927.1 protein_id gnl|my_center|LOCUS_11600 7854 7192 gene locus_tag LOCUS_11610 7854 7192 CDS product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_11610 9218 7857 gene locus_tag LOCUS_11620 9218 7857 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_11620 9693 9262 gene locus_tag LOCUS_11630 9693 9262 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64W20 protein_id gnl|my_center|LOCUS_11630 10762 9698 gene locus_tag LOCUS_11640 10762 9698 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107826.1 protein_id gnl|my_center|LOCUS_11640 10971 11246 gene locus_tag LOCUS_11650 10971 11246 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_11650 11491 13065 gene locus_tag LOCUS_11660 11491 13065 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_11660 13444 15042 gene locus_tag LOCUS_11670 13444 15042 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence064 1884 2345 gene locus_tag LOCUS_11680 1884 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11680 2355 3221 gene locus_tag LOCUS_11690 2355 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11690 3526 3452 gene locus_tag LOCUS_t00210 3526 3452 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4492 3614 gene locus_tag LOCUS_11700 gene folD 4492 3614 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7B8 protein_id gnl|my_center|LOCUS_11700 4659 5852 gene locus_tag LOCUS_11710 4659 5852 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_11710 5872 6759 gene locus_tag LOCUS_11720 5872 6759 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_11720 7191 8606 gene locus_tag LOCUS_11730 gene dnaA 7191 8606 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PL4 protein_id gnl|my_center|LOCUS_11730 9407 8667 gene locus_tag LOCUS_11740 9407 8667 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_11740 9734 12280 gene locus_tag LOCUS_11750 9734 12280 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203460.1 protein_id gnl|my_center|LOCUS_11750 12383 12754 gene locus_tag LOCUS_11760 12383 12754 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5T9 protein_id gnl|my_center|LOCUS_11760 12761 13417 gene locus_tag LOCUS_11770 12761 13417 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_11770 14682 13582 gene locus_tag LOCUS_11780 14682 13582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 <15453 14700 gene locus_tag LOCUS_11790 <15453 14700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ABF5:tRNA-specific 2-thiouridylase MnmA 1 >Feature sequence065 208 2298 gene locus_tag LOCUS_11800 208 2298 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107278.1 protein_id gnl|my_center|LOCUS_11800 3327 2305 gene locus_tag LOCUS_11810 3327 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201889.1 protein_id gnl|my_center|LOCUS_11810 5990 3336 gene locus_tag LOCUS_11820 5990 3336 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107551.1 protein_id gnl|my_center|LOCUS_11820 7541 6171 gene locus_tag LOCUS_11830 7541 6171 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_11830 8233 7538 gene locus_tag LOCUS_11840 8233 7538 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765779.1 protein_id gnl|my_center|LOCUS_11840 8387 8313 gene locus_tag LOCUS_t00220 8387 8313 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8506 9000 gene locus_tag LOCUS_11850 8506 9000 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108286.1 protein_id gnl|my_center|LOCUS_11850 9132 11579 gene locus_tag LOCUS_11860 9132 11579 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108297.1 protein_id gnl|my_center|LOCUS_11860 11582 11971 gene locus_tag LOCUS_11870 11582 11971 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784476.1 protein_id gnl|my_center|LOCUS_11870 11986 12612 gene locus_tag LOCUS_11880 11986 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206379.1 protein_id gnl|my_center|LOCUS_11880 13243 12575 gene locus_tag LOCUS_11890 13243 12575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791920.1 protein_id gnl|my_center|LOCUS_11890 13410 13961 gene locus_tag LOCUS_11900 13410 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107608.1 protein_id gnl|my_center|LOCUS_11900 13978 14601 gene locus_tag LOCUS_11910 13978 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107609.1 protein_id gnl|my_center|LOCUS_11910 14620 15246 gene locus_tag LOCUS_11920 14620 15246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763514.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence066 439 1713 gene locus_tag LOCUS_11930 439 1713 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_11930 3100 1847 gene locus_tag LOCUS_11940 3100 1847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107160.1 protein_id gnl|my_center|LOCUS_11940 3813 3190 gene locus_tag LOCUS_11950 3813 3190 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_11950 4863 3970 gene locus_tag LOCUS_11960 4863 3970 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109398.1 protein_id gnl|my_center|LOCUS_11960 6116 4932 gene locus_tag LOCUS_11970 6116 4932 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_11970 6302 6144 gene locus_tag LOCUS_11980 6302 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 9823 6326 gene locus_tag LOCUS_11990 9823 6326 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_11990 11147 10146 gene locus_tag LOCUS_12000 11147 10146 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202064.1 protein_id gnl|my_center|LOCUS_12000 11760 11203 gene locus_tag LOCUS_12010 11760 11203 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_12010 14192 12267 gene locus_tag LOCUS_12020 14192 12267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 14580 14206 gene locus_tag LOCUS_12030 14580 14206 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence067 2198 705 gene locus_tag LOCUS_12040 2198 705 CDS product acetyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767431.1 protein_id gnl|my_center|LOCUS_12040 2496 3977 gene locus_tag LOCUS_12050 2496 3977 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203639.1 protein_id gnl|my_center|LOCUS_12050 4011 5384 gene locus_tag LOCUS_12060 4011 5384 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293026.1 protein_id gnl|my_center|LOCUS_12060 5384 5830 gene locus_tag LOCUS_12070 5384 5830 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761597.1 protein_id gnl|my_center|LOCUS_12070 5840 6340 gene locus_tag LOCUS_12080 5840 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765751.1 protein_id gnl|my_center|LOCUS_12080 6723 7817 gene locus_tag LOCUS_12090 6723 7817 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 protein_id gnl|my_center|LOCUS_12090 7814 8467 gene locus_tag LOCUS_12100 7814 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_12100 8536 9297 gene locus_tag LOCUS_12110 gene kdsB 8536 9297 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 protein_id gnl|my_center|LOCUS_12110 9294 10586 gene locus_tag LOCUS_12120 9294 10586 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_12120 10622 10918 gene locus_tag LOCUS_12130 10622 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12130 10955 11779 gene locus_tag LOCUS_12140 10955 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12140 11779 12561 gene locus_tag LOCUS_12150 11779 12561 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108488.1 protein_id gnl|my_center|LOCUS_12150 12635 13300 gene locus_tag LOCUS_12160 12635 13300 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107439.1 protein_id gnl|my_center|LOCUS_12160 13329 13772 gene locus_tag LOCUS_12170 13329 13772 CDS product beta-D-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence068 1554 220 gene locus_tag LOCUS_12180 1554 220 CDS product xanthine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764627.1 protein_id gnl|my_center|LOCUS_12180 2132 1563 gene locus_tag LOCUS_12190 gene xpt 2132 1563 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN7 protein_id gnl|my_center|LOCUS_12190 3179 2298 gene locus_tag LOCUS_12200 3179 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3413 4831 gene locus_tag LOCUS_12210 3413 4831 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766999.1 protein_id gnl|my_center|LOCUS_12210 5729 4833 gene locus_tag LOCUS_12220 5729 4833 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202005.1 protein_id gnl|my_center|LOCUS_12220 7102 5729 gene locus_tag LOCUS_12230 7102 5729 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z78 protein_id gnl|my_center|LOCUS_12230 7193 7603 gene locus_tag LOCUS_12240 7193 7603 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762588.1 protein_id gnl|my_center|LOCUS_12240 8185 7682 gene locus_tag LOCUS_12250 8185 7682 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108357.1 protein_id gnl|my_center|LOCUS_12250 8829 8323 gene locus_tag LOCUS_12260 8829 8323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_12260 8985 8845 gene locus_tag LOCUS_12270 8985 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 10187 9072 gene locus_tag LOCUS_12280 10187 9072 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784130.1 protein_id gnl|my_center|LOCUS_12280 12097 10283 gene locus_tag LOCUS_12290 12097 10283 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762502.1 protein_id gnl|my_center|LOCUS_12290 12223 13287 gene locus_tag LOCUS_12300 12223 13287 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_12300 <15097 13399 gene locus_tag LOCUS_12310 <15097 13399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108684.1:alpha-xylosidase >Feature sequence069 905 1813 gene locus_tag LOCUS_12320 905 1813 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107322.1 protein_id gnl|my_center|LOCUS_12320 3193 1829 gene locus_tag LOCUS_12330 3193 1829 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_12330 5932 3314 gene locus_tag LOCUS_12340 gene alaS 5932 3314 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YB4 protein_id gnl|my_center|LOCUS_12340 6066 7031 gene locus_tag LOCUS_12350 6066 7031 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_12350 7047 7394 gene locus_tag LOCUS_12360 7047 7394 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_12360 8252 7605 gene locus_tag LOCUS_12370 gene nth 8252 7605 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A754 protein_id gnl|my_center|LOCUS_12370 9327 8287 gene locus_tag LOCUS_12380 gene corA 9327 8287 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WW0 protein_id gnl|my_center|LOCUS_12380 10197 9340 gene locus_tag LOCUS_12390 10197 9340 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966216.1 protein_id gnl|my_center|LOCUS_12390 10876 10229 gene locus_tag LOCUS_12400 10876 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 11647 12945 gene locus_tag LOCUS_12410 11647 12945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 13075 13761 gene locus_tag LOCUS_12420 13075 13761 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786205.1 protein_id gnl|my_center|LOCUS_12420 13767 14432 gene locus_tag LOCUS_12430 gene queC 13767 14432 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7F8 protein_id gnl|my_center|LOCUS_12430 14435 14893 gene locus_tag LOCUS_12440 gene queF 14435 14893 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA9 protein_id gnl|my_center|LOCUS_12440 >Feature sequence070 1333 1127 gene locus_tag LOCUS_12450 1333 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2276 1353 gene locus_tag LOCUS_12460 2276 1353 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_12460 3421 2351 gene locus_tag LOCUS_12470 gene serC 3421 2351 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L4 protein_id gnl|my_center|LOCUS_12470 4989 3673 gene locus_tag LOCUS_12480 4989 3673 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_12480 5645 5037 gene locus_tag LOCUS_12490 5645 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12490 9857 5658 gene locus_tag LOCUS_12500 9857 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459235.1 protein_id gnl|my_center|LOCUS_12500 10299 9976 gene locus_tag LOCUS_12510 10299 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 10451 11362 gene locus_tag LOCUS_12520 10451 11362 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_12520 11343 12221 gene locus_tag LOCUS_12530 11343 12221 CDS product type II restriction endonuclease MjaIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_12530 12222 13103 gene locus_tag LOCUS_12540 12222 13103 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24918 protein_id gnl|my_center|LOCUS_12540 13663 13100 gene locus_tag LOCUS_12550 13663 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 14202 13672 gene locus_tag LOCUS_12560 14202 13672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 14413 14204 gene locus_tag LOCUS_12570 14413 14204 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence071 2195 552 gene locus_tag LOCUS_12580 2195 552 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I3 protein_id gnl|my_center|LOCUS_12580 3797 2295 gene locus_tag LOCUS_12590 3797 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 5851 3860 gene locus_tag LOCUS_12600 5851 3860 CDS product DUF4954 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108193.1 protein_id gnl|my_center|LOCUS_12600 7120 5864 gene locus_tag LOCUS_12610 gene hflX 7120 5864 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YK6 protein_id gnl|my_center|LOCUS_12610 8593 7205 gene locus_tag LOCUS_12620 8593 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796344.1 protein_id gnl|my_center|LOCUS_12620 11776 8621 gene locus_tag LOCUS_12630 11776 8621 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792393.1 protein_id gnl|my_center|LOCUS_12630 13148 12123 gene locus_tag LOCUS_12640 13148 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 14804 13182 gene locus_tag LOCUS_12650 14804 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence072 5270 2535 gene locus_tag LOCUS_12660 5270 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107129.1 protein_id gnl|my_center|LOCUS_12660 5564 7309 gene locus_tag LOCUS_12670 5564 7309 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_12670 7489 8646 gene locus_tag LOCUS_12680 7489 8646 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAV6 protein_id gnl|my_center|LOCUS_12680 8695 9372 gene locus_tag LOCUS_12690 8695 9372 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_12690 9377 10066 gene locus_tag LOCUS_12700 gene araD 9377 10066 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_12700 10109 11635 gene locus_tag LOCUS_12710 gene araA 10109 11635 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAW1 protein_id gnl|my_center|LOCUS_12710 11744 13339 gene locus_tag LOCUS_12720 11744 13339 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence073 1922 729 gene locus_tag LOCUS_12730 1922 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2188 1916 gene locus_tag LOCUS_12740 2188 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 5201 2922 gene locus_tag LOCUS_12750 5201 2922 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760913.1 protein_id gnl|my_center|LOCUS_12750 6545 5280 gene locus_tag LOCUS_12760 6545 5280 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_12760 7331 6549 gene locus_tag LOCUS_12770 7331 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784846.1 protein_id gnl|my_center|LOCUS_12770 8239 7343 gene locus_tag LOCUS_12780 8239 7343 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_12780 9011 8244 gene locus_tag LOCUS_12790 9011 8244 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_12790 9226 9999 gene locus_tag LOCUS_12800 gene surE 9226 9999 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L8 protein_id gnl|my_center|LOCUS_12800 9996 11147 gene locus_tag LOCUS_12810 9996 11147 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784854.1 protein_id gnl|my_center|LOCUS_12810 12039 11182 gene locus_tag LOCUS_12820 12039 11182 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA2 protein_id gnl|my_center|LOCUS_12820 14090 12060 gene locus_tag LOCUS_12830 gene ftsH 14090 12060 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA1 protein_id gnl|my_center|LOCUS_12830 14472 14113 gene locus_tag LOCUS_12840 gene rsfS 14472 14113 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA0 protein_id gnl|my_center|LOCUS_12840 14700 14771 gene locus_tag LOCUS_t00230 14700 14771 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 14811 14882 gene locus_tag LOCUS_t00240 14811 14882 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence074 <1 1655 gene locus_tag LOCUS_12850 <1 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107135.1:SusC/RagA family TonB-linked outer membrane protein 1668 3407 gene locus_tag LOCUS_12860 1668 3407 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760460.1 protein_id gnl|my_center|LOCUS_12860 3434 4963 gene locus_tag LOCUS_12870 3434 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766733.1 protein_id gnl|my_center|LOCUS_12870 4978 6405 gene locus_tag LOCUS_12880 4978 6405 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766732.1 protein_id gnl|my_center|LOCUS_12880 6424 7365 gene locus_tag LOCUS_12890 6424 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203469.1 protein_id gnl|my_center|LOCUS_12890 7405 9129 gene locus_tag LOCUS_12900 7405 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 9300 11210 gene locus_tag LOCUS_12910 9300 11210 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107133.1 protein_id gnl|my_center|LOCUS_12910 11254 13527 gene locus_tag LOCUS_12920 11254 13527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence075 4318 5838 gene locus_tag LOCUS_12930 4318 5838 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109350.1 protein_id gnl|my_center|LOCUS_12930 5843 6547 gene locus_tag LOCUS_12940 5843 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818837.1 protein_id gnl|my_center|LOCUS_12940 6663 6869 gene locus_tag LOCUS_12950 6663 6869 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202676.1 protein_id gnl|my_center|LOCUS_12950 6883 7059 gene locus_tag LOCUS_12960 6883 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 7387 8193 gene locus_tag LOCUS_12970 7387 8193 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680804.1 protein_id gnl|my_center|LOCUS_12970 9042 8398 gene locus_tag LOCUS_12980 9042 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313932.1 protein_id gnl|my_center|LOCUS_12980 9941 9042 gene locus_tag LOCUS_12990 9941 9042 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313935.1 protein_id gnl|my_center|LOCUS_12990 10317 9925 gene locus_tag LOCUS_13000 10317 9925 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313937.1 protein_id gnl|my_center|LOCUS_13000 12134 10395 gene locus_tag LOCUS_13010 12134 10395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 12750 12151 gene locus_tag LOCUS_13020 12750 12151 CDS product VirE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313940.1 protein_id gnl|my_center|LOCUS_13020 13100 12747 gene locus_tag LOCUS_13030 13100 12747 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004313943.1 protein_id gnl|my_center|LOCUS_13030 13708 14379 gene locus_tag LOCUS_13040 13708 14379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence076 <1 2212 gene locus_tag LOCUS_13050 <1 2212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228378.1:DNA methylase 2240 5536 gene locus_tag LOCUS_13060 2240 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_13060 6200 5742 gene locus_tag LOCUS_13070 6200 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 6830 6745 gene locus_tag LOCUS_t00250 6830 6745 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6919 6846 gene locus_tag LOCUS_t00260 6919 6846 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8360 6996 gene locus_tag LOCUS_13080 gene argH 8360 6996 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_13080 8805 8377 gene locus_tag LOCUS_13090 8805 8377 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_13090 9569 8934 gene locus_tag LOCUS_13100 gene pyrE 9569 8934 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D5 protein_id gnl|my_center|LOCUS_13100 10360 9671 gene locus_tag LOCUS_13110 10360 9671 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_13110 10823 10344 gene locus_tag LOCUS_13120 gene recX 10823 10344 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D6 protein_id gnl|my_center|LOCUS_13120 11662 10820 gene locus_tag LOCUS_13130 gene prmC 11662 10820 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z19 protein_id gnl|my_center|LOCUS_13130 11695 12735 gene locus_tag LOCUS_13140 11695 12735 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D8 protein_id gnl|my_center|LOCUS_13140 14399 12738 gene locus_tag LOCUS_13150 14399 12738 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765321.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence077 2132 1758 gene locus_tag LOCUS_13160 2132 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 4194 2167 gene locus_tag LOCUS_13170 4194 2167 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760460.1 protein_id gnl|my_center|LOCUS_13170 7449 4216 gene locus_tag LOCUS_13180 7449 4216 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202537.1 protein_id gnl|my_center|LOCUS_13180 8787 7537 gene locus_tag LOCUS_13190 8787 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 9326 8808 gene locus_tag LOCUS_13200 9326 8808 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766735.1 protein_id gnl|my_center|LOCUS_13200 10881 9487 gene locus_tag LOCUS_13210 10881 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 14584 11108 gene locus_tag LOCUS_13220 14584 11108 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence078 1233 2582 gene locus_tag LOCUS_13230 1233 2582 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202606.1 protein_id gnl|my_center|LOCUS_13230 2813 2586 gene locus_tag LOCUS_13240 2813 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3642 2869 gene locus_tag LOCUS_13250 gene proC 3642 2869 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A9 protein_id gnl|my_center|LOCUS_13250 5199 4075 gene locus_tag LOCUS_13260 5199 4075 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_13260 6269 5301 gene locus_tag LOCUS_13270 gene argC 6269 5301 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 protein_id gnl|my_center|LOCUS_13270 7474 6266 gene locus_tag LOCUS_13280 7474 6266 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_13280 8121 7552 gene locus_tag LOCUS_13290 8121 7552 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_13290 8620 8138 gene locus_tag LOCUS_13300 gene argR 8620 8138 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A4 protein_id gnl|my_center|LOCUS_13300 8793 9518 gene locus_tag LOCUS_13310 8793 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 10632 9508 gene locus_tag LOCUS_13320 10632 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 12063 10642 gene locus_tag LOCUS_13330 12063 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 14459 12093 gene locus_tag LOCUS_13340 14459 12093 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108117.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence079 668 165 gene locus_tag LOCUS_13350 gene tpx 668 165 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SL6 protein_id gnl|my_center|LOCUS_13350 783 1709 gene locus_tag LOCUS_13360 783 1709 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882918.1 protein_id gnl|my_center|LOCUS_13360 3759 2020 gene locus_tag LOCUS_13370 3759 2020 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A849 protein_id gnl|my_center|LOCUS_13370 4217 5491 gene locus_tag LOCUS_13380 4217 5491 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_13380 5521 6480 gene locus_tag LOCUS_13390 5521 6480 CDS product glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_13390 6495 6962 gene locus_tag LOCUS_13400 6495 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_13400 7069 7299 gene locus_tag LOCUS_13410 7069 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788091.1 protein_id gnl|my_center|LOCUS_13410 8293 7373 gene locus_tag LOCUS_13420 8293 7373 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202975.1 protein_id gnl|my_center|LOCUS_13420 8461 8667 gene locus_tag LOCUS_13430 8461 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786459.1 protein_id gnl|my_center|LOCUS_13430 8827 9291 gene locus_tag LOCUS_13440 8827 9291 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_13440 9922 9365 gene locus_tag LOCUS_13450 9922 9365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 10296 9919 gene locus_tag LOCUS_13460 10296 9919 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_13460 11063 10305 gene locus_tag LOCUS_13470 11063 10305 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_13470 11731 11069 gene locus_tag LOCUS_13480 11731 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788195.1 protein_id gnl|my_center|LOCUS_13480 13577 11778 gene locus_tag LOCUS_13490 13577 11778 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107334.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence080 1078 2841 gene locus_tag LOCUS_13500 gene aspS 1078 2841 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9E3 protein_id gnl|my_center|LOCUS_13500 2877 3266 gene locus_tag LOCUS_13510 2877 3266 CDS product polysaccharide biosynthesis protein GtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787805.1 protein_id gnl|my_center|LOCUS_13510 3691 3263 gene locus_tag LOCUS_13520 3691 3263 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763158.1 protein_id gnl|my_center|LOCUS_13520 5017 3704 gene locus_tag LOCUS_13530 5017 3704 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VN6 protein_id gnl|my_center|LOCUS_13530 8126 5277 gene locus_tag LOCUS_13540 gene gcvP 8126 5277 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UQ7 protein_id gnl|my_center|LOCUS_13540 8814 8173 gene locus_tag LOCUS_13550 8814 8173 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_13550 9446 8820 gene locus_tag LOCUS_13560 gene rsmG 9446 8820 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8M2 protein_id gnl|my_center|LOCUS_13560 10259 9453 gene locus_tag LOCUS_13570 10259 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787233.1 protein_id gnl|my_center|LOCUS_13570 10477 11142 gene locus_tag LOCUS_13580 gene lipB 10477 11142 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8S8 protein_id gnl|my_center|LOCUS_13580 11809 11171 gene locus_tag LOCUS_13590 11809 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 12055 12618 gene locus_tag LOCUS_13600 12055 12618 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_13600 13386 12835 gene locus_tag LOCUS_13610 13386 12835 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108911.1 protein_id gnl|my_center|LOCUS_13610 13915 13370 gene locus_tag LOCUS_13620 13915 13370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789211.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence081 <1 1978 gene locus_tag LOCUS_13630 <1 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108335.1:alpha-rhamnosidase 2957 2064 gene locus_tag LOCUS_13640 2957 2064 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_13640 3120 4598 gene locus_tag LOCUS_13650 gene rhaB 3120 4598 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A3 protein_id gnl|my_center|LOCUS_13650 4605 5858 gene locus_tag LOCUS_13660 gene rhaA 4605 5858 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A2 protein_id gnl|my_center|LOCUS_13660 5924 6934 gene locus_tag LOCUS_13670 5924 6934 CDS product sugar:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_13670 6960 7769 gene locus_tag LOCUS_13680 gene rhaD 6960 7769 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A0 protein_id gnl|my_center|LOCUS_13680 7812 8957 gene locus_tag LOCUS_13690 7812 8957 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_13690 13269 9163 gene locus_tag LOCUS_13700 13269 9163 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108633.1 protein_id gnl|my_center|LOCUS_13700 13376 13546 gene locus_tag LOCUS_13710 13376 13546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 13561 13944 gene locus_tag LOCUS_13720 13561 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence082 1692 292 gene locus_tag LOCUS_13730 1692 292 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790372.1 protein_id gnl|my_center|LOCUS_13730 2342 1701 gene locus_tag LOCUS_13740 2342 1701 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_13740 3650 2355 gene locus_tag LOCUS_13750 3650 2355 CDS product UPF0597 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PR7 protein_id gnl|my_center|LOCUS_13750 5662 3656 gene locus_tag LOCUS_13760 5662 3656 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_13760 5932 6017 gene locus_tag LOCUS_t00270 5932 6017 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6290 7345 gene locus_tag LOCUS_13770 6290 7345 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202365.1 protein_id gnl|my_center|LOCUS_13770 7775 8668 gene locus_tag LOCUS_13780 7775 8668 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203113.1 protein_id gnl|my_center|LOCUS_13780 9868 10695 gene locus_tag LOCUS_13790 9868 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007567599.1 protein_id gnl|my_center|LOCUS_13790 10796 12541 gene locus_tag LOCUS_13800 10796 12541 CDS product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004293827.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence083 2141 48 gene locus_tag LOCUS_13810 2141 48 CDS product chloramphenicol resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108546.1 protein_id gnl|my_center|LOCUS_13810 2425 2697 gene locus_tag LOCUS_13820 gene groS 2425 2697 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6P7 protein_id gnl|my_center|LOCUS_13820 2740 4377 gene locus_tag LOCUS_13830 gene groL 2740 4377 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6P8 protein_id gnl|my_center|LOCUS_13830 6215 4464 gene locus_tag LOCUS_13840 6215 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 6599 6234 gene locus_tag LOCUS_13850 6599 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 7296 6646 gene locus_tag LOCUS_13860 7296 6646 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791874.1 protein_id gnl|my_center|LOCUS_13860 9134 7374 gene locus_tag LOCUS_13870 9134 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 9246 9713 gene locus_tag LOCUS_13880 9246 9713 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_13880 10406 9894 gene locus_tag LOCUS_13890 10406 9894 CDS product NTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_13890 11693 10425 gene locus_tag LOCUS_13900 gene queA 11693 10425 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_13900 11794 12846 gene locus_tag LOCUS_13910 11794 12846 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_13910 12852 13262 gene locus_tag LOCUS_13920 12852 13262 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_13920 <14128 13338 gene locus_tag LOCUS_13930 <14128 13338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763773.1:O-acetylhomoserine (thiol)-lyase >Feature sequence084 596 321 gene locus_tag LOCUS_13940 596 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1385 873 gene locus_tag LOCUS_13950 1385 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108372.1 protein_id gnl|my_center|LOCUS_13950 1794 1387 gene locus_tag LOCUS_13960 1794 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 2056 1796 gene locus_tag LOCUS_13970 2056 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 2647 2117 gene locus_tag LOCUS_13980 2647 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3446 2739 gene locus_tag LOCUS_13990 3446 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 4128 3460 gene locus_tag LOCUS_14000 4128 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4483 4190 gene locus_tag LOCUS_14010 4483 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 6271 4613 gene locus_tag LOCUS_14020 6271 4613 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310162.1 protein_id gnl|my_center|LOCUS_14020 6566 6363 gene locus_tag LOCUS_14030 6566 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 7041 6541 gene locus_tag LOCUS_14040 7041 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 8008 7094 gene locus_tag LOCUS_14050 8008 7094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 8337 8011 gene locus_tag LOCUS_14060 8337 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 8706 8353 gene locus_tag LOCUS_14070 8706 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 9780 8710 gene locus_tag LOCUS_14080 9780 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 10809 10129 gene locus_tag LOCUS_14090 10809 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 11266 10811 gene locus_tag LOCUS_14100 11266 10811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 11691 11272 gene locus_tag LOCUS_14110 11691 11272 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64W20 protein_id gnl|my_center|LOCUS_14110 12607 11684 gene locus_tag LOCUS_14120 12607 11684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 13410 12604 gene locus_tag LOCUS_14130 13410 12604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence085 2436 1042 gene locus_tag LOCUS_14140 2436 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 5182 2465 gene locus_tag LOCUS_14150 5182 2465 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_14150 7218 5290 gene locus_tag LOCUS_14160 7218 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 8869 7262 gene locus_tag LOCUS_14170 8869 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 8889 9098 gene locus_tag LOCUS_14180 8889 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 10980 9175 gene locus_tag LOCUS_14190 10980 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109083.1 protein_id gnl|my_center|LOCUS_14190 12627 11287 gene locus_tag LOCUS_14200 12627 11287 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y98 protein_id gnl|my_center|LOCUS_14200 13486 12683 gene locus_tag LOCUS_14210 gene rsmA 13486 12683 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0H8 protein_id gnl|my_center|LOCUS_14210 >Feature sequence086 458 1495 gene locus_tag LOCUS_14220 458 1495 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_14220 1488 2039 gene locus_tag LOCUS_14230 1488 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2359 3339 gene locus_tag LOCUS_14240 2359 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3815 4438 gene locus_tag LOCUS_14250 3815 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 4443 5582 gene locus_tag LOCUS_14260 gene darB 4443 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_14260 5822 6346 gene locus_tag LOCUS_14270 5822 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6685 8892 gene locus_tag LOCUS_14280 6685 8892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 8873 10192 gene locus_tag LOCUS_14290 8873 10192 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291471.1 protein_id gnl|my_center|LOCUS_14290 10822 12660 gene locus_tag LOCUS_14300 10822 12660 CDS product copper amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108420.1 protein_id gnl|my_center|LOCUS_14300 12714 12989 gene locus_tag LOCUS_14310 12714 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323215.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence087 <1 3033 gene locus_tag LOCUS_14320 <1 3033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108547.1:hybrid sensor histidine kinase/response regulator 4886 3066 gene locus_tag LOCUS_14330 4886 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784160.1 protein_id gnl|my_center|LOCUS_14330 8108 4920 gene locus_tag LOCUS_14340 8108 4920 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201969.1 protein_id gnl|my_center|LOCUS_14340 8548 10395 gene locus_tag LOCUS_14350 8548 10395 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_14350 10488 11666 gene locus_tag LOCUS_14360 10488 11666 CDS product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201966.1 protein_id gnl|my_center|LOCUS_14360 11667 12908 gene locus_tag LOCUS_14370 11667 12908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108589.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence088 <1 2020 gene locus_tag LOCUS_14380 <1 2020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64T17:UvrABC system protein A 2020 2502 gene locus_tag LOCUS_14390 2020 2502 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA86 protein_id gnl|my_center|LOCUS_14390 2529 3314 gene locus_tag LOCUS_14400 gene djlA 2529 3314 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST2 protein_id gnl|my_center|LOCUS_14400 3927 3493 gene locus_tag LOCUS_14410 3927 3493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760904.1 protein_id gnl|my_center|LOCUS_14410 4071 4601 gene locus_tag LOCUS_14420 4071 4601 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148830.1 protein_id gnl|my_center|LOCUS_14420 6309 5116 gene locus_tag LOCUS_14430 6309 5116 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808836.1 protein_id gnl|my_center|LOCUS_14430 6419 7972 gene locus_tag LOCUS_14440 6419 7972 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107456.1 protein_id gnl|my_center|LOCUS_14440 8613 8038 gene locus_tag LOCUS_14450 8613 8038 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_14450 9527 8634 gene locus_tag LOCUS_14460 9527 8634 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y70 protein_id gnl|my_center|LOCUS_14460 9720 9792 gene locus_tag LOCUS_t00280 9720 9792 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9817 9891 gene locus_tag LOCUS_t00290 9817 9891 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9904 9977 gene locus_tag LOCUS_t00300 9904 9977 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10120 11106 gene locus_tag LOCUS_14470 10120 11106 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783903.1 protein_id gnl|my_center|LOCUS_14470 11155 12990 gene locus_tag LOCUS_14480 gene fucI 11155 12990 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZS4 protein_id gnl|my_center|LOCUS_14480 >Feature sequence089 <1 600 gene locus_tag LOCUS_14490 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202181.1:alpha-L-fucosidase 616 2664 gene locus_tag LOCUS_14500 616 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202616.1 protein_id gnl|my_center|LOCUS_14500 2677 3915 gene locus_tag LOCUS_14510 2677 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813194.1 protein_id gnl|my_center|LOCUS_14510 5501 3999 gene locus_tag LOCUS_14520 5501 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 6936 5659 gene locus_tag LOCUS_14530 6936 5659 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107869.1 protein_id gnl|my_center|LOCUS_14530 7257 8579 gene locus_tag LOCUS_14540 7257 8579 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_14540 8646 9971 gene locus_tag LOCUS_14550 gene ffh 8646 9971 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7C3 protein_id gnl|my_center|LOCUS_14550 11171 10044 gene locus_tag LOCUS_14560 11171 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_14560 11283 11819 gene locus_tag LOCUS_14570 11283 11819 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203456.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence090 875 216 gene locus_tag LOCUS_14580 gene cobS 875 216 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TE3 protein_id gnl|my_center|LOCUS_14580 2007 967 gene locus_tag LOCUS_14590 gene cobT 2007 967 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TE4 protein_id gnl|my_center|LOCUS_14590 2520 2011 gene locus_tag LOCUS_14600 2520 2011 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_14600 3085 2672 gene locus_tag LOCUS_14610 3085 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_14610 3756 3151 gene locus_tag LOCUS_14620 gene coaE 3756 3151 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X24 protein_id gnl|my_center|LOCUS_14620 4679 3753 gene locus_tag LOCUS_14630 4679 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109340.1 protein_id gnl|my_center|LOCUS_14630 4797 4615 gene locus_tag LOCUS_14640 4797 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 5108 4800 gene locus_tag LOCUS_14650 5108 4800 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_14650 6075 5149 gene locus_tag LOCUS_14660 6075 5149 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY9 protein_id gnl|my_center|LOCUS_14660 6256 6630 gene locus_tag LOCUS_14670 6256 6630 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785761.1 protein_id gnl|my_center|LOCUS_14670 6820 7416 gene locus_tag LOCUS_14680 gene rplY 6820 7416 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YZ1 protein_id gnl|my_center|LOCUS_14680 7450 8013 gene locus_tag LOCUS_14690 gene pth 7450 8013 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_14690 8019 8360 gene locus_tag LOCUS_14700 8019 8360 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14700 10786 8510 gene locus_tag LOCUS_14710 10786 8510 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764744.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence091 <1 539 gene locus_tag LOCUS_14720 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814517.1:ABC transporter ATP-binding protein 536 1255 gene locus_tag LOCUS_14730 536 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1260 1634 gene locus_tag LOCUS_14740 1260 1634 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_14740 3188 1629 gene locus_tag LOCUS_14750 3188 1629 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202267.1 protein_id gnl|my_center|LOCUS_14750 3410 3949 gene locus_tag LOCUS_14760 3410 3949 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785889.1 protein_id gnl|my_center|LOCUS_14760 4014 4832 gene locus_tag LOCUS_14770 4014 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4829 7402 gene locus_tag LOCUS_14780 4829 7402 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_14780 7520 8374 gene locus_tag LOCUS_14790 7520 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 8409 9044 gene locus_tag LOCUS_14800 8409 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107176.1 protein_id gnl|my_center|LOCUS_14800 9098 9868 gene locus_tag LOCUS_14810 9098 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 9993 11087 gene locus_tag LOCUS_14820 9993 11087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence092 120 542 gene locus_tag LOCUS_14830 120 542 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760530.1 protein_id gnl|my_center|LOCUS_14830 590 1141 gene locus_tag LOCUS_14840 590 1141 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_14840 2655 1471 gene locus_tag LOCUS_14850 2655 1471 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107853.1 protein_id gnl|my_center|LOCUS_14850 3152 2778 gene locus_tag LOCUS_14860 3152 2778 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_14860 3947 3159 gene locus_tag LOCUS_14870 3947 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_14870 4489 3956 gene locus_tag LOCUS_14880 4489 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_14880 5795 4476 gene locus_tag LOCUS_14890 5795 4476 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_14890 8508 5869 gene locus_tag LOCUS_14900 8508 5869 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_14900 10026 8719 gene locus_tag LOCUS_14910 10026 8719 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_14910 10249 11196 gene locus_tag LOCUS_14920 10249 11196 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_14920 12056 11286 gene locus_tag LOCUS_14930 gene pstB3 12056 11286 CDS product phosphate import ATP-binding protein PstB 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63372 protein_id gnl|my_center|LOCUS_14930 <12698 12044 gene locus_tag LOCUS_14940 <12698 12044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63V80:phosphate transport system permease protein PstA >Feature sequence093 2990 891 gene locus_tag LOCUS_14950 2990 891 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107560.1 protein_id gnl|my_center|LOCUS_14950 3272 3060 gene locus_tag LOCUS_14960 3272 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14960 5689 3311 gene locus_tag LOCUS_14970 5689 3311 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202843.1 protein_id gnl|my_center|LOCUS_14970 6698 5745 gene locus_tag LOCUS_14980 6698 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 8167 6917 gene locus_tag LOCUS_14990 8167 6917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787749.1 protein_id gnl|my_center|LOCUS_14990 9685 8180 gene locus_tag LOCUS_15000 9685 8180 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_15000 9828 11198 gene locus_tag LOCUS_15010 9828 11198 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence094 993 211 gene locus_tag LOCUS_15020 993 211 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764352.1 protein_id gnl|my_center|LOCUS_15020 1447 2538 gene locus_tag LOCUS_15030 gene proB 1447 2538 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E7 protein_id gnl|my_center|LOCUS_15030 3692 2550 gene locus_tag LOCUS_15040 gene nagA 3692 2550 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_15040 4677 3685 gene locus_tag LOCUS_15050 4677 3685 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107892.1 protein_id gnl|my_center|LOCUS_15050 5268 4699 gene locus_tag LOCUS_15060 5268 4699 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798859.1 protein_id gnl|my_center|LOCUS_15060 5760 9152 gene locus_tag LOCUS_15070 5760 9152 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_15070 9243 10736 gene locus_tag LOCUS_15080 9243 10736 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784504.1 protein_id gnl|my_center|LOCUS_15080 10736 12163 gene locus_tag LOCUS_15090 10736 12163 CDS product glycosyl hydrolase family 109 protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZX8 protein_id gnl|my_center|LOCUS_15090 >Feature sequence095 <1 3842 gene locus_tag LOCUS_15100 <1 3842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107318.1:glutamate synthase 3873 5216 gene locus_tag LOCUS_15110 3873 5216 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_15110 5254 6924 gene locus_tag LOCUS_15120 gene asnB 5254 6924 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_15120 6939 7745 gene locus_tag LOCUS_15130 gene dapF 6939 7745 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SY7 protein_id gnl|my_center|LOCUS_15130 7756 8991 gene locus_tag LOCUS_15140 gene dapL 7756 8991 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SY6 protein_id gnl|my_center|LOCUS_15140 9685 9005 gene locus_tag LOCUS_15150 9685 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 10409 9702 gene locus_tag LOCUS_15160 10409 9702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 11782 10550 gene locus_tag LOCUS_15170 11782 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence096 <1 3400 gene locus_tag LOCUS_15180 <1 3400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202182.1:DNA helicase 3400 4143 gene locus_tag LOCUS_15190 3400 4143 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109289.1 protein_id gnl|my_center|LOCUS_15190 5503 4133 gene locus_tag LOCUS_15200 5503 4133 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_15200 6336 5776 gene locus_tag LOCUS_15210 6336 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 8680 6422 gene locus_tag LOCUS_15220 8680 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 9022 10365 gene locus_tag LOCUS_15230 9022 10365 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_15230 10405 10980 gene locus_tag LOCUS_15240 10405 10980 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_15240 11724 10993 gene locus_tag LOCUS_15250 11724 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence097 <1 1105 gene locus_tag LOCUS_15260 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767915.1:cytochrome-c peroxidase 1375 1941 gene locus_tag LOCUS_15270 1375 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1935 2222 gene locus_tag LOCUS_15280 1935 2222 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_15280 2557 3393 gene locus_tag LOCUS_15290 gene coaW 2557 3393 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81C81 protein_id gnl|my_center|LOCUS_15290 5601 3439 gene locus_tag LOCUS_15300 5601 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107937.1 protein_id gnl|my_center|LOCUS_15300 5596 5772 gene locus_tag LOCUS_15310 5596 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 5921 6538 gene locus_tag LOCUS_15320 5921 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 6559 6948 gene locus_tag LOCUS_15330 6559 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15330 6959 7123 gene locus_tag LOCUS_15340 6959 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 7128 8093 gene locus_tag LOCUS_15350 7128 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 8122 10515 gene locus_tag LOCUS_15360 8122 10515 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence098 1873 824 gene locus_tag LOCUS_15370 gene hisC 1873 824 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA8 protein_id gnl|my_center|LOCUS_15370 3153 1876 gene locus_tag LOCUS_15380 gene hisD 3153 1876 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABA9 protein_id gnl|my_center|LOCUS_15380 4036 3185 gene locus_tag LOCUS_15390 gene hisG 4036 3185 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABB0 protein_id gnl|my_center|LOCUS_15390 4777 4292 gene locus_tag LOCUS_15400 4777 4292 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766233.1 protein_id gnl|my_center|LOCUS_15400 5089 4790 gene locus_tag LOCUS_15410 5089 4790 CDS product stress responsive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760502.1 protein_id gnl|my_center|LOCUS_15410 5160 5771 gene locus_tag LOCUS_15420 gene udk 5160 5771 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RE1 protein_id gnl|my_center|LOCUS_15420 5768 7144 gene locus_tag LOCUS_15430 5768 7144 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107154.1 protein_id gnl|my_center|LOCUS_15430 7495 7821 gene locus_tag LOCUS_15440 7495 7821 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107450.1 protein_id gnl|my_center|LOCUS_15440 7940 8347 gene locus_tag LOCUS_15450 7940 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107452.1 protein_id gnl|my_center|LOCUS_15450 8360 9067 gene locus_tag LOCUS_15460 8360 9067 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_15460 9101 9337 gene locus_tag LOCUS_15470 9101 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879737.1 protein_id gnl|my_center|LOCUS_15470 9441 10409 gene locus_tag LOCUS_15480 9441 10409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_15480 10424 10879 gene locus_tag LOCUS_15490 10424 10879 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107123.1 protein_id gnl|my_center|LOCUS_15490 11006 11587 gene locus_tag LOCUS_15500 11006 11587 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107801.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence099 872 540 gene locus_tag LOCUS_15510 gene cas2 872 540 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_15510 1798 872 gene locus_tag LOCUS_15520 gene cas1 1798 872 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_15520 6294 1795 gene locus_tag LOCUS_15530 6294 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 9798 6571 gene locus_tag LOCUS_15540 9798 6571 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SZ4 protein_id gnl|my_center|LOCUS_15540 10898 9822 gene locus_tag LOCUS_15550 gene carA 10898 9822 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SZ3 protein_id gnl|my_center|LOCUS_15550 <11809 11246 gene locus_tag LOCUS_15560 <11809 11246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767048.1:arabinosidase >Feature sequence100 4162 1049 gene locus_tag LOCUS_15570 4162 1049 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790618.1 protein_id gnl|my_center|LOCUS_15570 5329 4175 gene locus_tag LOCUS_15580 5329 4175 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657461.1 protein_id gnl|my_center|LOCUS_15580 5833 5411 gene locus_tag LOCUS_15590 5833 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108102.1 protein_id gnl|my_center|LOCUS_15590 6795 6091 gene locus_tag LOCUS_15600 6795 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8350 6809 gene locus_tag LOCUS_15610 gene glyQS 8350 6809 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1P8 protein_id gnl|my_center|LOCUS_15610 9256 8459 gene locus_tag LOCUS_15620 9256 8459 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_15620 10278 9253 gene locus_tag LOCUS_15630 gene murB 10278 9253 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RZ8 protein_id gnl|my_center|LOCUS_15630 11139 10285 gene locus_tag LOCUS_15640 11139 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762407.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence101 961 41 gene locus_tag LOCUS_15650 961 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1674 2645 gene locus_tag LOCUS_15660 1674 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795545.1 protein_id gnl|my_center|LOCUS_15660 3466 2720 gene locus_tag LOCUS_15670 3466 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4062 3520 gene locus_tag LOCUS_15680 4062 3520 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107875.1 protein_id gnl|my_center|LOCUS_15680 4294 4872 gene locus_tag LOCUS_15690 4294 4872 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761981.1 protein_id gnl|my_center|LOCUS_15690 4896 6548 gene locus_tag LOCUS_15700 4896 6548 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108477.1 protein_id gnl|my_center|LOCUS_15700 7278 6619 gene locus_tag LOCUS_15710 7278 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 7424 8377 gene locus_tag LOCUS_15720 7424 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764184.1 protein_id gnl|my_center|LOCUS_15720 9629 8460 gene locus_tag LOCUS_15730 9629 8460 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_15730 9982 10824 gene locus_tag LOCUS_15740 9982 10824 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence102 1836 598 gene locus_tag LOCUS_15750 1836 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2824 2120 gene locus_tag LOCUS_15760 2824 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3336 2821 gene locus_tag LOCUS_15770 3336 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4015 3380 gene locus_tag LOCUS_15780 4015 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5562 4240 gene locus_tag LOCUS_15790 5562 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 5851 6303 gene locus_tag LOCUS_15800 5851 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 6314 6652 gene locus_tag LOCUS_15810 6314 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 6639 7772 gene locus_tag LOCUS_15820 6639 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 7775 8212 gene locus_tag LOCUS_15830 7775 8212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 8387 8608 gene locus_tag LOCUS_15840 8387 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 8637 9038 gene locus_tag LOCUS_15850 8637 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 9822 9190 gene locus_tag LOCUS_15860 9822 9190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 11044 9797 gene locus_tag LOCUS_15870 11044 9797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence103 1200 520 gene locus_tag LOCUS_15880 1200 520 CDS product cation-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763082.1 protein_id gnl|my_center|LOCUS_15880 1452 1790 gene locus_tag LOCUS_15890 1452 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769696.1 protein_id gnl|my_center|LOCUS_15890 1800 3653 gene locus_tag LOCUS_15900 1800 3653 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RL0 protein_id gnl|my_center|LOCUS_15900 4597 3680 gene locus_tag LOCUS_15910 4597 3680 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783741.1 protein_id gnl|my_center|LOCUS_15910 6068 4728 gene locus_tag LOCUS_15920 6068 4728 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PT6 protein_id gnl|my_center|LOCUS_15920 7393 6122 gene locus_tag LOCUS_15930 7393 6122 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A615 protein_id gnl|my_center|LOCUS_15930 9645 7390 gene locus_tag LOCUS_15940 9645 7390 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence104 1098 97 gene locus_tag LOCUS_15950 1098 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1273 1082 gene locus_tag LOCUS_15960 1273 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2605 1292 gene locus_tag LOCUS_15970 2605 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 4147 2618 gene locus_tag LOCUS_15980 gene hsdM 4147 2618 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_15980 4715 4155 gene locus_tag LOCUS_15990 4715 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 5024 5641 gene locus_tag LOCUS_16000 5024 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 6137 7447 gene locus_tag LOCUS_16010 6137 7447 CDS product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791486.1 protein_id gnl|my_center|LOCUS_16010 7716 8375 gene locus_tag LOCUS_16020 7716 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786014.1 protein_id gnl|my_center|LOCUS_16020 8382 8927 gene locus_tag LOCUS_16030 8382 8927 CDS product DUF4924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_16030 8941 9798 gene locus_tag LOCUS_16040 8941 9798 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_16040 9801 11372 gene locus_tag LOCUS_16050 gene prfC 9801 11372 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6Z6 protein_id gnl|my_center|LOCUS_16050 >Feature sequence105 611 1180 gene locus_tag LOCUS_16060 611 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1946 2737 gene locus_tag LOCUS_16070 1946 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 3317 3805 gene locus_tag LOCUS_16080 3317 3805 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680453.1 protein_id gnl|my_center|LOCUS_16080 4309 4794 gene locus_tag LOCUS_16090 4309 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323429.1 protein_id gnl|my_center|LOCUS_16090 4812 5237 gene locus_tag LOCUS_16100 4812 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291533.1 protein_id gnl|my_center|LOCUS_16100 5552 6505 gene locus_tag LOCUS_16110 5552 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 7022 7375 gene locus_tag LOCUS_16120 7022 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 7567 7863 gene locus_tag LOCUS_16130 7567 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308705.1 protein_id gnl|my_center|LOCUS_16130 8204 8572 gene locus_tag LOCUS_16140 8204 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308703.1 protein_id gnl|my_center|LOCUS_16140 10361 8676 gene locus_tag LOCUS_16150 10361 8676 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323428.1 protein_id gnl|my_center|LOCUS_16150 10975 10367 gene locus_tag LOCUS_16160 10975 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323427.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence106 <1 612 gene locus_tag LOCUS_16170 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815525.1:cell division protein Fic 728 2506 gene locus_tag LOCUS_16180 728 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203606.1 protein_id gnl|my_center|LOCUS_16180 3179 2583 gene locus_tag LOCUS_16190 3179 2583 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203201.1 protein_id gnl|my_center|LOCUS_16190 3589 5046 gene locus_tag LOCUS_16200 3589 5046 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107891.1 protein_id gnl|my_center|LOCUS_16200 5043 6062 gene locus_tag LOCUS_16210 5043 6062 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767908.1 protein_id gnl|my_center|LOCUS_16210 6488 7396 gene locus_tag LOCUS_16220 6488 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 7389 7997 gene locus_tag LOCUS_16230 7389 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 8123 9073 gene locus_tag LOCUS_16240 8123 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 10526 9171 gene locus_tag LOCUS_16250 10526 9171 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_16250 <11066 10538 gene locus_tag LOCUS_16260 <11066 10538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A602:chorismate synthase >Feature sequence107 429 187 gene locus_tag LOCUS_16270 429 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 745 467 gene locus_tag LOCUS_16280 745 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1170 976 gene locus_tag LOCUS_16290 1170 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16290 2147 1260 gene locus_tag LOCUS_16300 2147 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16300 2589 2248 gene locus_tag LOCUS_16310 2589 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2832 5771 gene locus_tag LOCUS_16320 2832 5771 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_16320 5790 7256 gene locus_tag LOCUS_16330 5790 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784672.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence108 871 422 gene locus_tag LOCUS_16340 gene rplI 871 422 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH9 protein_id gnl|my_center|LOCUS_16340 1159 890 gene locus_tag LOCUS_16350 gene rpsR 1159 890 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH8 protein_id gnl|my_center|LOCUS_16350 1455 1162 gene locus_tag LOCUS_16360 gene rpsF 1455 1162 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH7 protein_id gnl|my_center|LOCUS_16360 1715 2161 gene locus_tag LOCUS_16370 1715 2161 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790948.1 protein_id gnl|my_center|LOCUS_16370 2353 2529 gene locus_tag LOCUS_16380 2353 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3302 2604 gene locus_tag LOCUS_16390 gene rprY 3302 2604 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_16390 4820 3306 gene locus_tag LOCUS_16400 gene rprX 4820 3306 CDS product sensor protein RprX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q08408 protein_id gnl|my_center|LOCUS_16400 7281 5122 gene locus_tag LOCUS_16410 7281 5122 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790956.1 protein_id gnl|my_center|LOCUS_16410 7500 8633 gene locus_tag LOCUS_16420 7500 8633 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_16420 8897 8742 gene locus_tag LOCUS_16430 8897 8742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 10377 8989 gene locus_tag LOCUS_16440 10377 8989 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109034.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence109 3054 694 gene locus_tag LOCUS_16450 3054 694 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_16450 3716 3090 gene locus_tag LOCUS_16460 3716 3090 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764772.1 protein_id gnl|my_center|LOCUS_16460 4980 3730 gene locus_tag LOCUS_16470 4980 3730 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_16470 6325 5006 gene locus_tag LOCUS_16480 6325 5006 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769333.1 protein_id gnl|my_center|LOCUS_16480 6589 7962 gene locus_tag LOCUS_16490 6589 7962 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_16490 7952 9256 gene locus_tag LOCUS_16500 7952 9256 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_16500 9776 9330 gene locus_tag LOCUS_16510 9776 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 10588 9944 gene locus_tag LOCUS_16520 10588 9944 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL4 protein_id gnl|my_center|LOCUS_16520 >Feature sequence110 1117 1656 gene locus_tag LOCUS_16530 1117 1656 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389882.1 protein_id gnl|my_center|LOCUS_16530 1653 2777 gene locus_tag LOCUS_16540 1653 2777 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108070.1 protein_id gnl|my_center|LOCUS_16540 2774 5887 gene locus_tag LOCUS_16550 2774 5887 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108069.1 protein_id gnl|my_center|LOCUS_16550 6047 7243 gene locus_tag LOCUS_16560 6047 7243 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790315.1 protein_id gnl|my_center|LOCUS_16560 7300 7611 gene locus_tag LOCUS_16570 7300 7611 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898297.1 protein_id gnl|my_center|LOCUS_16570 7835 8608 gene locus_tag LOCUS_16580 7835 8608 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308677.1 protein_id gnl|my_center|LOCUS_16580 8740 9186 gene locus_tag LOCUS_16590 8740 9186 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765003.1 protein_id gnl|my_center|LOCUS_16590 <10670 9921 gene locus_tag LOCUS_16600 <10670 9921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795828.1:iron-regulated protein >Feature sequence111 <1 1233 gene locus_tag LOCUS_16610 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001062984.1:GTP-binding protein 2865 1330 gene locus_tag LOCUS_16620 2865 1330 CDS product exo-poly-alpha-D-galacturonosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226064.1 protein_id gnl|my_center|LOCUS_16620 3495 2965 gene locus_tag LOCUS_16630 3495 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4292 3534 gene locus_tag LOCUS_16640 4292 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 4968 4429 gene locus_tag LOCUS_16650 4968 4429 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_16650 5810 4992 gene locus_tag LOCUS_16660 5810 4992 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_16660 6585 5785 gene locus_tag LOCUS_16670 6585 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16670 6935 6585 gene locus_tag LOCUS_16680 6935 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16680 7463 6969 gene locus_tag LOCUS_16690 7463 6969 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948926.1 protein_id gnl|my_center|LOCUS_16690 7679 8368 gene locus_tag LOCUS_16700 7679 8368 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762363.1 protein_id gnl|my_center|LOCUS_16700 9712 8432 gene locus_tag LOCUS_16710 9712 8432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_16710 10520 9729 gene locus_tag LOCUS_16720 10520 9729 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107762.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence112 3 3503 gene locus_tag LOCUS_16730 3 3503 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203498.1 protein_id gnl|my_center|LOCUS_16730 3569 4441 gene locus_tag LOCUS_16740 3569 4441 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109045.1 protein_id gnl|my_center|LOCUS_16740 4451 5494 gene locus_tag LOCUS_16750 4451 5494 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109044.1 protein_id gnl|my_center|LOCUS_16750 5491 6249 gene locus_tag LOCUS_16760 5491 6249 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109043.1 protein_id gnl|my_center|LOCUS_16760 6368 7987 gene locus_tag LOCUS_16770 6368 7987 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_16770 8196 9353 gene locus_tag LOCUS_16780 8196 9353 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992113.1 protein_id gnl|my_center|LOCUS_16780 9839 9360 gene locus_tag LOCUS_16790 9839 9360 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence113 1124 759 gene locus_tag LOCUS_16800 1124 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16800 1335 1111 gene locus_tag LOCUS_16810 1335 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 2434 1316 gene locus_tag LOCUS_16820 2434 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_16820 4088 2427 gene locus_tag LOCUS_16830 4088 2427 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688773.1 protein_id gnl|my_center|LOCUS_16830 4687 4100 gene locus_tag LOCUS_16840 4687 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16840 7335 4699 gene locus_tag LOCUS_16850 7335 4699 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922226.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16850 7773 7345 gene locus_tag LOCUS_16860 7773 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 8052 7855 gene locus_tag LOCUS_16870 8052 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 8385 8149 gene locus_tag LOCUS_16880 8385 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 8687 10225 gene locus_tag LOCUS_16890 8687 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence114 427 1074 gene locus_tag LOCUS_16900 427 1074 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761373.1 protein_id gnl|my_center|LOCUS_16900 1138 1959 gene locus_tag LOCUS_16910 gene panB 1138 1959 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UB9 protein_id gnl|my_center|LOCUS_16910 2067 3188 gene locus_tag LOCUS_16920 2067 3188 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202766.1 protein_id gnl|my_center|LOCUS_16920 3208 4896 gene locus_tag LOCUS_16930 3208 4896 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_16930 5163 6137 gene locus_tag LOCUS_16940 5163 6137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 6441 7022 gene locus_tag LOCUS_16950 6441 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764750.1 protein_id gnl|my_center|LOCUS_16950 7036 7932 gene locus_tag LOCUS_16960 7036 7932 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_16960 9223 7955 gene locus_tag LOCUS_16970 9223 7955 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_16970 9910 9236 gene locus_tag LOCUS_16980 9910 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16980 9821 10129 gene locus_tag LOCUS_16990 9821 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence115 1282 146 gene locus_tag LOCUS_17000 1282 146 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785546.1 protein_id gnl|my_center|LOCUS_17000 2042 1692 gene locus_tag LOCUS_17010 gene rplT 2042 1692 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN9 protein_id gnl|my_center|LOCUS_17010 2349 2152 gene locus_tag LOCUS_17020 gene rpmI 2349 2152 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP0 protein_id gnl|my_center|LOCUS_17020 3003 2422 gene locus_tag LOCUS_17030 gene infC 3003 2422 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP1 protein_id gnl|my_center|LOCUS_17030 5045 3105 gene locus_tag LOCUS_17040 gene thrS 5045 3105 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP2 protein_id gnl|my_center|LOCUS_17040 7123 5120 gene locus_tag LOCUS_17050 7123 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_17050 7674 7120 gene locus_tag LOCUS_17060 gene def 7674 7120 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP4 protein_id gnl|my_center|LOCUS_17060 8112 7696 gene locus_tag LOCUS_17070 8112 7696 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP6 protein_id gnl|my_center|LOCUS_17070 8299 9852 gene locus_tag LOCUS_17080 gene guaA 8299 9852 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ7 protein_id gnl|my_center|LOCUS_17080 10190 9918 gene locus_tag LOCUS_17090 10190 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence116 928 71 gene locus_tag LOCUS_17100 gene pstC 928 71 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRS9 protein_id gnl|my_center|LOCUS_17100 1966 944 gene locus_tag LOCUS_17110 1966 944 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABV1 protein_id gnl|my_center|LOCUS_17110 3051 2050 gene locus_tag LOCUS_17120 3051 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 4828 3290 gene locus_tag LOCUS_17130 4828 3290 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_17130 5037 6062 gene locus_tag LOCUS_17140 5037 6062 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_17140 6760 6071 gene locus_tag LOCUS_17150 6760 6071 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760381.1 protein_id gnl|my_center|LOCUS_17150 8593 6764 gene locus_tag LOCUS_17160 8593 6764 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785879.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence117 1196 231 gene locus_tag LOCUS_17170 1196 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17170 1934 1269 gene locus_tag LOCUS_17180 1934 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17180 3356 2052 gene locus_tag LOCUS_17190 3356 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17190 5104 3506 gene locus_tag LOCUS_17200 5104 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107574.1 protein_id gnl|my_center|LOCUS_17200 6097 5141 gene locus_tag LOCUS_17210 6097 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 7384 6128 gene locus_tag LOCUS_17220 7384 6128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766732.1 protein_id gnl|my_center|LOCUS_17220 8765 7398 gene locus_tag LOCUS_17230 8765 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 <10060 8795 gene locus_tag LOCUS_17240 <10060 8795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760460.1:membrane protein >Feature sequence118 1520 129 gene locus_tag LOCUS_17250 1520 129 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764026.1 protein_id gnl|my_center|LOCUS_17250 4359 1579 gene locus_tag LOCUS_17260 4359 1579 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108199.1 protein_id gnl|my_center|LOCUS_17260 5915 4752 gene locus_tag LOCUS_17270 5915 4752 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784676.1 protein_id gnl|my_center|LOCUS_17270 6257 9262 gene locus_tag LOCUS_17280 6257 9262 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108199.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence119 <1 576 gene locus_tag LOCUS_17290 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A667:polyphosphate kinase 1910 573 gene locus_tag LOCUS_17300 1910 573 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761361.1 protein_id gnl|my_center|LOCUS_17300 2762 4735 gene locus_tag LOCUS_17310 2762 4735 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_17310 4784 5854 gene locus_tag LOCUS_17320 4784 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 5971 6996 gene locus_tag LOCUS_17330 5971 6996 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_17330 6993 8033 gene locus_tag LOCUS_17340 6993 8033 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_17340 8033 9046 gene locus_tag LOCUS_17350 8033 9046 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_17350 9122 9535 gene locus_tag LOCUS_17360 9122 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787390.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence120 974 135 gene locus_tag LOCUS_17370 974 135 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817720.1 protein_id gnl|my_center|LOCUS_17370 1608 1159 gene locus_tag LOCUS_17380 1608 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2734 1772 gene locus_tag LOCUS_17390 2734 1772 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_17390 3093 3554 gene locus_tag LOCUS_17400 3093 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143455.1 protein_id gnl|my_center|LOCUS_17400 3955 3578 gene locus_tag LOCUS_17410 3955 3578 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_17410 4107 4613 gene locus_tag LOCUS_17420 4107 4613 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SW2 protein_id gnl|my_center|LOCUS_17420 4656 5015 gene locus_tag LOCUS_17430 4656 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788315.1 protein_id gnl|my_center|LOCUS_17430 5445 5035 gene locus_tag LOCUS_17440 5445 5035 CDS product 5-hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAG4 protein_id gnl|my_center|LOCUS_17440 5606 5971 gene locus_tag LOCUS_17450 5606 5971 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764611.1 protein_id gnl|my_center|LOCUS_17450 5964 6968 gene locus_tag LOCUS_17460 5964 6968 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202798.1 protein_id gnl|my_center|LOCUS_17460 6952 7545 gene locus_tag LOCUS_17470 6952 7545 CDS product 4-amino-4-deoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794135.1 protein_id gnl|my_center|LOCUS_17470 8563 7559 gene locus_tag LOCUS_17480 8563 7559 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q97 protein_id gnl|my_center|LOCUS_17480 9115 8639 gene locus_tag LOCUS_17490 9115 8639 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788385.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence121 580 1359 gene locus_tag LOCUS_17500 580 1359 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108426.1 protein_id gnl|my_center|LOCUS_17500 1883 1440 gene locus_tag LOCUS_17510 1883 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2493 2167 gene locus_tag LOCUS_17520 2493 2167 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323231.1 protein_id gnl|my_center|LOCUS_17520 3643 2732 gene locus_tag LOCUS_17530 3643 2732 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308677.1 protein_id gnl|my_center|LOCUS_17530 3773 4066 gene locus_tag LOCUS_17540 3773 4066 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108428.1 protein_id gnl|my_center|LOCUS_17540 4138 4365 gene locus_tag LOCUS_17550 4138 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 4517 4774 gene locus_tag LOCUS_17560 4517 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 5202 5005 gene locus_tag LOCUS_17570 5202 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 5562 5858 gene locus_tag LOCUS_17580 5562 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 6316 7095 gene locus_tag LOCUS_17590 6316 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 8059 7196 gene locus_tag LOCUS_17600 8059 7196 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816488.1 protein_id gnl|my_center|LOCUS_17600 8539 9180 gene locus_tag LOCUS_17610 8539 9180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence122 124 756 gene locus_tag LOCUS_17620 124 756 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761396.1 protein_id gnl|my_center|LOCUS_17620 1311 808 gene locus_tag LOCUS_17630 1311 808 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765089.1 protein_id gnl|my_center|LOCUS_17630 1473 1802 gene locus_tag LOCUS_17640 1473 1802 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_17640 1815 2894 gene locus_tag LOCUS_17650 1815 2894 CDS product PspC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202943.1 protein_id gnl|my_center|LOCUS_17650 3085 5001 gene locus_tag LOCUS_17660 gene dnaK 3085 5001 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X01 protein_id gnl|my_center|LOCUS_17660 5066 6181 gene locus_tag LOCUS_17670 5066 6181 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074642.1 protein_id gnl|my_center|LOCUS_17670 9238 6305 gene locus_tag LOCUS_17680 9238 6305 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203068.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence123 2100 1051 gene locus_tag LOCUS_17690 gene recA 2100 1051 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45791 protein_id gnl|my_center|LOCUS_17690 2553 2104 gene locus_tag LOCUS_17700 2553 2104 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_17700 3841 2648 gene locus_tag LOCUS_17710 3841 2648 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_17710 4018 4815 gene locus_tag LOCUS_17720 4018 4815 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785793.1 protein_id gnl|my_center|LOCUS_17720 4892 6061 gene locus_tag LOCUS_17730 gene purT 4892 6061 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9W1 protein_id gnl|my_center|LOCUS_17730 6175 6426 gene locus_tag LOCUS_17740 6175 6426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 8088 6484 gene locus_tag LOCUS_17750 8088 6484 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107676.1 protein_id gnl|my_center|LOCUS_17750 9149 8085 gene locus_tag LOCUS_17760 9149 8085 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763044.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence124 <1 592 gene locus_tag LOCUS_17770 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792004.1:biopolymer transporter ExbD 604 1263 gene locus_tag LOCUS_17780 604 1263 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792003.1 protein_id gnl|my_center|LOCUS_17780 1284 2102 gene locus_tag LOCUS_17790 1284 2102 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792001.1 protein_id gnl|my_center|LOCUS_17790 2150 3058 gene locus_tag LOCUS_17800 2150 3058 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791999.1 protein_id gnl|my_center|LOCUS_17800 3048 4517 gene locus_tag LOCUS_17810 3048 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203594.1 protein_id gnl|my_center|LOCUS_17810 4548 5069 gene locus_tag LOCUS_17820 4548 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 5053 5697 gene locus_tag LOCUS_17830 5053 5697 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109355.1 protein_id gnl|my_center|LOCUS_17830 5694 6341 gene locus_tag LOCUS_17840 5694 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109354.1 protein_id gnl|my_center|LOCUS_17840 6356 7363 gene locus_tag LOCUS_17850 6356 7363 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766890.1 protein_id gnl|my_center|LOCUS_17850 7511 9163 gene locus_tag LOCUS_17860 7511 9163 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794233.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence125 1016 2899 gene locus_tag LOCUS_17870 1016 2899 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765068.1 protein_id gnl|my_center|LOCUS_17870 3345 4523 gene locus_tag LOCUS_17880 3345 4523 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763300.1 protein_id gnl|my_center|LOCUS_17880 4564 8121 gene locus_tag LOCUS_17890 4564 8121 CDS product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6X8 protein_id gnl|my_center|LOCUS_17890 8232 8771 gene locus_tag LOCUS_17900 8232 8771 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0I9 protein_id gnl|my_center|LOCUS_17900 >Feature sequence126 362 889 gene locus_tag LOCUS_17910 362 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323448.1 protein_id gnl|my_center|LOCUS_17910 1316 2005 gene locus_tag LOCUS_17920 1316 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323442.1 protein_id gnl|my_center|LOCUS_17920 2475 2789 gene locus_tag LOCUS_17930 2475 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323447.1 protein_id gnl|my_center|LOCUS_17930 3241 2849 gene locus_tag LOCUS_17940 3241 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3620 3339 gene locus_tag LOCUS_17950 3620 3339 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_17950 3838 5202 gene locus_tag LOCUS_17960 3838 5202 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_17960 5413 5649 gene locus_tag LOCUS_17970 5413 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007659486.1 protein_id gnl|my_center|LOCUS_17970 6082 5750 gene locus_tag LOCUS_17980 6082 5750 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015014.1 protein_id gnl|my_center|LOCUS_17980 7065 6418 gene locus_tag LOCUS_17990 7065 6418 CDS product serine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323440.1 protein_id gnl|my_center|LOCUS_17990 7300 8349 gene locus_tag LOCUS_18000 7300 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323439.1 protein_id gnl|my_center|LOCUS_18000 8376 8828 gene locus_tag LOCUS_18010 8376 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203054.1 protein_id gnl|my_center|LOCUS_18010 8839 9237 gene locus_tag LOCUS_18020 8839 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203053.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence127 2092 371 gene locus_tag LOCUS_18030 2092 371 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_18030 3568 2327 gene locus_tag LOCUS_18040 3568 2327 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_18040 4952 3561 gene locus_tag LOCUS_18050 4952 3561 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015939.1 protein_id gnl|my_center|LOCUS_18050 5087 5944 gene locus_tag LOCUS_18060 5087 5944 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203249.1 protein_id gnl|my_center|LOCUS_18060 7523 5988 gene locus_tag LOCUS_18070 gene rny 7523 5988 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q86 protein_id gnl|my_center|LOCUS_18070 7931 7626 gene locus_tag LOCUS_18080 7931 7626 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZF9 protein_id gnl|my_center|LOCUS_18080 8249 7956 gene locus_tag LOCUS_18090 8249 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_18090 8459 8791 gene locus_tag LOCUS_18100 8459 8791 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q92 protein_id gnl|my_center|LOCUS_18100 >Feature sequence128 1766 1275 gene locus_tag LOCUS_18110 1766 1275 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794873.1 protein_id gnl|my_center|LOCUS_18110 2723 1839 gene locus_tag LOCUS_18120 2723 1839 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_18120 3766 2765 gene locus_tag LOCUS_18130 3766 2765 CDS product UPF0365 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X50 protein_id gnl|my_center|LOCUS_18130 4273 3809 gene locus_tag LOCUS_18140 4273 3809 CDS product nodulation efficiency protein D (NfeD) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760315.1 protein_id gnl|my_center|LOCUS_18140 5707 4289 gene locus_tag LOCUS_18150 5707 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764708.1 protein_id gnl|my_center|LOCUS_18150 5941 6699 gene locus_tag LOCUS_18160 5941 6699 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764709.1 protein_id gnl|my_center|LOCUS_18160 7326 6703 gene locus_tag LOCUS_18170 7326 6703 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765568.1 protein_id gnl|my_center|LOCUS_18170 7441 9093 gene locus_tag LOCUS_18180 gene hcp 7441 9093 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5M8 protein_id gnl|my_center|LOCUS_18180 >Feature sequence129 1502 3298 gene locus_tag LOCUS_18190 1502 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3401 4585 gene locus_tag LOCUS_18200 3401 4585 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107260.1 protein_id gnl|my_center|LOCUS_18200 4717 5172 gene locus_tag LOCUS_18210 4717 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_18210 6454 5267 gene locus_tag LOCUS_18220 6454 5267 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_18220 7113 6472 gene locus_tag LOCUS_18230 7113 6472 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_18230 7750 7133 gene locus_tag LOCUS_18240 7750 7133 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785376.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence130 1066 2064 gene locus_tag LOCUS_18250 1066 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_18250 2076 3095 gene locus_tag LOCUS_18260 2076 3095 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_18260 3092 3805 gene locus_tag LOCUS_18270 3092 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202861.1 protein_id gnl|my_center|LOCUS_18270 3853 5682 gene locus_tag LOCUS_18280 3853 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_18280 5707 6459 gene locus_tag LOCUS_18290 5707 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_18290 6475 7185 gene locus_tag LOCUS_18300 6475 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 7295 7561 gene locus_tag LOCUS_18310 7295 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 protein_id gnl|my_center|LOCUS_18310 7665 8789 gene locus_tag LOCUS_18320 7665 8789 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence131 595 179 gene locus_tag LOCUS_18330 595 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004327094.1 protein_id gnl|my_center|LOCUS_18330 672 926 gene locus_tag LOCUS_18340 672 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008650625.1 protein_id gnl|my_center|LOCUS_18340 2076 1510 gene locus_tag LOCUS_18350 2076 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004289236.1 protein_id gnl|my_center|LOCUS_18350 2831 2073 gene locus_tag LOCUS_18360 2831 2073 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008650623.1 protein_id gnl|my_center|LOCUS_18360 3808 2828 gene locus_tag LOCUS_18370 3808 2828 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311292.1 protein_id gnl|my_center|LOCUS_18370 4948 3809 gene locus_tag LOCUS_18380 4948 3809 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004289233.1 protein_id gnl|my_center|LOCUS_18380 7038 4960 gene locus_tag LOCUS_18390 7038 4960 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_18390 8061 7057 gene locus_tag LOCUS_18400 8061 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004293828.1 protein_id gnl|my_center|LOCUS_18400 8755 8186 gene locus_tag LOCUS_18410 8755 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence132 916 197 gene locus_tag LOCUS_18420 916 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2280 994 gene locus_tag LOCUS_18430 2280 994 CDS product peptidase C11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107701.1 protein_id gnl|my_center|LOCUS_18430 2687 2280 gene locus_tag LOCUS_18440 2687 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798505.1 protein_id gnl|my_center|LOCUS_18440 3714 2854 gene locus_tag LOCUS_18450 3714 2854 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_18450 5476 3980 gene locus_tag LOCUS_18460 5476 3980 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_18460 6167 7483 gene locus_tag LOCUS_18470 6167 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788563.1 protein_id gnl|my_center|LOCUS_18470 8158 7553 gene locus_tag LOCUS_18480 8158 7553 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_18480 8404 8189 gene locus_tag LOCUS_18490 8404 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 8611 8538 gene locus_tag LOCUS_t00310 8611 8538 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8702 8620 gene locus_tag LOCUS_t00320 8702 8620 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence133 363 1118 gene locus_tag LOCUS_18500 363 1118 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107172.1 protein_id gnl|my_center|LOCUS_18500 1823 1182 gene locus_tag LOCUS_18510 1823 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2260 5304 gene locus_tag LOCUS_18520 2260 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 8283 8615 gene locus_tag LOCUS_18530 8283 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence134 260 640 gene locus_tag LOCUS_18540 260 640 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_18540 761 1411 gene locus_tag LOCUS_18550 gene lspA 761 1411 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U05 protein_id gnl|my_center|LOCUS_18550 1408 2268 gene locus_tag LOCUS_18560 1408 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660240.1 protein_id gnl|my_center|LOCUS_18560 2274 2600 gene locus_tag LOCUS_18570 2274 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3311 2595 gene locus_tag LOCUS_18580 3311 2595 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761499.1 protein_id gnl|my_center|LOCUS_18580 3458 5767 gene locus_tag LOCUS_18590 3458 5767 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_18590 5781 6017 gene locus_tag LOCUS_18600 5781 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 6122 7765 gene locus_tag LOCUS_18610 gene pfp 6122 7765 CDS product pyrophosphate--fructose 6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB05 protein_id gnl|my_center|LOCUS_18610 >Feature sequence135 104 379 gene locus_tag LOCUS_18620 104 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039950.1 protein_id gnl|my_center|LOCUS_18620 404 1486 gene locus_tag LOCUS_18630 404 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107079.1 protein_id gnl|my_center|LOCUS_18630 1483 2379 gene locus_tag LOCUS_18640 1483 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_18640 2416 3210 gene locus_tag LOCUS_18650 2416 3210 CDS product polysaccharide export protein, BexD/CtrA/VexA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039947.1 protein_id gnl|my_center|LOCUS_18650 3242 5587 gene locus_tag LOCUS_18660 3242 5587 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039946.1 protein_id gnl|my_center|LOCUS_18660 5687 5866 gene locus_tag LOCUS_18670 5687 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 5892 8375 gene locus_tag LOCUS_18680 5892 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence136 120 404 gene locus_tag LOCUS_18690 120 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 480 965 gene locus_tag LOCUS_18700 480 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 978 3092 gene locus_tag LOCUS_18710 978 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 3140 3565 gene locus_tag LOCUS_18720 3140 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 3959 4369 gene locus_tag LOCUS_18730 3959 4369 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766442.1 protein_id gnl|my_center|LOCUS_18730 4366 4860 gene locus_tag LOCUS_18740 4366 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 4903 5982 gene locus_tag LOCUS_18750 4903 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 6457 6191 gene locus_tag LOCUS_18760 6457 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 6991 6485 gene locus_tag LOCUS_18770 6991 6485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 7938 7864 gene locus_tag LOCUS_t00330 7938 7864 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence137 1572 895 gene locus_tag LOCUS_18780 1572 895 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_18780 4234 1667 gene locus_tag LOCUS_18790 4234 1667 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107692.1 protein_id gnl|my_center|LOCUS_18790 5931 4255 gene locus_tag LOCUS_18800 5931 4255 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 protein_id gnl|my_center|LOCUS_18800 6648 6187 gene locus_tag LOCUS_18810 6648 6187 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_18810 8492 6684 gene locus_tag LOCUS_18820 8492 6684 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SQ0 protein_id gnl|my_center|LOCUS_18820 >Feature sequence138 2698 1550 gene locus_tag LOCUS_18830 2698 1550 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_18830 3189 2815 gene locus_tag LOCUS_18840 3189 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 3432 4508 gene locus_tag LOCUS_18850 3432 4508 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_18850 4520 7552 gene locus_tag LOCUS_18860 4520 7552 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764017.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence139 759 1304 gene locus_tag LOCUS_18870 759 1304 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_18870 1735 1358 gene locus_tag LOCUS_18880 1735 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2119 2568 gene locus_tag LOCUS_18890 2119 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 2511 4085 gene locus_tag LOCUS_18900 2511 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18900 5967 4309 gene locus_tag LOCUS_18910 5967 4309 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108696.1 protein_id gnl|my_center|LOCUS_18910 6351 6929 gene locus_tag LOCUS_18920 6351 6929 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783570.1 protein_id gnl|my_center|LOCUS_18920 7094 8374 gene locus_tag LOCUS_18930 gene eno 7094 8374 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z05 protein_id gnl|my_center|LOCUS_18930 >Feature sequence140 185 1666 gene locus_tag LOCUS_18940 185 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1996 1757 gene locus_tag LOCUS_18950 1996 1757 CDS product TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_18950 2839 2102 gene locus_tag LOCUS_18960 2839 2102 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA38 protein_id gnl|my_center|LOCUS_18960 5420 2880 gene locus_tag LOCUS_18970 gene pheT 5420 2880 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T65 protein_id gnl|my_center|LOCUS_18970 7006 5444 gene locus_tag LOCUS_18980 7006 5444 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA40 protein_id gnl|my_center|LOCUS_18980 7109 7933 gene locus_tag LOCUS_18990 gene ispE 7109 7933 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T40 protein_id gnl|my_center|LOCUS_18990 <8500 7954 gene locus_tag LOCUS_19000 <8500 7954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108010.1:ATPase AAA >Feature sequence141 <1 1633 gene locus_tag LOCUS_19010 <1 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764112.1:ATP-dependent DNA helicase RecQ 1798 3273 gene locus_tag LOCUS_19020 gene guaB 1798 3273 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A126 protein_id gnl|my_center|LOCUS_19020 3432 4703 gene locus_tag LOCUS_19030 3432 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 4765 6135 gene locus_tag LOCUS_19040 4765 6135 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW8 protein_id gnl|my_center|LOCUS_19040 6138 7835 gene locus_tag LOCUS_19050 6138 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_19050 7839 8135 gene locus_tag LOCUS_19060 7839 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760777.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence142 3292 809 gene locus_tag LOCUS_19070 3292 809 CDS product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107923.1 protein_id gnl|my_center|LOCUS_19070 4292 3765 gene locus_tag LOCUS_19080 4292 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 4995 4303 gene locus_tag LOCUS_19090 4995 4303 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769912.1 protein_id gnl|my_center|LOCUS_19090 5374 5036 gene locus_tag LOCUS_19100 5374 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 6127 5720 gene locus_tag LOCUS_19110 6127 5720 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759699.1 protein_id gnl|my_center|LOCUS_19110 6404 6111 gene locus_tag LOCUS_19120 6404 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_19120 8113 6719 gene locus_tag LOCUS_19130 8113 6719 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence143 481 1737 gene locus_tag LOCUS_19140 gene pgk 481 1737 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A753 protein_id gnl|my_center|LOCUS_19140 1879 5856 gene locus_tag LOCUS_19150 1879 5856 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789596.1 protein_id gnl|my_center|LOCUS_19150 5867 6409 gene locus_tag LOCUS_19160 5867 6409 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_19160 6423 6992 gene locus_tag LOCUS_19170 6423 6992 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_19170 7542 7000 gene locus_tag LOCUS_19180 7542 7000 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787394.1 protein_id gnl|my_center|LOCUS_19180 <8481 7533 gene locus_tag LOCUS_19190 <8481 7533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202749.1:phosphoadenosine phosphosulfate sulfurtransferase >Feature sequence144 355 1425 gene locus_tag LOCUS_19200 355 1425 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_19200 1438 2211 gene locus_tag LOCUS_19210 1438 2211 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760853.1 protein_id gnl|my_center|LOCUS_19210 3816 2296 gene locus_tag LOCUS_19220 3816 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767799.1 protein_id gnl|my_center|LOCUS_19220 4611 3955 gene locus_tag LOCUS_19230 4611 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 5550 5017 gene locus_tag LOCUS_19240 5550 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 7777 5561 gene locus_tag LOCUS_19250 7777 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108600.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence145 <1 556 gene locus_tag LOCUS_19260 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A466:50S ribosomal protein L1 572 1090 gene locus_tag LOCUS_19270 gene rplJ 572 1090 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_19270 1138 1515 gene locus_tag LOCUS_19280 gene rplL 1138 1515 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A468 protein_id gnl|my_center|LOCUS_19280 1674 5486 gene locus_tag LOCUS_19290 gene rpoB 1674 5486 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ7 protein_id gnl|my_center|LOCUS_19290 >Feature sequence146 545 955 gene locus_tag LOCUS_19300 545 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793657.1 protein_id gnl|my_center|LOCUS_19300 957 2204 gene locus_tag LOCUS_19310 957 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793658.1 protein_id gnl|my_center|LOCUS_19310 2789 2304 gene locus_tag LOCUS_19320 2789 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 3868 2843 gene locus_tag LOCUS_19330 3868 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 4423 4004 gene locus_tag LOCUS_19340 4423 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 6392 4446 gene locus_tag LOCUS_19350 6392 4446 CDS product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962651.1 protein_id gnl|my_center|LOCUS_19350 6787 6404 gene locus_tag LOCUS_19360 6787 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 7958 6765 gene locus_tag LOCUS_19370 7958 6765 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109637.1 protein_id gnl|my_center|LOCUS_19370 8147 7962 gene locus_tag LOCUS_19380 8147 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence147 972 148 gene locus_tag LOCUS_19390 gene menB 972 148 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WQ8 protein_id gnl|my_center|LOCUS_19390 2641 977 gene locus_tag LOCUS_19400 gene menD 2641 977 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WR0 protein_id gnl|my_center|LOCUS_19400 3684 2662 gene locus_tag LOCUS_19410 3684 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202358.1 protein_id gnl|my_center|LOCUS_19410 4241 3789 gene locus_tag LOCUS_19420 4241 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 4464 6494 gene locus_tag LOCUS_19430 4464 6494 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201861.1 protein_id gnl|my_center|LOCUS_19430 6501 7259 gene locus_tag LOCUS_19440 6501 7259 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_812170.2 protein_id gnl|my_center|LOCUS_19440 >Feature sequence148 51 635 gene locus_tag LOCUS_19450 51 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 637 822 gene locus_tag LOCUS_19460 637 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 819 1265 gene locus_tag LOCUS_19470 819 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 1262 1480 gene locus_tag LOCUS_19480 1262 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1485 3182 gene locus_tag LOCUS_19490 gene dcm 1485 3182 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816510.1 protein_id gnl|my_center|LOCUS_19490 3175 3594 gene locus_tag LOCUS_19500 3175 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 3614 4108 gene locus_tag LOCUS_19510 3614 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108372.1 protein_id gnl|my_center|LOCUS_19510 4178 4666 gene locus_tag LOCUS_19520 4178 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 4663 4911 gene locus_tag LOCUS_19530 4663 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 5143 5547 gene locus_tag LOCUS_19540 5143 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 5921 6469 gene locus_tag LOCUS_19550 5921 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109081.1 protein_id gnl|my_center|LOCUS_19550 6482 6904 gene locus_tag LOCUS_19560 6482 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 6917 7339 gene locus_tag LOCUS_19570 6917 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 7435 7989 gene locus_tag LOCUS_19580 7435 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence149 3156 466 gene locus_tag LOCUS_19590 3156 466 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_19590 3464 4345 gene locus_tag LOCUS_19600 3464 4345 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_19600 5972 4398 gene locus_tag LOCUS_19610 5972 4398 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785433.1 protein_id gnl|my_center|LOCUS_19610 <8231 6003 gene locus_tag LOCUS_19620 <8231 6003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108592.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence150 <1 989 gene locus_tag LOCUS_19630 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64SX6:anthranilate phosphoribosyltransferase 997 1785 gene locus_tag LOCUS_19640 gene trpC 997 1785 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAD6 protein_id gnl|my_center|LOCUS_19640 1782 2405 gene locus_tag LOCUS_19650 gene trpF 1782 2405 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SX4 protein_id gnl|my_center|LOCUS_19650 2418 3197 gene locus_tag LOCUS_19660 gene trpA 2418 3197 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAD8 protein_id gnl|my_center|LOCUS_19660 3284 4333 gene locus_tag LOCUS_19670 3284 4333 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_19670 4437 5123 gene locus_tag LOCUS_19680 4437 5123 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762294.1 protein_id gnl|my_center|LOCUS_19680 5231 6922 gene locus_tag LOCUS_19690 5231 6922 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786392.1 protein_id gnl|my_center|LOCUS_19690 7572 7183 gene locus_tag LOCUS_19700 7572 7183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 8072 7695 gene locus_tag LOCUS_19710 8072 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence151 <1 834 gene locus_tag LOCUS_19720 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786035.1:O-succinylbenzoic acid--CoA ligase 920 3061 gene locus_tag LOCUS_19730 920 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3388 3086 gene locus_tag LOCUS_19740 3388 3086 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788897.1 protein_id gnl|my_center|LOCUS_19740 3776 4522 gene locus_tag LOCUS_19750 3776 4522 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_19750 4531 5871 gene locus_tag LOCUS_19760 4531 5871 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB61 protein_id gnl|my_center|LOCUS_19760 5882 6787 gene locus_tag LOCUS_19770 5882 6787 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660983.1 protein_id gnl|my_center|LOCUS_19770 6803 7972 gene locus_tag LOCUS_19780 6803 7972 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766203.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence152 744 193 gene locus_tag LOCUS_19790 744 193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765673.1 protein_id gnl|my_center|LOCUS_19790 906 2483 gene locus_tag LOCUS_19800 906 2483 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_19800 2705 4072 gene locus_tag LOCUS_19810 2705 4072 CDS product signal transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107587.1 protein_id gnl|my_center|LOCUS_19810 4095 5066 gene locus_tag LOCUS_19820 4095 5066 CDS product 1,4-beta-mannosyl-N-acetylglucosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8Y4 protein_id gnl|my_center|LOCUS_19820 5136 7364 gene locus_tag LOCUS_19830 5136 7364 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107585.1 protein_id gnl|my_center|LOCUS_19830 <7977 7370 gene locus_tag LOCUS_19840 <7977 7370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XY5:Sec-independent protein translocase protein TatC >Feature sequence153 321 2222 gene locus_tag LOCUS_19850 321 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109008.1 protein_id gnl|my_center|LOCUS_19850 2973 2431 gene locus_tag LOCUS_19860 2973 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 3731 4213 gene locus_tag LOCUS_19870 3731 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 4395 5042 gene locus_tag LOCUS_19880 4395 5042 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002041786.1 protein_id gnl|my_center|LOCUS_19880 5413 5339 gene locus_tag LOCUS_t00340 5413 5339 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5672 6262 gene locus_tag LOCUS_19890 gene hisH 5672 6262 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z4 protein_id gnl|my_center|LOCUS_19890 6284 7006 gene locus_tag LOCUS_19900 gene hisA 6284 7006 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z5 protein_id gnl|my_center|LOCUS_19900 7029 7784 gene locus_tag LOCUS_19910 gene hisF 7029 7784 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z6 protein_id gnl|my_center|LOCUS_19910 >Feature sequence154 26 129 gene locus_tag LOCUS_r00010 26 129 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 585 1436 gene locus_tag LOCUS_19920 585 1436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814517.1 protein_id gnl|my_center|LOCUS_19920 1447 2328 gene locus_tag LOCUS_19930 1447 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791993.1 protein_id gnl|my_center|LOCUS_19930 2325 2705 gene locus_tag LOCUS_19940 2325 2705 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_19940 4014 2794 gene locus_tag LOCUS_19950 4014 2794 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_19950 5540 4023 gene locus_tag LOCUS_19960 gene gltX 5540 4023 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_19960 5626 7683 gene locus_tag LOCUS_19970 5626 7683 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence155 1994 1572 gene locus_tag LOCUS_19980 1994 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 6646 1991 gene locus_tag LOCUS_19990 6646 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 6831 6649 gene locus_tag LOCUS_20000 6831 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 7229 6846 gene locus_tag LOCUS_20010 7229 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence156 397 1215 gene locus_tag LOCUS_20020 397 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 1219 1680 gene locus_tag LOCUS_20030 1219 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1693 2616 gene locus_tag LOCUS_20040 1693 2616 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766067.1 protein_id gnl|my_center|LOCUS_20040 3068 2643 gene locus_tag LOCUS_20050 3068 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 4495 3158 gene locus_tag LOCUS_20060 4495 3158 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790315.1 protein_id gnl|my_center|LOCUS_20060 5702 4578 gene locus_tag LOCUS_20070 5702 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20070 7714 5597 gene locus_tag LOCUS_20080 7714 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20080 >Feature sequence157 435 100 gene locus_tag LOCUS_20090 435 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759609.1 protein_id gnl|my_center|LOCUS_20090 770 453 gene locus_tag LOCUS_20100 770 453 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YG6 protein_id gnl|my_center|LOCUS_20100 4606 809 gene locus_tag LOCUS_20110 4606 809 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YG7 protein_id gnl|my_center|LOCUS_20110 5258 4755 gene locus_tag LOCUS_20120 5258 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202343.1 protein_id gnl|my_center|LOCUS_20120 5955 5377 gene locus_tag LOCUS_20130 5955 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 6206 6889 gene locus_tag LOCUS_20140 6206 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760077.1 protein_id gnl|my_center|LOCUS_20140 7302 7526 gene locus_tag LOCUS_20150 gene tatA 7302 7526 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0B9 protein_id gnl|my_center|LOCUS_20150 >Feature sequence158 148 363 gene locus_tag LOCUS_20160 148 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 375 596 gene locus_tag LOCUS_20170 375 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20170 609 1205 gene locus_tag LOCUS_20180 609 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1258 1644 gene locus_tag LOCUS_20190 1258 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291533.1 protein_id gnl|my_center|LOCUS_20190 2085 2936 gene locus_tag LOCUS_20200 2085 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2961 3218 gene locus_tag LOCUS_20210 2961 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291531.1 protein_id gnl|my_center|LOCUS_20210 3239 3472 gene locus_tag LOCUS_20220 3239 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485418.1 protein_id gnl|my_center|LOCUS_20220 3469 3714 gene locus_tag LOCUS_20230 3469 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 3760 4068 gene locus_tag LOCUS_20240 3760 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20240 4186 4407 gene locus_tag LOCUS_20250 4186 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203040.1 protein_id gnl|my_center|LOCUS_20250 4995 4471 gene locus_tag LOCUS_20260 4995 4471 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008674060.1 protein_id gnl|my_center|LOCUS_20260 5498 4995 gene locus_tag LOCUS_20270 5498 4995 CDS product conjugal transfer protein TraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291525.1 protein_id gnl|my_center|LOCUS_20270 6397 5495 gene locus_tag LOCUS_20280 6397 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291524.1 protein_id gnl|my_center|LOCUS_20280 6983 6408 gene locus_tag LOCUS_20290 6983 6408 CDS product conjugal transfer protein TraO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291523.1 protein_id gnl|my_center|LOCUS_20290 >Feature sequence159 3749 2640 gene locus_tag LOCUS_20300 3749 2640 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761836.1 protein_id gnl|my_center|LOCUS_20300 3941 4849 gene locus_tag LOCUS_20310 3941 4849 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108482.1 protein_id gnl|my_center|LOCUS_20310 5147 7000 gene locus_tag LOCUS_20320 5147 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762677.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence160 1637 132 gene locus_tag LOCUS_20330 1637 132 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769710.1 protein_id gnl|my_center|LOCUS_20330 2451 1876 gene locus_tag LOCUS_20340 gene kdpC 2451 1876 CDS product potassium-transporting ATPase KdpC subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A521 protein_id gnl|my_center|LOCUS_20340 4454 2466 gene locus_tag LOCUS_20350 gene kdpB 4454 2466 CDS product potassium-transporting ATPase ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A520 protein_id gnl|my_center|LOCUS_20350 5299 4559 gene locus_tag LOCUS_20360 5299 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20360 6265 5303 gene locus_tag LOCUS_20370 6265 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20370 <7351 6692 gene locus_tag LOCUS_20380 <7351 6692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796447.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence161 661 239 gene locus_tag LOCUS_20390 661 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 859 2163 gene locus_tag LOCUS_20400 859 2163 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764994.1 protein_id gnl|my_center|LOCUS_20400 2221 2526 gene locus_tag LOCUS_20410 2221 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767861.1 protein_id gnl|my_center|LOCUS_20410 2523 3092 gene locus_tag LOCUS_20420 gene ruvC 2523 3092 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A761 protein_id gnl|my_center|LOCUS_20420 3105 5105 gene locus_tag LOCUS_20430 3105 5105 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_20430 5155 6606 gene locus_tag LOCUS_20440 5155 6606 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence162 >Feature sequence163 466 1356 gene locus_tag LOCUS_20450 466 1356 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783741.1 protein_id gnl|my_center|LOCUS_20450 1379 1870 gene locus_tag LOCUS_20460 1379 1870 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_20460 2327 1872 gene locus_tag LOCUS_20470 2327 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 4311 3337 gene locus_tag LOCUS_20480 4311 3337 CDS product UNC-44 ankyrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_20480 5896 4319 gene locus_tag LOCUS_20490 5896 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016208.1 protein_id gnl|my_center|LOCUS_20490 6374 5886 gene locus_tag LOCUS_20500 6374 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 7203 6406 gene locus_tag LOCUS_20510 7203 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762597.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence164 417 13 gene locus_tag LOCUS_20520 417 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_20520 2730 520 gene locus_tag LOCUS_20530 2730 520 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_20530 2865 4388 gene locus_tag LOCUS_20540 2865 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_20540 5389 4475 gene locus_tag LOCUS_20550 5389 4475 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767227.1 protein_id gnl|my_center|LOCUS_20550 5545 6624 gene locus_tag LOCUS_20560 5545 6624 CDS product RND family efflux transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096849.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence165 2996 1218 gene locus_tag LOCUS_20570 gene ilvD 2996 1218 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A608 protein_id gnl|my_center|LOCUS_20570 3599 5308 gene locus_tag LOCUS_20580 3599 5308 CDS product glycosyl hydrolase family 109 protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C863 protein_id gnl|my_center|LOCUS_20580 <7121 6187 gene locus_tag LOCUS_20590 <7121 6187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786230.1:phosphoglucomutase >Feature sequence166 53 1549 gene locus_tag LOCUS_20600 gene leuA 53 1549 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP0 protein_id gnl|my_center|LOCUS_20600 1569 2966 gene locus_tag LOCUS_20610 gene leuC 1569 2966 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP1 protein_id gnl|my_center|LOCUS_20610 2970 3575 gene locus_tag LOCUS_20620 2970 3575 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_20620 3594 5126 gene locus_tag LOCUS_20630 3594 5126 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_20630 5139 6200 gene locus_tag LOCUS_20640 gene leuB 5139 6200 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54354 protein_id gnl|my_center|LOCUS_20640 6750 6265 gene locus_tag LOCUS_20650 6750 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence167 1712 1044 gene locus_tag LOCUS_20660 1712 1044 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_20660 2774 1752 gene locus_tag LOCUS_20670 2774 1752 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_20670 2992 4068 gene locus_tag LOCUS_20680 2992 4068 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_20680 4090 5583 gene locus_tag LOCUS_20690 4090 5583 CDS product altronate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_20690 7103 5751 gene locus_tag LOCUS_20700 7103 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence168 3737 30 gene locus_tag LOCUS_20710 gene purL 3737 30 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6Z2 protein_id gnl|my_center|LOCUS_20710 4571 3867 gene locus_tag LOCUS_20720 4571 3867 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938991.1 protein_id gnl|my_center|LOCUS_20720 7060 4559 gene locus_tag LOCUS_20730 7060 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence169 255 1109 gene locus_tag LOCUS_20740 gene map 255 1109 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T79 protein_id gnl|my_center|LOCUS_20740 1125 2147 gene locus_tag LOCUS_20750 gene tsaD 1125 2147 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A997 protein_id gnl|my_center|LOCUS_20750 2168 2668 gene locus_tag LOCUS_20760 2168 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2773 3033 gene locus_tag LOCUS_20770 gene rpmB 2773 3033 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A999 protein_id gnl|my_center|LOCUS_20770 3053 3241 gene locus_tag LOCUS_20780 gene rpmG 3053 3241 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK2 protein_id gnl|my_center|LOCUS_20780 3251 3406 gene locus_tag LOCUS_20790 3251 3406 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_20790 3531 4496 gene locus_tag LOCUS_20800 gene ftsY 3531 4496 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK4 protein_id gnl|my_center|LOCUS_20800 4493 5794 gene locus_tag LOCUS_20810 gene rimO 4493 5794 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A2 protein_id gnl|my_center|LOCUS_20810 5796 6086 gene locus_tag LOCUS_20820 5796 6086 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787931.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence170 3642 1210 gene locus_tag LOCUS_20830 3642 1210 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_20830 4039 5412 gene locus_tag LOCUS_20840 gene radA 4039 5412 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YS2 protein_id gnl|my_center|LOCUS_20840 >Feature sequence171 285 2507 gene locus_tag LOCUS_20850 285 2507 CDS product formate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786073.1 protein_id gnl|my_center|LOCUS_20850 2574 3326 gene locus_tag LOCUS_20860 2574 3326 CDS product pyruvate formate-lyase-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WN9 protein_id gnl|my_center|LOCUS_20860 3572 3799 gene locus_tag LOCUS_20870 3572 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 4475 3888 gene locus_tag LOCUS_20880 4475 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764615.1 protein_id gnl|my_center|LOCUS_20880 5850 4483 gene locus_tag LOCUS_20890 5850 4483 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764614.1 protein_id gnl|my_center|LOCUS_20890 6587 5847 gene locus_tag LOCUS_20900 6587 5847 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence172 802 473 gene locus_tag LOCUS_20910 802 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788139.1 protein_id gnl|my_center|LOCUS_20910 1220 807 gene locus_tag LOCUS_20920 1220 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 2065 1232 gene locus_tag LOCUS_20930 2065 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2405 2067 gene locus_tag LOCUS_20940 2405 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3750 2605 gene locus_tag LOCUS_20950 3750 2605 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAJ8 protein_id gnl|my_center|LOCUS_20950 5174 3846 gene locus_tag LOCUS_20960 5174 3846 CDS product UDP-glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107229.1 protein_id gnl|my_center|LOCUS_20960 6359 5244 gene locus_tag LOCUS_20970 gene fcl 6359 5244 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8E2 protein_id gnl|my_center|LOCUS_20970 >Feature sequence173 2872 878 gene locus_tag LOCUS_20980 2872 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 6037 2891 gene locus_tag LOCUS_20990 6037 2891 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784823.1 protein_id gnl|my_center|LOCUS_20990 6590 6503 gene locus_tag LOCUS_t00350 6590 6503 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6674 6601 gene locus_tag LOCUS_t00360 6674 6601 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence174 678 19 gene locus_tag LOCUS_21000 678 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 1087 683 gene locus_tag LOCUS_21010 1087 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 1315 1127 gene locus_tag LOCUS_21020 1315 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3015 1504 gene locus_tag LOCUS_21030 3015 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 4294 3026 gene locus_tag LOCUS_21040 4294 3026 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254222.1 protein_id gnl|my_center|LOCUS_21040 4806 4291 gene locus_tag LOCUS_21050 4806 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 4989 4807 gene locus_tag LOCUS_21060 4989 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 6148 5399 gene locus_tag LOCUS_21070 6148 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 6335 6141 gene locus_tag LOCUS_21080 6335 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 >Feature sequence175 452 748 gene locus_tag LOCUS_21090 452 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 733 1875 gene locus_tag LOCUS_21100 733 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 1879 2766 gene locus_tag LOCUS_21110 1879 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108370.1 protein_id gnl|my_center|LOCUS_21110 2836 3087 gene locus_tag LOCUS_21120 2836 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 3138 3548 gene locus_tag LOCUS_21130 3138 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323445.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21130 3671 4282 gene locus_tag LOCUS_21140 3671 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 4279 4578 gene locus_tag LOCUS_21150 4279 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 4554 4763 gene locus_tag LOCUS_21160 4554 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 4771 5796 gene locus_tag LOCUS_21170 4771 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 5807 6508 gene locus_tag LOCUS_21180 5807 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence176 106 489 gene locus_tag LOCUS_21190 106 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202244.1 protein_id gnl|my_center|LOCUS_21190 497 955 gene locus_tag LOCUS_21200 497 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785406.1 protein_id gnl|my_center|LOCUS_21200 1058 1143 gene locus_tag LOCUS_t00370 1058 1143 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2268 1369 gene locus_tag LOCUS_21210 2268 1369 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107849.1 protein_id gnl|my_center|LOCUS_21210 2405 3184 gene locus_tag LOCUS_21220 2405 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931028.1 protein_id gnl|my_center|LOCUS_21220 3218 3682 gene locus_tag LOCUS_21230 3218 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 3661 4374 gene locus_tag LOCUS_21240 3661 4374 CDS product radical SAM mobile pair protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679436.1 protein_id gnl|my_center|LOCUS_21240 4371 5246 gene locus_tag LOCUS_21250 4371 5246 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence177 3 626 gene locus_tag LOCUS_21260 3 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 619 840 gene locus_tag LOCUS_21270 619 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 846 1442 gene locus_tag LOCUS_21280 846 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 1449 2504 gene locus_tag LOCUS_21290 1449 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2509 3207 gene locus_tag LOCUS_21300 2509 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 3194 4477 gene locus_tag LOCUS_21310 3194 4477 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107098.1 protein_id gnl|my_center|LOCUS_21310 4672 5784 gene locus_tag LOCUS_21320 4672 5784 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005842179.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence178 135 3500 gene locus_tag LOCUS_21330 135 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_21330 3701 5674 gene locus_tag LOCUS_21340 3701 5674 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109145.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence179 754 230 gene locus_tag LOCUS_21350 754 230 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_21350 3687 808 gene locus_tag LOCUS_21360 3687 808 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766196.1 protein_id gnl|my_center|LOCUS_21360 4851 3808 gene locus_tag LOCUS_21370 4851 3808 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_21370 5652 4906 gene locus_tag LOCUS_21380 5652 4906 CDS product acyl-ACP thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766475.1 protein_id gnl|my_center|LOCUS_21380 6213 5656 gene locus_tag LOCUS_21390 6213 5656 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence180 <1 685 gene locus_tag LOCUS_21400 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XW9:3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ 687 1454 gene locus_tag LOCUS_21410 687 1454 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XX0 protein_id gnl|my_center|LOCUS_21410 1501 2058 gene locus_tag LOCUS_21420 1501 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785115.1 protein_id gnl|my_center|LOCUS_21420 2170 3081 gene locus_tag LOCUS_21430 gene miaA1 2170 3081 CDS product tRNA dimethylallyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A018 protein_id gnl|my_center|LOCUS_21430 4084 3068 gene locus_tag LOCUS_21440 4084 3068 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202490.1 protein_id gnl|my_center|LOCUS_21440 4450 4109 gene locus_tag LOCUS_21450 4450 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767910.1 protein_id gnl|my_center|LOCUS_21450 4752 4450 gene locus_tag LOCUS_21460 4752 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 >Feature sequence181 <1 1394 gene locus_tag LOCUS_21470 <1 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P13356:ATP synthase subunit beta 1432 1677 gene locus_tag LOCUS_21480 1432 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107410.1 protein_id gnl|my_center|LOCUS_21480 1747 2238 gene locus_tag LOCUS_21490 1747 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765589.1 protein_id gnl|my_center|LOCUS_21490 2198 3214 gene locus_tag LOCUS_21500 gene atpB 2198 3214 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA8 protein_id gnl|my_center|LOCUS_21500 3261 3515 gene locus_tag LOCUS_21510 gene atpE 3261 3515 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA7 protein_id gnl|my_center|LOCUS_21510 3534 4037 gene locus_tag LOCUS_21520 gene atpF 3534 4037 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9U9 protein_id gnl|my_center|LOCUS_21520 4044 4598 gene locus_tag LOCUS_21530 gene atpH 4044 4598 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9U8 protein_id gnl|my_center|LOCUS_21530 4694 6283 gene locus_tag LOCUS_21540 gene atpA 4694 6283 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA4 protein_id gnl|my_center|LOCUS_21540 >Feature sequence182 958 587 gene locus_tag LOCUS_21550 958 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762411.1 protein_id gnl|my_center|LOCUS_21550 1135 2259 gene locus_tag LOCUS_21560 1135 2259 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64S02 protein_id gnl|my_center|LOCUS_21560 2284 3060 gene locus_tag LOCUS_21570 2284 3060 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107740.1 protein_id gnl|my_center|LOCUS_21570 3073 4278 gene locus_tag LOCUS_21580 3073 4278 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788745.1 protein_id gnl|my_center|LOCUS_21580 4285 5952 gene locus_tag LOCUS_21590 4285 5952 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64S05 protein_id gnl|my_center|LOCUS_21590 >Feature sequence183 695 426 gene locus_tag LOCUS_21600 695 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 654 1403 gene locus_tag LOCUS_21610 654 1403 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887097.1 protein_id gnl|my_center|LOCUS_21610 1415 2203 gene locus_tag LOCUS_21620 1415 2203 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887034.1 protein_id gnl|my_center|LOCUS_21620 2394 2639 gene locus_tag LOCUS_21630 2394 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2700 2984 gene locus_tag LOCUS_21640 2700 2984 CDS product phosphatidylinositol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784907.1 protein_id gnl|my_center|LOCUS_21640 2981 3982 gene locus_tag LOCUS_21650 2981 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 4030 5349 gene locus_tag LOCUS_21660 4030 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence184 <1 1032 gene locus_tag LOCUS_21670 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787452.1:MATE family efflux transporter 1547 1029 gene locus_tag LOCUS_21680 1547 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2614 2006 gene locus_tag LOCUS_21690 2614 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3796 2873 gene locus_tag LOCUS_21700 3796 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 4158 3865 gene locus_tag LOCUS_21710 4158 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 5696 4329 gene locus_tag LOCUS_21720 5696 4329 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202347.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence185 <1 1887 gene locus_tag LOCUS_21730 <1 1887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107592.1:SusC/RagA family TonB-linked outer membrane protein 1913 3523 gene locus_tag LOCUS_21740 1913 3523 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107593.1 protein_id gnl|my_center|LOCUS_21740 3561 4664 gene locus_tag LOCUS_21750 3561 4664 CDS product endoglycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761680.1 protein_id gnl|my_center|LOCUS_21750 4675 5853 gene locus_tag LOCUS_21760 4675 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107594.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence186 1355 306 gene locus_tag LOCUS_21770 1355 306 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UC1 protein_id gnl|my_center|LOCUS_21770 4973 1539 gene locus_tag LOCUS_21780 gene sbcC 4973 1539 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVR0 protein_id gnl|my_center|LOCUS_21780 6191 4977 gene locus_tag LOCUS_21790 gene sbcD 6191 4977 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB67 protein_id gnl|my_center|LOCUS_21790 >Feature sequence187 398 862 gene locus_tag LOCUS_21800 398 862 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_21800 1038 1991 gene locus_tag LOCUS_21810 1038 1991 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 protein_id gnl|my_center|LOCUS_21810 4096 2006 gene locus_tag LOCUS_21820 4096 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 4269 4916 gene locus_tag LOCUS_21830 4269 4916 CDS product DUF5020 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109270.1 protein_id gnl|my_center|LOCUS_21830 4947 6239 gene locus_tag LOCUS_21840 4947 6239 CDS product xanthine/uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence188 <1 2082 gene locus_tag LOCUS_21850 <1 2082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203037.1:DNA methylase 2535 3059 gene locus_tag LOCUS_21860 2535 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 4317 4763 gene locus_tag LOCUS_21870 4317 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 5232 5645 gene locus_tag LOCUS_21880 5232 5645 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SF3 protein_id gnl|my_center|LOCUS_21880 >Feature sequence189 203 2953 gene locus_tag LOCUS_21890 203 2953 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107291.1 protein_id gnl|my_center|LOCUS_21890 2964 4595 gene locus_tag LOCUS_21900 2964 4595 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107292.1 protein_id gnl|my_center|LOCUS_21900 4768 6120 gene locus_tag LOCUS_21910 gene nqrA 4768 6120 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence190 957 10 gene locus_tag LOCUS_21920 gene purC 957 10 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A004 protein_id gnl|my_center|LOCUS_21920 1997 999 gene locus_tag LOCUS_21930 1997 999 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_21930 3737 2088 gene locus_tag LOCUS_21940 3737 2088 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_21940 5429 3780 gene locus_tag LOCUS_21950 5429 3780 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767962.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence191 1936 209 gene locus_tag LOCUS_21960 1936 209 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_21960 2976 1990 gene locus_tag LOCUS_21970 2976 1990 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108486.1 protein_id gnl|my_center|LOCUS_21970 3056 3130 gene locus_tag LOCUS_t00380 3056 3130 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3158 3232 gene locus_tag LOCUS_t00390 3158 3232 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3414 4340 gene locus_tag LOCUS_21980 3414 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_21980 4352 4771 gene locus_tag LOCUS_21990 4352 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800831.1 protein_id gnl|my_center|LOCUS_21990 <6372 4964 gene locus_tag LOCUS_22000 <6372 4964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A470:DNA-directed RNA polymerase subunit beta' >Feature sequence192 <1 608 gene locus_tag LOCUS_22010 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811577.1:stage V sporulation protein K 1215 703 gene locus_tag LOCUS_22020 1215 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1535 1359 gene locus_tag LOCUS_22030 1535 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1528 3876 gene locus_tag LOCUS_22040 1528 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108188.1 protein_id gnl|my_center|LOCUS_22040 4974 3880 gene locus_tag LOCUS_22050 4974 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108189.1 protein_id gnl|my_center|LOCUS_22050 5986 4964 gene locus_tag LOCUS_22060 5986 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108190.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence193 2748 187 gene locus_tag LOCUS_22070 2748 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 3261 3875 gene locus_tag LOCUS_22080 3261 3875 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005924132.1 protein_id gnl|my_center|LOCUS_22080 3971 5077 gene locus_tag LOCUS_22090 3971 5077 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202397.1 protein_id gnl|my_center|LOCUS_22090 5171 6142 gene locus_tag LOCUS_22100 5171 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence194 1011 130 gene locus_tag LOCUS_22110 1011 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2259 1024 gene locus_tag LOCUS_22120 2259 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 3032 2292 gene locus_tag LOCUS_22130 3032 2292 CDS product type I restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108375.1 protein_id gnl|my_center|LOCUS_22130 3465 3019 gene locus_tag LOCUS_22140 3465 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 3418 3696 gene locus_tag LOCUS_22150 3418 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 4105 3827 gene locus_tag LOCUS_22160 4105 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 4677 4387 gene locus_tag LOCUS_22170 4677 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297763.1 protein_id gnl|my_center|LOCUS_22170 5008 5352 gene locus_tag LOCUS_22180 5008 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108377.1 protein_id gnl|my_center|LOCUS_22180 6181 5411 gene locus_tag LOCUS_22190 6181 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence195 587 2194 gene locus_tag LOCUS_22200 587 2194 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890798.1 protein_id gnl|my_center|LOCUS_22200 2358 4325 gene locus_tag LOCUS_22210 2358 4325 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_22210 4341 5729 gene locus_tag LOCUS_22220 gene xynD 4341 5729 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_22220 >Feature sequence196 1126 482 gene locus_tag LOCUS_22230 1126 482 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZB4 protein_id gnl|my_center|LOCUS_22230 2142 1123 gene locus_tag LOCUS_22240 2142 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 3249 2227 gene locus_tag LOCUS_22250 3249 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 3677 3922 gene locus_tag LOCUS_22260 3677 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 3912 4250 gene locus_tag LOCUS_22270 3912 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 4852 5646 gene locus_tag LOCUS_22280 4852 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 5603 6055 gene locus_tag LOCUS_22290 5603 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 >Feature sequence197 1181 174 gene locus_tag LOCUS_22300 1181 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203302.1 protein_id gnl|my_center|LOCUS_22300 2082 1201 gene locus_tag LOCUS_22310 2082 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098079.1 protein_id gnl|my_center|LOCUS_22310 2444 2175 gene locus_tag LOCUS_22320 2444 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3823 2744 gene locus_tag LOCUS_22330 3823 2744 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202712.1 protein_id gnl|my_center|LOCUS_22330 4591 4197 gene locus_tag LOCUS_tm00010 4591 4197 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5896 4718 gene locus_tag LOCUS_22340 5896 4718 CDS product 5-aminoimidazole-4-carboxamide ribonucleotide transformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence198 2379 727 gene locus_tag LOCUS_22350 2379 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 3962 2769 gene locus_tag LOCUS_22360 3962 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 4807 3959 gene locus_tag LOCUS_22370 4807 3959 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJS2 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22370 5296 4880 gene locus_tag LOCUS_22380 5296 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 5456 5274 gene locus_tag LOCUS_22390 5456 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 5677 5555 gene locus_tag LOCUS_22400 5677 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence199 115 552 gene locus_tag LOCUS_22410 115 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764582.1 protein_id gnl|my_center|LOCUS_22410 583 831 gene locus_tag LOCUS_22420 583 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1498 869 gene locus_tag LOCUS_22430 1498 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2276 1527 gene locus_tag LOCUS_22440 2276 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 3258 2413 gene locus_tag LOCUS_22450 3258 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 3598 3278 gene locus_tag LOCUS_22460 3598 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 3771 4637 gene locus_tag LOCUS_22470 3771 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203107.1 protein_id gnl|my_center|LOCUS_22470 4634 5167 gene locus_tag LOCUS_22480 4634 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 5158 5376 gene locus_tag LOCUS_22490 5158 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202368.1 protein_id gnl|my_center|LOCUS_22490 5445 5518 gene locus_tag LOCUS_t00400 5445 5518 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5542 5901 gene locus_tag LOCUS_22500 5542 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence200 9 1388 gene locus_tag LOCUS_22510 9 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 2034 1453 gene locus_tag LOCUS_22520 2034 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_22520 2166 2768 gene locus_tag LOCUS_22530 gene rnhB 2166 2768 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_22530 3064 2843 gene locus_tag LOCUS_22540 3064 2843 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796270.1 protein_id gnl|my_center|LOCUS_22540 3495 3067 gene locus_tag LOCUS_22550 3495 3067 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_22550 4349 3528 gene locus_tag LOCUS_22560 4349 3528 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784764.1 protein_id gnl|my_center|LOCUS_22560 4783 4364 gene locus_tag LOCUS_22570 4783 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763987.1 protein_id gnl|my_center|LOCUS_22570 6027 4795 gene locus_tag LOCUS_22580 gene aroA 6027 4795 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5Q2 protein_id gnl|my_center|LOCUS_22580 >Feature sequence201 1715 585 gene locus_tag LOCUS_22590 gene tgt 1715 585 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX9 protein_id gnl|my_center|LOCUS_22590 4195 1712 gene locus_tag LOCUS_22600 gene lon 4195 1712 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX8 protein_id gnl|my_center|LOCUS_22600 4439 5098 gene locus_tag LOCUS_22610 4439 5098 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX7 protein_id gnl|my_center|LOCUS_22610 >Feature sequence202 2154 769 gene locus_tag LOCUS_22620 2154 769 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_22620 2285 3658 gene locus_tag LOCUS_22630 2285 3658 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539358.1 protein_id gnl|my_center|LOCUS_22630 3728 4357 gene locus_tag LOCUS_22640 3728 4357 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_22640 <5968 4642 gene locus_tag LOCUS_22650 <5968 4642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202074.1:threonine synthase >Feature sequence203 1475 504 gene locus_tag LOCUS_22660 1475 504 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_22660 1691 4381 gene locus_tag LOCUS_22670 1691 4381 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 protein_id gnl|my_center|LOCUS_22670 4440 5723 gene locus_tag LOCUS_22680 4440 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202177.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence204 2574 1333 gene locus_tag LOCUS_22690 2574 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795094.1 protein_id gnl|my_center|LOCUS_22690 3576 2704 gene locus_tag LOCUS_22700 3576 2704 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 protein_id gnl|my_center|LOCUS_22700 4235 3585 gene locus_tag LOCUS_22710 gene bioD 4235 3585 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VX7 protein_id gnl|my_center|LOCUS_22710 4998 4249 gene locus_tag LOCUS_22720 4998 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22720 5651 4983 gene locus_tag LOCUS_22730 5651 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22730 >Feature sequence205 1814 816 gene locus_tag LOCUS_22740 1814 816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784898.1 protein_id gnl|my_center|LOCUS_22740 2653 1829 gene locus_tag LOCUS_22750 2653 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22750 2772 3701 gene locus_tag LOCUS_22760 2772 3701 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_22760 3694 5580 gene locus_tag LOCUS_22770 3694 5580 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108125.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence206 <1 1601 gene locus_tag LOCUS_22780 <1 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963080.1:multidrug transporter AcrB 1582 3033 gene locus_tag LOCUS_22790 1582 3033 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_22790 4091 3114 gene locus_tag LOCUS_22800 gene rsgA2 4091 3114 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5I9 protein_id gnl|my_center|LOCUS_22800 4687 4127 gene locus_tag LOCUS_22810 gene frr 4687 4127 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ0 protein_id gnl|my_center|LOCUS_22810 4862 5386 gene locus_tag LOCUS_22820 4862 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence207 2418 751 gene locus_tag LOCUS_22830 2418 751 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108208.1 protein_id gnl|my_center|LOCUS_22830 4091 3075 gene locus_tag LOCUS_22840 4091 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 5041 4142 gene locus_tag LOCUS_22850 5041 4142 CDS product clindamycin resistance transfer factor BtgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202089.1 protein_id gnl|my_center|LOCUS_22850 5640 5038 gene locus_tag LOCUS_22860 5640 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence208 1507 44 gene locus_tag LOCUS_22870 1507 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 1691 3238 gene locus_tag LOCUS_22880 1691 3238 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_22880 3959 3321 gene locus_tag LOCUS_22890 3959 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272550.1 protein_id gnl|my_center|LOCUS_22890 4114 4728 gene locus_tag LOCUS_22900 4114 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 4816 5625 gene locus_tag LOCUS_22910 4816 5625 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795585.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence209 2653 602 gene locus_tag LOCUS_22920 gene htpG 2653 602 CDS product chaperone protein htpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CJ84 protein_id gnl|my_center|LOCUS_22920 5319 2773 gene locus_tag LOCUS_22930 5319 2773 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765726.1 protein_id gnl|my_center|LOCUS_22930 5556 5741 gene locus_tag LOCUS_22940 5556 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence210 2906 1359 gene locus_tag LOCUS_22950 2906 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 5353 2945 gene locus_tag LOCUS_22960 5353 2945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803550.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence211 316 825 gene locus_tag LOCUS_22970 gene purE 316 825 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4S9 protein_id gnl|my_center|LOCUS_22970 830 2671 gene locus_tag LOCUS_22980 gene ispG 830 2671 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4T0 protein_id gnl|my_center|LOCUS_22980 4205 2847 gene locus_tag LOCUS_22990 4205 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 4628 4404 gene locus_tag LOCUS_23000 4628 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 5098 4625 gene locus_tag LOCUS_23010 5098 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_23010 5319 5095 gene locus_tag LOCUS_23020 5319 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence212 <1 1039 gene locus_tag LOCUS_23030 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203140.1:ATP-binding protein 1267 1563 gene locus_tag LOCUS_23040 1267 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_23040 1601 1966 gene locus_tag LOCUS_23050 1601 1966 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791845.1 protein_id gnl|my_center|LOCUS_23050 3140 2199 gene locus_tag LOCUS_23060 3140 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 3599 3147 gene locus_tag LOCUS_23070 3599 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 4843 3596 gene locus_tag LOCUS_23080 4843 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 5558 4845 gene locus_tag LOCUS_23090 5558 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence213 347 712 gene locus_tag LOCUS_23100 347 712 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764156.1 protein_id gnl|my_center|LOCUS_23100 833 1993 gene locus_tag LOCUS_23110 833 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2154 3299 gene locus_tag LOCUS_23120 2154 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3312 4520 gene locus_tag LOCUS_23130 3312 4520 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802516.1 protein_id gnl|my_center|LOCUS_23130 4610 4999 gene locus_tag LOCUS_23140 4610 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence214 185 715 gene locus_tag LOCUS_23150 185 715 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791506.1 protein_id gnl|my_center|LOCUS_23150 1826 792 gene locus_tag LOCUS_23160 1826 792 CDS product amino acid lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_23160 2556 1846 gene locus_tag LOCUS_23170 2556 1846 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_23170 3955 2558 gene locus_tag LOCUS_23180 3955 2558 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107419.1 protein_id gnl|my_center|LOCUS_23180 4086 5570 gene locus_tag LOCUS_23190 4086 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence215 1326 151 gene locus_tag LOCUS_23200 1326 151 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_23200 2759 1335 gene locus_tag LOCUS_23210 2759 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 5505 2776 gene locus_tag LOCUS_23220 5505 2776 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202757.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence216 1237 245 gene locus_tag LOCUS_23230 1237 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23230 2539 1280 gene locus_tag LOCUS_23240 2539 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23240 2890 3168 gene locus_tag LOCUS_23250 2890 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786499.1 protein_id gnl|my_center|LOCUS_23250 3181 3411 gene locus_tag LOCUS_23260 3181 3411 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_23260 3414 4523 gene locus_tag LOCUS_23270 3414 4523 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_23270 4719 5492 gene locus_tag LOCUS_23280 4719 5492 CDS product 2-oxoglutarate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786495.1 protein_id gnl|my_center|LOCUS_23280 >Feature sequence217 1447 386 gene locus_tag LOCUS_23290 1447 386 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_23290 2581 1460 gene locus_tag LOCUS_23300 2581 1460 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T01 protein_id gnl|my_center|LOCUS_23300 4068 2578 gene locus_tag LOCUS_23310 4068 2578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202953.1 protein_id gnl|my_center|LOCUS_23310 4973 4083 gene locus_tag LOCUS_23320 4973 4083 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_23320 5400 5002 gene locus_tag LOCUS_23330 5400 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23330 >Feature sequence218 1536 1931 gene locus_tag LOCUS_23340 1536 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764759.1 protein_id gnl|my_center|LOCUS_23340 1928 2248 gene locus_tag LOCUS_23350 1928 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 2260 4248 gene locus_tag LOCUS_23360 2260 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 4266 4790 gene locus_tag LOCUS_23370 4266 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 4830 5390 gene locus_tag LOCUS_23380 4830 5390 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence219 2641 407 gene locus_tag LOCUS_23390 2641 407 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762569.1 protein_id gnl|my_center|LOCUS_23390 3086 4141 gene locus_tag LOCUS_23400 gene rlmN 3086 4141 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZK5 protein_id gnl|my_center|LOCUS_23400 4182 5219 gene locus_tag LOCUS_23410 4182 5219 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence220 2095 677 gene locus_tag LOCUS_23420 2095 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 4798 2144 gene locus_tag LOCUS_23430 4798 2144 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence221 1087 305 gene locus_tag LOCUS_23440 1087 305 CDS product cytochrome c assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767916.1 protein_id gnl|my_center|LOCUS_23440 2018 1116 gene locus_tag LOCUS_23450 2018 1116 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767917.1 protein_id gnl|my_center|LOCUS_23450 3455 2142 gene locus_tag LOCUS_23460 3455 2142 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_23460 4838 3498 gene locus_tag LOCUS_23470 4838 3498 CDS product L-fuculose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783910.1 protein_id gnl|my_center|LOCUS_23470 <5370 4835 gene locus_tag LOCUS_23480 <5370 4835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783908.1:aldolase >Feature sequence222 1538 168 gene locus_tag LOCUS_23490 1538 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817735.1 protein_id gnl|my_center|LOCUS_23490 3093 1465 gene locus_tag LOCUS_23500 3093 1465 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202758.1 protein_id gnl|my_center|LOCUS_23500 3860 3081 gene locus_tag LOCUS_23510 3860 3081 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_23510 <5353 4097 gene locus_tag LOCUS_23520 <5353 4097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203341.1:methylmalonyl-CoA carboxyltransferase >Feature sequence223 2026 1103 gene locus_tag LOCUS_23530 gene metA 2026 1103 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A531 protein_id gnl|my_center|LOCUS_23530 3021 2128 gene locus_tag LOCUS_23540 gene cynR 3021 2128 CDS product HTH-type transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X4M5 protein_id gnl|my_center|LOCUS_23540 3687 5141 gene locus_tag LOCUS_23550 gene katA 3687 5141 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72WJ8 protein_id gnl|my_center|LOCUS_23550 >Feature sequence224 3989 1203 gene locus_tag LOCUS_23560 3989 1203 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_23560 4811 4377 gene locus_tag LOCUS_23570 4811 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788539.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence225 1044 1421 gene locus_tag LOCUS_23580 1044 1421 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762436.1 protein_id gnl|my_center|LOCUS_23580 1498 2706 gene locus_tag LOCUS_23590 1498 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786395.1 protein_id gnl|my_center|LOCUS_23590 2719 3465 gene locus_tag LOCUS_23600 2719 3465 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786188.1 protein_id gnl|my_center|LOCUS_23600 3473 3850 gene locus_tag LOCUS_23610 3473 3850 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786184.1 protein_id gnl|my_center|LOCUS_23610 3885 4709 gene locus_tag LOCUS_23620 3885 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107812.1 protein_id gnl|my_center|LOCUS_23620 >Feature sequence226 3117 181 gene locus_tag LOCUS_23630 3117 181 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108915.1 protein_id gnl|my_center|LOCUS_23630 5095 3275 gene locus_tag LOCUS_23640 5095 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108191.1 protein_id gnl|my_center|LOCUS_23640 >Feature sequence227 2611 1295 gene locus_tag LOCUS_23650 gene xylA 2611 1295 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_23650 4135 2648 gene locus_tag LOCUS_23660 4135 2648 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_23660 4884 4156 gene locus_tag LOCUS_23670 4884 4156 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence228 1612 293 gene locus_tag LOCUS_23680 1612 293 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788433.1 protein_id gnl|my_center|LOCUS_23680 3394 1637 gene locus_tag LOCUS_23690 gene atpA 3394 1637 CDS product V-type ATP synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A875 protein_id gnl|my_center|LOCUS_23690 4249 3410 gene locus_tag LOCUS_23700 4249 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788436.1 protein_id gnl|my_center|LOCUS_23700 4849 4259 gene locus_tag LOCUS_23710 4849 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788438.1 protein_id gnl|my_center|LOCUS_23710 5182 5079 gene locus_tag LOCUS_r00020 5182 5079 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence229 560 886 gene locus_tag LOCUS_23720 560 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 870 1187 gene locus_tag LOCUS_23730 870 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798232.1 protein_id gnl|my_center|LOCUS_23730 1195 1503 gene locus_tag LOCUS_23740 1195 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1989 3128 gene locus_tag LOCUS_23750 1989 3128 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815896.1 protein_id gnl|my_center|LOCUS_23750 3148 3687 gene locus_tag LOCUS_23760 3148 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787716.1 protein_id gnl|my_center|LOCUS_23760 >Feature sequence230 4544 3048 gene locus_tag LOCUS_23770 4544 3048 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784872.1 protein_id gnl|my_center|LOCUS_23770 <5178 4541 gene locus_tag LOCUS_23780 <5178 4541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760929.1:dolichol-P-glucose synthetase >Feature sequence231 847 41 gene locus_tag LOCUS_23790 847 41 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942064.1 protein_id gnl|my_center|LOCUS_23790 967 1992 gene locus_tag LOCUS_23800 gene ruvB 967 1992 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650B4 protein_id gnl|my_center|LOCUS_23800 2001 3491 gene locus_tag LOCUS_23810 2001 3491 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 protein_id gnl|my_center|LOCUS_23810 3545 4903 gene locus_tag LOCUS_23820 3545 4903 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence232 <1 669 gene locus_tag LOCUS_23830 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767434.1:transcriptional regulator 885 1622 gene locus_tag LOCUS_23840 885 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2234 3943 gene locus_tag LOCUS_23850 2234 3943 CDS product maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680466.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence233 <1 2308 gene locus_tag LOCUS_23860 <1 2308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TL9:DNA gyrase subunit A 2357 3574 gene locus_tag LOCUS_23870 2357 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_23870 3772 4635 gene locus_tag LOCUS_23880 3772 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence234 1242 31 gene locus_tag LOCUS_23890 1242 31 CDS product exopolygalacturonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_23890 1863 2993 gene locus_tag LOCUS_23900 1863 2993 CDS product glycosyl hydrolase family 88 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109151.1 protein_id gnl|my_center|LOCUS_23900 3675 3073 gene locus_tag LOCUS_23910 3675 3073 CDS product sigma factor regulator FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762908.1 protein_id gnl|my_center|LOCUS_23910 4232 3699 gene locus_tag LOCUS_23920 4232 3699 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650A4 protein_id gnl|my_center|LOCUS_23920 >Feature sequence235 2075 669 gene locus_tag LOCUS_23930 gene uxaC 2075 669 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_23930 2388 3827 gene locus_tag LOCUS_23940 gene uxaB 2388 3827 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J0 protein_id gnl|my_center|LOCUS_23940 3963 4751 gene locus_tag LOCUS_23950 3963 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764147.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence236 2406 634 gene locus_tag LOCUS_23960 2406 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 2821 3840 gene locus_tag LOCUS_23970 2821 3840 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_23970 4659 3922 gene locus_tag LOCUS_23980 4659 3922 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence237 1430 759 gene locus_tag LOCUS_23990 1430 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 1714 1427 gene locus_tag LOCUS_24000 1714 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2108 1770 gene locus_tag LOCUS_24010 2108 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2998 2111 gene locus_tag LOCUS_24020 2998 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 <4899 3208 gene locus_tag LOCUS_24030 <4899 3208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765523.1:pyruvate, phosphate dikinase >Feature sequence238 33 106 gene locus_tag LOCUS_t00410 33 106 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 349 1581 gene locus_tag LOCUS_24040 349 1581 CDS product tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202712.1 protein_id gnl|my_center|LOCUS_24040 2094 2453 gene locus_tag LOCUS_24050 2094 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 3518 4648 gene locus_tag LOCUS_24060 3518 4648 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence239 3318 61 gene locus_tag LOCUS_24070 3318 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 3596 3420 gene locus_tag LOCUS_24080 3596 3420 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780999.1 protein_id gnl|my_center|LOCUS_24080 <4864 3713 gene locus_tag LOCUS_24090 <4864 3713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A7D1:tRNA(Ile)-lysidine synthase >Feature sequence240 352 1326 gene locus_tag LOCUS_24100 352 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1361 2515 gene locus_tag LOCUS_24110 1361 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence241 <1 670 gene locus_tag LOCUS_24120 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108756.1:peptidase M16 800 1135 gene locus_tag LOCUS_24130 800 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 1221 3038 gene locus_tag LOCUS_24140 gene argS 1221 3038 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_24140 3122 3748 gene locus_tag LOCUS_24150 3122 3748 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence242 465 383 gene locus_tag LOCUS_t00420 465 383 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1507 539 gene locus_tag LOCUS_24160 1507 539 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_24160 2321 1566 gene locus_tag LOCUS_24170 2321 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291423.1 protein_id gnl|my_center|LOCUS_24170 4802 2421 gene locus_tag LOCUS_24180 4802 2421 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108893.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence243 <1 817 gene locus_tag LOCUS_24190 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767100.1:9-O-acetylesterase 832 3030 gene locus_tag LOCUS_24200 832 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 <4771 3209 gene locus_tag LOCUS_24210 <4771 3209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A7D2:ferrous iron transport protein B >Feature sequence244 330 551 gene locus_tag LOCUS_24220 330 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789734.1 protein_id gnl|my_center|LOCUS_24220 1271 600 gene locus_tag LOCUS_24230 1271 600 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802487.1 protein_id gnl|my_center|LOCUS_24230 1623 2432 gene locus_tag LOCUS_24240 1623 2432 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_24240 2952 2419 gene locus_tag LOCUS_24250 2952 2419 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787811.1 protein_id gnl|my_center|LOCUS_24250 4412 3225 gene locus_tag LOCUS_24260 4412 3225 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761538.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence245 386 532 gene locus_tag LOCUS_24270 386 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1743 934 gene locus_tag LOCUS_24280 1743 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994756.1 protein_id gnl|my_center|LOCUS_24280 1994 2605 gene locus_tag LOCUS_24290 1994 2605 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787373.1 protein_id gnl|my_center|LOCUS_24290 2738 3592 gene locus_tag LOCUS_24300 2738 3592 CDS product polyketide synthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202744.1 protein_id gnl|my_center|LOCUS_24300 3769 4290 gene locus_tag LOCUS_24310 3769 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence246 2464 1793 gene locus_tag LOCUS_24320 2464 1793 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence247 <1 634 gene locus_tag LOCUS_24330 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A294:putative K(+)-stimulated pyrophosphate-energized sodium pump 1107 691 gene locus_tag LOCUS_24340 1107 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778250.1 protein_id gnl|my_center|LOCUS_24340 2426 1125 gene locus_tag LOCUS_24350 2426 1125 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA94 protein_id gnl|my_center|LOCUS_24350 3791 2469 gene locus_tag LOCUS_24360 3791 2469 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763512.1 protein_id gnl|my_center|LOCUS_24360 4379 3792 gene locus_tag LOCUS_24370 4379 3792 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence248 3 995 gene locus_tag LOCUS_24380 3 995 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_24380 1010 2428 gene locus_tag LOCUS_24390 1010 2428 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203501.1 protein_id gnl|my_center|LOCUS_24390 2457 3641 gene locus_tag LOCUS_24400 2457 3641 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798360.1 protein_id gnl|my_center|LOCUS_24400 4439 3711 gene locus_tag LOCUS_24410 4439 3711 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence249 1129 680 gene locus_tag LOCUS_24420 1129 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_24420 1334 2110 gene locus_tag LOCUS_24430 1334 2110 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_24430 2121 3137 gene locus_tag LOCUS_24440 2121 3137 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_24440 3870 4295 gene locus_tag LOCUS_24450 3870 4295 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107510.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence250 248 2797 gene locus_tag LOCUS_24460 248 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2843 3940 gene locus_tag LOCUS_24470 2843 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107963.1 protein_id gnl|my_center|LOCUS_24470 4094 4429 gene locus_tag LOCUS_24480 4094 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence251 1367 825 gene locus_tag LOCUS_24490 1367 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 2322 1474 gene locus_tag LOCUS_24500 2322 1474 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_24500 4330 2342 gene locus_tag LOCUS_24510 4330 2342 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence252 1577 894 gene locus_tag LOCUS_24520 1577 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2083 1604 gene locus_tag LOCUS_24530 2083 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2801 2187 gene locus_tag LOCUS_24540 2801 2187 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005924132.1 protein_id gnl|my_center|LOCUS_24540 4250 2982 gene locus_tag LOCUS_24550 4250 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 >Feature sequence253 <1 725 gene locus_tag LOCUS_24560 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZQ8:cysteine desulfurase 2541 805 gene locus_tag LOCUS_24570 2541 805 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_24570 2786 2977 gene locus_tag LOCUS_24580 gene rpsU 2786 2977 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 protein_id gnl|my_center|LOCUS_24580 3051 3932 gene locus_tag LOCUS_24590 gene xerC 3051 3932 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI8 protein_id gnl|my_center|LOCUS_24590 3907 4248 gene locus_tag LOCUS_24600 3907 4248 CDS product RNA polymerase subunit sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 protein_id gnl|my_center|LOCUS_24600 4342 4416 gene locus_tag LOCUS_t00430 4342 4416 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence254 789 103 gene locus_tag LOCUS_24610 789 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 1799 1200 gene locus_tag LOCUS_24620 1799 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 3206 2124 gene locus_tag LOCUS_24630 3206 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_24630 3360 4034 gene locus_tag LOCUS_24640 3360 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence255 1108 398 gene locus_tag LOCUS_24650 1108 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814285.1 protein_id gnl|my_center|LOCUS_24650 1402 2616 gene locus_tag LOCUS_24660 gene trpB 1402 2616 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAD2 protein_id gnl|my_center|LOCUS_24660 2629 4029 gene locus_tag LOCUS_24670 2629 4029 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence256 <1 2559 gene locus_tag LOCUS_24680 <1 2559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937370.1:multidrug transporter AcrB 2650 3885 gene locus_tag LOCUS_24690 2650 3885 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017031.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence257 924 1505 gene locus_tag LOCUS_24700 gene tpx 924 1505 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SL6 protein_id gnl|my_center|LOCUS_24700 2724 1525 gene locus_tag LOCUS_24710 2724 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 protein_id gnl|my_center|LOCUS_24710 3616 2744 gene locus_tag LOCUS_24720 3616 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence258 40 816 gene locus_tag LOCUS_24730 gene thiG 40 816 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA14 protein_id gnl|my_center|LOCUS_24730 876 1721 gene locus_tag LOCUS_24740 876 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24740 1830 2576 gene locus_tag LOCUS_24750 1830 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24750 2628 3779 gene locus_tag LOCUS_24760 gene thiH 2628 3779 CDS product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107371.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence259 1093 236 gene locus_tag LOCUS_24770 1093 236 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948667.1 protein_id gnl|my_center|LOCUS_24770 1482 1105 gene locus_tag LOCUS_24780 1482 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 4219 2066 gene locus_tag LOCUS_24790 4219 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence260 1007 1615 gene locus_tag LOCUS_24800 1007 1615 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761321.1 protein_id gnl|my_center|LOCUS_24800 1804 2646 gene locus_tag LOCUS_24810 1804 2646 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538156.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence261 490 29 gene locus_tag LOCUS_24820 490 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 863 501 gene locus_tag LOCUS_24830 863 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 1230 865 gene locus_tag LOCUS_24840 1230 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 1372 1623 gene locus_tag LOCUS_24850 1372 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 1653 1898 gene locus_tag LOCUS_24860 1653 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 2767 2414 gene locus_tag LOCUS_24870 2767 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 3306 3521 gene locus_tag LOCUS_24880 3306 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 3521 3817 gene locus_tag LOCUS_24890 3521 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence262 717 373 gene locus_tag LOCUS_24900 gene rplR 717 373 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM4 protein_id gnl|my_center|LOCUS_24900 1307 738 gene locus_tag LOCUS_24910 gene rplF 1307 738 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM3 protein_id gnl|my_center|LOCUS_24910 1718 1323 gene locus_tag LOCUS_24920 gene rpsH 1718 1323 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM2 protein_id gnl|my_center|LOCUS_24920 2073 1774 gene locus_tag LOCUS_24930 gene rpsN 2073 1774 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM1 protein_id gnl|my_center|LOCUS_24930 2635 2078 gene locus_tag LOCUS_24940 gene rplE 2635 2078 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM0 protein_id gnl|my_center|LOCUS_24940 2955 2635 gene locus_tag LOCUS_24950 gene rplX 2955 2635 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL9 protein_id gnl|my_center|LOCUS_24950 3341 2976 gene locus_tag LOCUS_24960 gene rplN 3341 2976 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A486 protein_id gnl|my_center|LOCUS_24960 3613 3344 gene locus_tag LOCUS_24970 gene rpsQ1 3613 3344 CDS product 30S ribosomal protein S17 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A485 protein_id gnl|my_center|LOCUS_24970 3807 3610 gene locus_tag LOCUS_24980 gene rpmC 3807 3610 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A484 protein_id gnl|my_center|LOCUS_24980 4247 3813 gene locus_tag LOCUS_24990 gene rplP 4247 3813 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A483 protein_id gnl|my_center|LOCUS_24990 >Feature sequence263 2 1810 gene locus_tag LOCUS_25000 2 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 1852 4164 gene locus_tag LOCUS_25010 1852 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence264 1436 1714 gene locus_tag LOCUS_25020 1436 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 3227 1761 gene locus_tag LOCUS_25030 3227 1761 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108290.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence265 1876 929 gene locus_tag LOCUS_25040 1876 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 2742 1876 gene locus_tag LOCUS_25050 2742 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 3512 2805 gene locus_tag LOCUS_25060 3512 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 <4195 3514 gene locus_tag LOCUS_25070 <4195 3514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XE6:4-hydroxythreonine-4-phosphate dehydrogenase >Feature sequence266 <1 2751 gene locus_tag LOCUS_25080 <1 2751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2A1:translation initiation factor IF-2 2886 3404 gene locus_tag LOCUS_25090 2886 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767606.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence267 2730 730 gene locus_tag LOCUS_25100 gene ligA 2730 730 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM7 protein_id gnl|my_center|LOCUS_25100 2804 3484 gene locus_tag LOCUS_25110 gene trmD 2804 3484 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C2 protein_id gnl|my_center|LOCUS_25110 3652 4020 gene locus_tag LOCUS_25120 3652 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 >Feature sequence268 948 244 gene locus_tag LOCUS_25130 948 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2138 1017 gene locus_tag LOCUS_25140 2138 1017 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884008.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence269 1424 387 gene locus_tag LOCUS_25150 1424 387 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_25150 3257 1485 gene locus_tag LOCUS_25160 3257 1485 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203504.1 protein_id gnl|my_center|LOCUS_25160 4118 3462 gene locus_tag LOCUS_25170 4118 3462 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0S5 protein_id gnl|my_center|LOCUS_25170 >Feature sequence270 <1 757 gene locus_tag LOCUS_25180 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269432.1:NAD-dependent epimerase 825 1289 gene locus_tag LOCUS_25190 825 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1293 1823 gene locus_tag LOCUS_25200 1293 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1909 3909 gene locus_tag LOCUS_25210 1909 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence271 1884 703 gene locus_tag LOCUS_25220 gene clpX 1884 703 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW3 protein_id gnl|my_center|LOCUS_25220 2659 1985 gene locus_tag LOCUS_25230 gene clpP 2659 1985 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A129 protein_id gnl|my_center|LOCUS_25230 <4024 2815 gene locus_tag LOCUS_25240 <4024 2815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791866.1:trigger factor >Feature sequence272 <1 1729 gene locus_tag LOCUS_25250 <1 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A120:DNA mismatch repair protein MutL 3879 2092 gene locus_tag LOCUS_25260 3879 2092 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202211.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence273 1842 223 gene locus_tag LOCUS_25270 1842 223 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202279.1 protein_id gnl|my_center|LOCUS_25270 2071 3231 gene locus_tag LOCUS_25280 2071 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence274 1309 767 gene locus_tag LOCUS_25290 1309 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202562.1 protein_id gnl|my_center|LOCUS_25290 2753 1344 gene locus_tag LOCUS_25300 2753 1344 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766006.1 protein_id gnl|my_center|LOCUS_25300 3681 2926 gene locus_tag LOCUS_25310 gene wbyL 3681 2926 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208589.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence275 1046 156 gene locus_tag LOCUS_25320 1046 156 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790353.1 protein_id gnl|my_center|LOCUS_25320 3036 1177 gene locus_tag LOCUS_25330 gene yidC 3036 1177 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T26 protein_id gnl|my_center|LOCUS_25330 <3956 3066 gene locus_tag LOCUS_25340 <3956 3066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64T27:CTP synthase >Feature sequence276 1290 286 gene locus_tag LOCUS_25350 1290 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 1891 2142 gene locus_tag LOCUS_25360 1891 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 2139 2414 gene locus_tag LOCUS_25370 2139 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 2425 2622 gene locus_tag LOCUS_25380 2425 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3112 3906 gene locus_tag LOCUS_25390 3112 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence277 1485 910 gene locus_tag LOCUS_25400 gene nqrE 1485 910 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L1 protein_id gnl|my_center|LOCUS_25400 2208 1570 gene locus_tag LOCUS_25410 gene nqrD 2208 1570 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_25410 2903 2223 gene locus_tag LOCUS_25420 gene nqrC 2903 2223 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_25420 <3904 2918 gene locus_tag LOCUS_25430 <3904 2918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64US0:Na(+)-translocating NADH-quinone reductase subunit B >Feature sequence278 2 526 gene locus_tag LOCUS_25440 2 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 551 1267 gene locus_tag LOCUS_25450 551 1267 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107649.1 protein_id gnl|my_center|LOCUS_25450 1348 2043 gene locus_tag LOCUS_25460 gene mtgA 1348 2043 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8H2 protein_id gnl|my_center|LOCUS_25460 2694 2059 gene locus_tag LOCUS_25470 2694 2059 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765911.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence279 2276 1041 gene locus_tag LOCUS_25480 2276 1041 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_25480 3412 2273 gene locus_tag LOCUS_25490 3412 2273 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence280 1608 2003 gene locus_tag LOCUS_25500 1608 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 2250 2897 gene locus_tag LOCUS_25510 2250 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence281 1479 139 gene locus_tag LOCUS_25520 1479 139 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203619.1 protein_id gnl|my_center|LOCUS_25520 3763 1829 gene locus_tag LOCUS_25530 gene nadE 3763 1829 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence282 296 505 gene locus_tag LOCUS_25540 296 505 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Y0 protein_id gnl|my_center|LOCUS_25540 2706 544 gene locus_tag LOCUS_25550 2706 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203170.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence283 1568 429 gene locus_tag LOCUS_25560 1568 429 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PX7 protein_id gnl|my_center|LOCUS_25560 2123 1632 gene locus_tag LOCUS_25570 2123 1632 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A668 protein_id gnl|my_center|LOCUS_25570 >Feature sequence284 <1 1007 gene locus_tag LOCUS_25580 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767229.1:multidrug resistance protein 1820 1161 gene locus_tag LOCUS_25590 1820 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_25590 3043 2615 gene locus_tag LOCUS_25600 3043 2615 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202354.1 protein_id gnl|my_center|LOCUS_25600 <3727 3124 gene locus_tag LOCUS_25610 <3727 3124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789686.1:aminopeptidase >Feature sequence285 <1 1525 gene locus_tag LOCUS_25620 <1 1525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203029.1:type IV secretion protein Rhs 1622 2596 gene locus_tag LOCUS_25630 1622 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 3520 3143 gene locus_tag LOCUS_25640 3520 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence286 2292 1555 gene locus_tag LOCUS_25650 2292 1555 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107904.1 protein_id gnl|my_center|LOCUS_25650 <3698 2289 gene locus_tag LOCUS_25660 <3698 2289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107905.1:phosphotransferase >Feature sequence287 665 1645 gene locus_tag LOCUS_25670 665 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25670 1649 2083 gene locus_tag LOCUS_25680 1649 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25680 2125 3051 gene locus_tag LOCUS_25690 2125 3051 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T90 protein_id gnl|my_center|LOCUS_25690 3061 3687 gene locus_tag LOCUS_25700 3061 3687 CDS product D-ribitol-5-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A947 protein_id gnl|my_center|LOCUS_25700 >Feature sequence288 650 576 gene locus_tag LOCUS_t00440 650 576 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 753 678 gene locus_tag LOCUS_t00450 753 678 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3073 836 gene locus_tag LOCUS_25710 3073 836 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107511.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence289 981 73 gene locus_tag LOCUS_25720 981 73 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202375.1 protein_id gnl|my_center|LOCUS_25720 1600 995 gene locus_tag LOCUS_25730 1600 995 CDS product conjugal transfer protein TraI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308758.1 protein_id gnl|my_center|LOCUS_25730 <3641 1633 gene locus_tag LOCUS_25740 <3641 1633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202376.1:transposase >Feature sequence290 784 1482 gene locus_tag LOCUS_25750 784 1482 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_25750 1593 2459 gene locus_tag LOCUS_25760 1593 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108129.1 protein_id gnl|my_center|LOCUS_25760 2750 3175 gene locus_tag LOCUS_25770 2750 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108317.1 protein_id gnl|my_center|LOCUS_25770 3611 3261 gene locus_tag LOCUS_25780 3611 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence291 120 779 gene locus_tag LOCUS_25790 120 779 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792215.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence292 210 1136 gene locus_tag LOCUS_25800 210 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1164 2264 gene locus_tag LOCUS_25810 1164 2264 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345307.1 protein_id gnl|my_center|LOCUS_25810 2261 2812 gene locus_tag LOCUS_25820 2261 2812 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence293 785 1618 gene locus_tag LOCUS_25830 785 1618 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_25830 1679 2566 gene locus_tag LOCUS_25840 1679 2566 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U24 protein_id gnl|my_center|LOCUS_25840 >Feature sequence294 2976 205 gene locus_tag LOCUS_25850 2976 205 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64R17 protein_id gnl|my_center|LOCUS_25850 >Feature sequence295 6 79 gene locus_tag LOCUS_t00460 6 79 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 253 717 gene locus_tag LOCUS_25860 gene rimP 253 717 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR6 protein_id gnl|my_center|LOCUS_25860 720 1979 gene locus_tag LOCUS_25870 gene nusA 720 1979 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2A2 protein_id gnl|my_center|LOCUS_25870 >Feature sequence296 472 1611 gene locus_tag LOCUS_25880 472 1611 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786560.1 protein_id gnl|my_center|LOCUS_25880 1850 2491 gene locus_tag LOCUS_25890 1850 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202515.1 protein_id gnl|my_center|LOCUS_25890 2607 3053 gene locus_tag LOCUS_25900 2607 3053 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP5 protein_id gnl|my_center|LOCUS_25900 >Feature sequence297 1819 233 gene locus_tag LOCUS_25910 1819 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 2870 1839 gene locus_tag LOCUS_25920 2870 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence298 55 1431 gene locus_tag LOCUS_25930 55 1431 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702612.1 protein_id gnl|my_center|LOCUS_25930 1449 2120 gene locus_tag LOCUS_25940 1449 2120 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_25940 2366 3163 gene locus_tag LOCUS_25950 2366 3163 CDS product two component sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253438.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence299 564 73 gene locus_tag LOCUS_25960 564 73 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_25960 989 654 gene locus_tag LOCUS_25970 989 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_25970 1786 1019 gene locus_tag LOCUS_25980 1786 1019 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_25980 >Feature sequence300 <1 699 gene locus_tag LOCUS_25990 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64U39:1,4-alpha-glucan branching enzyme 711 1862 gene locus_tag LOCUS_26000 711 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 >Feature sequence301 3 1511 gene locus_tag LOCUS_26010 3 1511 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_26010 1556 2467 gene locus_tag LOCUS_26020 1556 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108287.1 protein_id gnl|my_center|LOCUS_26020 >Feature sequence302 188 3295 gene locus_tag LOCUS_26030 188 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence303 1879 530 gene locus_tag LOCUS_26040 1879 530 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201910.1 protein_id gnl|my_center|LOCUS_26040 2628 1876 gene locus_tag LOCUS_26050 2628 1876 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783928.1 protein_id gnl|my_center|LOCUS_26050 3334 2648 gene locus_tag LOCUS_26060 3334 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence304 1575 541 gene locus_tag LOCUS_26070 1575 541 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108483.1 protein_id gnl|my_center|LOCUS_26070 2950 1610 gene locus_tag LOCUS_26080 2950 1610 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870126.1 protein_id gnl|my_center|LOCUS_26080 >Feature sequence305 299 165 gene locus_tag LOCUS_26090 299 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 615 346 gene locus_tag LOCUS_26100 615 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 874 608 gene locus_tag LOCUS_26110 874 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 1338 2318 gene locus_tag LOCUS_26120 1338 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 2347 2547 gene locus_tag LOCUS_26130 2347 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2661 3203 gene locus_tag LOCUS_26140 2661 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence306 <1 564 gene locus_tag LOCUS_26150 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AA95:UvrABC system protein B 1441 530 gene locus_tag LOCUS_26160 1441 530 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_26160 1688 3043 gene locus_tag LOCUS_26170 1688 3043 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_26170 >Feature sequence307 487 1293 gene locus_tag LOCUS_26180 487 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 2317 1355 gene locus_tag LOCUS_26190 2317 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 2725 2348 gene locus_tag LOCUS_26200 2725 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 3047 2685 gene locus_tag LOCUS_26210 3047 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence308 <1 2820 gene locus_tag LOCUS_26220 <1 2820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107135.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence309 1238 501 gene locus_tag LOCUS_26230 1238 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787542.1 protein_id gnl|my_center|LOCUS_26230 1812 1246 gene locus_tag LOCUS_26240 1812 1246 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_26240 2274 1816 gene locus_tag LOCUS_26250 gene pyrI 2274 1816 CDS product aspartate carbamoyltransferase regulatory chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64U75 protein_id gnl|my_center|LOCUS_26250 3243 2302 gene locus_tag LOCUS_26260 gene pyrB 3243 2302 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S3 protein_id gnl|my_center|LOCUS_26260 >Feature sequence310 2255 18 gene locus_tag LOCUS_26270 2255 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence311 115 399 gene locus_tag LOCUS_26280 115 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 841 575 gene locus_tag LOCUS_26290 841 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 1758 1105 gene locus_tag LOCUS_26300 1758 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791447.1 protein_id gnl|my_center|LOCUS_26300 1856 2644 gene locus_tag LOCUS_26310 1856 2644 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203643.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence312 335 883 gene locus_tag LOCUS_26320 335 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 927 2030 gene locus_tag LOCUS_26330 927 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 2032 2913 gene locus_tag LOCUS_26340 2032 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence313 <1 1363 gene locus_tag LOCUS_26350 <1 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107427.1:sensor histidine kinase 1395 2117 gene locus_tag LOCUS_26360 1395 2117 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787590.1 protein_id gnl|my_center|LOCUS_26360 2107 2790 gene locus_tag LOCUS_26370 2107 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence314 <1 1498 gene locus_tag LOCUS_26380 <1 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203526.1:ATP-dependent DNA helicase RecQ 1742 2182 gene locus_tag LOCUS_26390 1742 2182 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765008.1 protein_id gnl|my_center|LOCUS_26390 >Feature sequence315 2821 137 gene locus_tag LOCUS_26400 2821 137 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202212.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence316 2787 199 gene locus_tag LOCUS_26410 gene clpB 2787 199 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY3 protein_id gnl|my_center|LOCUS_26410 >Feature sequence317 717 112 gene locus_tag LOCUS_26420 gene rpsD 717 112 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A1 protein_id gnl|my_center|LOCUS_26420 1224 835 gene locus_tag LOCUS_26430 gene rpsK 1224 835 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4A0 protein_id gnl|my_center|LOCUS_26430 1616 1236 gene locus_tag LOCUS_26440 gene rpsM 1616 1236 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 protein_id gnl|my_center|LOCUS_26440 2805 2005 gene locus_tag LOCUS_26450 gene map 2805 2005 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM9 protein_id gnl|my_center|LOCUS_26450 >Feature sequence318 305 820 gene locus_tag LOCUS_26460 305 820 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788621.1 protein_id gnl|my_center|LOCUS_26460 <3135 907 gene locus_tag LOCUS_26470 <3135 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202791.1:penicillin-binding protein 1A >Feature sequence319 338 1078 gene locus_tag LOCUS_26480 338 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308671.1 protein_id gnl|my_center|LOCUS_26480 1450 1650 gene locus_tag LOCUS_26490 1450 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 2076 1591 gene locus_tag LOCUS_26500 2076 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203038.1 protein_id gnl|my_center|LOCUS_26500 2639 2082 gene locus_tag LOCUS_26510 2639 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308669.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence320 1228 869 gene locus_tag LOCUS_26520 1228 869 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202389.1 protein_id gnl|my_center|LOCUS_26520 2235 1333 gene locus_tag LOCUS_26530 2235 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004326095.1 protein_id gnl|my_center|LOCUS_26530 3085 2267 gene locus_tag LOCUS_26540 3085 2267 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202390.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence321 100 297 gene locus_tag LOCUS_26550 100 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 587 739 gene locus_tag LOCUS_26560 587 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 2112 835 gene locus_tag LOCUS_26570 2112 835 CDS product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815839.1 protein_id gnl|my_center|LOCUS_26570 2952 2617 gene locus_tag LOCUS_26580 2952 2617 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308735.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence322 697 266 gene locus_tag LOCUS_26590 697 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 1050 700 gene locus_tag LOCUS_26600 1050 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 1487 1047 gene locus_tag LOCUS_26610 1487 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 1937 1491 gene locus_tag LOCUS_26620 1937 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 2700 1930 gene locus_tag LOCUS_26630 2700 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 >Feature sequence323 318 722 gene locus_tag LOCUS_26640 318 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 1147 2712 gene locus_tag LOCUS_26650 1147 2712 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108243.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence324 2501 1026 gene locus_tag LOCUS_26660 gene nrfA 2501 1026 CDS product cytochrome c-552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7V7 protein_id gnl|my_center|LOCUS_26660 >Feature sequence325 1672 1361 gene locus_tag LOCUS_26670 1672 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2029 1685 gene locus_tag LOCUS_26680 2029 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2398 2048 gene locus_tag LOCUS_26690 2398 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 2607 2395 gene locus_tag LOCUS_26700 2607 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence326 114 359 gene locus_tag LOCUS_26710 114 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 409 807 gene locus_tag LOCUS_26720 409 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648588.1 protein_id gnl|my_center|LOCUS_26720 907 1191 gene locus_tag LOCUS_26730 907 1191 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_26730 1204 1476 gene locus_tag LOCUS_26740 1204 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 1756 1538 gene locus_tag LOCUS_26750 1756 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 2256 1930 gene locus_tag LOCUS_26760 2256 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2556 2302 gene locus_tag LOCUS_26770 2556 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence327 579 382 gene locus_tag LOCUS_26780 579 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 2339 657 gene locus_tag LOCUS_26790 2339 657 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108208.1 protein_id gnl|my_center|LOCUS_26790 >Feature sequence328 <1 1798 gene locus_tag LOCUS_26800 <1 1798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107134.1:transcriptional regulator 2019 2534 gene locus_tag LOCUS_26810 2019 2534 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766735.1 protein_id gnl|my_center|LOCUS_26810 >Feature sequence329 1 291 gene locus_tag LOCUS_26820 1 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 983 369 gene locus_tag LOCUS_26830 983 369 CDS product DUF4923 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765853.1 protein_id gnl|my_center|LOCUS_26830 1906 1052 gene locus_tag LOCUS_26840 1906 1052 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_26840 2002 2475 gene locus_tag LOCUS_26850 gene rlmH 2002 2475 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7G2 protein_id gnl|my_center|LOCUS_26850 <2987 2481 gene locus_tag LOCUS_26860 <2987 2481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786259.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence330 1979 1497 gene locus_tag LOCUS_26870 1979 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2682 1984 gene locus_tag LOCUS_26880 2682 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence331 1232 48 gene locus_tag LOCUS_26890 gene dnaJ 1232 48 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C3 protein_id gnl|my_center|LOCUS_26890 1853 1248 gene locus_tag LOCUS_26900 gene grpE 1853 1248 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 protein_id gnl|my_center|LOCUS_26900 >Feature sequence332 272 57 gene locus_tag LOCUS_26910 272 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 505 272 gene locus_tag LOCUS_26920 505 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 1335 568 gene locus_tag LOCUS_26930 1335 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 1901 1464 gene locus_tag LOCUS_26940 1901 1464 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254210.1 protein_id gnl|my_center|LOCUS_26940 2222 1905 gene locus_tag LOCUS_26950 2222 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2397 2203 gene locus_tag LOCUS_26960 2397 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 2765 2397 gene locus_tag LOCUS_26970 2765 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence333 447 190 gene locus_tag LOCUS_26980 447 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308737.1 protein_id gnl|my_center|LOCUS_26980 748 452 gene locus_tag LOCUS_26990 748 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 1093 761 gene locus_tag LOCUS_27000 1093 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323450.1 protein_id gnl|my_center|LOCUS_27000 1284 1108 gene locus_tag LOCUS_27010 1284 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1599 1303 gene locus_tag LOCUS_27020 1599 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323452.1 protein_id gnl|my_center|LOCUS_27020 2439 2705 gene locus_tag LOCUS_27030 2439 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence334 1814 642 gene locus_tag LOCUS_27040 1814 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 2287 1811 gene locus_tag LOCUS_27050 2287 1811 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793653.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence335 2095 1577 gene locus_tag LOCUS_27060 2095 1577 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766735.1 protein_id gnl|my_center|LOCUS_27060 <2902 2317 gene locus_tag LOCUS_27070 <2902 2317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107134.1:transcriptional regulator >Feature sequence336 <1 1089 gene locus_tag LOCUS_27080 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949005.1:NADH-dependent alcohol dehydrogenase 1102 1593 gene locus_tag LOCUS_27090 1102 1593 CDS product 5-nitroimidazole antibiotic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291426.1 protein_id gnl|my_center|LOCUS_27090 1987 2553 gene locus_tag LOCUS_27100 1987 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765529.1 protein_id gnl|my_center|LOCUS_27100 2749 2822 gene locus_tag LOCUS_t00470 2749 2822 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence337 596 1735 gene locus_tag LOCUS_27110 596 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 <2895 1742 gene locus_tag LOCUS_27120 <2895 1742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107934.1:MFS transporter >Feature sequence338 454 1536 gene locus_tag LOCUS_27130 454 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1533 1847 gene locus_tag LOCUS_27140 1533 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 1844 2167 gene locus_tag LOCUS_27150 1844 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 2158 2454 gene locus_tag LOCUS_27160 2158 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2451 2843 gene locus_tag LOCUS_27170 2451 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence339 1719 115 gene locus_tag LOCUS_27180 1719 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 <2866 1722 gene locus_tag LOCUS_27190 <2866 1722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108914.1:DUF4876 domain-containing protein >Feature sequence340 <1 830 gene locus_tag LOCUS_27200 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767392.1:flagellar motor protein MotB 2527 926 gene locus_tag LOCUS_27210 2527 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107132.1 protein_id gnl|my_center|LOCUS_27210 >Feature sequence341 784 173 gene locus_tag LOCUS_27220 gene engB 784 173 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_27220 837 1547 gene locus_tag LOCUS_27230 gene recR 837 1547 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8T6 protein_id gnl|my_center|LOCUS_27230 1560 2021 gene locus_tag LOCUS_27240 1560 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107612.1 protein_id gnl|my_center|LOCUS_27240 2029 2544 gene locus_tag LOCUS_27250 2029 2544 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763510.1 protein_id gnl|my_center|LOCUS_27250 2848 2773 gene locus_tag LOCUS_t00480 2848 2773 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence342 <1 2301 gene locus_tag LOCUS_27260 <1 2301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202237.1:peptidase M16 2482 2754 gene locus_tag LOCUS_27270 2482 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27270 >Feature sequence343 2057 384 gene locus_tag LOCUS_27280 2057 384 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312011.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence344 1079 111 gene locus_tag LOCUS_27290 1079 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 1754 1104 gene locus_tag LOCUS_27300 1754 1104 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767382.1 protein_id gnl|my_center|LOCUS_27300 2662 1751 gene locus_tag LOCUS_27310 2662 1751 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A338 protein_id gnl|my_center|LOCUS_27310 >Feature sequence345 512 805 gene locus_tag LOCUS_27320 gene rplW 512 805 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A478 protein_id gnl|my_center|LOCUS_27320 811 1635 gene locus_tag LOCUS_27330 gene rplB 811 1635 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL1 protein_id gnl|my_center|LOCUS_27330 1656 1925 gene locus_tag LOCUS_27340 gene rpsS 1656 1925 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_27340 1962 2372 gene locus_tag LOCUS_27350 gene rplV 1962 2372 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL3 protein_id gnl|my_center|LOCUS_27350 >Feature sequence346 1192 590 gene locus_tag LOCUS_27360 1192 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence347 42 593 gene locus_tag LOCUS_27370 42 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 583 1749 gene locus_tag LOCUS_27380 583 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426117.1 protein_id gnl|my_center|LOCUS_27380 >Feature sequence348 1039 464 gene locus_tag LOCUS_27390 1039 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 1204 2112 gene locus_tag LOCUS_27400 1204 2112 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence349 626 168 gene locus_tag LOCUS_27410 626 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762313.1 protein_id gnl|my_center|LOCUS_27410 2398 1805 gene locus_tag LOCUS_27420 2398 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence350 61 801 gene locus_tag LOCUS_27430 gene menG 61 801 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV8 protein_id gnl|my_center|LOCUS_27430 811 1563 gene locus_tag LOCUS_27440 811 1563 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_27440 1577 2530 gene locus_tag LOCUS_27450 1577 2530 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785146.1 protein_id gnl|my_center|LOCUS_27450 >Feature sequence351 319 1284 gene locus_tag LOCUS_27460 319 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 1672 1298 gene locus_tag LOCUS_27470 1672 1298 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_27470 2434 1751 gene locus_tag LOCUS_27480 2434 1751 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766769.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence352 >Feature sequence353 <2639 1016 gene locus_tag LOCUS_27490 <2639 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AB59:transcription-repair-coupling factor >Feature sequence354 318 1982 gene locus_tag LOCUS_27500 318 1982 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_27500 >Feature sequence355 288 1799 gene locus_tag LOCUS_27510 288 1799 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_27510 1825 2346 gene locus_tag LOCUS_27520 1825 2346 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766266.1 protein_id gnl|my_center|LOCUS_27520 >Feature sequence356 1834 242 gene locus_tag LOCUS_27530 1834 242 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108208.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence357 307 1224 gene locus_tag LOCUS_27540 gene natA 307 1224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_27540 1248 2501 gene locus_tag LOCUS_27550 gene natB 1248 2501 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence358 >Feature sequence359 650 132 gene locus_tag LOCUS_27560 650 132 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_27560 1364 666 gene locus_tag LOCUS_27570 gene rplA 1364 666 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ4 protein_id gnl|my_center|LOCUS_27570 1823 1380 gene locus_tag LOCUS_27580 gene rplK 1823 1380 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ3 protein_id gnl|my_center|LOCUS_27580 2426 1884 gene locus_tag LOCUS_27590 gene nusG 2426 1884 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A464 protein_id gnl|my_center|LOCUS_27590 >Feature sequence360 1915 1235 gene locus_tag LOCUS_27600 1915 1235 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_27600 <2549 1954 gene locus_tag LOCUS_27610 <2549 1954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287105.1:choloylglycine hydrolase >Feature sequence361 220 699 gene locus_tag LOCUS_27620 220 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 756 1019 gene locus_tag LOCUS_27630 756 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 1053 1760 gene locus_tag LOCUS_27640 1053 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 1790 2113 gene locus_tag LOCUS_27650 1790 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 2113 2466 gene locus_tag LOCUS_27660 2113 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence362 <1 598 gene locus_tag LOCUS_27670 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64VS6:transketolase 598 1032 gene locus_tag LOCUS_27680 598 1032 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_27680 1260 2303 gene locus_tag LOCUS_27690 1260 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795332.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence363 >Feature sequence364 692 432 gene locus_tag LOCUS_27700 692 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence365 1146 250 gene locus_tag LOCUS_27710 1146 250 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107322.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence366 642 226 gene locus_tag LOCUS_27720 642 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 1861 674 gene locus_tag LOCUS_27730 1861 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109198.1 protein_id gnl|my_center|LOCUS_27730 <2476 1883 gene locus_tag LOCUS_27740 <2476 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801226.1:ABC transporter ATP-binding protein >Feature sequence367 <2455 593 gene locus_tag LOCUS_27750 <2455 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109304.1:DEAD/DEAH box helicase >Feature sequence368 2175 1198 gene locus_tag LOCUS_27760 2175 1198 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_27760 >Feature sequence369 191 1204 gene locus_tag LOCUS_27770 191 1204 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768909.1 protein_id gnl|my_center|LOCUS_27770 1186 2127 gene locus_tag LOCUS_27780 gene cobD 1186 2127 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TE1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence370 2218 509 gene locus_tag LOCUS_27790 2218 509 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107737.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence371 883 14 gene locus_tag LOCUS_27800 883 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_27800 2020 1025 gene locus_tag LOCUS_27810 2020 1025 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence372 1271 354 gene locus_tag LOCUS_27820 1271 354 CDS product mobilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107624.1 protein_id gnl|my_center|LOCUS_27820 1620 1237 gene locus_tag LOCUS_27830 1620 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27830 <2367 1766 gene locus_tag LOCUS_27840 <2367 1766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816488.1:DNA primase >Feature sequence373 1713 241 gene locus_tag LOCUS_27850 1713 241 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108076.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence374 1702 803 gene locus_tag LOCUS_27860 1702 803 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence375 <1 677 gene locus_tag LOCUS_27870 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64RT5:aspartokinase 785 1945 gene locus_tag LOCUS_27880 gene lysA 785 1945 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A800 protein_id gnl|my_center|LOCUS_27880 >Feature sequence376 2312 159 gene locus_tag LOCUS_27890 2312 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 >Feature sequence377 73 507 gene locus_tag LOCUS_27900 73 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 510 869 gene locus_tag LOCUS_27910 510 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 866 1273 gene locus_tag LOCUS_27920 866 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 1270 1719 gene locus_tag LOCUS_27930 1270 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 1759 2127 gene locus_tag LOCUS_27940 1759 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence378 1354 284 gene locus_tag LOCUS_27950 1354 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 <2265 1754 gene locus_tag LOCUS_27960 <2265 1754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764238.1:lipid-A-disaccharide synthase >Feature sequence379 1602 40 gene locus_tag LOCUS_27970 1602 40 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199135.1 protein_id gnl|my_center|LOCUS_27970 1896 1824 gene locus_tag LOCUS_t00490 1896 1824 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence380 >Feature sequence381 145 906 gene locus_tag LOCUS_27980 145 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 909 1349 gene locus_tag LOCUS_27990 909 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291503.1 protein_id gnl|my_center|LOCUS_27990 1352 1705 gene locus_tag LOCUS_28000 1352 1705 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291505.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence382 <1 1111 gene locus_tag LOCUS_28010 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000844667.1:6-aminohexanoate-dimer hydrolase 1190 1402 gene locus_tag LOCUS_28020 1190 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767859.1 protein_id gnl|my_center|LOCUS_28020 <2138 1509 gene locus_tag LOCUS_28030 <2138 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784328.1:alkaline phosphatase >Feature sequence383 1300 263 gene locus_tag LOCUS_28040 1300 263 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_28040 >Feature sequence384 >Feature sequence385 <1 721 gene locus_tag LOCUS_28050 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762996.1:thiol:disulfide interchange protein <2085 815 gene locus_tag LOCUS_28060 <2085 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764544.1:MFS transporter >Feature sequence386 1604 1137 gene locus_tag LOCUS_28070 gene rimP 1604 1137 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2A3 protein_id gnl|my_center|LOCUS_28070 >Feature sequence387 527 273 gene locus_tag LOCUS_28080 527 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 817 524 gene locus_tag LOCUS_28090 817 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 1002 1541 gene locus_tag LOCUS_28100 1002 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 1727 1467 gene locus_tag LOCUS_28110 1727 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence388 238 579 gene locus_tag LOCUS_28120 238 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963215.1 protein_id gnl|my_center|LOCUS_28120 623 1558 gene locus_tag LOCUS_28130 623 1558 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362003.1 protein_id gnl|my_center|LOCUS_28130 1757 1686 gene locus_tag LOCUS_t00500 1757 1686 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence389 1988 639 gene locus_tag LOCUS_28140 gene nqrA 1988 639 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence390 <2024 436 gene locus_tag LOCUS_28150 <2024 436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202279.1:RNA pseudouridine synthase >Feature sequence391 >Feature sequence392 603 803 gene locus_tag LOCUS_28160 603 803 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765536.1 protein_id gnl|my_center|LOCUS_28160 793 1452 gene locus_tag LOCUS_28170 gene thiE 793 1452 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TA1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence393 575 1693 gene locus_tag LOCUS_28180 575 1693 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706579.1 protein_id gnl|my_center|LOCUS_28180 >Feature sequence394 <1980 1345 gene locus_tag LOCUS_28190 <1980 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0H9:magnesium transporter MgtE >Feature sequence395 382 197 gene locus_tag LOCUS_28200 382 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 >Feature sequence396 1448 852 gene locus_tag LOCUS_28210 1448 852 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690638.1 protein_id gnl|my_center|LOCUS_28210 1818 1489 gene locus_tag LOCUS_28220 1818 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence397 >Feature sequence398 >Feature sequence399 474 1154 gene locus_tag LOCUS_28230 474 1154 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence400 1252 104 gene locus_tag LOCUS_28240 1252 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence401 1417 185 gene locus_tag LOCUS_28250 1417 185 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107629.1 protein_id gnl|my_center|LOCUS_28250 >Feature sequence402 3 839 gene locus_tag LOCUS_28260 3 839 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4Q4 protein_id gnl|my_center|LOCUS_28260 1065 1550 gene locus_tag LOCUS_28270 1065 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence403 452 634 gene locus_tag LOCUS_28280 452 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 757 1617 gene locus_tag LOCUS_28290 757 1617 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765456.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence404 217 555 gene locus_tag LOCUS_28300 217 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28300 >Feature sequence405 >Feature sequence406 556 1239 gene locus_tag LOCUS_28310 556 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence407 1745 1671 gene locus_tag LOCUS_t00510 1745 1671 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence408 1255 230 gene locus_tag LOCUS_28320 1255 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 1329 1499 gene locus_tag LOCUS_28330 1329 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence409 558 70 gene locus_tag LOCUS_28340 558 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 679 1098 gene locus_tag LOCUS_28350 679 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence410 884 417 gene locus_tag LOCUS_28360 884 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784138.1 protein_id gnl|my_center|LOCUS_28360 1038 904 gene locus_tag LOCUS_28370 1038 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 <1757 1119 gene locus_tag LOCUS_28380 <1757 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784130.1:peptide chain release factor 2 >Feature sequence411 1147 140 gene locus_tag LOCUS_28390 1147 140 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297199.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence412 1481 258 gene locus_tag LOCUS_28400 1481 258 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107629.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence413 43 384 gene locus_tag LOCUS_28410 gene rplR 43 384 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A492 protein_id gnl|my_center|LOCUS_28410 391 906 gene locus_tag LOCUS_28420 gene rpsE 391 906 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM5 protein_id gnl|my_center|LOCUS_28420 916 1092 gene locus_tag LOCUS_28430 gene rpmD 916 1092 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM6 protein_id gnl|my_center|LOCUS_28430 >Feature sequence414 242 406 gene locus_tag LOCUS_28440 242 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 393 581 gene locus_tag LOCUS_28450 393 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 738 980 gene locus_tag LOCUS_28460 738 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence415 >Feature sequence416 262 1428 gene locus_tag LOCUS_28470 262 1428 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_28470 >Feature sequence417 280 993 gene locus_tag LOCUS_28480 280 993 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_28480 1000 1419 gene locus_tag LOCUS_28490 1000 1419 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence418 442 1488 gene locus_tag LOCUS_28500 442 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence419 747 1541 gene locus_tag LOCUS_28510 747 1541 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence420 921 418 gene locus_tag LOCUS_28520 921 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence421 >Feature sequence422 17 238 gene locus_tag LOCUS_28530 17 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 284 706 gene locus_tag LOCUS_28540 284 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 <1621 755 gene locus_tag LOCUS_28550 <1621 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362003.1:DDE transposase >Feature sequence423 <1 1431 gene locus_tag LOCUS_28560 <1 1431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZY5:beta-galactosidase >Feature sequence424 <1 525 gene locus_tag LOCUS_28570 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202242.1:DNA translocase FtsK 596 1174 gene locus_tag LOCUS_28580 596 1174 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109203.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence425 1 1041 gene locus_tag LOCUS_28590 1 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence426 <1568 272 gene locus_tag LOCUS_28600 <1568 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002324544.1:recombinase >Feature sequence427 322 816 gene locus_tag LOCUS_28610 322 816 CDS product RNA polymerase subunit sigma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306931.1 protein_id gnl|my_center|LOCUS_28610 800 1513 gene locus_tag LOCUS_28620 800 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence428 >Feature sequence429 760 999 gene locus_tag LOCUS_28630 760 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630