>Feature sequence001 640 864 gene locus_tag LOCUS_00010 640 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55482 protein_id gnl|my_center|LOCUS_00010 994 1191 gene locus_tag LOCUS_00020 994 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639145.2 protein_id gnl|my_center|LOCUS_00020 1566 1814 gene locus_tag LOCUS_00030 1566 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1927 2277 gene locus_tag LOCUS_00040 1927 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2479 3006 gene locus_tag LOCUS_00050 2479 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3287 3015 gene locus_tag LOCUS_00060 3287 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4417 3287 gene locus_tag LOCUS_00070 4417 3287 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332020.1 protein_id gnl|my_center|LOCUS_00070 6763 4478 gene locus_tag LOCUS_00080 6763 4478 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FYY7 protein_id gnl|my_center|LOCUS_00080 7060 6854 gene locus_tag LOCUS_00090 7060 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7761 7117 gene locus_tag LOCUS_00100 gene pgp 7761 7117 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222833.1 protein_id gnl|my_center|LOCUS_00100 8471 7761 gene locus_tag LOCUS_00110 gene ubiG 8471 7761 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5J8 protein_id gnl|my_center|LOCUS_00110 8650 9765 gene locus_tag LOCUS_00120 8650 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00120 9877 11376 gene locus_tag LOCUS_00130 9877 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00130 11449 12528 gene locus_tag LOCUS_00140 gene serC 11449 12528 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6F2 protein_id gnl|my_center|LOCUS_00140 12528 13808 gene locus_tag LOCUS_00150 gene aroA 12528 13808 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRB0 protein_id gnl|my_center|LOCUS_00150 13964 14677 gene locus_tag LOCUS_00160 gene cmk 13964 14677 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ92 protein_id gnl|my_center|LOCUS_00160 14770 16437 gene locus_tag LOCUS_00170 gene rpsA 14770 16437 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AG69 protein_id gnl|my_center|LOCUS_00170 16495 16782 gene locus_tag LOCUS_00180 gene ihfB 16495 16782 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y4W4 protein_id gnl|my_center|LOCUS_00180 16712 17053 gene locus_tag LOCUS_00190 16712 17053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17056 18192 gene locus_tag LOCUS_00200 gene lapB 17056 18192 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N48 protein_id gnl|my_center|LOCUS_00200 18227 18931 gene locus_tag LOCUS_00210 gene pyrF 18227 18931 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ97 protein_id gnl|my_center|LOCUS_00210 19805 18981 gene locus_tag LOCUS_00220 19805 18981 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 protein_id gnl|my_center|LOCUS_00220 21133 19808 gene locus_tag LOCUS_00230 21133 19808 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072757.1 protein_id gnl|my_center|LOCUS_00230 21329 22315 gene locus_tag LOCUS_00240 21329 22315 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_00240 22885 22975 gene locus_tag LOCUS_t00010 22885 22975 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23025 23396 gene locus_tag LOCUS_00250 23025 23396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 23461 24078 gene locus_tag LOCUS_00260 gene fklB 23461 24078 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS8 protein_id gnl|my_center|LOCUS_00260 25600 24203 gene locus_tag LOCUS_00270 gene asnS 25600 24203 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32E51 protein_id gnl|my_center|LOCUS_00270 25829 26263 gene locus_tag LOCUS_00280 25829 26263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072037.1 protein_id gnl|my_center|LOCUS_00280 27480 26359 gene locus_tag LOCUS_00290 gene ald 27480 26359 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6E8 protein_id gnl|my_center|LOCUS_00290 27623 28102 gene locus_tag LOCUS_00300 gene lrp 27623 28102 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418488.1 protein_id gnl|my_center|LOCUS_00300 28261 30348 gene locus_tag LOCUS_00310 gene ftsK 28261 30348 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER3 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00310 30373 30852 gene locus_tag LOCUS_00320 30373 30852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00320 30853 31485 gene locus_tag LOCUS_00330 gene lolA 30853 31485 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6E5 protein_id gnl|my_center|LOCUS_00330 >Feature sequence002 1305 538 gene locus_tag LOCUS_00340 1305 538 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_00340 1595 1873 gene locus_tag LOCUS_00350 gene xseB 1595 1873 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL1 protein_id gnl|my_center|LOCUS_00350 1883 2770 gene locus_tag LOCUS_00360 1883 2770 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707087.1 protein_id gnl|my_center|LOCUS_00360 2767 4734 gene locus_tag LOCUS_00370 gene dxs 2767 4734 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RU0 protein_id gnl|my_center|LOCUS_00370 7881 4786 gene locus_tag LOCUS_00380 7881 4786 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038432.1 protein_id gnl|my_center|LOCUS_00380 8386 7901 gene locus_tag LOCUS_00390 gene pgpA 8386 7901 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_00390 9390 8395 gene locus_tag LOCUS_00400 gene thiL 9390 8395 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNG5 protein_id gnl|my_center|LOCUS_00400 9813 9403 gene locus_tag LOCUS_00410 gene nusB 9813 9403 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y367 protein_id gnl|my_center|LOCUS_00410 10289 9825 gene locus_tag LOCUS_00420 gene ribH 10289 9825 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP3 protein_id gnl|my_center|LOCUS_00420 11556 10444 gene locus_tag LOCUS_00430 gene ribB 11556 10444 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6Z9 protein_id gnl|my_center|LOCUS_00430 12236 11580 gene locus_tag LOCUS_00440 12236 11580 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073315.1 protein_id gnl|my_center|LOCUS_00440 13357 12248 gene locus_tag LOCUS_00450 gene ribD 13357 12248 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNH1 protein_id gnl|my_center|LOCUS_00450 13806 13357 gene locus_tag LOCUS_00460 gene nrdR 13806 13357 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNH2 protein_id gnl|my_center|LOCUS_00460 15143 13887 gene locus_tag LOCUS_00470 gene glyA 15143 13887 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZCR1 protein_id gnl|my_center|LOCUS_00470 16679 15396 gene locus_tag LOCUS_00480 gene thrC 16679 15396 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44503 protein_id gnl|my_center|LOCUS_00480 20048 16686 gene locus_tag LOCUS_00490 20048 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 20694 20329 gene locus_tag LOCUS_00500 20694 20329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 20920 22683 gene locus_tag LOCUS_00510 20920 22683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 22795 23706 gene locus_tag LOCUS_00520 gene rdgC 22795 23706 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU12 protein_id gnl|my_center|LOCUS_00520 24932 23778 gene locus_tag LOCUS_00530 24932 23778 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966662.1 protein_id gnl|my_center|LOCUS_00530 25098 25973 gene locus_tag LOCUS_00540 25098 25973 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213786.1 protein_id gnl|my_center|LOCUS_00540 26517 26020 gene locus_tag LOCUS_00550 26517 26020 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_00550 28791 26797 gene locus_tag LOCUS_00560 gene tkt 28791 26797 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX2 protein_id gnl|my_center|LOCUS_00560 >Feature sequence003 226 1413 gene locus_tag LOCUS_00570 gene metK 226 1413 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88AK7 protein_id gnl|my_center|LOCUS_00570 2344 1499 gene locus_tag LOCUS_00580 2344 1499 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402256.1 protein_id gnl|my_center|LOCUS_00580 3027 2395 gene locus_tag LOCUS_00590 3027 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706101.1 protein_id gnl|my_center|LOCUS_00590 4590 3067 gene locus_tag LOCUS_00600 4590 3067 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447090.1 protein_id gnl|my_center|LOCUS_00600 4754 5365 gene locus_tag LOCUS_00610 4754 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733229.1 protein_id gnl|my_center|LOCUS_00610 5992 5429 gene locus_tag LOCUS_00620 5992 5429 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_00620 6825 6115 gene locus_tag LOCUS_00630 6825 6115 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7Q6 protein_id gnl|my_center|LOCUS_00630 6894 8126 gene locus_tag LOCUS_00640 gene srmB 6894 8126 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI96 protein_id gnl|my_center|LOCUS_00640 9294 8170 gene locus_tag LOCUS_00650 9294 8170 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106438.1 protein_id gnl|my_center|LOCUS_00650 10188 9409 gene locus_tag LOCUS_00660 10188 9409 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC0 protein_id gnl|my_center|LOCUS_00660 10430 11380 gene locus_tag LOCUS_00670 gene tal 10430 11380 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIN2 protein_id gnl|my_center|LOCUS_00670 11768 11962 gene locus_tag LOCUS_00680 11768 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 12660 12001 gene locus_tag LOCUS_00690 gene ung 12660 12001 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC4 protein_id gnl|my_center|LOCUS_00690 13511 12657 gene locus_tag LOCUS_00700 gene btuF 13511 12657 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_00700 14107 13511 gene locus_tag LOCUS_00710 14107 13511 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894344.1 protein_id gnl|my_center|LOCUS_00710 15596 14115 gene locus_tag LOCUS_00720 gene cobQ 15596 14115 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLL6 protein_id gnl|my_center|LOCUS_00720 16134 15601 gene locus_tag LOCUS_00730 gene cobU 16134 15601 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_00730 16898 16125 gene locus_tag LOCUS_00740 gene cobS 16898 16125 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q45 protein_id gnl|my_center|LOCUS_00740 17961 16891 gene locus_tag LOCUS_00750 gene cobT 17961 16891 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI18 protein_id gnl|my_center|LOCUS_00750 18954 17965 gene locus_tag LOCUS_00760 gene btuC 18954 17965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071293.1 protein_id gnl|my_center|LOCUS_00760 19757 18990 gene locus_tag LOCUS_00770 gene btuD 19757 18990 CDS product ABC cobalamin uptake system ATPase BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071292.1 protein_id gnl|my_center|LOCUS_00770 20749 20147 gene locus_tag LOCUS_00780 20749 20147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 21025 20813 gene locus_tag LOCUS_00790 21025 20813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705066.1 protein_id gnl|my_center|LOCUS_00790 22164 21148 gene locus_tag LOCUS_00800 22164 21148 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHD2 protein_id gnl|my_center|LOCUS_00800 23482 22256 gene locus_tag LOCUS_00810 gene nqrF 23482 22256 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV4 protein_id gnl|my_center|LOCUS_00810 24108 23500 gene locus_tag LOCUS_00820 gene nqrE 24108 23500 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV5 protein_id gnl|my_center|LOCUS_00820 24751 24119 gene locus_tag LOCUS_00830 gene nqrD 24751 24119 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 protein_id gnl|my_center|LOCUS_00830 25497 24751 gene locus_tag LOCUS_00840 gene nqrC 25497 24751 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHC8 protein_id gnl|my_center|LOCUS_00840 26689 25490 gene locus_tag LOCUS_00850 gene nqrB 26689 25490 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV8 protein_id gnl|my_center|LOCUS_00850 28049 26694 gene locus_tag LOCUS_00860 gene nqrA 28049 26694 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA6 protein_id gnl|my_center|LOCUS_00860 >Feature sequence004 115 549 gene locus_tag LOCUS_00870 115 549 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070493.1 protein_id gnl|my_center|LOCUS_00870 1039 1755 gene locus_tag LOCUS_00880 1039 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 1770 1976 gene locus_tag LOCUS_00890 1770 1976 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974621.1 protein_id gnl|my_center|LOCUS_00890 2257 4056 gene locus_tag LOCUS_00900 2257 4056 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043985.1 protein_id gnl|my_center|LOCUS_00900 4437 4258 gene locus_tag LOCUS_00910 4437 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 5103 4789 gene locus_tag LOCUS_00920 5103 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 5494 7206 gene locus_tag LOCUS_00930 5494 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 8544 7303 gene locus_tag LOCUS_00940 8544 7303 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_00940 9467 8670 gene locus_tag LOCUS_00950 gene hyuE 9467 8670 CDS product hydantoin racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385665.1 protein_id gnl|my_center|LOCUS_00950 10812 9547 gene locus_tag LOCUS_00960 10812 9547 CDS product purine-cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803756.1 protein_id gnl|my_center|LOCUS_00960 12682 11021 gene locus_tag LOCUS_00970 gene huyB 12682 11021 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538145.1 protein_id gnl|my_center|LOCUS_00970 14778 12679 gene locus_tag LOCUS_00980 14778 12679 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538146.1 protein_id gnl|my_center|LOCUS_00980 15272 14781 gene locus_tag LOCUS_00990 15272 14781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385660.1 protein_id gnl|my_center|LOCUS_00990 17590 15275 gene locus_tag LOCUS_01000 17590 15275 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388620.1 protein_id gnl|my_center|LOCUS_01000 17721 17993 gene locus_tag LOCUS_01010 17721 17993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01010 18078 20423 gene locus_tag LOCUS_01020 gene acoK 18078 20423 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038375.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01020 20838 20548 gene locus_tag LOCUS_01030 20838 20548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 21093 21482 gene locus_tag LOCUS_01040 gene yjfI 21093 21482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312608.1 protein_id gnl|my_center|LOCUS_01040 21494 22192 gene locus_tag LOCUS_01050 21494 22192 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092609.1 protein_id gnl|my_center|LOCUS_01050 22328 22972 gene locus_tag LOCUS_01060 22328 22972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 22985 23401 gene locus_tag LOCUS_01070 22985 23401 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483612.1 protein_id gnl|my_center|LOCUS_01070 23415 24035 gene locus_tag LOCUS_01080 23415 24035 CDS product UPF0441 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGH1 protein_id gnl|my_center|LOCUS_01080 24037 25218 gene locus_tag LOCUS_01090 24037 25218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483628.1 protein_id gnl|my_center|LOCUS_01090 25939 25394 gene locus_tag LOCUS_01100 25939 25394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 26558 26836 gene locus_tag LOCUS_01110 26558 26836 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479216.1 protein_id gnl|my_center|LOCUS_01110 >Feature sequence005 817 1701 gene locus_tag LOCUS_01120 gene nadK 817 1701 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGS1 protein_id gnl|my_center|LOCUS_01120 1754 2314 gene locus_tag LOCUS_01130 1754 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 2382 4058 gene locus_tag LOCUS_01140 2382 4058 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RX8 protein_id gnl|my_center|LOCUS_01140 5534 4119 gene locus_tag LOCUS_01150 5534 4119 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098959.1 protein_id gnl|my_center|LOCUS_01150 6903 5545 gene locus_tag LOCUS_01160 6903 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01160 10002 7009 gene locus_tag LOCUS_01170 10002 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01170 11603 10599 gene locus_tag LOCUS_01180 gene ruvB 11603 10599 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRJ5 protein_id gnl|my_center|LOCUS_01180 12229 11612 gene locus_tag LOCUS_01190 gene ruvA 12229 11612 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QU8 protein_id gnl|my_center|LOCUS_01190 12756 12235 gene locus_tag LOCUS_01200 gene ruvC 12756 12235 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZEU7 protein_id gnl|my_center|LOCUS_01200 14167 12812 gene locus_tag LOCUS_01210 14167 12812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 15572 14169 gene locus_tag LOCUS_01220 15572 14169 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107494.1 protein_id gnl|my_center|LOCUS_01220 18006 15586 gene locus_tag LOCUS_01230 18006 15586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141479.1 protein_id gnl|my_center|LOCUS_01230 18724 18017 gene locus_tag LOCUS_01240 18724 18017 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_01240 20006 18750 gene locus_tag LOCUS_01250 20006 18750 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211952.1 protein_id gnl|my_center|LOCUS_01250 20782 20192 gene locus_tag LOCUS_01260 20782 20192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 21076 22035 gene locus_tag LOCUS_01270 21076 22035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 22556 22044 gene locus_tag LOCUS_01280 22556 22044 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103092.1 protein_id gnl|my_center|LOCUS_01280 24552 22618 gene locus_tag LOCUS_01290 24552 22618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 <27335 24552 gene locus_tag LOCUS_01300 <27335 24552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87M84:RecBCD enzyme subunit RecB >Feature sequence006 64 140 gene locus_tag LOCUS_t00020 64 140 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 381 1685 gene locus_tag LOCUS_01310 gene tig 381 1685 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQS5 protein_id gnl|my_center|LOCUS_01310 1830 2447 gene locus_tag LOCUS_01320 gene clpP 1830 2447 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R80 protein_id gnl|my_center|LOCUS_01320 2570 3853 gene locus_tag LOCUS_01330 gene clpX 2570 3853 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJU2 protein_id gnl|my_center|LOCUS_01330 3973 6342 gene locus_tag LOCUS_01340 gene lon 3973 6342 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJU3 protein_id gnl|my_center|LOCUS_01340 6542 6814 gene locus_tag LOCUS_01350 6542 6814 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005315375.1 protein_id gnl|my_center|LOCUS_01350 6971 8887 gene locus_tag LOCUS_01360 gene ppiD 6971 8887 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG15 protein_id gnl|my_center|LOCUS_01360 9000 8806 gene locus_tag LOCUS_01370 9000 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 9056 9604 gene locus_tag LOCUS_01380 9056 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 10400 9639 gene locus_tag LOCUS_01390 gene sapF 10400 9639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071922.1 protein_id gnl|my_center|LOCUS_01390 11392 10385 gene locus_tag LOCUS_01400 gene sapD 11392 10385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705749.1 protein_id gnl|my_center|LOCUS_01400 12285 11392 gene locus_tag LOCUS_01410 gene sapC 12285 11392 CDS product antimicrobial peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705750.1 protein_id gnl|my_center|LOCUS_01410 13303 12272 gene locus_tag LOCUS_01420 gene sapB 13303 12272 CDS product antimicrobial peptide ABC transporter permease SapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071925.1 protein_id gnl|my_center|LOCUS_01420 14910 13303 gene locus_tag LOCUS_01430 gene sapA 14910 13303 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071926.1 protein_id gnl|my_center|LOCUS_01430 15996 14914 gene locus_tag LOCUS_01440 gene pspF 15996 14914 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071927.1 protein_id gnl|my_center|LOCUS_01440 16181 16843 gene locus_tag LOCUS_01450 gene pspA 16181 16843 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_01450 16902 17135 gene locus_tag LOCUS_01460 gene pspB 16902 17135 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071929.1 protein_id gnl|my_center|LOCUS_01460 17132 17536 gene locus_tag LOCUS_01470 17132 17536 CDS product phage shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105784.1 protein_id gnl|my_center|LOCUS_01470 17611 18651 gene locus_tag LOCUS_01480 17611 18651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01480 18712 19014 gene locus_tag LOCUS_01490 18712 19014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01490 19011 20036 gene locus_tag LOCUS_01500 gene ycjF 19011 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263200.1 protein_id gnl|my_center|LOCUS_01500 20171 21349 gene locus_tag LOCUS_01510 gene mdeA 20171 21349 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 protein_id gnl|my_center|LOCUS_01510 21570 22367 gene locus_tag LOCUS_01520 gene phhA 21570 22367 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268521.1 protein_id gnl|my_center|LOCUS_01520 22378 22722 gene locus_tag LOCUS_01530 22378 22722 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGD7 protein_id gnl|my_center|LOCUS_01530 22850 24796 gene locus_tag LOCUS_01540 gene topB 22850 24796 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4B0 protein_id gnl|my_center|LOCUS_01540 24852 25709 gene locus_tag LOCUS_01550 24852 25709 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012601353.1 protein_id gnl|my_center|LOCUS_01550 >Feature sequence007 1687 2586 gene locus_tag LOCUS_01560 1687 2586 CDS product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQH1 protein_id gnl|my_center|LOCUS_01560 2912 2583 gene locus_tag LOCUS_01570 2912 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 2937 3971 gene locus_tag LOCUS_01580 gene sypH 2937 3971 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263836.1 protein_id gnl|my_center|LOCUS_01580 5725 4070 gene locus_tag LOCUS_01590 5725 4070 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_01590 7879 5735 gene locus_tag LOCUS_01600 gene gidA 7879 5735 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 protein_id gnl|my_center|LOCUS_01600 8772 7954 gene locus_tag LOCUS_01610 8772 7954 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_01610 14451 8782 gene locus_tag LOCUS_01620 14451 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 15653 14460 gene locus_tag LOCUS_01630 15653 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 16947 15643 gene locus_tag LOCUS_01640 16947 15643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 18604 17114 gene locus_tag LOCUS_01650 gene fadH 18604 17114 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262203.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01650 19075 18614 gene locus_tag LOCUS_01660 19075 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01660 19287 21158 gene locus_tag LOCUS_01670 gene sppA 19287 21158 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4A8 protein_id gnl|my_center|LOCUS_01670 21223 22233 gene locus_tag LOCUS_01680 gene ansA 21223 22233 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366152.1 protein_id gnl|my_center|LOCUS_01680 23693 22320 gene locus_tag LOCUS_01690 gene gnd 23693 22320 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFR5 protein_id gnl|my_center|LOCUS_01690 >Feature sequence008 1668 451 gene locus_tag LOCUS_01700 1668 451 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082362.1 protein_id gnl|my_center|LOCUS_01700 2364 1675 gene locus_tag LOCUS_01710 gene rstA 2364 1675 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_01710 2774 2364 gene locus_tag LOCUS_01720 2774 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 3711 2764 gene locus_tag LOCUS_01730 gene mipA 3711 2764 CDS product outer membrane MltA-interaction protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073410.1 protein_id gnl|my_center|LOCUS_01730 3883 5949 gene locus_tag LOCUS_01740 3883 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8553 6376 gene locus_tag LOCUS_01750 gene glcB 8553 6376 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 protein_id gnl|my_center|LOCUS_01750 8803 10407 gene locus_tag LOCUS_01760 gene aceA 8803 10407 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117581.1 protein_id gnl|my_center|LOCUS_01760 10560 11585 gene locus_tag LOCUS_01770 10560 11585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 13117 11675 gene locus_tag LOCUS_01780 13117 11675 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478725.1 protein_id gnl|my_center|LOCUS_01780 13895 13212 gene locus_tag LOCUS_01790 13895 13212 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546865.1 protein_id gnl|my_center|LOCUS_01790 14112 13921 gene locus_tag LOCUS_01800 14112 13921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 17427 14323 gene locus_tag LOCUS_01810 17427 14323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 18475 17513 gene locus_tag LOCUS_01820 18475 17513 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100771.1 protein_id gnl|my_center|LOCUS_01820 19725 18487 gene locus_tag LOCUS_01830 gene parA 19725 18487 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074409.1 protein_id gnl|my_center|LOCUS_01830 20400 21614 gene locus_tag LOCUS_01840 20400 21614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 22493 21624 gene locus_tag LOCUS_01850 gene tus 22493 21624 CDS product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706671.1 protein_id gnl|my_center|LOCUS_01850 >Feature sequence009 644 312 gene locus_tag LOCUS_01860 644 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 1003 641 gene locus_tag LOCUS_01870 gene sdhC 1003 641 CDS product succinate dehydrogenase cytochrome b556 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043021.1 protein_id gnl|my_center|LOCUS_01870 1171 1362 gene locus_tag LOCUS_01880 1171 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 1746 1498 gene locus_tag LOCUS_01890 1746 1498 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460424.1 protein_id gnl|my_center|LOCUS_01890 2961 1831 gene locus_tag LOCUS_01900 2961 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 4103 2976 gene locus_tag LOCUS_01910 4103 2976 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230992.2 protein_id gnl|my_center|LOCUS_01910 4176 8138 gene locus_tag LOCUS_01920 4176 8138 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256602.1 protein_id gnl|my_center|LOCUS_01920 8326 8135 gene locus_tag LOCUS_01930 8326 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 8244 9044 gene locus_tag LOCUS_01940 8244 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_01940 10279 9086 gene locus_tag LOCUS_01950 10279 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450494.1 protein_id gnl|my_center|LOCUS_01950 11057 10389 gene locus_tag LOCUS_01960 gene nth 11057 10389 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_01960 11448 11636 gene locus_tag LOCUS_01970 11448 11636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 13636 11753 gene locus_tag LOCUS_01980 13636 11753 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482128.1 protein_id gnl|my_center|LOCUS_01980 13864 13685 gene locus_tag LOCUS_01990 13864 13685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 14002 14982 gene locus_tag LOCUS_02000 14002 14982 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221643.1 protein_id gnl|my_center|LOCUS_02000 15119 15958 gene locus_tag LOCUS_02010 15119 15958 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089434.1 protein_id gnl|my_center|LOCUS_02010 15963 17147 gene locus_tag LOCUS_02020 15963 17147 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267108.1 protein_id gnl|my_center|LOCUS_02020 17450 17211 gene locus_tag LOCUS_02030 17450 17211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421716.1 protein_id gnl|my_center|LOCUS_02030 17604 18320 gene locus_tag LOCUS_02040 17604 18320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 18406 19101 gene locus_tag LOCUS_02050 18406 19101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477491.1 protein_id gnl|my_center|LOCUS_02050 19480 19689 gene locus_tag LOCUS_02060 19480 19689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 21949 19751 gene locus_tag LOCUS_02070 21949 19751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 >Feature sequence010 93 4343 gene locus_tag LOCUS_02080 93 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 4330 8415 gene locus_tag LOCUS_02090 4330 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 8708 10213 gene locus_tag LOCUS_02100 8708 10213 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_02100 10586 11632 gene locus_tag LOCUS_02110 gene hppD 10586 11632 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072057.1 protein_id gnl|my_center|LOCUS_02110 11780 13093 gene locus_tag LOCUS_02120 gene fahA 11780 13093 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 protein_id gnl|my_center|LOCUS_02120 13425 14288 gene locus_tag LOCUS_02130 13425 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 14278 14661 gene locus_tag LOCUS_02140 14278 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 15107 14658 gene locus_tag LOCUS_02150 15107 14658 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 protein_id gnl|my_center|LOCUS_02150 15298 16485 gene locus_tag LOCUS_02160 gene mdtL 15298 16485 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260921.1 protein_id gnl|my_center|LOCUS_02160 16700 17329 gene locus_tag LOCUS_02170 gene rhtB 16700 17329 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088199.1 protein_id gnl|my_center|LOCUS_02170 18756 17395 gene locus_tag LOCUS_02180 gene yegD 18756 17395 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072221.1 protein_id gnl|my_center|LOCUS_02180 19640 18810 gene locus_tag LOCUS_02190 19640 18810 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908473.1 protein_id gnl|my_center|LOCUS_02190 20190 19738 gene locus_tag LOCUS_02200 20190 19738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02200 20397 20269 gene locus_tag LOCUS_02210 20397 20269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 20729 20430 gene locus_tag LOCUS_02220 20729 20430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 <22168 20863 gene locus_tag LOCUS_02230 <22168 20863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036237.1:TonB-dependent receptor >Feature sequence011 858 511 gene locus_tag LOCUS_02240 858 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02240 1559 1203 gene locus_tag LOCUS_02250 1559 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 2667 2185 gene locus_tag LOCUS_02260 2667 2185 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KML0 protein_id gnl|my_center|LOCUS_02260 5079 2674 gene locus_tag LOCUS_02270 5079 2674 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268923.1 protein_id gnl|my_center|LOCUS_02270 5576 5118 gene locus_tag LOCUS_02280 5576 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816834.1 protein_id gnl|my_center|LOCUS_02280 5749 8337 gene locus_tag LOCUS_02290 gene leuS 5749 8337 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ0 protein_id gnl|my_center|LOCUS_02290 8339 8836 gene locus_tag LOCUS_02300 gene lptE 8339 8836 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ1 protein_id gnl|my_center|LOCUS_02300 8836 9873 gene locus_tag LOCUS_02310 gene holA 8836 9873 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707024.1 protein_id gnl|my_center|LOCUS_02310 9880 10509 gene locus_tag LOCUS_02320 gene nadD 9880 10509 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX21 protein_id gnl|my_center|LOCUS_02320 10566 10883 gene locus_tag LOCUS_02330 gene rsfS 10566 10883 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ3 protein_id gnl|my_center|LOCUS_02330 10886 11356 gene locus_tag LOCUS_02340 gene rlmH 10886 11356 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ4 protein_id gnl|my_center|LOCUS_02340 11367 13238 gene locus_tag LOCUS_02350 11367 13238 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945987.1 protein_id gnl|my_center|LOCUS_02350 13238 14344 gene locus_tag LOCUS_02360 gene mrdB 13238 14344 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_02360 14341 15102 gene locus_tag LOCUS_02370 gene rlpA 14341 15102 CDS product endolytic peptidoglycan transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTF4 protein_id gnl|my_center|LOCUS_02370 15149 16312 gene locus_tag LOCUS_02380 15149 16312 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748295.1 protein_id gnl|my_center|LOCUS_02380 16444 16722 gene locus_tag LOCUS_02390 16444 16722 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ4 protein_id gnl|my_center|LOCUS_02390 16732 17385 gene locus_tag LOCUS_02400 gene lipB 16732 17385 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ5 protein_id gnl|my_center|LOCUS_02400 17382 18347 gene locus_tag LOCUS_02410 gene lipA 17382 18347 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNA3 protein_id gnl|my_center|LOCUS_02410 18350 18535 gene locus_tag LOCUS_02420 18350 18535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 18528 19733 gene locus_tag LOCUS_02430 gene tyrP 18528 19733 CDS product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072133.1 protein_id gnl|my_center|LOCUS_02430 20345 19845 gene locus_tag LOCUS_02440 20345 19845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 <21058 20521 gene locus_tag LOCUS_02450 <21058 20521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071708.1:flagellar motor protein MotB >Feature sequence012 4472 2196 gene locus_tag LOCUS_02460 4472 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 5531 4767 gene locus_tag LOCUS_02470 5531 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 7174 5696 gene locus_tag LOCUS_02480 7174 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 7200 7460 gene locus_tag LOCUS_02490 7200 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 9185 7590 gene locus_tag LOCUS_02500 9185 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 9621 9178 gene locus_tag LOCUS_02510 9621 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271117.1 protein_id gnl|my_center|LOCUS_02510 10859 9624 gene locus_tag LOCUS_02520 10859 9624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 11740 11015 gene locus_tag LOCUS_02530 11740 11015 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNF8 protein_id gnl|my_center|LOCUS_02530 12475 11885 gene locus_tag LOCUS_02540 12475 11885 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482630.1 protein_id gnl|my_center|LOCUS_02540 13084 12590 gene locus_tag LOCUS_02550 13084 12590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 15511 13088 gene locus_tag LOCUS_02560 15511 13088 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919028.1 protein_id gnl|my_center|LOCUS_02560 15963 16202 gene locus_tag LOCUS_02570 15963 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 16256 17470 gene locus_tag LOCUS_02580 gene sbcD 16256 17470 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWB9 protein_id gnl|my_center|LOCUS_02580 >Feature sequence013 2971 2060 gene locus_tag LOCUS_02590 2971 2060 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_02590 3754 3101 gene locus_tag LOCUS_02600 3754 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 6839 3945 gene locus_tag LOCUS_02610 gene rapA 6839 3945 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LD0 protein_id gnl|my_center|LOCUS_02610 7133 8533 gene locus_tag LOCUS_02620 7133 8533 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704812.1 protein_id gnl|my_center|LOCUS_02620 8702 9562 gene locus_tag LOCUS_02630 8702 9562 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_02630 9756 10547 gene locus_tag LOCUS_02640 9756 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 11177 12079 gene locus_tag LOCUS_02650 11177 12079 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010256898.1 protein_id gnl|my_center|LOCUS_02650 12493 12113 gene locus_tag LOCUS_02660 12493 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071769.1 protein_id gnl|my_center|LOCUS_02660 13602 12655 gene locus_tag LOCUS_02670 13602 12655 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056892.1 protein_id gnl|my_center|LOCUS_02670 13677 14174 gene locus_tag LOCUS_02680 gene zntR 13677 14174 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001886208.1 protein_id gnl|my_center|LOCUS_02680 14074 14853 gene locus_tag LOCUS_02690 14074 14853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02690 14914 15396 gene locus_tag LOCUS_02700 14914 15396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02700 15488 16588 gene locus_tag LOCUS_02710 15488 16588 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277810.1 protein_id gnl|my_center|LOCUS_02710 17700 17014 gene locus_tag LOCUS_02720 17700 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 17814 18008 gene locus_tag LOCUS_02730 17814 18008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 18012 18419 gene locus_tag LOCUS_02740 18012 18419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 >Feature sequence014 49 1227 gene locus_tag LOCUS_02750 49 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2978 1455 gene locus_tag LOCUS_02760 gene phoD 2978 1455 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071101.1 protein_id gnl|my_center|LOCUS_02760 5960 3198 gene locus_tag LOCUS_02770 5960 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 6479 6033 gene locus_tag LOCUS_02780 6479 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 6872 9625 gene locus_tag LOCUS_02790 6872 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 11239 10067 gene locus_tag LOCUS_02800 gene mdoC 11239 10067 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002067937.1 protein_id gnl|my_center|LOCUS_02800 11514 12473 gene locus_tag LOCUS_02810 11514 12473 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_02810 12582 13067 gene locus_tag LOCUS_02820 12582 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 13833 15560 gene locus_tag LOCUS_02830 13833 15560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 15735 16376 gene locus_tag LOCUS_02840 15735 16376 CDS product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859237.1 protein_id gnl|my_center|LOCUS_02840 >Feature sequence015 583 365 gene locus_tag LOCUS_02850 583 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478080.1 protein_id gnl|my_center|LOCUS_02850 1853 660 gene locus_tag LOCUS_02860 1853 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 3688 2036 gene locus_tag LOCUS_02870 3688 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 5577 4387 gene locus_tag LOCUS_02880 5577 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 6007 5594 gene locus_tag LOCUS_02890 6007 5594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 7098 6022 gene locus_tag LOCUS_02900 7098 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 7486 8997 gene locus_tag LOCUS_02910 7486 8997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 11103 9520 gene locus_tag LOCUS_02920 11103 9520 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453764.1 protein_id gnl|my_center|LOCUS_02920 11291 11527 gene locus_tag LOCUS_02930 11291 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 12060 11794 gene locus_tag LOCUS_02940 12060 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02940 12800 12360 gene locus_tag LOCUS_02950 12800 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 13134 14135 gene locus_tag LOCUS_02960 gene sph 13134 14135 CDS product sphingomyelin phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283440.1 protein_id gnl|my_center|LOCUS_02960 15545 14202 gene locus_tag LOCUS_02970 gene argA 15545 14202 CDS product amino-acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59292 protein_id gnl|my_center|LOCUS_02970 >Feature sequence016 1754 1488 gene locus_tag LOCUS_02980 1754 1488 CDS product glutaredoxin, GrxA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809455.1 protein_id gnl|my_center|LOCUS_02980 4210 2120 gene locus_tag LOCUS_02990 4210 2120 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 protein_id gnl|my_center|LOCUS_02990 4840 4355 gene locus_tag LOCUS_03000 4840 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 6653 4947 gene locus_tag LOCUS_03010 6653 4947 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_03010 6825 7745 gene locus_tag LOCUS_03020 gene ghrA 6825 7745 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRR3 protein_id gnl|my_center|LOCUS_03020 8593 8012 gene locus_tag LOCUS_03030 8593 8012 CDS product Smr domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704977.1 protein_id gnl|my_center|LOCUS_03030 8924 8697 gene locus_tag LOCUS_03040 8924 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 9513 9037 gene locus_tag LOCUS_03050 9513 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 9593 9991 gene locus_tag LOCUS_03060 gene cheB 9593 9991 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359271.1 protein_id gnl|my_center|LOCUS_03060 10384 10124 gene locus_tag LOCUS_03070 gene rpsT 10384 10124 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S93 protein_id gnl|my_center|LOCUS_03070 10738 12306 gene locus_tag LOCUS_03080 10738 12306 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S92 protein_id gnl|my_center|LOCUS_03080 12389 13315 gene locus_tag LOCUS_03090 gene ribF 12389 13315 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI3 protein_id gnl|my_center|LOCUS_03090 13337 16162 gene locus_tag LOCUS_03100 gene ileS 13337 16162 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S90 protein_id gnl|my_center|LOCUS_03100 16172 16681 gene locus_tag LOCUS_03110 gene lspA 16172 16681 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S89 protein_id gnl|my_center|LOCUS_03110 16678 17118 gene locus_tag LOCUS_03120 gene fkpB 16678 17118 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG41 protein_id gnl|my_center|LOCUS_03120 >Feature sequence017 483 1952 gene locus_tag LOCUS_03130 483 1952 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q49 protein_id gnl|my_center|LOCUS_03130 2829 2164 gene locus_tag LOCUS_03140 gene queE 2829 2164 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE87 protein_id gnl|my_center|LOCUS_03140 2952 3611 gene locus_tag LOCUS_03150 2952 3611 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_03150 3747 3977 gene locus_tag LOCUS_03160 3747 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5945 3972 gene locus_tag LOCUS_03170 5945 3972 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMV1 protein_id gnl|my_center|LOCUS_03170 6163 6079 gene locus_tag LOCUS_t00030 6163 6079 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6517 6173 gene locus_tag LOCUS_03180 gene secG 6517 6173 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272680.1 protein_id gnl|my_center|LOCUS_03180 7267 6518 gene locus_tag LOCUS_03190 gene tpiA 7267 6518 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A861 protein_id gnl|my_center|LOCUS_03190 8686 7346 gene locus_tag LOCUS_03200 gene glmM 8686 7346 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_03200 9531 8683 gene locus_tag LOCUS_03210 9531 8683 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU85 protein_id gnl|my_center|LOCUS_03210 11567 9681 gene locus_tag LOCUS_03220 gene hflB 11567 9681 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNF0 protein_id gnl|my_center|LOCUS_03220 12310 11681 gene locus_tag LOCUS_03230 gene rlmE 12310 11681 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7M3 protein_id gnl|my_center|LOCUS_03230 12393 12686 gene locus_tag LOCUS_03240 12393 12686 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054291.1 protein_id gnl|my_center|LOCUS_03240 13849 12683 gene locus_tag LOCUS_03250 13849 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 13944 14750 gene locus_tag LOCUS_03260 13944 14750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 14859 15581 gene locus_tag LOCUS_03270 gene rstA 14859 15581 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_03270 15589 16878 gene locus_tag LOCUS_03280 15589 16878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence018 936 64 gene locus_tag LOCUS_03290 936 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 1065 1457 gene locus_tag LOCUS_03300 1065 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 2470 1460 gene locus_tag LOCUS_03310 2470 1460 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 protein_id gnl|my_center|LOCUS_03310 2583 4484 gene locus_tag LOCUS_03320 gene fabY 2583 4484 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_03320 5852 4662 gene locus_tag LOCUS_03330 gene rlmI 5852 4662 CDS product ribosomal RNA large subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P89 protein_id gnl|my_center|LOCUS_03330 5949 6590 gene locus_tag LOCUS_03340 5949 6590 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405389.1 protein_id gnl|my_center|LOCUS_03340 6826 7836 gene locus_tag LOCUS_03350 gene nagR 6826 7836 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073351.1 protein_id gnl|my_center|LOCUS_03350 8423 9334 gene locus_tag LOCUS_03360 gene nagK 8423 9334 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073346.1 protein_id gnl|my_center|LOCUS_03360 9334 10458 gene locus_tag LOCUS_03370 gene nagA 9334 10458 CDS product N-acetylgalactosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBK8 protein_id gnl|my_center|LOCUS_03370 10525 11646 gene locus_tag LOCUS_03380 gene nagX 10525 11646 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_03380 11884 12678 gene locus_tag LOCUS_03390 gene gamA 11884 12678 CDS product putative glucosamine-6-phosphate deaminase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31458 protein_id gnl|my_center|LOCUS_03390 12803 13732 gene locus_tag LOCUS_03400 12803 13732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 13876 14061 gene locus_tag LOCUS_03410 13876 14061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03410 14182 15045 gene locus_tag LOCUS_03420 14182 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03420 15198 15392 gene locus_tag LOCUS_03430 15198 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 16680 15529 gene locus_tag LOCUS_03440 16680 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 16931 16683 gene locus_tag LOCUS_03450 16931 16683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence019 267 76 gene locus_tag LOCUS_03460 267 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 592 1770 gene locus_tag LOCUS_03470 592 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 3443 2640 gene locus_tag LOCUS_03480 3443 2640 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 protein_id gnl|my_center|LOCUS_03480 4559 3537 gene locus_tag LOCUS_03490 gene astA 4559 3537 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2G8 protein_id gnl|my_center|LOCUS_03490 5796 4591 gene locus_tag LOCUS_03500 gene argD 5796 4591 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN20 protein_id gnl|my_center|LOCUS_03500 5906 6376 gene locus_tag LOCUS_03510 5906 6376 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971277.1 protein_id gnl|my_center|LOCUS_03510 8289 6373 gene locus_tag LOCUS_03520 8289 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 8674 8997 gene locus_tag LOCUS_03530 8674 8997 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_03530 8984 10966 gene locus_tag LOCUS_03540 gene malQ 8984 10966 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU8 protein_id gnl|my_center|LOCUS_03540 10959 11159 gene locus_tag LOCUS_03550 10959 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 11343 13196 gene locus_tag LOCUS_03560 gene glgB 11343 13196 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45177 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03560 13199 15238 gene locus_tag LOCUS_03570 gene glgX 13199 15238 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU6 protein_id gnl|my_center|LOCUS_03570 >Feature sequence020 452 1492 gene locus_tag LOCUS_03580 gene tqsA 452 1492 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_03580 1896 1489 gene locus_tag LOCUS_03590 1896 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 3217 1889 gene locus_tag LOCUS_03600 3217 1889 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074242.1 protein_id gnl|my_center|LOCUS_03600 3888 3214 gene locus_tag LOCUS_03610 gene phoP 3888 3214 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_03610 4139 3891 gene locus_tag LOCUS_03620 4139 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 4518 4219 gene locus_tag LOCUS_03630 4518 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767703.1 protein_id gnl|my_center|LOCUS_03630 4698 6122 gene locus_tag LOCUS_03640 4698 6122 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403661.1 protein_id gnl|my_center|LOCUS_03640 6814 6164 gene locus_tag LOCUS_03650 6814 6164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 7479 6883 gene locus_tag LOCUS_03660 7479 6883 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNW8 protein_id gnl|my_center|LOCUS_03660 7605 7877 gene locus_tag LOCUS_03670 gene hupA 7605 7877 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV83 protein_id gnl|my_center|LOCUS_03670 8791 7991 gene locus_tag LOCUS_03680 gene trpA 8791 7991 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NE80 protein_id gnl|my_center|LOCUS_03680 9975 8791 gene locus_tag LOCUS_03690 gene trpB 9975 8791 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E623 protein_id gnl|my_center|LOCUS_03690 11350 9983 gene locus_tag LOCUS_03700 gene trpCF 11350 9983 CDS product tryptophan biosynthesis protein TrpCF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KST5 protein_id gnl|my_center|LOCUS_03700 12347 11343 gene locus_tag LOCUS_03710 gene trpD 12347 11343 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMC8 protein_id gnl|my_center|LOCUS_03710 12946 12356 gene locus_tag LOCUS_03720 12946 12356 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706724.1 protein_id gnl|my_center|LOCUS_03720 14517 12946 gene locus_tag LOCUS_03730 gene trpE 14517 12946 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KST2 protein_id gnl|my_center|LOCUS_03730 14965 15804 gene locus_tag LOCUS_03740 14965 15804 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285675.1 protein_id gnl|my_center|LOCUS_03740 15816 16436 gene locus_tag LOCUS_03750 gene yciO 15816 16436 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261668.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence021 740 432 gene locus_tag LOCUS_03760 740 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03760 1016 1354 gene locus_tag LOCUS_03770 1016 1354 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340730.1 protein_id gnl|my_center|LOCUS_03770 1366 2595 gene locus_tag LOCUS_03780 1366 2595 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 protein_id gnl|my_center|LOCUS_03780 3026 5188 gene locus_tag LOCUS_03790 gene mrcB 3026 5188 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNZ9 protein_id gnl|my_center|LOCUS_03790 6589 5309 gene locus_tag LOCUS_03800 gene hemL 6589 5309 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNY9 protein_id gnl|my_center|LOCUS_03800 7622 6606 gene locus_tag LOCUS_03810 gene pyrB 7622 6606 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 protein_id gnl|my_center|LOCUS_03810 9849 8173 gene locus_tag LOCUS_03820 9849 8173 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_03820 10031 10369 gene locus_tag LOCUS_03830 gene erpA 10031 10369 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LY4 protein_id gnl|my_center|LOCUS_03830 10890 11132 gene locus_tag LOCUS_03840 10890 11132 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 protein_id gnl|my_center|LOCUS_03840 12557 11181 gene locus_tag LOCUS_03850 12557 11181 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456555.1 protein_id gnl|my_center|LOCUS_03850 13148 12570 gene locus_tag LOCUS_03860 gene ppiA 13148 12570 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAT0 protein_id gnl|my_center|LOCUS_03860 13753 13202 gene locus_tag LOCUS_03870 13753 13202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 14910 13756 gene locus_tag LOCUS_03880 gene rlmG 14910 13756 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSE2 protein_id gnl|my_center|LOCUS_03880 14946 15533 gene locus_tag LOCUS_03890 14946 15533 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115462.1 protein_id gnl|my_center|LOCUS_03890 15774 16088 gene locus_tag LOCUS_03900 gene bolA 15774 16088 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence022 1819 941 gene locus_tag LOCUS_03910 gene hflC 1819 941 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGS4 protein_id gnl|my_center|LOCUS_03910 2988 1825 gene locus_tag LOCUS_03920 gene hflK 2988 1825 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704866.1 protein_id gnl|my_center|LOCUS_03920 4369 3083 gene locus_tag LOCUS_03930 gene hflX 4369 3083 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV10 protein_id gnl|my_center|LOCUS_03930 4658 4389 gene locus_tag LOCUS_03940 gene hfq 4658 4389 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2C8 protein_id gnl|my_center|LOCUS_03940 5653 4733 gene locus_tag LOCUS_03950 gene miaA 5653 4733 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGS0 protein_id gnl|my_center|LOCUS_03950 7497 5650 gene locus_tag LOCUS_03960 gene mutL 7497 5650 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV13 protein_id gnl|my_center|LOCUS_03960 8742 7504 gene locus_tag LOCUS_03970 gene amiB 8742 7504 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070931.1 protein_id gnl|my_center|LOCUS_03970 9307 8822 gene locus_tag LOCUS_03980 9307 8822 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 protein_id gnl|my_center|LOCUS_03980 10788 9310 gene locus_tag LOCUS_03990 gene nnr 10788 9310 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CM5 protein_id gnl|my_center|LOCUS_03990 10801 11934 gene locus_tag LOCUS_04000 gene queG 10801 11934 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV16 protein_id gnl|my_center|LOCUS_04000 12349 11939 gene locus_tag LOCUS_04010 12349 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 13066 12353 gene locus_tag LOCUS_04020 13066 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 15086 13137 gene locus_tag LOCUS_04030 15086 13137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 15660 15175 gene locus_tag LOCUS_04040 gene ywnH 15660 15175 CDS product putative phosphinothricin acetyltransferase YwnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71043 protein_id gnl|my_center|LOCUS_04040 >Feature sequence023 1445 261 gene locus_tag LOCUS_04050 1445 261 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706206.1 protein_id gnl|my_center|LOCUS_04050 2550 1468 gene locus_tag LOCUS_04060 2550 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 4170 2629 gene locus_tag LOCUS_04070 gene ilvA 4170 2629 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KB5 protein_id gnl|my_center|LOCUS_04070 6029 4173 gene locus_tag LOCUS_04080 gene ilvD 6029 4173 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTF8 protein_id gnl|my_center|LOCUS_04080 7074 6154 gene locus_tag LOCUS_04090 gene ilvE 7074 6154 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_04090 7370 7125 gene locus_tag LOCUS_04100 gene ilvM 7370 7125 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368897.1 protein_id gnl|my_center|LOCUS_04100 9016 7370 gene locus_tag LOCUS_04110 gene ilvG 9016 7370 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D7 protein_id gnl|my_center|LOCUS_04110 9524 10408 gene locus_tag LOCUS_04120 9524 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972447.1 protein_id gnl|my_center|LOCUS_04120 10536 11156 gene locus_tag LOCUS_04130 10536 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 11660 12544 gene locus_tag LOCUS_04140 gene dapA 11660 12544 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6K9 protein_id gnl|my_center|LOCUS_04140 12556 13296 gene locus_tag LOCUS_04150 gene dapD 12556 13296 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403729.1 protein_id gnl|my_center|LOCUS_04150 13296 14501 gene locus_tag LOCUS_04160 gene lysA 13296 14501 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_04160 14510 15622 gene locus_tag LOCUS_04170 gene dapA 14510 15622 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073716.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence024 440 240 gene locus_tag LOCUS_04180 440 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 665 498 gene locus_tag LOCUS_04190 665 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04190 1356 667 gene locus_tag LOCUS_04200 gene tolQ 1356 667 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072690.1 protein_id gnl|my_center|LOCUS_04200 2521 2180 gene locus_tag LOCUS_04210 2521 2180 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW4 protein_id gnl|my_center|LOCUS_04210 2759 3340 gene locus_tag LOCUS_04220 2759 3340 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQF3 protein_id gnl|my_center|LOCUS_04220 3533 5455 gene locus_tag LOCUS_04230 3533 5455 CDS product serine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097060.1 protein_id gnl|my_center|LOCUS_04230 5481 6767 gene locus_tag LOCUS_04240 5481 6767 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59352 protein_id gnl|my_center|LOCUS_04240 6784 8295 gene locus_tag LOCUS_04250 6784 8295 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706275.1 protein_id gnl|my_center|LOCUS_04250 9277 8306 gene locus_tag LOCUS_04260 9277 8306 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_04260 10285 9281 gene locus_tag LOCUS_04270 10285 9281 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705680.1 protein_id gnl|my_center|LOCUS_04270 10478 11077 gene locus_tag LOCUS_04280 gene tpx 10478 11077 CDS product 2-Cys peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073211.1 protein_id gnl|my_center|LOCUS_04280 11782 11138 gene locus_tag LOCUS_04290 gene adk 11782 11138 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF5 protein_id gnl|my_center|LOCUS_04290 13854 11941 gene locus_tag LOCUS_04300 gene htpG 13854 11941 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF7 protein_id gnl|my_center|LOCUS_04300 15041 13974 gene locus_tag LOCUS_04310 15041 13974 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462611.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence025 771 424 gene locus_tag LOCUS_04320 771 424 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457702.1 protein_id gnl|my_center|LOCUS_04320 1289 780 gene locus_tag LOCUS_04330 1289 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 1669 1289 gene locus_tag LOCUS_04340 1669 1289 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072256.1 protein_id gnl|my_center|LOCUS_04340 3905 1755 gene locus_tag LOCUS_04350 3905 1755 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGN7 protein_id gnl|my_center|LOCUS_04350 5104 3902 gene locus_tag LOCUS_04360 gene ackA 5104 3902 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED55 protein_id gnl|my_center|LOCUS_04360 5259 5711 gene locus_tag LOCUS_04370 5259 5711 CDS product UPF0208 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6L3 protein_id gnl|my_center|LOCUS_04370 6517 5708 gene locus_tag LOCUS_04380 gene rrmA 6517 5708 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010934.1 protein_id gnl|my_center|LOCUS_04380 7666 6851 gene locus_tag LOCUS_04390 7666 6851 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481860.1 protein_id gnl|my_center|LOCUS_04390 8044 8580 gene locus_tag LOCUS_04400 8044 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404923.1 protein_id gnl|my_center|LOCUS_04400 9498 8746 gene locus_tag LOCUS_04410 9498 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 9729 10916 gene locus_tag LOCUS_04420 9729 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 11140 10970 gene locus_tag LOCUS_04430 11140 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 13456 11282 gene locus_tag LOCUS_04440 13456 11282 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459357.1 protein_id gnl|my_center|LOCUS_04440 13738 14166 gene locus_tag LOCUS_04450 13738 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 15640 14222 gene locus_tag LOCUS_04460 gene agcS-2 15640 14222 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706925.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence026 2434 578 gene locus_tag LOCUS_04470 2434 578 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141343.1 protein_id gnl|my_center|LOCUS_04470 3748 2855 gene locus_tag LOCUS_04480 3748 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4580 4047 gene locus_tag LOCUS_04490 4580 4047 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198315.1 protein_id gnl|my_center|LOCUS_04490 5842 4586 gene locus_tag LOCUS_04500 gene prrB 5842 4586 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073863.1 protein_id gnl|my_center|LOCUS_04500 6481 6927 gene locus_tag LOCUS_04510 6481 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 8245 7160 gene locus_tag LOCUS_04520 8245 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_04520 9622 9014 gene locus_tag LOCUS_04530 9622 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 12345 10021 gene locus_tag LOCUS_04540 gene pvdQ 12345 10021 CDS product acyl-homoserine lactone acylase PvdQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I194 protein_id gnl|my_center|LOCUS_04540 13135 13515 gene locus_tag LOCUS_04550 13135 13515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 13689 14990 gene locus_tag LOCUS_04560 13689 14990 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706576.1 protein_id gnl|my_center|LOCUS_04560 >Feature sequence027 1259 528 gene locus_tag LOCUS_04570 gene trmJ 1259 528 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ30 protein_id gnl|my_center|LOCUS_04570 1509 2312 gene locus_tag LOCUS_04580 1509 2312 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705600.1 protein_id gnl|my_center|LOCUS_04580 3160 2345 gene locus_tag LOCUS_04590 3160 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_04590 5009 3222 gene locus_tag LOCUS_04600 5009 3222 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770458.1 protein_id gnl|my_center|LOCUS_04600 5202 5825 gene locus_tag LOCUS_04610 gene gmk 5202 5825 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJU6 protein_id gnl|my_center|LOCUS_04610 5925 6200 gene locus_tag LOCUS_04620 gene rpoZ 5925 6200 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KR23 protein_id gnl|my_center|LOCUS_04620 6378 8498 gene locus_tag LOCUS_04630 gene spoT 6378 8498 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070723.1 protein_id gnl|my_center|LOCUS_04630 8506 8898 gene locus_tag LOCUS_04640 8506 8898 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_04640 9270 11267 gene locus_tag LOCUS_04650 9270 11267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 11270 12754 gene locus_tag LOCUS_04660 11270 12754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 13525 13043 gene locus_tag LOCUS_04670 13525 13043 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHB9 protein_id gnl|my_center|LOCUS_04670 13695 14045 gene locus_tag LOCUS_04680 13695 14045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence028 328 3150 gene locus_tag LOCUS_04690 gene uvrA 328 3150 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LA0 protein_id gnl|my_center|LOCUS_04690 3288 4421 gene locus_tag LOCUS_04700 3288 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 4791 4402 gene locus_tag LOCUS_04710 4791 4402 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704482.1 protein_id gnl|my_center|LOCUS_04710 4821 5537 gene locus_tag LOCUS_04720 4821 5537 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072041.1 protein_id gnl|my_center|LOCUS_04720 5929 5558 gene locus_tag LOCUS_04730 5929 5558 CDS product UPF0231 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNX3 protein_id gnl|my_center|LOCUS_04730 6208 6029 gene locus_tag LOCUS_04740 6208 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 6207 6968 gene locus_tag LOCUS_04750 6207 6968 CDS product malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338408.1 protein_id gnl|my_center|LOCUS_04750 7190 6951 gene locus_tag LOCUS_04760 7190 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074051.1 protein_id gnl|my_center|LOCUS_04760 7483 8793 gene locus_tag LOCUS_04770 gene atoE 7483 8793 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071598.1 protein_id gnl|my_center|LOCUS_04770 9866 8853 gene locus_tag LOCUS_04780 9866 8853 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071117.1 protein_id gnl|my_center|LOCUS_04780 10006 11220 gene locus_tag LOCUS_04790 10006 11220 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706358.1 protein_id gnl|my_center|LOCUS_04790 12286 11210 gene locus_tag LOCUS_04800 12286 11210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence029 290 111 gene locus_tag LOCUS_04810 290 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 855 301 gene locus_tag LOCUS_04820 855 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1985 894 gene locus_tag LOCUS_04830 1985 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 2815 1991 gene locus_tag LOCUS_04840 2815 1991 CDS product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268327.1 protein_id gnl|my_center|LOCUS_04840 3113 2865 gene locus_tag LOCUS_04850 3113 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 3505 3110 gene locus_tag LOCUS_04860 3505 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3921 3502 gene locus_tag LOCUS_04870 3921 3502 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CS4 protein_id gnl|my_center|LOCUS_04870 4295 3933 gene locus_tag LOCUS_04880 4295 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 4542 4270 gene locus_tag LOCUS_04890 4542 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 5103 5990 gene locus_tag LOCUS_04900 5103 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_04900 6085 7758 gene locus_tag LOCUS_04910 gene ettA 6085 7758 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45127 protein_id gnl|my_center|LOCUS_04910 7841 8233 gene locus_tag LOCUS_04920 7841 8233 CDS product cyclic diguanosine monophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD5 protein_id gnl|my_center|LOCUS_04920 8578 9492 gene locus_tag LOCUS_04930 8578 9492 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE2 protein_id gnl|my_center|LOCUS_04930 9493 10005 gene locus_tag LOCUS_04940 9493 10005 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L33 protein_id gnl|my_center|LOCUS_04940 10584 10063 gene locus_tag LOCUS_04950 10584 10063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 11489 10599 gene locus_tag LOCUS_04960 11489 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073675.1 protein_id gnl|my_center|LOCUS_04960 11828 11499 gene locus_tag LOCUS_04970 11828 11499 CDS product UPF0263 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQ46 protein_id gnl|my_center|LOCUS_04970 11905 12762 gene locus_tag LOCUS_04980 11905 12762 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070911.1 protein_id gnl|my_center|LOCUS_04980 12772 13149 gene locus_tag LOCUS_04990 12772 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 13532 13861 gene locus_tag LOCUS_05000 13532 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05000 >Feature sequence030 443 1654 gene locus_tag LOCUS_05010 443 1654 CDS product phage integrase family site specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_819027.1 protein_id gnl|my_center|LOCUS_05010 1913 3607 gene locus_tag LOCUS_05020 gene dld 1913 3607 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CH75 protein_id gnl|my_center|LOCUS_05020 5170 3614 gene locus_tag LOCUS_05030 5170 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05030 6655 5180 gene locus_tag LOCUS_05040 6655 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05040 6782 6985 gene locus_tag LOCUS_05050 6782 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 7495 7016 gene locus_tag LOCUS_05060 7495 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05060 9394 7511 gene locus_tag LOCUS_05070 gene ppsA 9394 7511 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDU9 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05070 9534 10343 gene locus_tag LOCUS_05080 9534 10343 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDU8 protein_id gnl|my_center|LOCUS_05080 10837 10370 gene locus_tag LOCUS_05090 10837 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05090 11719 10850 gene locus_tag LOCUS_05100 11719 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05100 12133 12393 gene locus_tag LOCUS_05110 12133 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05110 12505 13698 gene locus_tag LOCUS_05120 12505 13698 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05120 >Feature sequence031 170 95 gene locus_tag LOCUS_t00040 170 95 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 282 207 gene locus_tag LOCUS_t00050 282 207 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 885 960 gene locus_tag LOCUS_t00060 885 960 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1069 2700 gene locus_tag LOCUS_05130 1069 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3154 2714 gene locus_tag LOCUS_05140 3154 2714 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_05140 3645 3169 gene locus_tag LOCUS_05150 3645 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 5714 3696 gene locus_tag LOCUS_05160 gene ligA 5714 3696 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RJ4 protein_id gnl|my_center|LOCUS_05160 6467 5811 gene locus_tag LOCUS_05170 6467 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 9875 6486 gene locus_tag LOCUS_05180 gene smc 9875 6486 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ7 protein_id gnl|my_center|LOCUS_05180 10663 9932 gene locus_tag LOCUS_05190 10663 9932 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_05190 10807 11184 gene locus_tag LOCUS_05200 10807 11184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 11321 12052 gene locus_tag LOCUS_05210 gene cysZ 11321 12052 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED68 protein_id gnl|my_center|LOCUS_05210 13429 12110 gene locus_tag LOCUS_05220 13429 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence032 1084 116 gene locus_tag LOCUS_05230 1084 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05230 1348 1273 gene locus_tag LOCUS_t00070 1348 1273 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1476 1874 gene locus_tag LOCUS_05240 1476 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 1867 2382 gene locus_tag LOCUS_05250 1867 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3744 4286 gene locus_tag LOCUS_05260 gene yaiL 3744 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096718.1 protein_id gnl|my_center|LOCUS_05260 4454 5221 gene locus_tag LOCUS_05270 4454 5221 CDS product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYH5 protein_id gnl|my_center|LOCUS_05270 5230 6405 gene locus_tag LOCUS_05280 5230 6405 CDS product MR-MLE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236009.1 protein_id gnl|my_center|LOCUS_05280 8125 6497 gene locus_tag LOCUS_05290 8125 6497 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106074.1 protein_id gnl|my_center|LOCUS_05290 8960 8259 gene locus_tag LOCUS_05300 gene rsuA 8960 8259 CDS product ribosomal small subunit pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGM2 protein_id gnl|my_center|LOCUS_05300 9347 9018 gene locus_tag LOCUS_05310 9347 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 9450 9884 gene locus_tag LOCUS_05320 gene creA 9450 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072222.1 protein_id gnl|my_center|LOCUS_05320 9887 10678 gene locus_tag LOCUS_05330 9887 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 10662 11288 gene locus_tag LOCUS_05340 10662 11288 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406892.1 protein_id gnl|my_center|LOCUS_05340 11291 11791 gene locus_tag LOCUS_05350 11291 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 11811 13370 gene locus_tag LOCUS_05360 11811 13370 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037766.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence033 1956 2348 gene locus_tag LOCUS_05370 1956 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 3674 2382 gene locus_tag LOCUS_05380 3674 2382 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87R73 protein_id gnl|my_center|LOCUS_05380 3907 4731 gene locus_tag LOCUS_05390 3907 4731 CDS product glycoside hydrolase family 73 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 protein_id gnl|my_center|LOCUS_05390 5081 5926 gene locus_tag LOCUS_05400 5081 5926 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106287.1 protein_id gnl|my_center|LOCUS_05400 5985 6752 gene locus_tag LOCUS_05410 5985 6752 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704586.1 protein_id gnl|my_center|LOCUS_05410 6749 7066 gene locus_tag LOCUS_05420 6749 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 9011 7350 gene locus_tag LOCUS_05430 gene asnB 9011 7350 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 protein_id gnl|my_center|LOCUS_05430 9871 9212 gene locus_tag LOCUS_05440 gene pcp 9871 9212 CDS product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JR34 protein_id gnl|my_center|LOCUS_05440 10886 9864 gene locus_tag LOCUS_05450 10886 9864 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096574.1 protein_id gnl|my_center|LOCUS_05450 11611 10883 gene locus_tag LOCUS_05460 11611 10883 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096573.1 protein_id gnl|my_center|LOCUS_05460 12549 11623 gene locus_tag LOCUS_05470 12549 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816816.1 protein_id gnl|my_center|LOCUS_05470 13199 12543 gene locus_tag LOCUS_05480 13199 12543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097549.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence034 2251 1172 gene locus_tag LOCUS_05490 2251 1172 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_05490 2414 2797 gene locus_tag LOCUS_05500 2414 2797 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537728.1 protein_id gnl|my_center|LOCUS_05500 4033 2864 gene locus_tag LOCUS_05510 4033 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05510 4786 4106 gene locus_tag LOCUS_05520 4786 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05520 4920 6392 gene locus_tag LOCUS_05530 4920 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 6512 7633 gene locus_tag LOCUS_05540 6512 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 8367 7720 gene locus_tag LOCUS_05550 8367 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 8860 8372 gene locus_tag LOCUS_05560 8860 8372 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203275.1 protein_id gnl|my_center|LOCUS_05560 9308 10270 gene locus_tag LOCUS_05570 9308 10270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 10267 13005 gene locus_tag LOCUS_05580 10267 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence035 704 952 gene locus_tag LOCUS_05590 704 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303367.1 protein_id gnl|my_center|LOCUS_05590 2459 1023 gene locus_tag LOCUS_05600 2459 1023 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704939.1 protein_id gnl|my_center|LOCUS_05600 3976 2495 gene locus_tag LOCUS_05610 3976 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 4690 3983 gene locus_tag LOCUS_05620 4690 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 6810 4687 gene locus_tag LOCUS_05630 6810 4687 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483457.1 protein_id gnl|my_center|LOCUS_05630 7660 6803 gene locus_tag LOCUS_05640 gene sypB 7660 6803 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263830.1 protein_id gnl|my_center|LOCUS_05640 8003 7689 gene locus_tag LOCUS_05650 8003 7689 CDS product anti-anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454817.1 protein_id gnl|my_center|LOCUS_05650 8641 8189 gene locus_tag LOCUS_05660 8641 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05660 10000 8675 gene locus_tag LOCUS_05670 gene sypQ 10000 8675 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263845.1 protein_id gnl|my_center|LOCUS_05670 11085 10009 gene locus_tag LOCUS_05680 11085 10009 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105843.1 protein_id gnl|my_center|LOCUS_05680 12571 11078 gene locus_tag LOCUS_05690 gene sypO 12571 11078 CDS product chain-length determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263843.1 protein_id gnl|my_center|LOCUS_05690 <13297 12741 gene locus_tag LOCUS_05700 <13297 12741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483463.1:glycosyl transferase >Feature sequence036 <1 857 gene locus_tag LOCUS_05710 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KP62:UDP-N-acetylglucosamine 1-carboxyvinyltransferase 2028 925 gene locus_tag LOCUS_05720 2028 925 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911599.1 protein_id gnl|my_center|LOCUS_05720 3496 2144 gene locus_tag LOCUS_05730 3496 2144 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457169.1 protein_id gnl|my_center|LOCUS_05730 4092 3637 gene locus_tag LOCUS_05740 gene yhcB 4092 3637 CDS product cytochrome D ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262645.1 protein_id gnl|my_center|LOCUS_05740 4246 5334 gene locus_tag LOCUS_05750 gene yhcM 4246 5334 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2M8 protein_id gnl|my_center|LOCUS_05750 5580 6008 gene locus_tag LOCUS_05760 gene rplM 5580 6008 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUF1 protein_id gnl|my_center|LOCUS_05760 6020 6409 gene locus_tag LOCUS_05770 gene rpsI 6020 6409 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPA4 protein_id gnl|my_center|LOCUS_05770 6836 7426 gene locus_tag LOCUS_05780 gene petA 6836 7426 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPZ1 protein_id gnl|my_center|LOCUS_05780 7423 8721 gene locus_tag LOCUS_05790 7423 8721 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SI1 protein_id gnl|my_center|LOCUS_05790 8718 9455 gene locus_tag LOCUS_05800 8718 9455 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758871.1 protein_id gnl|my_center|LOCUS_05800 9556 9756 gene locus_tag LOCUS_05810 9556 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05810 9781 10182 gene locus_tag LOCUS_05820 9781 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05820 10182 10607 gene locus_tag LOCUS_05830 gene sspB 10182 10607 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707593.1 protein_id gnl|my_center|LOCUS_05830 11349 10780 gene locus_tag LOCUS_05840 11349 10780 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707592.1 protein_id gnl|my_center|LOCUS_05840 11933 11346 gene locus_tag LOCUS_05850 gene diaA 11933 11346 CDS product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NKL8 protein_id gnl|my_center|LOCUS_05850 12301 11936 gene locus_tag LOCUS_05860 12301 11936 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZR89 protein_id gnl|my_center|LOCUS_05860 <13285 12347 gene locus_tag LOCUS_05870 <13285 12347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_230232.2:lipoprotein >Feature sequence037 935 231 gene locus_tag LOCUS_05880 935 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05880 1396 932 gene locus_tag LOCUS_05890 1396 932 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457737.1 protein_id gnl|my_center|LOCUS_05890 1964 1530 gene locus_tag LOCUS_05900 1964 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05900 3913 1961 gene locus_tag LOCUS_05910 gene ccmF 3913 1961 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420290.1 protein_id gnl|my_center|LOCUS_05910 4394 3915 gene locus_tag LOCUS_05920 gene ccmE 4394 3915 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI35 protein_id gnl|my_center|LOCUS_05920 4594 4397 gene locus_tag LOCUS_05930 gene ccmD 4594 4397 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3T0 protein_id gnl|my_center|LOCUS_05930 5334 4597 gene locus_tag LOCUS_05940 gene ccmC 5334 4597 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705299.1 protein_id gnl|my_center|LOCUS_05940 6021 5335 gene locus_tag LOCUS_05950 gene ccmB 6021 5335 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK41 protein_id gnl|my_center|LOCUS_05950 6641 6021 gene locus_tag LOCUS_05960 gene ccmA 6641 6021 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3S7 protein_id gnl|my_center|LOCUS_05960 6724 8790 gene locus_tag LOCUS_05970 6724 8790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 8938 9303 gene locus_tag LOCUS_05980 8938 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 9312 9608 gene locus_tag LOCUS_05990 9312 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073086.1 protein_id gnl|my_center|LOCUS_05990 10074 9649 gene locus_tag LOCUS_06000 10074 9649 CDS product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073087.1 protein_id gnl|my_center|LOCUS_06000 10572 10075 gene locus_tag LOCUS_06010 10572 10075 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438733.1 protein_id gnl|my_center|LOCUS_06010 11373 10597 gene locus_tag LOCUS_06020 11373 10597 CDS product chemotaxis protein W inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705295.1 protein_id gnl|my_center|LOCUS_06020 12151 11381 gene locus_tag LOCUS_06030 12151 11381 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073090.1 protein_id gnl|my_center|LOCUS_06030 <13167 12186 gene locus_tag LOCUS_06040 <13167 12186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ECD7:chemotaxis response regulator protein-glutamate methylesterase of group 1 operon >Feature sequence038 364 176 gene locus_tag LOCUS_06050 364 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 420 1037 gene locus_tag LOCUS_06060 gene lexA 420 1037 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVP9 protein_id gnl|my_center|LOCUS_06060 1272 2411 gene locus_tag LOCUS_06070 1272 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2415 3995 gene locus_tag LOCUS_06080 gene coxA 2415 3995 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q4 protein_id gnl|my_center|LOCUS_06080 3997 4548 gene locus_tag LOCUS_06090 3997 4548 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083725.1 protein_id gnl|my_center|LOCUS_06090 4557 5426 gene locus_tag LOCUS_06100 gene coxC 4557 5426 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 protein_id gnl|my_center|LOCUS_06100 5447 6172 gene locus_tag LOCUS_06110 5447 6172 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYG3 protein_id gnl|my_center|LOCUS_06110 6162 6650 gene locus_tag LOCUS_06120 6162 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 6659 7660 gene locus_tag LOCUS_06130 6659 7660 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462008.1 protein_id gnl|my_center|LOCUS_06130 7657 8556 gene locus_tag LOCUS_06140 gene cyoE1 7657 8556 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87IR2 protein_id gnl|my_center|LOCUS_06140 8610 9146 gene locus_tag LOCUS_06150 8610 9146 CDS product photosynthetic protein synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704204.1 protein_id gnl|my_center|LOCUS_06150 9301 9567 gene locus_tag LOCUS_06160 9301 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 9582 9944 gene locus_tag LOCUS_06170 gene cheY 9582 9944 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_06170 9959 12067 gene locus_tag LOCUS_06180 9959 12067 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_06180 12068 12553 gene locus_tag LOCUS_06190 12068 12553 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence039 <1 1548 gene locus_tag LOCUS_06200 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:GGDEF domain-containing protein 2870 1977 gene locus_tag LOCUS_06210 2870 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3463 2870 gene locus_tag LOCUS_06220 3463 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3989 3453 gene locus_tag LOCUS_06230 3989 3453 CDS product sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_06230 4983 4072 gene locus_tag LOCUS_06240 gene oxyR 4983 4072 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071537.1 protein_id gnl|my_center|LOCUS_06240 6409 5141 gene locus_tag LOCUS_06250 6409 5141 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAX0 protein_id gnl|my_center|LOCUS_06250 7122 6445 gene locus_tag LOCUS_06260 7122 6445 CDS product phosphate transport regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707482.1 protein_id gnl|my_center|LOCUS_06260 7964 7263 gene locus_tag LOCUS_06270 gene phoU 7964 7263 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG81 protein_id gnl|my_center|LOCUS_06270 8815 7991 gene locus_tag LOCUS_06280 gene pstB 8815 7991 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM15 protein_id gnl|my_center|LOCUS_06280 10496 8847 gene locus_tag LOCUS_06290 10496 8847 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM16 protein_id gnl|my_center|LOCUS_06290 12752 10515 gene locus_tag LOCUS_06300 gene pstC 12752 10515 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706617.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence040 1234 500 gene locus_tag LOCUS_06310 gene pdxJ 1234 500 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH78 protein_id gnl|my_center|LOCUS_06310 1652 1239 gene locus_tag LOCUS_06320 1652 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06320 2465 1929 gene locus_tag LOCUS_06330 2465 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06330 2828 2499 gene locus_tag LOCUS_06340 2828 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06340 3495 2818 gene locus_tag LOCUS_06350 gene rnc 3495 2818 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPB0 protein_id gnl|my_center|LOCUS_06350 4429 3497 gene locus_tag LOCUS_06360 gene lepB 4429 3497 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGF1 protein_id gnl|my_center|LOCUS_06360 6229 4442 gene locus_tag LOCUS_06370 gene lepA 6229 4442 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XVZ3 protein_id gnl|my_center|LOCUS_06370 6749 6300 gene locus_tag LOCUS_06380 6749 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 7696 6746 gene locus_tag LOCUS_06390 gene rseB 7696 6746 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734779.1 protein_id gnl|my_center|LOCUS_06390 8304 7693 gene locus_tag LOCUS_06400 8304 7693 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPA7 protein_id gnl|my_center|LOCUS_06400 8888 8307 gene locus_tag LOCUS_06410 gene rpoE 8888 8307 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_06410 9126 10718 gene locus_tag LOCUS_06420 gene nadB 9126 10718 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH88 protein_id gnl|my_center|LOCUS_06420 11347 11147 gene locus_tag LOCUS_06430 11347 11147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH90 protein_id gnl|my_center|LOCUS_06430 <12742 11502 gene locus_tag LOCUS_06440 <12742 11502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase >Feature sequence041 1219 218 gene locus_tag LOCUS_06450 1219 218 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707808.1 protein_id gnl|my_center|LOCUS_06450 1446 2231 gene locus_tag LOCUS_06460 gene fliC 1446 2231 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CK20 protein_id gnl|my_center|LOCUS_06460 2387 3826 gene locus_tag LOCUS_06470 gene flrA 2387 3826 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073116.1 protein_id gnl|my_center|LOCUS_06470 4131 4661 gene locus_tag LOCUS_06480 4131 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 4726 5238 gene locus_tag LOCUS_06490 4726 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 5250 5639 gene locus_tag LOCUS_06500 5250 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 6394 5822 gene locus_tag LOCUS_06510 gene tag 6394 5822 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_06510 6598 7734 gene locus_tag LOCUS_06520 gene flrB 6598 7734 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262362.1 protein_id gnl|my_center|LOCUS_06520 7731 9137 gene locus_tag LOCUS_06530 gene flrC 7731 9137 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262361.1 protein_id gnl|my_center|LOCUS_06530 9291 9629 gene locus_tag LOCUS_06540 gene fliE 9291 9629 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB4 protein_id gnl|my_center|LOCUS_06540 9651 11354 gene locus_tag LOCUS_06550 gene fliF 9651 11354 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI03 protein_id gnl|my_center|LOCUS_06550 11347 12390 gene locus_tag LOCUS_06560 gene fliG 11347 12390 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB6 protein_id gnl|my_center|LOCUS_06560 >Feature sequence042 416 1996 gene locus_tag LOCUS_06570 416 1996 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245617.1 protein_id gnl|my_center|LOCUS_06570 2791 2054 gene locus_tag LOCUS_06580 2791 2054 CDS product DUF4386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022315.1 protein_id gnl|my_center|LOCUS_06580 3538 4635 gene locus_tag LOCUS_06590 3538 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 6715 5144 gene locus_tag LOCUS_06600 6715 5144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479209.1 protein_id gnl|my_center|LOCUS_06600 7530 7102 gene locus_tag LOCUS_06610 7530 7102 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 protein_id gnl|my_center|LOCUS_06610 7656 8546 gene locus_tag LOCUS_06620 7656 8546 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070732.1 protein_id gnl|my_center|LOCUS_06620 10246 8618 gene locus_tag LOCUS_06630 10246 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 10597 10271 gene locus_tag LOCUS_06640 10597 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 10730 11839 gene locus_tag LOCUS_06650 10730 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 <12652 11981 gene locus_tag LOCUS_06660 <12652 11981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121449.1:lipase >Feature sequence043 768 2135 gene locus_tag LOCUS_06670 768 2135 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 protein_id gnl|my_center|LOCUS_06670 2151 2807 gene locus_tag LOCUS_06680 2151 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 3118 4635 gene locus_tag LOCUS_06690 3118 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5535 4621 gene locus_tag LOCUS_06700 5535 4621 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704360.1 protein_id gnl|my_center|LOCUS_06700 5748 7805 gene locus_tag LOCUS_06710 5748 7805 CDS product NirV precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263653.1 protein_id gnl|my_center|LOCUS_06710 7873 8916 gene locus_tag LOCUS_06720 gene mreB 7873 8916 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308111.1 protein_id gnl|my_center|LOCUS_06720 8916 9752 gene locus_tag LOCUS_06730 gene mreC 8916 9752 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFA8 protein_id gnl|my_center|LOCUS_06730 9966 9763 gene locus_tag LOCUS_06740 9966 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 10228 10803 gene locus_tag LOCUS_06750 10228 10803 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7X6 protein_id gnl|my_center|LOCUS_06750 10796 12268 gene locus_tag LOCUS_06760 10796 12268 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704378.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence044 3769 1646 gene locus_tag LOCUS_06770 3769 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 3929 4630 gene locus_tag LOCUS_06780 3929 4630 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142663.1 protein_id gnl|my_center|LOCUS_06780 4630 6378 gene locus_tag LOCUS_06790 4630 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 6596 7843 gene locus_tag LOCUS_06800 6596 7843 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459985.1 protein_id gnl|my_center|LOCUS_06800 9227 7911 gene locus_tag LOCUS_06810 9227 7911 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706632.1 protein_id gnl|my_center|LOCUS_06810 11484 9397 gene locus_tag LOCUS_06820 gene ppk 11484 9397 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM32 protein_id gnl|my_center|LOCUS_06820 12092 11586 gene locus_tag LOCUS_06830 12092 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence045 829 572 gene locus_tag LOCUS_06840 829 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306001.1 protein_id gnl|my_center|LOCUS_06840 1131 835 gene locus_tag LOCUS_06850 1131 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1795 1121 gene locus_tag LOCUS_06860 gene mlaC 1795 1121 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073690.1 protein_id gnl|my_center|LOCUS_06860 2342 1797 gene locus_tag LOCUS_06870 gene mlaD 2342 1797 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073691.1 protein_id gnl|my_center|LOCUS_06870 3134 2358 gene locus_tag LOCUS_06880 3134 2358 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455118.1 protein_id gnl|my_center|LOCUS_06880 3940 3134 gene locus_tag LOCUS_06890 gene yrbF 3940 3134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261187.1 protein_id gnl|my_center|LOCUS_06890 4160 5119 gene locus_tag LOCUS_06900 4160 5119 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864071.1 protein_id gnl|my_center|LOCUS_06900 5134 6105 gene locus_tag LOCUS_06910 gene kdsD 5134 6105 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ16 protein_id gnl|my_center|LOCUS_06910 6105 6656 gene locus_tag LOCUS_06920 6105 6656 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174251.1 protein_id gnl|my_center|LOCUS_06920 6653 7207 gene locus_tag LOCUS_06930 6653 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7197 7718 gene locus_tag LOCUS_06940 7197 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 7724 8449 gene locus_tag LOCUS_06950 7724 8449 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_06950 8497 10017 gene locus_tag LOCUS_06960 gene rpoN 8497 10017 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ11 protein_id gnl|my_center|LOCUS_06960 10040 10333 gene locus_tag LOCUS_06970 gene yfiA-2 10040 10333 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_06970 10336 10788 gene locus_tag LOCUS_06980 gene ptsN 10336 10788 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261179.1 protein_id gnl|my_center|LOCUS_06980 10809 11657 gene locus_tag LOCUS_06990 10809 11657 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ08 protein_id gnl|my_center|LOCUS_06990 11667 11942 gene locus_tag LOCUS_07000 gene ptsO 11667 11942 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence046 715 374 gene locus_tag LOCUS_07010 715 374 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261605.1 protein_id gnl|my_center|LOCUS_07010 904 3537 gene locus_tag LOCUS_07020 gene ppc 904 3537 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFU8 protein_id gnl|my_center|LOCUS_07020 3776 4147 gene locus_tag LOCUS_07030 3776 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4190 5050 gene locus_tag LOCUS_07040 gene cdd 4190 5050 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4R6 protein_id gnl|my_center|LOCUS_07040 5843 5085 gene locus_tag LOCUS_07050 gene udp 5843 5085 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43770 protein_id gnl|my_center|LOCUS_07050 6346 7458 gene locus_tag LOCUS_07060 gene speB 6346 7458 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727391.1 protein_id gnl|my_center|LOCUS_07060 7514 8209 gene locus_tag LOCUS_07070 7514 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 8452 8213 gene locus_tag LOCUS_07080 8452 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_07080 8772 8467 gene locus_tag LOCUS_07090 8772 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 8864 9094 gene locus_tag LOCUS_07100 8864 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 9738 9112 gene locus_tag LOCUS_07110 gene hmgA 9738 9112 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207986.1 protein_id gnl|my_center|LOCUS_07110 11101 9806 gene locus_tag LOCUS_07120 gene hmgA 11101 9806 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDA2 protein_id gnl|my_center|LOCUS_07120 11232 11651 gene locus_tag LOCUS_07130 11232 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 <12373 11700 gene locus_tag LOCUS_07140 <12373 11700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037631.1:Oar protein >Feature sequence047 <1 573 gene locus_tag LOCUS_07150 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072544.1:RND transporter 774 1061 gene locus_tag LOCUS_07160 774 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07160 1077 5612 gene locus_tag LOCUS_07170 gene gdh 1077 5612 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072543.1 protein_id gnl|my_center|LOCUS_07170 5691 6701 gene locus_tag LOCUS_07180 gene pyrD 5691 6701 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5B6 protein_id gnl|my_center|LOCUS_07180 6823 7350 gene locus_tag LOCUS_07190 gene zapC 6823 7350 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKK8 protein_id gnl|my_center|LOCUS_07190 7418 9529 gene locus_tag LOCUS_07200 gene rlmL 7418 9529 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87PC0 protein_id gnl|my_center|LOCUS_07200 9522 9749 gene locus_tag LOCUS_07210 9522 9749 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071966.1 protein_id gnl|my_center|LOCUS_07210 9751 11661 gene locus_tag LOCUS_07220 9751 11661 CDS product ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490212.1 protein_id gnl|my_center|LOCUS_07220 11673 12290 gene locus_tag LOCUS_07230 11673 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence048 909 121 gene locus_tag LOCUS_07240 909 121 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106646.1 protein_id gnl|my_center|LOCUS_07240 2036 897 gene locus_tag LOCUS_07250 2036 897 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704723.1 protein_id gnl|my_center|LOCUS_07250 3274 2207 gene locus_tag LOCUS_07260 gene hemE 3274 2207 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD0 protein_id gnl|my_center|LOCUS_07260 3729 4199 gene locus_tag LOCUS_07270 gene rsd 3729 4199 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_07270 5020 4262 gene locus_tag LOCUS_07280 gene fklB 5020 4262 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHY9 protein_id gnl|my_center|LOCUS_07280 5258 6247 gene locus_tag LOCUS_07290 5258 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704937.1 protein_id gnl|my_center|LOCUS_07290 6244 6456 gene locus_tag LOCUS_07300 6244 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230006.2 protein_id gnl|my_center|LOCUS_07300 6679 6479 gene locus_tag LOCUS_07310 6679 6479 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704934.1 protein_id gnl|my_center|LOCUS_07310 6866 8782 gene locus_tag LOCUS_07320 6866 8782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707314.1 protein_id gnl|my_center|LOCUS_07320 8782 9228 gene locus_tag LOCUS_07330 8782 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 9363 10340 gene locus_tag LOCUS_07340 9363 10340 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947351.1 protein_id gnl|my_center|LOCUS_07340 10341 10604 gene locus_tag LOCUS_07350 10341 10604 CDS product UPF0270 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKJ5 protein_id gnl|my_center|LOCUS_07350 10721 11917 gene locus_tag LOCUS_07360 10721 11917 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence049 487 143 gene locus_tag LOCUS_07370 487 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 742 1446 gene locus_tag LOCUS_07380 742 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_07380 1457 2173 gene locus_tag LOCUS_07390 1457 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_07390 2269 2991 gene locus_tag LOCUS_07400 2269 2991 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704857.1 protein_id gnl|my_center|LOCUS_07400 3000 4472 gene locus_tag LOCUS_07410 3000 4472 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704858.1 protein_id gnl|my_center|LOCUS_07410 5491 4481 gene locus_tag LOCUS_07420 5491 4481 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 protein_id gnl|my_center|LOCUS_07420 6324 5491 gene locus_tag LOCUS_07430 6324 5491 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104455.1 protein_id gnl|my_center|LOCUS_07430 6736 9522 gene locus_tag LOCUS_07440 6736 9522 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_07440 9527 10852 gene locus_tag LOCUS_07450 9527 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence050 <1 710 gene locus_tag LOCUS_07460 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EF99:phenylalanine--tRNA ligase beta subunit 713 1012 gene locus_tag LOCUS_07470 gene ihfA 713 1012 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMM4 protein_id gnl|my_center|LOCUS_07470 1994 1125 gene locus_tag LOCUS_07480 1994 1125 CDS product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495957.1 protein_id gnl|my_center|LOCUS_07480 3005 2118 gene locus_tag LOCUS_07490 3005 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4099 3131 gene locus_tag LOCUS_07500 gene cysK 4099 3131 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMN9 protein_id gnl|my_center|LOCUS_07500 6579 4240 gene locus_tag LOCUS_07510 6579 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_07510 6784 7932 gene locus_tag LOCUS_07520 6784 7932 CDS product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706715.1 protein_id gnl|my_center|LOCUS_07520 8114 8764 gene locus_tag LOCUS_07530 8114 8764 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005386783.1 protein_id gnl|my_center|LOCUS_07530 8773 10596 gene locus_tag LOCUS_07540 gene uvrC 8773 10596 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFV4 protein_id gnl|my_center|LOCUS_07540 10638 11183 gene locus_tag LOCUS_07550 gene pgsA 10638 11183 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706577.1 protein_id gnl|my_center|LOCUS_07550 11349 11424 gene locus_tag LOCUS_t00080 11349 11424 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11436 11509 gene locus_tag LOCUS_t00090 11436 11509 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 11544 11630 gene locus_tag LOCUS_t00100 11544 11630 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence051 2053 989 gene locus_tag LOCUS_07560 gene murG 2053 989 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX2 protein_id gnl|my_center|LOCUS_07560 3225 2050 gene locus_tag LOCUS_07570 gene ftsW 3225 2050 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P7 protein_id gnl|my_center|LOCUS_07570 4547 3222 gene locus_tag LOCUS_07580 gene murD 4547 3222 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P6 protein_id gnl|my_center|LOCUS_07580 5630 4548 gene locus_tag LOCUS_07590 gene mraY 5630 4548 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P5 protein_id gnl|my_center|LOCUS_07590 7024 5624 gene locus_tag LOCUS_07600 gene murF 7024 5624 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPG3 protein_id gnl|my_center|LOCUS_07600 8505 7021 gene locus_tag LOCUS_07610 gene murE 8505 7021 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X9Z2 protein_id gnl|my_center|LOCUS_07610 10312 8495 gene locus_tag LOCUS_07620 gene ftsI 10312 8495 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073906.1 protein_id gnl|my_center|LOCUS_07620 10632 10309 gene locus_tag LOCUS_07630 10632 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 <11544 10632 gene locus_tag LOCUS_07640 <11544 10632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8E9P0:ribosomal RNA small subunit methyltransferase H >Feature sequence052 286 642 gene locus_tag LOCUS_07650 286 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 723 1319 gene locus_tag LOCUS_07660 723 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 1436 2434 gene locus_tag LOCUS_07670 1436 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2440 5547 gene locus_tag LOCUS_07680 2440 5547 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108104.1 protein_id gnl|my_center|LOCUS_07680 5612 5986 gene locus_tag LOCUS_07690 5612 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 6103 6681 gene locus_tag LOCUS_07700 6103 6681 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_07700 7053 6721 gene locus_tag LOCUS_07710 gene phnA 7053 6721 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261944.1 protein_id gnl|my_center|LOCUS_07710 7700 7212 gene locus_tag LOCUS_07720 gene brf1 7700 7212 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV0 protein_id gnl|my_center|LOCUS_07720 8174 7704 gene locus_tag LOCUS_07730 gene brf2 8174 7704 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV1 protein_id gnl|my_center|LOCUS_07730 10011 8413 gene locus_tag LOCUS_07740 10011 8413 CDS product regulatory protein LuxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155015.1 protein_id gnl|my_center|LOCUS_07740 10427 11254 gene locus_tag LOCUS_07750 10427 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 11258 11461 gene locus_tag LOCUS_07760 11258 11461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence053 1000 2724 gene locus_tag LOCUS_07770 gene ilvB-1 1000 2724 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGN4 protein_id gnl|my_center|LOCUS_07770 2724 3221 gene locus_tag LOCUS_07780 gene ilvH 2724 3221 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459526.1 protein_id gnl|my_center|LOCUS_07780 3547 3272 gene locus_tag LOCUS_07790 gene hupB 3547 3272 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1R9 protein_id gnl|my_center|LOCUS_07790 4004 3702 gene locus_tag LOCUS_07800 gene atl1 4004 3702 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207466.1 protein_id gnl|my_center|LOCUS_07800 4914 4075 gene locus_tag LOCUS_07810 gene rluF 4914 4075 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4I3 protein_id gnl|my_center|LOCUS_07810 6048 4972 gene locus_tag LOCUS_07820 6048 4972 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970638.1 protein_id gnl|my_center|LOCUS_07820 7284 6067 gene locus_tag LOCUS_07830 7284 6067 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459079.1 protein_id gnl|my_center|LOCUS_07830 9005 7473 gene locus_tag LOCUS_07840 gene glgA 9005 7473 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071682.1 protein_id gnl|my_center|LOCUS_07840 10320 9016 gene locus_tag LOCUS_07850 gene glgC 10320 9016 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_07850 <11355 10313 gene locus_tag LOCUS_07860 <11355 10313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EGU5:alpha-1,4 glucan phosphorylase >Feature sequence054 <1 780 gene locus_tag LOCUS_07870 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001080345.1:membrane protein 1966 1529 gene locus_tag LOCUS_07880 1966 1529 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482841.1 protein_id gnl|my_center|LOCUS_07880 2066 2653 gene locus_tag LOCUS_07890 2066 2653 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246986.1 protein_id gnl|my_center|LOCUS_07890 3501 3307 gene locus_tag LOCUS_07900 3501 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 4914 3577 gene locus_tag LOCUS_07910 gene astB 4914 3577 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDN7 protein_id gnl|my_center|LOCUS_07910 5896 7671 gene locus_tag LOCUS_07920 5896 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 7778 8731 gene locus_tag LOCUS_07930 7778 8731 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063757.1 protein_id gnl|my_center|LOCUS_07930 8735 9187 gene locus_tag LOCUS_07940 8735 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 9971 10891 gene locus_tag LOCUS_07950 9971 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence055 918 550 gene locus_tag LOCUS_07960 918 550 CDS product UPF0382 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTQ5 protein_id gnl|my_center|LOCUS_07960 1453 911 gene locus_tag LOCUS_07970 1453 911 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 protein_id gnl|my_center|LOCUS_07970 2430 1537 gene locus_tag LOCUS_07980 gene gcvA 2430 1537 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 protein_id gnl|my_center|LOCUS_07980 3338 2484 gene locus_tag LOCUS_07990 gene kdsA 3338 2484 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR9 protein_id gnl|my_center|LOCUS_07990 4263 3463 gene locus_tag LOCUS_08000 4263 3463 CDS product UPF0162 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ28 protein_id gnl|my_center|LOCUS_08000 4811 4446 gene locus_tag LOCUS_08010 4811 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 6377 4824 gene locus_tag LOCUS_08020 6377 4824 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938023.1 protein_id gnl|my_center|LOCUS_08020 7259 6411 gene locus_tag LOCUS_08030 gene prmC 7259 6411 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR4 protein_id gnl|my_center|LOCUS_08030 8347 7262 gene locus_tag LOCUS_08040 gene prfA 8347 7262 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR3 protein_id gnl|my_center|LOCUS_08040 9620 8352 gene locus_tag LOCUS_08050 gene hemA 9620 8352 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ24 protein_id gnl|my_center|LOCUS_08050 9697 10290 gene locus_tag LOCUS_08060 gene lolB 9697 10290 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR1 protein_id gnl|my_center|LOCUS_08060 10283 11131 gene locus_tag LOCUS_08070 gene ispE 10283 11131 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RN7 protein_id gnl|my_center|LOCUS_08070 >Feature sequence056 <1 942 gene locus_tag LOCUS_08080 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000168092.1:lipoprotein transporter subunit LolE 1017 1448 gene locus_tag LOCUS_08090 1017 1448 CDS product DUF4826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072584.1 protein_id gnl|my_center|LOCUS_08090 1890 1432 gene locus_tag LOCUS_08100 1890 1432 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064118.1 protein_id gnl|my_center|LOCUS_08100 3127 1976 gene locus_tag LOCUS_08110 gene ycfD 3127 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_707041.1 protein_id gnl|my_center|LOCUS_08110 4558 3188 gene locus_tag LOCUS_08120 gene purB 4558 3188 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDV8 protein_id gnl|my_center|LOCUS_08120 5203 4598 gene locus_tag LOCUS_08130 gene hflD 5203 4598 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI52 protein_id gnl|my_center|LOCUS_08130 6300 5200 gene locus_tag LOCUS_08140 gene mnmA 6300 5200 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJK3 protein_id gnl|my_center|LOCUS_08140 7029 6388 gene locus_tag LOCUS_08150 gene rluE 7029 6388 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSH1 protein_id gnl|my_center|LOCUS_08150 9374 7152 gene locus_tag LOCUS_08160 9374 7152 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_08160 9855 9637 gene locus_tag LOCUS_08170 9855 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 10063 10371 gene locus_tag LOCUS_08180 gene clpS 10063 10371 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Y5 protein_id gnl|my_center|LOCUS_08180 >Feature sequence057 <1 792 gene locus_tag LOCUS_08190 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705171.1:Zn-dependent protease 1017 1859 gene locus_tag LOCUS_08200 1017 1859 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455357.1 protein_id gnl|my_center|LOCUS_08200 2720 1920 gene locus_tag LOCUS_08210 2720 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2861 4306 gene locus_tag LOCUS_08220 gene gapB 2861 4306 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN1 protein_id gnl|my_center|LOCUS_08220 4484 5611 gene locus_tag LOCUS_08230 4484 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106235.1 protein_id gnl|my_center|LOCUS_08230 5678 7411 gene locus_tag LOCUS_08240 5678 7411 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_08240 7835 8116 gene locus_tag LOCUS_08250 7835 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097051.1 protein_id gnl|my_center|LOCUS_08250 8106 10775 gene locus_tag LOCUS_08260 8106 10775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence058 892 1935 gene locus_tag LOCUS_08270 892 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 4044 2023 gene locus_tag LOCUS_08280 4044 2023 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918113.1 protein_id gnl|my_center|LOCUS_08280 4977 4207 gene locus_tag LOCUS_08290 4977 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 6345 5218 gene locus_tag LOCUS_08300 6345 5218 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_08300 7979 6549 gene locus_tag LOCUS_08310 7979 6549 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_08310 8261 9511 gene locus_tag LOCUS_08320 8261 9511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787749.1 protein_id gnl|my_center|LOCUS_08320 9523 10230 gene locus_tag LOCUS_08330 9523 10230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence059 <1 1789 gene locus_tag LOCUS_08340 <1 1789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262264.1:ATP-dependent helicase 1791 2483 gene locus_tag LOCUS_08350 gene yeaZ 1791 2483 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262263.1 protein_id gnl|my_center|LOCUS_08350 3843 2545 gene locus_tag LOCUS_08360 3843 2545 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463736.1 protein_id gnl|my_center|LOCUS_08360 4018 4929 gene locus_tag LOCUS_08370 4018 4929 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072531.1 protein_id gnl|my_center|LOCUS_08370 5008 6660 gene locus_tag LOCUS_08380 5008 6660 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706061.1 protein_id gnl|my_center|LOCUS_08380 6705 7832 gene locus_tag LOCUS_08390 gene rnd 6705 7832 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RC6 protein_id gnl|my_center|LOCUS_08390 8122 7862 gene locus_tag LOCUS_08400 gene minE 8122 7862 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK55 protein_id gnl|my_center|LOCUS_08400 8933 8124 gene locus_tag LOCUS_08410 gene minD 8933 8124 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE13 protein_id gnl|my_center|LOCUS_08410 9637 8939 gene locus_tag LOCUS_08420 gene minC 9637 8939 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RC3 protein_id gnl|my_center|LOCUS_08420 9808 10089 gene locus_tag LOCUS_08430 9808 10089 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE15 protein_id gnl|my_center|LOCUS_08430 >Feature sequence060 264 1109 gene locus_tag LOCUS_08440 264 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1403 3028 gene locus_tag LOCUS_08450 1403 3028 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112293.1 protein_id gnl|my_center|LOCUS_08450 4018 3410 gene locus_tag LOCUS_08460 4018 3410 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNU0 protein_id gnl|my_center|LOCUS_08460 4547 4053 gene locus_tag LOCUS_08470 4547 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 4723 4950 gene locus_tag LOCUS_08480 4723 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 5699 4962 gene locus_tag LOCUS_08490 5699 4962 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938683.1 protein_id gnl|my_center|LOCUS_08490 6056 6469 gene locus_tag LOCUS_08500 6056 6469 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073406.1 protein_id gnl|my_center|LOCUS_08500 6909 6490 gene locus_tag LOCUS_08510 6909 6490 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069390.1 protein_id gnl|my_center|LOCUS_08510 7806 6931 gene locus_tag LOCUS_08520 7806 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 8271 7840 gene locus_tag LOCUS_08530 gene marR 8271 7840 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520538.1 protein_id gnl|my_center|LOCUS_08530 8752 8282 gene locus_tag LOCUS_08540 gene gpo 8752 8282 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CFV1 protein_id gnl|my_center|LOCUS_08540 9766 8831 gene locus_tag LOCUS_08550 9766 8831 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263103.1 protein_id gnl|my_center|LOCUS_08550 10271 9840 gene locus_tag LOCUS_08560 10271 9840 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074172.1 protein_id gnl|my_center|LOCUS_08560 10710 10540 gene locus_tag LOCUS_08570 10710 10540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence061 <1 1818 gene locus_tag LOCUS_08580 <1 1818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P40406:beta-hexosaminidase 1830 2150 gene locus_tag LOCUS_08590 1830 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08590 2175 2570 gene locus_tag LOCUS_08600 2175 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08600 3873 2665 gene locus_tag LOCUS_08610 3873 2665 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073485.1 protein_id gnl|my_center|LOCUS_08610 5202 3883 gene locus_tag LOCUS_08620 gene ybjZ 5202 3883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 protein_id gnl|my_center|LOCUS_08620 5904 5212 gene locus_tag LOCUS_08630 gene ycfV 5904 5212 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035813.1 protein_id gnl|my_center|LOCUS_08630 7258 5978 gene locus_tag LOCUS_08640 7258 5978 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073489.1 protein_id gnl|my_center|LOCUS_08640 8026 7454 gene locus_tag LOCUS_08650 8026 7454 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5C9 protein_id gnl|my_center|LOCUS_08650 8497 8153 gene locus_tag LOCUS_08660 8497 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 9169 8600 gene locus_tag LOCUS_08670 9169 8600 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_08670 9794 10246 gene locus_tag LOCUS_08680 9794 10246 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL36 protein_id gnl|my_center|LOCUS_08680 10243 10770 gene locus_tag LOCUS_08690 10243 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence062 142 933 gene locus_tag LOCUS_08700 142 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08700 991 1554 gene locus_tag LOCUS_08710 gene infC 991 1554 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z6I3 protein_id gnl|my_center|LOCUS_08710 1730 1930 gene locus_tag LOCUS_08720 gene rpmI 1730 1930 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67917 protein_id gnl|my_center|LOCUS_08720 1946 2305 gene locus_tag LOCUS_08730 gene rplT 1946 2305 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZDW8 protein_id gnl|my_center|LOCUS_08730 3181 2357 gene locus_tag LOCUS_08740 3181 2357 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167389.1 protein_id gnl|my_center|LOCUS_08740 3410 5107 gene locus_tag LOCUS_08750 3410 5107 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 protein_id gnl|my_center|LOCUS_08750 5129 5770 gene locus_tag LOCUS_08760 5129 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170954.1 protein_id gnl|my_center|LOCUS_08760 5834 6292 gene locus_tag LOCUS_08770 5834 6292 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380560.1 protein_id gnl|my_center|LOCUS_08770 6419 7975 gene locus_tag LOCUS_08780 6419 7975 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_08780 8119 9195 gene locus_tag LOCUS_08790 8119 9195 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_08790 9188 10012 gene locus_tag LOCUS_08800 9188 10012 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_08800 <10658 10124 gene locus_tag LOCUS_08810 <10658 10124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EE96:pyruvate kinase >Feature sequence063 4468 2612 gene locus_tag LOCUS_08820 4468 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103382.1 protein_id gnl|my_center|LOCUS_08820 5256 4474 gene locus_tag LOCUS_08830 5256 4474 CDS product DNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706112.1 protein_id gnl|my_center|LOCUS_08830 5591 5265 gene locus_tag LOCUS_08840 gene pilZ 5591 5265 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_08840 6503 5604 gene locus_tag LOCUS_08850 6503 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 7129 6500 gene locus_tag LOCUS_08860 gene tmk 7129 6500 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQI2 protein_id gnl|my_center|LOCUS_08860 8108 7119 gene locus_tag LOCUS_08870 8108 7119 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453967.1 protein_id gnl|my_center|LOCUS_08870 8891 8115 gene locus_tag LOCUS_08880 gene pabC 8891 8115 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262287.1 protein_id gnl|my_center|LOCUS_08880 10191 8953 gene locus_tag LOCUS_08890 gene fabF 10191 8953 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJ22 protein_id gnl|my_center|LOCUS_08890 10512 10276 gene locus_tag LOCUS_08900 gene acpP 10512 10276 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH5 protein_id gnl|my_center|LOCUS_08900 >Feature sequence064 402 1232 gene locus_tag LOCUS_08910 gene dapF 402 1232 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ4 protein_id gnl|my_center|LOCUS_08910 1266 1874 gene locus_tag LOCUS_08920 1266 1874 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084657.1 protein_id gnl|my_center|LOCUS_08920 1884 2810 gene locus_tag LOCUS_08930 gene xerC 1884 2810 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFI3 protein_id gnl|my_center|LOCUS_08930 2855 3559 gene locus_tag LOCUS_08940 2855 3559 CDS product 2-haloalkanoic acid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478999.1 protein_id gnl|my_center|LOCUS_08940 3581 4474 gene locus_tag LOCUS_08950 3581 4474 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073864.1 protein_id gnl|my_center|LOCUS_08950 5362 4523 gene locus_tag LOCUS_08960 5362 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 5429 6112 gene locus_tag LOCUS_08970 5429 6112 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCX7 protein_id gnl|my_center|LOCUS_08970 6557 6174 gene locus_tag LOCUS_08980 6557 6174 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947947.1 protein_id gnl|my_center|LOCUS_08980 6806 7678 gene locus_tag LOCUS_08990 6806 7678 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219805.1 protein_id gnl|my_center|LOCUS_08990 10027 7733 gene locus_tag LOCUS_09000 10027 7733 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009952308.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence065 2124 1324 gene locus_tag LOCUS_09010 2124 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2212 3108 gene locus_tag LOCUS_09020 2212 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 4697 3126 gene locus_tag LOCUS_09030 4697 3126 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262057.1 protein_id gnl|my_center|LOCUS_09030 6300 4843 gene locus_tag LOCUS_09040 gene cry2 6300 4843 CDS product cryptochrome-like protein cry2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KS67 protein_id gnl|my_center|LOCUS_09040 7669 6275 gene locus_tag LOCUS_09050 gene cry1 7669 6275 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR33 protein_id gnl|my_center|LOCUS_09050 8028 9290 gene locus_tag LOCUS_09060 8028 9290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence066 344 12 gene locus_tag LOCUS_09070 344 12 CDS product monovalent cation/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_09070 621 352 gene locus_tag LOCUS_09080 621 352 CDS product monovalent cation/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_09080 1151 615 gene locus_tag LOCUS_09090 1151 615 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_09090 2668 1151 gene locus_tag LOCUS_09100 2668 1151 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_09100 3012 2665 gene locus_tag LOCUS_09110 3012 2665 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_09110 4097 3012 gene locus_tag LOCUS_09120 4097 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09120 5903 4161 gene locus_tag LOCUS_09130 5903 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09130 7120 6035 gene locus_tag LOCUS_09140 7120 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 8030 7149 gene locus_tag LOCUS_09150 8030 7149 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ25 protein_id gnl|my_center|LOCUS_09150 10290 8164 gene locus_tag LOCUS_09160 gene pnp 10290 8164 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU76 protein_id gnl|my_center|LOCUS_09160 >Feature sequence067 625 1455 gene locus_tag LOCUS_09170 625 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_09170 1878 1516 gene locus_tag LOCUS_09180 1878 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2812 2048 gene locus_tag LOCUS_09190 2812 2048 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881501.1 protein_id gnl|my_center|LOCUS_09190 3765 2878 gene locus_tag LOCUS_09200 gene metR 3765 2878 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262273.1 protein_id gnl|my_center|LOCUS_09200 6607 4229 gene locus_tag LOCUS_09210 6607 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 6763 7836 gene locus_tag LOCUS_09220 gene pyrC 6763 7836 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB40 protein_id gnl|my_center|LOCUS_09220 8025 8330 gene locus_tag LOCUS_09230 8025 8330 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECJ6 protein_id gnl|my_center|LOCUS_09230 8375 10144 gene locus_tag LOCUS_09240 8375 10144 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578121.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence068 1348 407 gene locus_tag LOCUS_09250 gene nahR 1348 407 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_09250 3078 1345 gene locus_tag LOCUS_09260 gene aceK 3078 1345 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62MX7 protein_id gnl|my_center|LOCUS_09260 3698 3222 gene locus_tag LOCUS_09270 3698 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 5274 3778 gene locus_tag LOCUS_09280 5274 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 5491 5279 gene locus_tag LOCUS_09290 5491 5279 CDS product UPF0352 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF26 protein_id gnl|my_center|LOCUS_09290 5553 6566 gene locus_tag LOCUS_09300 gene yejK 5553 6566 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4A3 protein_id gnl|my_center|LOCUS_09300 6678 8165 gene locus_tag LOCUS_09310 6678 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 9163 8183 gene locus_tag LOCUS_09320 9163 8183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 9779 9153 gene locus_tag LOCUS_09330 9779 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence069 <1 899 gene locus_tag LOCUS_09340 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070482.1:transporter 1071 1448 gene locus_tag LOCUS_09350 1071 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1464 2084 gene locus_tag LOCUS_09360 1464 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2867 2433 gene locus_tag LOCUS_09370 2867 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240372.1 protein_id gnl|my_center|LOCUS_09370 2964 3113 gene locus_tag LOCUS_09380 2964 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 3334 3972 gene locus_tag LOCUS_09390 3334 3972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 5980 4079 gene locus_tag LOCUS_09400 5980 4079 CDS product 3-phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104453.1 protein_id gnl|my_center|LOCUS_09400 6767 6312 gene locus_tag LOCUS_09410 6767 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09410 7208 6774 gene locus_tag LOCUS_09420 7208 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 7360 8121 gene locus_tag LOCUS_09430 7360 8121 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098370.1 protein_id gnl|my_center|LOCUS_09430 8439 9305 gene locus_tag LOCUS_09440 8439 9305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 protein_id gnl|my_center|LOCUS_09440 <10292 9537 gene locus_tag LOCUS_09450 <10292 9537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072342.1:universal stress protein E >Feature sequence070 <1 3159 gene locus_tag LOCUS_09460 <1 3159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TJ3:tricorn protease 3602 5452 gene locus_tag LOCUS_09470 3602 5452 CDS product alkaline serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473082.1 protein_id gnl|my_center|LOCUS_09470 5654 7756 gene locus_tag LOCUS_09480 5654 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021631.1 protein_id gnl|my_center|LOCUS_09480 9777 7960 gene locus_tag LOCUS_09490 9777 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence071 2057 2812 gene locus_tag LOCUS_09500 gene yeeZ 2057 2812 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072778.1 protein_id gnl|my_center|LOCUS_09500 3549 2830 gene locus_tag LOCUS_09510 gene hutC 3549 2830 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070506.1 protein_id gnl|my_center|LOCUS_09510 3660 4883 gene locus_tag LOCUS_09520 gene hutI 3660 4883 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKJ7 protein_id gnl|my_center|LOCUS_09520 4912 6687 gene locus_tag LOCUS_09530 4912 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 7749 6697 gene locus_tag LOCUS_09540 gene hutG 7749 6697 CDS product formimidoylglutamase HutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073881.1 protein_id gnl|my_center|LOCUS_09540 8255 7746 gene locus_tag LOCUS_09550 gene rraA 8255 7746 CDS product regulator of ribonuclease activity A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNQ9 protein_id gnl|my_center|LOCUS_09550 8518 9537 gene locus_tag LOCUS_09560 8518 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932036.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence072 620 886 gene locus_tag LOCUS_09570 620 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09570 890 3973 gene locus_tag LOCUS_09580 890 3973 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_09580 4202 7489 gene locus_tag LOCUS_09590 4202 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 8155 7553 gene locus_tag LOCUS_09600 8155 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 8482 9720 gene locus_tag LOCUS_09610 8482 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 9736 9873 gene locus_tag LOCUS_09620 9736 9873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence073 158 1495 gene locus_tag LOCUS_09630 gene rarA 158 1495 CDS product recombinase RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261567.1 protein_id gnl|my_center|LOCUS_09630 1488 1868 gene locus_tag LOCUS_09640 gene crcB 1488 1868 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE9 protein_id gnl|my_center|LOCUS_09640 1876 3177 gene locus_tag LOCUS_09650 gene serS 1876 3177 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P67564 protein_id gnl|my_center|LOCUS_09650 3641 3811 gene locus_tag LOCUS_09660 gene rmf 3641 3811 CDS product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNU3 protein_id gnl|my_center|LOCUS_09660 4400 3864 gene locus_tag LOCUS_09670 gene fabA 4400 3864 CDS product 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKK2 protein_id gnl|my_center|LOCUS_09670 4581 5438 gene locus_tag LOCUS_09680 gene queD 4581 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072215.1 protein_id gnl|my_center|LOCUS_09680 5431 6246 gene locus_tag LOCUS_09690 5431 6246 CDS product periplasmic metalloprotease M23B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072216.1 protein_id gnl|my_center|LOCUS_09690 6253 6684 gene locus_tag LOCUS_09700 6253 6684 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072593.1 protein_id gnl|my_center|LOCUS_09700 7549 6710 gene locus_tag LOCUS_09710 7549 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 9017 7680 gene locus_tag LOCUS_09720 9017 7680 CDS product putative L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67554 protein_id gnl|my_center|LOCUS_09720 9961 9323 gene locus_tag LOCUS_09730 9961 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence074 <1 1540 gene locus_tag LOCUS_09740 <1 1540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073983.1:bifunctional diguanylate cyclase/phosphodiesterase 3544 1529 gene locus_tag LOCUS_09750 gene rep 3544 1529 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQV9 protein_id gnl|my_center|LOCUS_09750 7503 3607 gene locus_tag LOCUS_09760 7503 3607 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_09760 7701 9191 gene locus_tag LOCUS_09770 7701 9191 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263372.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence075 2638 479 gene locus_tag LOCUS_09780 2638 479 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_09780 3700 2810 gene locus_tag LOCUS_09790 gene folE2 3700 2810 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HT35 protein_id gnl|my_center|LOCUS_09790 4024 3872 gene locus_tag LOCUS_09800 4024 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 4167 5054 gene locus_tag LOCUS_09810 4167 5054 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106385.1 protein_id gnl|my_center|LOCUS_09810 5078 7243 gene locus_tag LOCUS_09820 gene dcp 5078 7243 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073033.1 protein_id gnl|my_center|LOCUS_09820 7402 8310 gene locus_tag LOCUS_09830 7402 8310 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074136.1 protein_id gnl|my_center|LOCUS_09830 9041 8340 gene locus_tag LOCUS_09840 9041 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence076 1078 3045 gene locus_tag LOCUS_09850 1078 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3113 4891 gene locus_tag LOCUS_09860 3113 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_09860 4991 5488 gene locus_tag LOCUS_09870 4991 5488 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE17 protein_id gnl|my_center|LOCUS_09870 7698 5533 gene locus_tag LOCUS_09880 7698 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence077 519 1895 gene locus_tag LOCUS_09890 gene dbpA 519 1895 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263052.1 protein_id gnl|my_center|LOCUS_09890 2485 1892 gene locus_tag LOCUS_09900 2485 1892 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263300.1 protein_id gnl|my_center|LOCUS_09900 2627 5419 gene locus_tag LOCUS_09910 2627 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 6595 5396 gene locus_tag LOCUS_09920 6595 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 8033 6774 gene locus_tag LOCUS_09930 gene rho 8033 6774 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KH7 protein_id gnl|my_center|LOCUS_09930 8550 8224 gene locus_tag LOCUS_09940 8550 8224 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV51 protein_id gnl|my_center|LOCUS_09940 >Feature sequence078 1 135 gene locus_tag LOCUS_09950 1 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 148 849 gene locus_tag LOCUS_09960 148 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09960 924 1514 gene locus_tag LOCUS_09970 924 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1684 2391 gene locus_tag LOCUS_09980 gene mtnN 1684 2391 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIZ1 protein_id gnl|my_center|LOCUS_09980 2391 3362 gene locus_tag LOCUS_09990 2391 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 4609 3407 gene locus_tag LOCUS_10000 gene tyrS 4609 3407 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB3 protein_id gnl|my_center|LOCUS_10000 4756 6090 gene locus_tag LOCUS_10010 4756 6090 CDS product family M23 zinc metallopeptidase with OapA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071525.1 protein_id gnl|my_center|LOCUS_10010 7122 6199 gene locus_tag LOCUS_10020 7122 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 8361 7138 gene locus_tag LOCUS_10030 gene radA 8361 7138 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD6 protein_id gnl|my_center|LOCUS_10030 >Feature sequence079 1495 242 gene locus_tag LOCUS_10040 gene lysA 1495 242 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9H4 protein_id gnl|my_center|LOCUS_10040 1789 2109 gene locus_tag LOCUS_10050 gene cyaY 1789 2109 CDS product protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JI88 protein_id gnl|my_center|LOCUS_10050 2109 2762 gene locus_tag LOCUS_10060 2109 2762 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_10060 2779 3819 gene locus_tag LOCUS_10070 2779 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 3840 4778 gene locus_tag LOCUS_10080 gene hemC 3840 4778 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFH6 protein_id gnl|my_center|LOCUS_10080 4795 6621 gene locus_tag LOCUS_10090 4795 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 6614 7720 gene locus_tag LOCUS_10100 6614 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 8004 9002 gene locus_tag LOCUS_10110 gene add 8004 9002 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TF3 protein_id gnl|my_center|LOCUS_10110 9496 9089 gene locus_tag LOCUS_10120 9496 9089 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707727.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence080 990 445 gene locus_tag LOCUS_10130 gene seqA 990 445 CDS product negative modulator of initiation of replication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEP2 protein_id gnl|my_center|LOCUS_10130 1117 1875 gene locus_tag LOCUS_10140 1117 1875 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_10140 2158 2436 gene locus_tag LOCUS_10150 2158 2436 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705430.1 protein_id gnl|my_center|LOCUS_10150 2451 2978 gene locus_tag LOCUS_10160 gene fldA 2451 2978 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEP7 protein_id gnl|my_center|LOCUS_10160 3074 3517 gene locus_tag LOCUS_10170 gene fur 3074 3517 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367698.1 protein_id gnl|my_center|LOCUS_10170 3987 3586 gene locus_tag LOCUS_10180 3987 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4919 4086 gene locus_tag LOCUS_10190 4919 4086 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480764.1 protein_id gnl|my_center|LOCUS_10190 5366 6844 gene locus_tag LOCUS_10200 gene rsmF 5366 6844 CDS product ribosomal RNA small subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKI5 protein_id gnl|my_center|LOCUS_10200 8600 7098 gene locus_tag LOCUS_10210 8600 7098 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence081 949 1791 gene locus_tag LOCUS_10220 949 1791 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142129.1 protein_id gnl|my_center|LOCUS_10220 4329 1858 gene locus_tag LOCUS_10230 4329 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035989.1 protein_id gnl|my_center|LOCUS_10230 4543 5772 gene locus_tag LOCUS_10240 4543 5772 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_10240 5951 7123 gene locus_tag LOCUS_10250 5951 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070677.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence082 <1 711 gene locus_tag LOCUS_10260 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002721316.1:sodium:proton antiporter 1092 2441 gene locus_tag LOCUS_10270 gene lysC 1092 2441 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAC1 protein_id gnl|my_center|LOCUS_10270 2624 3601 gene locus_tag LOCUS_10280 2624 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10280 5214 4015 gene locus_tag LOCUS_10290 5214 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 7095 5455 gene locus_tag LOCUS_10300 7095 5455 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479694.1 protein_id gnl|my_center|LOCUS_10300 7395 8465 gene locus_tag LOCUS_10310 gene lolC 7395 8465 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705875.1 protein_id gnl|my_center|LOCUS_10310 8458 9147 gene locus_tag LOCUS_10320 gene lolD 8458 9147 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57066 protein_id gnl|my_center|LOCUS_10320 9140 9490 gene locus_tag LOCUS_10330 9140 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence083 608 294 gene locus_tag LOCUS_10340 608 294 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482297.1 protein_id gnl|my_center|LOCUS_10340 826 1122 gene locus_tag LOCUS_10350 826 1122 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105744.1 protein_id gnl|my_center|LOCUS_10350 1477 1160 gene locus_tag LOCUS_10360 1477 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 2002 1484 gene locus_tag LOCUS_10370 gene dsbB 2002 1484 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL09 protein_id gnl|my_center|LOCUS_10370 2287 3000 gene locus_tag LOCUS_10380 gene fadR 2287 3000 CDS product fatty acid metabolism regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL07 protein_id gnl|my_center|LOCUS_10380 3236 3841 gene locus_tag LOCUS_10390 3236 3841 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381738.1 protein_id gnl|my_center|LOCUS_10390 4294 4055 gene locus_tag LOCUS_10400 4294 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 5269 4469 gene locus_tag LOCUS_10410 5269 4469 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070889.1 protein_id gnl|my_center|LOCUS_10410 5917 5363 gene locus_tag LOCUS_10420 5917 5363 CDS product UPF0115 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK38 protein_id gnl|my_center|LOCUS_10420 6006 6941 gene locus_tag LOCUS_10430 gene prmB 6006 6941 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MM8 protein_id gnl|my_center|LOCUS_10430 6992 8095 gene locus_tag LOCUS_10440 gene aroC 6992 8095 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKS7 protein_id gnl|my_center|LOCUS_10440 9002 8148 gene locus_tag LOCUS_10450 gene folD 9002 8148 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Y1 protein_id gnl|my_center|LOCUS_10450 9353 9429 gene locus_tag LOCUS_t00110 9353 9429 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence084 <1 969 gene locus_tag LOCUS_10460 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EFP4:citrate synthase 1057 2268 gene locus_tag LOCUS_10470 gene sufS 1057 2268 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_10470 2271 2675 gene locus_tag LOCUS_10480 2271 2675 CDS product cysteine desulfurase, sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 protein_id gnl|my_center|LOCUS_10480 3468 2677 gene locus_tag LOCUS_10490 3468 2677 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073641.1 protein_id gnl|my_center|LOCUS_10490 4129 3470 gene locus_tag LOCUS_10500 4129 3470 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074068.1 protein_id gnl|my_center|LOCUS_10500 4880 4122 gene locus_tag LOCUS_10510 gene kdsB 4880 4122 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0E9 protein_id gnl|my_center|LOCUS_10510 5065 4868 gene locus_tag LOCUS_10520 5065 4868 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMK8 protein_id gnl|my_center|LOCUS_10520 6035 5055 gene locus_tag LOCUS_10530 gene lpxK 6035 5055 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44491 protein_id gnl|my_center|LOCUS_10530 7774 6038 gene locus_tag LOCUS_10540 gene msbA 7774 6038 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLY2 protein_id gnl|my_center|LOCUS_10540 <9262 7929 gene locus_tag LOCUS_10550 <9262 7929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481856.1:DNA internalization-related competence protein ComEC/Rec2 >Feature sequence085 1437 229 gene locus_tag LOCUS_10560 1437 229 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454895.1 protein_id gnl|my_center|LOCUS_10560 1565 2953 gene locus_tag LOCUS_10570 gene dbpA 1565 2953 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263052.1 protein_id gnl|my_center|LOCUS_10570 3119 3520 gene locus_tag LOCUS_10580 3119 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 3708 4430 gene locus_tag LOCUS_10590 3708 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 5666 4476 gene locus_tag LOCUS_10600 5666 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5810 6574 gene locus_tag LOCUS_10610 5810 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 7564 6635 gene locus_tag LOCUS_10620 7564 6635 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106053.1 protein_id gnl|my_center|LOCUS_10620 7703 8857 gene locus_tag LOCUS_10630 7703 8857 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482338.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence086 195 917 gene locus_tag LOCUS_10640 195 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10640 1007 2032 gene locus_tag LOCUS_10650 gene tdh 1007 2032 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59410 protein_id gnl|my_center|LOCUS_10650 2104 2418 gene locus_tag LOCUS_10660 gene glpE 2104 2418 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSF1 protein_id gnl|my_center|LOCUS_10660 2418 3242 gene locus_tag LOCUS_10670 gene glpG 2418 3242 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074262.1 protein_id gnl|my_center|LOCUS_10670 3631 3236 gene locus_tag LOCUS_10680 3631 3236 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460376.1 protein_id gnl|my_center|LOCUS_10680 3865 4389 gene locus_tag LOCUS_10690 gene ubiC 3865 4389 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKG2 protein_id gnl|my_center|LOCUS_10690 4379 5245 gene locus_tag LOCUS_10700 gene ubiA 4379 5245 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y5B7 protein_id gnl|my_center|LOCUS_10700 6204 5311 gene locus_tag LOCUS_10710 6204 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 7840 6311 gene locus_tag LOCUS_10720 7840 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 protein_id gnl|my_center|LOCUS_10720 8323 7898 gene locus_tag LOCUS_10730 8323 7898 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_10730 8329 8661 gene locus_tag LOCUS_10740 8329 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704337.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence087 162 1391 gene locus_tag LOCUS_10750 162 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 2860 1436 gene locus_tag LOCUS_10760 gene sthA 2860 1436 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZA97 protein_id gnl|my_center|LOCUS_10760 3900 2908 gene locus_tag LOCUS_10770 3900 2908 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704344.1 protein_id gnl|my_center|LOCUS_10770 4140 4766 gene locus_tag LOCUS_10780 gene fabR 4140 4766 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM60 protein_id gnl|my_center|LOCUS_10780 5192 6739 gene locus_tag LOCUS_10790 gene leuA 5192 6739 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGM9 protein_id gnl|my_center|LOCUS_10790 6736 7812 gene locus_tag LOCUS_10800 gene leuB 6736 7812 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGM8 protein_id gnl|my_center|LOCUS_10800 7867 8838 gene locus_tag LOCUS_10810 7867 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10810 >Feature sequence088 1103 399 gene locus_tag LOCUS_10820 1103 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2790 2050 gene locus_tag LOCUS_10830 gene kynA 2790 2050 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDA8 protein_id gnl|my_center|LOCUS_10830 3249 4490 gene locus_tag LOCUS_10840 3249 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 4490 5239 gene locus_tag LOCUS_10850 4490 5239 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337438.1 protein_id gnl|my_center|LOCUS_10850 5241 6827 gene locus_tag LOCUS_10860 gene mhpA 5241 6827 CDS product 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X680 protein_id gnl|my_center|LOCUS_10860 7061 7837 gene locus_tag LOCUS_10870 7061 7837 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809826.1 protein_id gnl|my_center|LOCUS_10870 8350 7970 gene locus_tag LOCUS_10880 8350 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 8390 8929 gene locus_tag LOCUS_10890 8390 8929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence089 1165 362 gene locus_tag LOCUS_10900 gene cmoM 1165 362 CDS product tRNA 5-carboxymethoxyuridine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTN2 protein_id gnl|my_center|LOCUS_10900 1931 1176 gene locus_tag LOCUS_10910 1931 1176 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM26 protein_id gnl|my_center|LOCUS_10910 2392 2003 gene locus_tag LOCUS_10920 2392 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3857 2532 gene locus_tag LOCUS_10930 3857 2532 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KP3 protein_id gnl|my_center|LOCUS_10930 4107 5057 gene locus_tag LOCUS_10940 gene trxB 4107 5057 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSS4 protein_id gnl|my_center|LOCUS_10940 5132 5851 gene locus_tag LOCUS_10950 gene aat 5132 5851 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMD2 protein_id gnl|my_center|LOCUS_10950 5844 6551 gene locus_tag LOCUS_10960 gene ate 5844 6551 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJD9 protein_id gnl|my_center|LOCUS_10960 6647 6865 gene locus_tag LOCUS_10970 gene infA 6647 6865 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65128 protein_id gnl|my_center|LOCUS_10970 <9028 6974 gene locus_tag LOCUS_10980 <9028 6974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005495889.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence090 2355 1303 gene locus_tag LOCUS_10990 2355 1303 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402542.1 protein_id gnl|my_center|LOCUS_10990 4771 2360 gene locus_tag LOCUS_11000 4771 2360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881418.1 protein_id gnl|my_center|LOCUS_11000 5408 4752 gene locus_tag LOCUS_11010 5408 4752 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_11010 5927 5577 gene locus_tag LOCUS_11020 5927 5577 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 protein_id gnl|my_center|LOCUS_11020 6961 6026 gene locus_tag LOCUS_11030 6961 6026 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_11030 8005 7166 gene locus_tag LOCUS_11040 8005 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071178.1 protein_id gnl|my_center|LOCUS_11040 <8974 8197 gene locus_tag LOCUS_11050 <8974 8197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478447.1:ABC transporter ATP-binding protein >Feature sequence091 414 1916 gene locus_tag LOCUS_11060 414 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2644 1961 gene locus_tag LOCUS_11070 gene bioD 2644 1961 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CU9 protein_id gnl|my_center|LOCUS_11070 3405 2641 gene locus_tag LOCUS_11080 3405 2641 CDS product biotin synthesis protein BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230759.2 protein_id gnl|my_center|LOCUS_11080 4535 3402 gene locus_tag LOCUS_11090 gene bioF 4535 3402 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLM9 protein_id gnl|my_center|LOCUS_11090 5569 4535 gene locus_tag LOCUS_11100 gene bioB 5569 4535 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZMA8 protein_id gnl|my_center|LOCUS_11100 5692 6987 gene locus_tag LOCUS_11110 gene bioA 5692 6987 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZH8 protein_id gnl|my_center|LOCUS_11110 8156 6993 gene locus_tag LOCUS_11120 8156 6993 CDS product colanic acid biosynthesis glycosyltransferase WcaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803854.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence092 820 239 gene locus_tag LOCUS_11130 820 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073723.1 protein_id gnl|my_center|LOCUS_11130 972 1763 gene locus_tag LOCUS_11140 972 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1945 3177 gene locus_tag LOCUS_11150 1945 3177 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706753.1 protein_id gnl|my_center|LOCUS_11150 5739 3610 gene locus_tag LOCUS_11160 5739 3610 CDS product dTDP-D-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479992.1 protein_id gnl|my_center|LOCUS_11160 7173 6211 gene locus_tag LOCUS_11170 gene ltaA 7173 6211 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211362.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence093 1327 119 gene locus_tag LOCUS_11180 1327 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2936 1377 gene locus_tag LOCUS_11190 2936 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 protein_id gnl|my_center|LOCUS_11190 4758 2938 gene locus_tag LOCUS_11200 4758 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5463 4852 gene locus_tag LOCUS_11210 5463 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6455 5487 gene locus_tag LOCUS_11220 gene mauG 6455 5487 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence094 1407 1123 gene locus_tag LOCUS_11230 gene rpmE2 1407 1123 CDS product 50S ribosomal protein L31 type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0Y6Q3 protein_id gnl|my_center|LOCUS_11230 1555 1806 gene locus_tag LOCUS_11240 1555 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 2404 1808 gene locus_tag LOCUS_11250 2404 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2602 3516 gene locus_tag LOCUS_11260 gene dapA 2602 3516 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4W3 protein_id gnl|my_center|LOCUS_11260 3573 4868 gene locus_tag LOCUS_11270 3573 4868 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 protein_id gnl|my_center|LOCUS_11270 5573 4935 gene locus_tag LOCUS_11280 5573 4935 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919407.1 protein_id gnl|my_center|LOCUS_11280 7337 5730 gene locus_tag LOCUS_11290 gene abgT 7337 5730 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262003.1 protein_id gnl|my_center|LOCUS_11290 7496 8446 gene locus_tag LOCUS_11300 gene rnz 7496 8446 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ23 protein_id gnl|my_center|LOCUS_11300 >Feature sequence095 <1 549 gene locus_tag LOCUS_11310 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730675.1:serine hydrolase 2955 691 gene locus_tag LOCUS_11320 2955 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3122 4117 gene locus_tag LOCUS_11330 3122 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4298 4660 gene locus_tag LOCUS_11340 4298 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4796 5152 gene locus_tag LOCUS_11350 4796 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 5456 6028 gene locus_tag LOCUS_11360 5456 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 6028 7653 gene locus_tag LOCUS_11370 6028 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 7909 7757 gene locus_tag LOCUS_11380 7909 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 8116 7934 gene locus_tag LOCUS_11390 8116 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11390 >Feature sequence096 <1 970 gene locus_tag LOCUS_11400 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:type IV pili system adhesin PilY 957 1385 gene locus_tag LOCUS_11410 957 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1936 1382 gene locus_tag LOCUS_11420 1936 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2687 2007 gene locus_tag LOCUS_11430 2687 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2686 3024 gene locus_tag LOCUS_11440 2686 3024 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881945.1 protein_id gnl|my_center|LOCUS_11440 3848 3081 gene locus_tag LOCUS_11450 3848 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 3973 4950 gene locus_tag LOCUS_11460 gene rluD 3973 4950 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FII1 protein_id gnl|my_center|LOCUS_11460 4953 5687 gene locus_tag LOCUS_11470 4953 5687 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CK84 protein_id gnl|my_center|LOCUS_11470 5775 8348 gene locus_tag LOCUS_11480 gene clpB 5775 8348 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7D5 protein_id gnl|my_center|LOCUS_11480 >Feature sequence097 1241 456 gene locus_tag LOCUS_11490 1241 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 2040 1339 gene locus_tag LOCUS_11500 2040 1339 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070966.1 protein_id gnl|my_center|LOCUS_11500 2319 2648 gene locus_tag LOCUS_11510 2319 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 4127 2976 gene locus_tag LOCUS_11520 4127 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 5602 4229 gene locus_tag LOCUS_11530 5602 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 6092 5922 gene locus_tag LOCUS_11540 6092 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 7004 6096 gene locus_tag LOCUS_11550 7004 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 7553 7137 gene locus_tag LOCUS_11560 7553 7137 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438356.1 protein_id gnl|my_center|LOCUS_11560 8280 7894 gene locus_tag LOCUS_11570 8280 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence098 730 263 gene locus_tag LOCUS_11580 gene argR 730 263 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIR6 protein_id gnl|my_center|LOCUS_11580 1018 1959 gene locus_tag LOCUS_11590 gene mdh 1018 1959 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SU7 protein_id gnl|my_center|LOCUS_11590 2549 2052 gene locus_tag LOCUS_11600 2549 2052 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071580.1 protein_id gnl|my_center|LOCUS_11600 2805 2889 gene locus_tag LOCUS_t00120 2805 2889 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3676 3155 gene locus_tag LOCUS_11610 3676 3155 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SB6 protein_id gnl|my_center|LOCUS_11610 3756 4682 gene locus_tag LOCUS_11620 gene xerD 3756 4682 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZHK1 protein_id gnl|my_center|LOCUS_11620 4741 5478 gene locus_tag LOCUS_11630 gene dsbC 4741 5478 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 protein_id gnl|my_center|LOCUS_11630 5579 7306 gene locus_tag LOCUS_11640 gene recJ 5579 7306 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707042.1 protein_id gnl|my_center|LOCUS_11640 7606 8538 gene locus_tag LOCUS_11650 gene prfB 7606 8538 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7P9 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11650 >Feature sequence099 <1 644 gene locus_tag LOCUS_11660 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107494.1:sigma-54-dependent Fis family transcriptional regulator 637 1938 gene locus_tag LOCUS_11670 637 1938 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107804.1 protein_id gnl|my_center|LOCUS_11670 3031 1994 gene locus_tag LOCUS_11680 3031 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_11680 3413 4264 gene locus_tag LOCUS_11690 3413 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 5627 4341 gene locus_tag LOCUS_11700 5627 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480179.1 protein_id gnl|my_center|LOCUS_11700 6966 5836 gene locus_tag LOCUS_11710 6966 5836 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886844.1 protein_id gnl|my_center|LOCUS_11710 8159 7065 gene locus_tag LOCUS_11720 8159 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence100 3492 1897 gene locus_tag LOCUS_11730 3492 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 3852 3652 gene locus_tag LOCUS_11740 3852 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4660 4004 gene locus_tag LOCUS_11750 4660 4004 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315741.1 protein_id gnl|my_center|LOCUS_11750 5370 4672 gene locus_tag LOCUS_11760 gene dhcA 5370 4672 CDS product dehydrocarnitine CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_11760 6338 5433 gene locus_tag LOCUS_11770 6338 5433 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106427.1 protein_id gnl|my_center|LOCUS_11770 8303 6339 gene locus_tag LOCUS_11780 gene liuD 8303 6339 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072001.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence101 58 207 gene locus_tag LOCUS_11790 58 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11790 274 1287 gene locus_tag LOCUS_11800 gene epsF 274 1287 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45780 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11800 1342 1770 gene locus_tag LOCUS_11810 gene gspG 1342 1770 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308483.1 protein_id gnl|my_center|LOCUS_11810 1776 2372 gene locus_tag LOCUS_11820 gene gspH 1776 2372 CDS product type II secretion system protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262829.1 protein_id gnl|my_center|LOCUS_11820 2369 2746 gene locus_tag LOCUS_11830 gene yst1I 2369 2746 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173839.1 protein_id gnl|my_center|LOCUS_11830 2746 3510 gene locus_tag LOCUS_11840 gene gspJ 2746 3510 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262827.1 protein_id gnl|my_center|LOCUS_11840 3507 4511 gene locus_tag LOCUS_11850 gene gspK 3507 4511 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC2 protein_id gnl|my_center|LOCUS_11850 4508 5713 gene locus_tag LOCUS_11860 gene gspL 4508 5713 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC1 protein_id gnl|my_center|LOCUS_11860 5710 6183 gene locus_tag LOCUS_11870 5710 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 6185 6943 gene locus_tag LOCUS_11880 gene epsN 6185 6943 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45784 protein_id gnl|my_center|LOCUS_11880 6956 7534 gene locus_tag LOCUS_11890 6956 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 7767 7555 gene locus_tag LOCUS_11900 7767 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 8123 7764 gene locus_tag LOCUS_11910 8123 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence102 92 1012 gene locus_tag LOCUS_11920 92 1012 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707287.1 protein_id gnl|my_center|LOCUS_11920 1009 1272 gene locus_tag LOCUS_11930 1009 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11930 1294 1782 gene locus_tag LOCUS_11940 1294 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11940 1782 2450 gene locus_tag LOCUS_11950 1782 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 4410 2533 gene locus_tag LOCUS_11960 4410 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 4668 6293 gene locus_tag LOCUS_11970 4668 6293 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071894.1 protein_id gnl|my_center|LOCUS_11970 6395 6784 gene locus_tag LOCUS_11980 6395 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 7111 6761 gene locus_tag LOCUS_11990 7111 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 7714 7133 gene locus_tag LOCUS_12000 7714 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 8131 7850 gene locus_tag LOCUS_12010 gene ppiC2 8131 7850 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWK5 protein_id gnl|my_center|LOCUS_12010 >Feature sequence103 <1 1272 gene locus_tag LOCUS_12020 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVJ7:glutamate dehydrogenase 3509 1338 gene locus_tag LOCUS_12030 3509 1338 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_12030 4083 4532 gene locus_tag LOCUS_12040 4083 4532 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87G89 protein_id gnl|my_center|LOCUS_12040 4909 5253 gene locus_tag LOCUS_12050 4909 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226834.1 protein_id gnl|my_center|LOCUS_12050 5966 7819 gene locus_tag LOCUS_12060 5966 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 <8531 7981 gene locus_tag LOCUS_12070 <8531 7981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074059.1:class V aminotransferase >Feature sequence104 2947 5745 gene locus_tag LOCUS_12080 2947 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 5993 7078 gene locus_tag LOCUS_12090 5993 7078 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111446.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence105 <1 1473 gene locus_tag LOCUS_12100 <1 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965785.1:transcriptional regulator 1714 2430 gene locus_tag LOCUS_12110 1714 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2627 2797 gene locus_tag LOCUS_12120 2627 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3794 3222 gene locus_tag LOCUS_12130 3794 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 4126 5865 gene locus_tag LOCUS_12140 4126 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073516.1 protein_id gnl|my_center|LOCUS_12140 6368 5910 gene locus_tag LOCUS_12150 6368 5910 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037753.1 protein_id gnl|my_center|LOCUS_12150 7297 6527 gene locus_tag LOCUS_12160 7297 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 7612 8346 gene locus_tag LOCUS_12170 7612 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence106 125 433 gene locus_tag LOCUS_12180 125 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2095 662 gene locus_tag LOCUS_12190 gene rhlE 2095 662 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87J63 protein_id gnl|my_center|LOCUS_12190 3244 2231 gene locus_tag LOCUS_12200 3244 2231 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070874.1 protein_id gnl|my_center|LOCUS_12200 3930 3382 gene locus_tag LOCUS_12210 3930 3382 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_12210 4004 4555 gene locus_tag LOCUS_12220 4004 4555 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262231.1 protein_id gnl|my_center|LOCUS_12220 4581 5048 gene locus_tag LOCUS_12230 4581 5048 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462468.1 protein_id gnl|my_center|LOCUS_12230 5158 5796 gene locus_tag LOCUS_12240 5158 5796 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 protein_id gnl|my_center|LOCUS_12240 6290 5889 gene locus_tag LOCUS_12250 6290 5889 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461766.1 protein_id gnl|my_center|LOCUS_12250 7109 6390 gene locus_tag LOCUS_12260 gene gufA 7109 6390 CDS product divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123018.1 protein_id gnl|my_center|LOCUS_12260 7722 7243 gene locus_tag LOCUS_12270 7722 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_12270 7942 8199 gene locus_tag LOCUS_12280 7942 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence107 <1 543 gene locus_tag LOCUS_12290 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001103638.1:phosphomannomutase 1613 903 gene locus_tag LOCUS_12300 1613 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070552.1 protein_id gnl|my_center|LOCUS_12300 1788 2207 gene locus_tag LOCUS_12310 1788 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2876 2256 gene locus_tag LOCUS_12320 2876 2256 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455373.1 protein_id gnl|my_center|LOCUS_12320 2875 3588 gene locus_tag LOCUS_12330 gene ybbA 2875 3588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072831.1 protein_id gnl|my_center|LOCUS_12330 3578 6079 gene locus_tag LOCUS_12340 gene ybbP 3578 6079 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072830.1 protein_id gnl|my_center|LOCUS_12340 6093 6443 gene locus_tag LOCUS_12350 6093 6443 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477812.1 protein_id gnl|my_center|LOCUS_12350 6989 8137 gene locus_tag LOCUS_12360 6989 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_12360 8223 8402 gene locus_tag LOCUS_12370 8223 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence108 46 2760 gene locus_tag LOCUS_12380 46 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2844 3656 gene locus_tag LOCUS_12390 gene cheR1 2844 3656 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3N9 protein_id gnl|my_center|LOCUS_12390 3658 4275 gene locus_tag LOCUS_12400 gene cheD1 3658 4275 CDS product putative chemoreceptor glutamine deamidase CheD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF62 protein_id gnl|my_center|LOCUS_12400 4284 5309 gene locus_tag LOCUS_12410 gene cheB 4284 5309 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z5V2 protein_id gnl|my_center|LOCUS_12410 6213 5299 gene locus_tag LOCUS_12420 6213 5299 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_12420 6313 7644 gene locus_tag LOCUS_12430 gene dinF 6313 7644 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074213.1 protein_id gnl|my_center|LOCUS_12430 7864 7589 gene locus_tag LOCUS_12440 7864 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 <8391 7881 gene locus_tag LOCUS_12450 <8391 7881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FT82:Fe/S biogenesis protein NfuA >Feature sequence109 1180 1923 gene locus_tag LOCUS_12460 1180 1923 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261310.1 protein_id gnl|my_center|LOCUS_12460 1985 3262 gene locus_tag LOCUS_12470 1985 3262 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_12470 4470 3685 gene locus_tag LOCUS_12480 4470 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 5631 5011 gene locus_tag LOCUS_12490 5631 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073386.1 protein_id gnl|my_center|LOCUS_12490 7322 5745 gene locus_tag LOCUS_12500 gene gshA 7322 5745 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG77 protein_id gnl|my_center|LOCUS_12500 <8361 7380 gene locus_tag LOCUS_12510 <8361 7380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704674.1:quinone oxidoreductase >Feature sequence110 1908 1009 gene locus_tag LOCUS_12520 gene glyQ 1908 1009 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS5 protein_id gnl|my_center|LOCUS_12520 4509 2086 gene locus_tag LOCUS_12530 gene gyrB 4509 2086 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS9 protein_id gnl|my_center|LOCUS_12530 5610 4525 gene locus_tag LOCUS_12540 gene recF 5610 4525 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT0 protein_id gnl|my_center|LOCUS_12540 6717 5614 gene locus_tag LOCUS_12550 gene dnaN 6717 5614 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEE7 protein_id gnl|my_center|LOCUS_12550 8136 6736 gene locus_tag LOCUS_12560 gene dnaA 8136 6736 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9U7 protein_id gnl|my_center|LOCUS_12560 >Feature sequence111 786 115 gene locus_tag LOCUS_12570 786 115 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494926.1 protein_id gnl|my_center|LOCUS_12570 1030 1120 gene locus_tag LOCUS_t00130 1030 1120 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1270 1614 gene locus_tag LOCUS_12580 1270 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1745 2206 gene locus_tag LOCUS_12590 1745 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706144.1 protein_id gnl|my_center|LOCUS_12590 2203 2481 gene locus_tag LOCUS_12600 2203 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2496 3149 gene locus_tag LOCUS_12610 gene proQ 2496 3149 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRY6 protein_id gnl|my_center|LOCUS_12610 3160 4842 gene locus_tag LOCUS_12620 gene prc 3160 4842 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706142.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12620 4870 5196 gene locus_tag LOCUS_12630 4870 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12630 5475 6932 gene locus_tag LOCUS_12640 5475 6932 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence112 <1 515 gene locus_tag LOCUS_12650 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038421.1:gamma-glutamyltranspeptidase 1191 709 gene locus_tag LOCUS_12660 1191 709 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071583.1 protein_id gnl|my_center|LOCUS_12660 1515 1318 gene locus_tag LOCUS_12670 1515 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3757 1733 gene locus_tag LOCUS_12680 3757 1733 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073445.1 protein_id gnl|my_center|LOCUS_12680 4000 5385 gene locus_tag LOCUS_12690 4000 5385 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037121.1 protein_id gnl|my_center|LOCUS_12690 5734 5378 gene locus_tag LOCUS_12700 5734 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 6242 5766 gene locus_tag LOCUS_12710 6242 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence113 <1 771 gene locus_tag LOCUS_12720 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705461.1:lytic transglycosylase 768 1667 gene locus_tag LOCUS_12730 gene yfgA 768 1667 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261365.1 protein_id gnl|my_center|LOCUS_12730 1673 2791 gene locus_tag LOCUS_12740 gene ispG 1673 2791 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S16 protein_id gnl|my_center|LOCUS_12740 2894 4222 gene locus_tag LOCUS_12750 gene hisS 2894 4222 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC33 protein_id gnl|my_center|LOCUS_12750 4232 4852 gene locus_tag LOCUS_12760 gene yfgM 4232 4852 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_12760 4861 6036 gene locus_tag LOCUS_12770 gene bamB 4861 6036 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S13 protein_id gnl|my_center|LOCUS_12770 6109 7590 gene locus_tag LOCUS_12780 gene der 6109 7590 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ48 protein_id gnl|my_center|LOCUS_12780 8183 7650 gene locus_tag LOCUS_12790 gene msrA 8183 7650 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_12790 >Feature sequence114 747 1643 gene locus_tag LOCUS_12800 747 1643 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766730.1 protein_id gnl|my_center|LOCUS_12800 3036 1693 gene locus_tag LOCUS_12810 gene tilS 3036 1693 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3F6 protein_id gnl|my_center|LOCUS_12810 4045 3089 gene locus_tag LOCUS_12820 gene accA 4045 3089 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NIE7 protein_id gnl|my_center|LOCUS_12820 7551 4060 gene locus_tag LOCUS_12830 gene dnaE 7551 4060 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHH8 protein_id gnl|my_center|LOCUS_12830 8147 7551 gene locus_tag LOCUS_12840 gene rnhB 8147 7551 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FWT3 protein_id gnl|my_center|LOCUS_12840 >Feature sequence115 2536 395 gene locus_tag LOCUS_12850 2536 395 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482128.1 protein_id gnl|my_center|LOCUS_12850 3962 2619 gene locus_tag LOCUS_12860 3962 2619 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895528.1 protein_id gnl|my_center|LOCUS_12860 4639 3959 gene locus_tag LOCUS_12870 gene cpxR 4639 3959 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 protein_id gnl|my_center|LOCUS_12870 4891 5514 gene locus_tag LOCUS_12880 4891 5514 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704971.1 protein_id gnl|my_center|LOCUS_12880 6870 5560 gene locus_tag LOCUS_12890 6870 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12890 7098 6922 gene locus_tag LOCUS_12900 7098 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12900 <8128 7085 gene locus_tag LOCUS_12910 <8128 7085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase >Feature sequence116 250 1137 gene locus_tag LOCUS_12920 250 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12920 1159 2613 gene locus_tag LOCUS_12930 gene flhF 1159 2613 CDS product flagellar biosynthesis regulator FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262353.1 protein_id gnl|my_center|LOCUS_12930 2627 2848 gene locus_tag LOCUS_12940 2627 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12940 2861 3487 gene locus_tag LOCUS_12950 2861 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12950 3490 4224 gene locus_tag LOCUS_12960 gene fliA 3490 4224 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD3 protein_id gnl|my_center|LOCUS_12960 4267 4650 gene locus_tag LOCUS_12970 gene cheY 4267 4650 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_12970 4670 5443 gene locus_tag LOCUS_12980 gene cheZ 4670 5443 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI22 protein_id gnl|my_center|LOCUS_12980 5459 7708 gene locus_tag LOCUS_12990 gene cheA-2 5459 7708 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705290.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence117 1771 221 gene locus_tag LOCUS_13000 1771 221 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 protein_id gnl|my_center|LOCUS_13000 2653 4608 gene locus_tag LOCUS_13010 2653 4608 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072315.1 protein_id gnl|my_center|LOCUS_13010 4902 5231 gene locus_tag LOCUS_13020 4902 5231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 5778 5503 gene locus_tag LOCUS_13030 5778 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209715.1 protein_id gnl|my_center|LOCUS_13030 6914 5787 gene locus_tag LOCUS_13040 6914 5787 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_13040 7461 6904 gene locus_tag LOCUS_13050 7461 6904 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098148.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence118 326 784 gene locus_tag LOCUS_13060 326 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1790 915 gene locus_tag LOCUS_13070 1790 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2285 2743 gene locus_tag LOCUS_13080 2285 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3042 2782 gene locus_tag LOCUS_13090 3042 2782 CDS product DUF2999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071035.1 protein_id gnl|my_center|LOCUS_13090 3824 3105 gene locus_tag LOCUS_13100 3824 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706559.1 protein_id gnl|my_center|LOCUS_13100 4184 3870 gene locus_tag LOCUS_13110 4184 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072363.1 protein_id gnl|my_center|LOCUS_13110 4644 4189 gene locus_tag LOCUS_13120 4644 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5447 4707 gene locus_tag LOCUS_13130 5447 4707 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796310.1 protein_id gnl|my_center|LOCUS_13130 6544 5843 gene locus_tag LOCUS_13140 gene deoD-2 6544 5843 CDS product purine nucleoside phosphorylase DeoD-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPE1 protein_id gnl|my_center|LOCUS_13140 6937 6557 gene locus_tag LOCUS_13150 6937 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13150 7771 6968 gene locus_tag LOCUS_13160 7771 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13160 >Feature sequence119 1203 106 gene locus_tag LOCUS_13170 1203 106 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13170 1085 1381 gene locus_tag LOCUS_13180 1085 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2347 2423 gene locus_tag LOCUS_t00140 2347 2423 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2812 4626 gene locus_tag LOCUS_13190 2812 4626 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072470.1 protein_id gnl|my_center|LOCUS_13190 4817 5398 gene locus_tag LOCUS_13200 4817 5398 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MX4 protein_id gnl|my_center|LOCUS_13200 5401 5955 gene locus_tag LOCUS_13210 gene rnfB 5401 5955 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLJ3 protein_id gnl|my_center|LOCUS_13210 5966 7939 gene locus_tag LOCUS_13220 5966 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13220 >Feature sequence120 54 1418 gene locus_tag LOCUS_13230 gene mnmE 54 1418 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVY5 protein_id gnl|my_center|LOCUS_13230 2191 2628 gene locus_tag LOCUS_13240 2191 2628 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458506.1 protein_id gnl|my_center|LOCUS_13240 3059 4948 gene locus_tag LOCUS_13250 gene mnmG 3059 4948 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87K98 protein_id gnl|my_center|LOCUS_13250 4965 5585 gene locus_tag LOCUS_13260 gene rsmG 4965 5585 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87K99 protein_id gnl|my_center|LOCUS_13260 5599 6384 gene locus_tag LOCUS_13270 gene parA 5599 6384 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_13270 6399 7355 gene locus_tag LOCUS_13280 6399 7355 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707915.1 protein_id gnl|my_center|LOCUS_13280 7494 7874 gene locus_tag LOCUS_13290 gene atpI 7494 7874 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074336.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence121 400 1848 gene locus_tag LOCUS_13300 gene yfgC 400 1848 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED93 protein_id gnl|my_center|LOCUS_13300 1880 2227 gene locus_tag LOCUS_13310 1880 2227 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MH6 protein_id gnl|my_center|LOCUS_13310 2227 2778 gene locus_tag LOCUS_13320 2227 2778 CDS product Trp repressor-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457725.1 protein_id gnl|my_center|LOCUS_13320 2826 3221 gene locus_tag LOCUS_13330 2826 3221 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420490.1 protein_id gnl|my_center|LOCUS_13330 4583 3255 gene locus_tag LOCUS_13340 4583 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 4756 4917 gene locus_tag LOCUS_13350 4756 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 6319 4949 gene locus_tag LOCUS_13360 gene argW 6319 4949 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071470.1 protein_id gnl|my_center|LOCUS_13360 7446 6385 gene locus_tag LOCUS_13370 gene nlpB 7446 6385 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3I4 protein_id gnl|my_center|LOCUS_13370 >Feature sequence122 <1 1075 gene locus_tag LOCUS_13380 <1 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073719.1:peptidase S9 1829 1314 gene locus_tag LOCUS_13390 1829 1314 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389004.1 protein_id gnl|my_center|LOCUS_13390 2854 2264 gene locus_tag LOCUS_13400 2854 2264 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070428.1 protein_id gnl|my_center|LOCUS_13400 3030 3887 gene locus_tag LOCUS_13410 3030 3887 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483391.1 protein_id gnl|my_center|LOCUS_13410 4023 4619 gene locus_tag LOCUS_13420 4023 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5247 4873 gene locus_tag LOCUS_13430 5247 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_13430 7308 5302 gene locus_tag LOCUS_13440 gene uvrB 7308 5302 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL12 protein_id gnl|my_center|LOCUS_13440 <7927 7428 gene locus_tag LOCUS_13450 <7927 7428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261057.1:MATE family efflux transporter >Feature sequence123 470 54 gene locus_tag LOCUS_13460 470 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1865 537 gene locus_tag LOCUS_13470 gene hslU 1865 537 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T21 protein_id gnl|my_center|LOCUS_13470 2394 1876 gene locus_tag LOCUS_13480 gene hslV 2394 1876 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T20 protein_id gnl|my_center|LOCUS_13480 3012 2479 gene locus_tag LOCUS_13490 3012 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5191 3020 gene locus_tag LOCUS_13500 gene priA 5191 3020 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTJ4 protein_id gnl|my_center|LOCUS_13500 5409 5624 gene locus_tag LOCUS_13510 gene rpmE 5409 5624 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_13510 6219 7460 gene locus_tag LOCUS_13520 6219 7460 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 protein_id gnl|my_center|LOCUS_13520 7878 7519 gene locus_tag LOCUS_13530 gene metJ 7878 7519 CDS product Met repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L49 protein_id gnl|my_center|LOCUS_13530 >Feature sequence124 710 546 gene locus_tag LOCUS_13540 710 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 712 1794 gene locus_tag LOCUS_13550 712 1794 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 protein_id gnl|my_center|LOCUS_13550 1797 4859 gene locus_tag LOCUS_13560 1797 4859 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478455.1 protein_id gnl|my_center|LOCUS_13560 5074 5742 gene locus_tag LOCUS_13570 5074 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 5873 7294 gene locus_tag LOCUS_13580 5873 7294 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHU4 protein_id gnl|my_center|LOCUS_13580 >Feature sequence125 1888 482 gene locus_tag LOCUS_13590 1888 482 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE8 protein_id gnl|my_center|LOCUS_13590 2591 4414 gene locus_tag LOCUS_13600 2591 4414 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456840.1 protein_id gnl|my_center|LOCUS_13600 5316 4468 gene locus_tag LOCUS_13610 5316 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 6343 5561 gene locus_tag LOCUS_13620 6343 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13620 7633 6479 gene locus_tag LOCUS_13630 7633 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13630 >Feature sequence126 <1 627 gene locus_tag LOCUS_13640 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87LV2:3-methyl-2-oxobutanoate hydroxymethyltransferase 627 1475 gene locus_tag LOCUS_13650 gene panC 627 1475 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIH0 protein_id gnl|my_center|LOCUS_13650 1488 1715 gene locus_tag LOCUS_13660 1488 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 2786 1818 gene locus_tag LOCUS_13670 gene pstS 2786 1818 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071729.1 protein_id gnl|my_center|LOCUS_13670 4199 2892 gene locus_tag LOCUS_13680 gene phoR 4199 2892 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705169.1 protein_id gnl|my_center|LOCUS_13680 4915 4226 gene locus_tag LOCUS_13690 4915 4226 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091117.1 protein_id gnl|my_center|LOCUS_13690 6517 5453 gene locus_tag LOCUS_13700 gene fba 6517 5453 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5Y1 protein_id gnl|my_center|LOCUS_13700 <7843 6667 gene locus_tag LOCUS_13710 <7843 6667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EIB1:phosphoglycerate kinase >Feature sequence127 272 715 gene locus_tag LOCUS_13720 272 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 818 1141 gene locus_tag LOCUS_13730 818 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2339 1101 gene locus_tag LOCUS_13740 2339 1101 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706654.1 protein_id gnl|my_center|LOCUS_13740 2832 2497 gene locus_tag LOCUS_13750 gene rraB 2832 2497 CDS product regulator of ribonuclease activity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNU5 protein_id gnl|my_center|LOCUS_13750 3544 2825 gene locus_tag LOCUS_13760 gene plsC 3544 2825 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPI7 protein_id gnl|my_center|LOCUS_13760 4557 3694 gene locus_tag LOCUS_13770 gene rpoH 4557 3694 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S8 protein_id gnl|my_center|LOCUS_13770 5812 4829 gene locus_tag LOCUS_13780 gene ftsX 5812 4829 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S7 protein_id gnl|my_center|LOCUS_13780 6486 5809 gene locus_tag LOCUS_13790 gene ftsE 6486 5809 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_13790 7319 6558 gene locus_tag LOCUS_13800 7319 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence128 441 2672 gene locus_tag LOCUS_13810 441 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2798 3037 gene locus_tag LOCUS_13820 2798 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3299 3481 gene locus_tag LOCUS_13830 3299 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3828 4229 gene locus_tag LOCUS_13840 3828 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4370 5032 gene locus_tag LOCUS_13850 gene hypR 4370 5032 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072770.1 protein_id gnl|my_center|LOCUS_13850 5430 5056 gene locus_tag LOCUS_13860 gene yjqA 5430 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522465.1 protein_id gnl|my_center|LOCUS_13860 6335 5433 gene locus_tag LOCUS_13870 6335 5433 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071977.1 protein_id gnl|my_center|LOCUS_13870 7141 6332 gene locus_tag LOCUS_13880 7141 6332 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071978.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence129 1426 1163 gene locus_tag LOCUS_13890 1426 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13890 3370 1535 gene locus_tag LOCUS_13900 3370 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 4459 3857 gene locus_tag LOCUS_13910 4459 3857 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070716.1 protein_id gnl|my_center|LOCUS_13910 5121 4456 gene locus_tag LOCUS_13920 5121 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 5666 6583 gene locus_tag LOCUS_13930 5666 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114815.1 protein_id gnl|my_center|LOCUS_13930 6583 7275 gene locus_tag LOCUS_13940 6583 7275 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 protein_id gnl|my_center|LOCUS_13940 7566 7402 gene locus_tag LOCUS_13950 7566 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13950 >Feature sequence130 2405 3 gene locus_tag LOCUS_13960 2405 3 CDS product sugar hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_13960 2596 3591 gene locus_tag LOCUS_13970 2596 3591 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529706.1 protein_id gnl|my_center|LOCUS_13970 3909 5465 gene locus_tag LOCUS_13980 3909 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 5822 6871 gene locus_tag LOCUS_13990 5822 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13990 >Feature sequence131 1297 1506 gene locus_tag LOCUS_14000 1297 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1753 2667 gene locus_tag LOCUS_14010 1753 2667 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268102.1 protein_id gnl|my_center|LOCUS_14010 3072 2674 gene locus_tag LOCUS_14020 3072 2674 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ01 protein_id gnl|my_center|LOCUS_14020 3259 4110 gene locus_tag LOCUS_14030 3259 4110 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 protein_id gnl|my_center|LOCUS_14030 4263 4517 gene locus_tag LOCUS_14040 4263 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 4609 7476 gene locus_tag LOCUS_14050 4609 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence132 236 403 gene locus_tag LOCUS_14060 236 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3304 641 gene locus_tag LOCUS_14070 3304 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 5584 3341 gene locus_tag LOCUS_14080 5584 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 6303 5707 gene locus_tag LOCUS_14090 6303 5707 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937337.1 protein_id gnl|my_center|LOCUS_14090 6478 7362 gene locus_tag LOCUS_14100 6478 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266939.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence133 1972 521 gene locus_tag LOCUS_14110 gene trkH 1972 521 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_14110 2638 2024 gene locus_tag LOCUS_14120 2638 2024 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704168.1 protein_id gnl|my_center|LOCUS_14120 4094 2772 gene locus_tag LOCUS_14130 gene pepQ 4094 2772 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR8 protein_id gnl|my_center|LOCUS_14130 6074 4188 gene locus_tag LOCUS_14140 6074 4188 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence134 2143 197 gene locus_tag LOCUS_14150 2143 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 protein_id gnl|my_center|LOCUS_14150 3613 2246 gene locus_tag LOCUS_14160 3613 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4121 3603 gene locus_tag LOCUS_14170 4121 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14170 5030 7123 gene locus_tag LOCUS_14180 5030 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence135 <1 1223 gene locus_tag LOCUS_14190 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005417487.1:metalloprotease PmbA 3362 1302 gene locus_tag LOCUS_14200 3362 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14200 4064 3426 gene locus_tag LOCUS_14210 4064 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4821 4231 gene locus_tag LOCUS_14220 gene slmA 4821 4231 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_14220 5626 5003 gene locus_tag LOCUS_14230 5626 5003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14230 6190 5672 gene locus_tag LOCUS_14240 6190 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14240 6340 7014 gene locus_tag LOCUS_14250 6340 7014 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T86 protein_id gnl|my_center|LOCUS_14250 7286 7522 gene locus_tag LOCUS_14260 gene rpmB 7286 7522 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVC8 protein_id gnl|my_center|LOCUS_14260 >Feature sequence136 2201 822 gene locus_tag LOCUS_14270 gene dnaB 2201 822 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH08 protein_id gnl|my_center|LOCUS_14270 3275 2337 gene locus_tag LOCUS_14280 3275 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073605.1 protein_id gnl|my_center|LOCUS_14280 3753 3286 gene locus_tag LOCUS_14290 3753 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4309 3746 gene locus_tag LOCUS_14300 4309 3746 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_14300 6315 4471 gene locus_tag LOCUS_14310 6315 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071140.1 protein_id gnl|my_center|LOCUS_14310 6848 6312 gene locus_tag LOCUS_14320 6848 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 7257 6832 gene locus_tag LOCUS_14330 7257 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence137 2583 1027 gene locus_tag LOCUS_14340 gene bkdB 2583 1027 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN6 protein_id gnl|my_center|LOCUS_14340 3570 2593 gene locus_tag LOCUS_14350 gene bkdA2 3570 2593 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 protein_id gnl|my_center|LOCUS_14350 4787 3570 gene locus_tag LOCUS_14360 gene bkdA1 4787 3570 CDS product 3-methyl-2-oxobutanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 protein_id gnl|my_center|LOCUS_14360 6070 5036 gene locus_tag LOCUS_14370 gene astE 6070 5036 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM71 protein_id gnl|my_center|LOCUS_14370 <7505 6162 gene locus_tag LOCUS_14380 <7505 6162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705434.1:phosphoglucomutase, alpha-D-glucose phosphate-specific >Feature sequence138 985 794 gene locus_tag LOCUS_14390 985 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 2389 1091 gene locus_tag LOCUS_14400 2389 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 3983 2745 gene locus_tag LOCUS_14410 3983 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 4930 3980 gene locus_tag LOCUS_14420 4930 3980 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_14420 5610 5212 gene locus_tag LOCUS_14430 5610 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 7272 5614 gene locus_tag LOCUS_14440 7272 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence139 2347 278 gene locus_tag LOCUS_14450 2347 278 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459357.1 protein_id gnl|my_center|LOCUS_14450 5684 2535 gene locus_tag LOCUS_14460 5684 2535 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479898.1 protein_id gnl|my_center|LOCUS_14460 6870 5695 gene locus_tag LOCUS_14470 6870 5695 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106254.1 protein_id gnl|my_center|LOCUS_14470 7352 7059 gene locus_tag LOCUS_14480 7352 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence140 327 1169 gene locus_tag LOCUS_14490 327 1169 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_14490 1169 1906 gene locus_tag LOCUS_14500 1169 1906 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072093.1 protein_id gnl|my_center|LOCUS_14500 2076 2621 gene locus_tag LOCUS_14510 gene apt 2076 2621 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG1 protein_id gnl|my_center|LOCUS_14510 2623 5028 gene locus_tag LOCUS_14520 2623 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 5086 5412 gene locus_tag LOCUS_14530 5086 5412 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD5 protein_id gnl|my_center|LOCUS_14530 5974 6135 gene locus_tag LOCUS_14540 5974 6135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 6753 6139 gene locus_tag LOCUS_14550 6753 6139 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093976.1 protein_id gnl|my_center|LOCUS_14550 7121 6765 gene locus_tag LOCUS_14560 7121 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence141 1152 40 gene locus_tag LOCUS_14570 gene gfcE 1152 40 CDS product polysaccharide export protein Wza inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261018.1 protein_id gnl|my_center|LOCUS_14570 1770 1573 gene locus_tag LOCUS_14580 1770 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14580 3130 2096 gene locus_tag LOCUS_14590 3130 2096 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481622.1 protein_id gnl|my_center|LOCUS_14590 4283 3117 gene locus_tag LOCUS_14600 4283 3117 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097850.1 protein_id gnl|my_center|LOCUS_14600 5283 5098 gene locus_tag LOCUS_14610 5283 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 5632 5270 gene locus_tag LOCUS_14620 5632 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14620 5824 5651 gene locus_tag LOCUS_14630 5824 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14630 6349 6155 gene locus_tag LOCUS_14640 6349 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14640 <7423 6852 gene locus_tag LOCUS_14650 <7423 6852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000756756.1:UDP-N-acetyl glucosamine 2-epimerase >Feature sequence142 <1 1892 gene locus_tag LOCUS_14660 <1 1892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease 2199 4607 gene locus_tag LOCUS_14670 2199 4607 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_14670 4745 7117 gene locus_tag LOCUS_14680 4745 7117 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence143 601 293 gene locus_tag LOCUS_14690 601 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1439 702 gene locus_tag LOCUS_14700 gene bioH 1439 702 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF11 protein_id gnl|my_center|LOCUS_14700 1496 2200 gene locus_tag LOCUS_14710 1496 2200 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074221.1 protein_id gnl|my_center|LOCUS_14710 4717 2162 gene locus_tag LOCUS_14720 4717 2162 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_14720 5444 4827 gene locus_tag LOCUS_14730 5444 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 6045 5668 gene locus_tag LOCUS_14740 gene ytrA 6045 5668 CDS product HTH-type transcriptional repressor YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34712 protein_id gnl|my_center|LOCUS_14740 6944 6663 gene locus_tag LOCUS_14750 6944 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence144 1367 618 gene locus_tag LOCUS_14760 1367 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14760 3230 1509 gene locus_tag LOCUS_14770 3230 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14770 4139 3354 gene locus_tag LOCUS_14780 4139 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_14780 4972 4157 gene locus_tag LOCUS_14790 4972 4157 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_14790 5111 5186 gene locus_tag LOCUS_t00150 5111 5186 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 <7332 5214 gene locus_tag LOCUS_14800 <7332 5214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388417.1:diguanylate cyclase >Feature sequence145 339 863 gene locus_tag LOCUS_14810 gene fliL 339 863 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073106.1 protein_id gnl|my_center|LOCUS_14810 874 1968 gene locus_tag LOCUS_14820 gene fliM 874 1968 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI10 protein_id gnl|my_center|LOCUS_14820 1992 2390 gene locus_tag LOCUS_14830 1992 2390 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YW6 protein_id gnl|my_center|LOCUS_14830 2387 2785 gene locus_tag LOCUS_14840 2387 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2778 3518 gene locus_tag LOCUS_14850 gene fliP 2778 3518 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC5 protein_id gnl|my_center|LOCUS_14850 3520 3789 gene locus_tag LOCUS_14860 gene fliQ 3520 3789 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073101.1 protein_id gnl|my_center|LOCUS_14860 3792 4571 gene locus_tag LOCUS_14870 gene fliR 3792 4571 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC7 protein_id gnl|my_center|LOCUS_14870 4575 5705 gene locus_tag LOCUS_14880 gene flhB 4575 5705 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073099.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence146 660 130 gene locus_tag LOCUS_14890 660 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1589 849 gene locus_tag LOCUS_14900 gene cysH 1589 849 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJS4 protein_id gnl|my_center|LOCUS_14900 3355 1637 gene locus_tag LOCUS_14910 gene cysI 3355 1637 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E840 protein_id gnl|my_center|LOCUS_14910 5224 3410 gene locus_tag LOCUS_14920 5224 3410 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNK9 protein_id gnl|my_center|LOCUS_14920 5859 5479 gene locus_tag LOCUS_14930 5859 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 6094 6804 gene locus_tag LOCUS_14940 6094 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence147 196 543 gene locus_tag LOCUS_14950 196 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 677 835 gene locus_tag LOCUS_14960 677 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14960 3781 1715 gene locus_tag LOCUS_14970 gene pepO 3781 1715 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_14970 4171 4605 gene locus_tag LOCUS_14980 4171 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5718 4597 gene locus_tag LOCUS_14990 5718 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 5879 6478 gene locus_tag LOCUS_15000 gene recR 5879 6478 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MQ4 protein_id gnl|my_center|LOCUS_15000 6762 6544 gene locus_tag LOCUS_15010 6762 6544 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_15010 7237 6755 gene locus_tag LOCUS_15020 7237 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence148 1145 3025 gene locus_tag LOCUS_15030 gene speA 1145 3025 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIP8 protein_id gnl|my_center|LOCUS_15030 3129 3995 gene locus_tag LOCUS_15040 3129 3995 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707863.1 protein_id gnl|my_center|LOCUS_15040 4008 4922 gene locus_tag LOCUS_15050 4008 4922 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481175.1 protein_id gnl|my_center|LOCUS_15050 4919 6091 gene locus_tag LOCUS_15060 4919 6091 CDS product miniconductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894643.1 protein_id gnl|my_center|LOCUS_15060 6299 7078 gene locus_tag LOCUS_15070 6299 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence149 2427 19 gene locus_tag LOCUS_15080 2427 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2803 3033 gene locus_tag LOCUS_15090 2803 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 3017 3211 gene locus_tag LOCUS_15100 3017 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 3989 4777 gene locus_tag LOCUS_15110 3989 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 4986 4822 gene locus_tag LOCUS_15120 4986 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 5643 5086 gene locus_tag LOCUS_15130 5643 5086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6181 6271 gene locus_tag LOCUS_t00160 6181 6271 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6287 6379 gene locus_tag LOCUS_t00170 6287 6379 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6587 7111 gene locus_tag LOCUS_15140 6587 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence150 <1 670 gene locus_tag LOCUS_15150 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E2E6:acetylglutamate kinase 680 1600 gene locus_tag LOCUS_15160 gene argF-1 680 1600 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFV2 protein_id gnl|my_center|LOCUS_15160 1611 2819 gene locus_tag LOCUS_15170 gene argG 1611 2819 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK28 protein_id gnl|my_center|LOCUS_15170 2844 4223 gene locus_tag LOCUS_15180 gene argH 2844 4223 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNT9 protein_id gnl|my_center|LOCUS_15180 4493 4657 gene locus_tag LOCUS_15190 4493 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 4742 5218 gene locus_tag LOCUS_15200 4742 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 5398 5892 gene locus_tag LOCUS_15210 5398 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 5905 6522 gene locus_tag LOCUS_15220 5905 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence151 473 796 gene locus_tag LOCUS_15230 473 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1055 786 gene locus_tag LOCUS_15240 1055 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423827.1 protein_id gnl|my_center|LOCUS_15240 1242 1066 gene locus_tag LOCUS_15250 1242 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1576 1298 gene locus_tag LOCUS_15260 1576 1298 CDS product glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423838.1 protein_id gnl|my_center|LOCUS_15260 1858 1586 gene locus_tag LOCUS_15270 1858 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2240 1851 gene locus_tag LOCUS_15280 2240 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2683 2390 gene locus_tag LOCUS_15290 2683 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423827.1 protein_id gnl|my_center|LOCUS_15290 3029 2754 gene locus_tag LOCUS_15300 3029 2754 CDS product glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423838.1 protein_id gnl|my_center|LOCUS_15300 3384 3118 gene locus_tag LOCUS_15310 3384 3118 CDS product glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423838.1 protein_id gnl|my_center|LOCUS_15310 3757 3467 gene locus_tag LOCUS_15320 3757 3467 CDS product glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423832.1 protein_id gnl|my_center|LOCUS_15320 4027 3812 gene locus_tag LOCUS_15330 4027 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 5612 4134 gene locus_tag LOCUS_15340 5612 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 6153 6686 gene locus_tag LOCUS_15350 gene lspA 6153 6686 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CMS8 protein_id gnl|my_center|LOCUS_15350 >Feature sequence152 3302 1221 gene locus_tag LOCUS_15360 gene pepO 3302 1221 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070787.1 protein_id gnl|my_center|LOCUS_15360 3752 3360 gene locus_tag LOCUS_15370 gene mutT 3752 3360 CDS product 7,8-dihydro-8-oxoguanine-triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070770.1 protein_id gnl|my_center|LOCUS_15370 6522 3814 gene locus_tag LOCUS_15380 gene secA 6522 3814 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPW5 protein_id gnl|my_center|LOCUS_15380 >Feature sequence153 567 1910 gene locus_tag LOCUS_15390 567 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1907 2893 gene locus_tag LOCUS_15400 1907 2893 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087701.1 protein_id gnl|my_center|LOCUS_15400 2902 4521 gene locus_tag LOCUS_15410 2902 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15410 4534 4863 gene locus_tag LOCUS_15420 4534 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15420 4912 5772 gene locus_tag LOCUS_15430 4912 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15430 5845 6039 gene locus_tag LOCUS_15440 5845 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15440 6154 6723 gene locus_tag LOCUS_15450 6154 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence154 4281 10 gene locus_tag LOCUS_15460 4281 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 5009 4413 gene locus_tag LOCUS_15470 5009 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 5869 5006 gene locus_tag LOCUS_15480 5869 5006 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263304.1 protein_id gnl|my_center|LOCUS_15480 6476 6934 gene locus_tag LOCUS_15490 gene mraZ 6476 6934 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPY1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence155 1933 923 gene locus_tag LOCUS_15500 gene murB 1933 923 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P08373 protein_id gnl|my_center|LOCUS_15500 2065 2343 gene locus_tag LOCUS_15510 2065 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2515 3912 gene locus_tag LOCUS_15520 2515 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15520 4576 3986 gene locus_tag LOCUS_15530 4576 3986 CDS product UPF0319 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFZ8 protein_id gnl|my_center|LOCUS_15530 4712 5083 gene locus_tag LOCUS_15540 4712 5083 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902960.1 protein_id gnl|my_center|LOCUS_15540 5310 5966 gene locus_tag LOCUS_15550 5310 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence156 1676 1425 gene locus_tag LOCUS_15560 1676 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1670 2443 gene locus_tag LOCUS_15570 gene fabG 1670 2443 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013843.1 protein_id gnl|my_center|LOCUS_15570 2443 3762 gene locus_tag LOCUS_15580 2443 3762 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013841.1 protein_id gnl|my_center|LOCUS_15580 3771 4592 gene locus_tag LOCUS_15590 gene thiD 3771 4592 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263201.1 protein_id gnl|my_center|LOCUS_15590 4958 5941 gene locus_tag LOCUS_15600 4958 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 6068 6829 gene locus_tag LOCUS_15610 6068 6829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence157 650 1891 gene locus_tag LOCUS_15620 650 1891 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261604.1 protein_id gnl|my_center|LOCUS_15620 5239 2078 gene locus_tag LOCUS_15630 5239 2078 CDS product lantibiotic dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026974.1 protein_id gnl|my_center|LOCUS_15630 6460 5249 gene locus_tag LOCUS_15640 6460 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence158 670 236 gene locus_tag LOCUS_15650 670 236 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381641.1 protein_id gnl|my_center|LOCUS_15650 811 1293 gene locus_tag LOCUS_15660 gene smpB 811 1293 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKI0 protein_id gnl|my_center|LOCUS_15660 1328 5509 gene locus_tag LOCUS_15670 1328 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 6743 5556 gene locus_tag LOCUS_15680 gene pyrD 6743 5556 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NC99 protein_id gnl|my_center|LOCUS_15680 >Feature sequence159 1692 3764 gene locus_tag LOCUS_15690 gene dinG 1692 3764 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071940.1 protein_id gnl|my_center|LOCUS_15690 3764 4543 gene locus_tag LOCUS_15700 gene yfcA 3764 4543 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E643 protein_id gnl|my_center|LOCUS_15700 4540 5142 gene locus_tag LOCUS_15710 4540 5142 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071938.1 protein_id gnl|my_center|LOCUS_15710 5139 6029 gene locus_tag LOCUS_15720 5139 6029 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461762.1 protein_id gnl|my_center|LOCUS_15720 6072 6350 gene locus_tag LOCUS_15730 6072 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 6340 6501 gene locus_tag LOCUS_15740 6340 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence160 207 1229 gene locus_tag LOCUS_15750 gene nadA 207 1229 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN5 protein_id gnl|my_center|LOCUS_15750 1330 1419 gene locus_tag LOCUS_t00180 1330 1419 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1610 2638 gene locus_tag LOCUS_15760 1610 2638 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998604.1 protein_id gnl|my_center|LOCUS_15760 2838 6107 gene locus_tag LOCUS_15770 gene recC 2838 6107 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ59 protein_id gnl|my_center|LOCUS_15770 >Feature sequence161 1277 21 gene locus_tag LOCUS_15780 1277 21 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804287.1 protein_id gnl|my_center|LOCUS_15780 3103 1454 gene locus_tag LOCUS_15790 gene groL1 3103 1454 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNR7 protein_id gnl|my_center|LOCUS_15790 3436 3149 gene locus_tag LOCUS_15800 gene groS 3436 3149 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6F9 protein_id gnl|my_center|LOCUS_15800 4079 3597 gene locus_tag LOCUS_15810 gene fxsA 4079 3597 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_15810 4257 4577 gene locus_tag LOCUS_15820 4257 4577 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_15820 4577 6343 gene locus_tag LOCUS_15830 gene dsbD 4577 6343 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD7 protein_id gnl|my_center|LOCUS_15830 >Feature sequence162 2026 1376 gene locus_tag LOCUS_15840 2026 1376 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLY1 protein_id gnl|my_center|LOCUS_15840 2435 5182 gene locus_tag LOCUS_15850 gene polA 2435 5182 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074260.1 protein_id gnl|my_center|LOCUS_15850 5615 6178 gene locus_tag LOCUS_15860 5615 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262066.1 protein_id gnl|my_center|LOCUS_15860 6198 6719 gene locus_tag LOCUS_15870 6198 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence163 <1 527 gene locus_tag LOCUS_15880 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462975.1:ATPase AAA 527 1477 gene locus_tag LOCUS_15890 527 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263513.1 protein_id gnl|my_center|LOCUS_15890 1481 1915 gene locus_tag LOCUS_15900 1481 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1908 2903 gene locus_tag LOCUS_15910 gene batA 1908 2903 CDS product VWR domain protein in aerotolerance operon BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 protein_id gnl|my_center|LOCUS_15910 2905 4785 gene locus_tag LOCUS_15920 gene batB 2905 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 protein_id gnl|my_center|LOCUS_15920 4779 6410 gene locus_tag LOCUS_15930 gene batD 4779 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072992.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence164 75 167 gene locus_tag LOCUS_t00190 75 167 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 189 265 gene locus_tag LOCUS_t00200 189 265 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1034 714 gene locus_tag LOCUS_15940 1034 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15940 1103 1771 gene locus_tag LOCUS_15950 1103 1771 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208749.1 protein_id gnl|my_center|LOCUS_15950 2471 2301 gene locus_tag LOCUS_15960 2471 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2398 3402 gene locus_tag LOCUS_15970 2398 3402 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420827.1 protein_id gnl|my_center|LOCUS_15970 3693 5033 gene locus_tag LOCUS_15980 gene fbpB 3693 5033 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071050.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15980 5033 6064 gene locus_tag LOCUS_15990 5033 6064 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461276.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence165 487 648 gene locus_tag LOCUS_16000 487 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 719 1954 gene locus_tag LOCUS_16010 719 1954 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387846.1 protein_id gnl|my_center|LOCUS_16010 2896 2012 gene locus_tag LOCUS_16020 2896 2012 CDS product chloramphenicol resistance permease RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480950.1 protein_id gnl|my_center|LOCUS_16020 3055 3846 gene locus_tag LOCUS_16030 3055 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16030 3871 4881 gene locus_tag LOCUS_16040 3871 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16040 4885 5178 gene locus_tag LOCUS_16050 4885 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence166 947 129 gene locus_tag LOCUS_16060 gene speD 947 129 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBJ7 protein_id gnl|my_center|LOCUS_16060 1436 1023 gene locus_tag LOCUS_16070 1436 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703648.1 protein_id gnl|my_center|LOCUS_16070 1853 1518 gene locus_tag LOCUS_16080 1853 1518 CDS product topoisomerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072801.1 protein_id gnl|my_center|LOCUS_16080 3477 2005 gene locus_tag LOCUS_16090 gene astD 3477 2005 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN18 protein_id gnl|my_center|LOCUS_16090 4508 3492 gene locus_tag LOCUS_16100 gene astA 4508 3492 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJ55 protein_id gnl|my_center|LOCUS_16100 5787 4576 gene locus_tag LOCUS_16110 gene argD 5787 4576 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN20 protein_id gnl|my_center|LOCUS_16110 >Feature sequence167 1236 376 gene locus_tag LOCUS_16120 gene tesB 1236 376 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167662.1 protein_id gnl|my_center|LOCUS_16120 1365 1838 gene locus_tag LOCUS_16130 1365 1838 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106124.1 protein_id gnl|my_center|LOCUS_16130 2913 1846 gene locus_tag LOCUS_16140 2913 1846 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459829.1 protein_id gnl|my_center|LOCUS_16140 3090 4034 gene locus_tag LOCUS_16150 gene cheV 3090 4034 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072079.1 protein_id gnl|my_center|LOCUS_16150 4183 6348 gene locus_tag LOCUS_16160 gene uvrD 4183 6348 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KET2 protein_id gnl|my_center|LOCUS_16160 >Feature sequence168 1019 1996 gene locus_tag LOCUS_16170 gene cysB 1019 1996 CDS product transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419628.1 protein_id gnl|my_center|LOCUS_16170 3427 2051 gene locus_tag LOCUS_16180 gene sdaA-2 3427 2051 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705997.1 protein_id gnl|my_center|LOCUS_16180 4077 3517 gene locus_tag LOCUS_16190 4077 3517 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338789.1 protein_id gnl|my_center|LOCUS_16190 5449 4097 gene locus_tag LOCUS_16200 gene pabB 5449 4097 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072245.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence169 238 35 gene locus_tag LOCUS_16210 238 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1168 356 gene locus_tag LOCUS_16220 1168 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16220 1944 1168 gene locus_tag LOCUS_16230 1944 1168 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477237.1 protein_id gnl|my_center|LOCUS_16230 3117 1960 gene locus_tag LOCUS_16240 gene ivdC 3117 1960 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 protein_id gnl|my_center|LOCUS_16240 4681 3191 gene locus_tag LOCUS_16250 gene ivdB 4681 3191 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071828.1 protein_id gnl|my_center|LOCUS_16250 5159 4758 gene locus_tag LOCUS_16260 5159 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16260 5936 5340 gene locus_tag LOCUS_16270 5936 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16270 >Feature sequence170 92 913 gene locus_tag LOCUS_16280 92 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1049 1846 gene locus_tag LOCUS_16290 gene truA 1049 1846 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTA4 protein_id gnl|my_center|LOCUS_16290 1990 2871 gene locus_tag LOCUS_16300 gene accD 1990 2871 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTA3 protein_id gnl|my_center|LOCUS_16300 2894 4156 gene locus_tag LOCUS_16310 gene folC 2894 4156 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706492.1 protein_id gnl|my_center|LOCUS_16310 4168 4848 gene locus_tag LOCUS_16320 gene dedD 4168 4848 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209731.1 protein_id gnl|my_center|LOCUS_16320 4910 5404 gene locus_tag LOCUS_16330 gene cvpA 4910 5404 CDS product bacteriocin production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072963.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence171 462 998 gene locus_tag LOCUS_16340 462 998 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_16340 1351 1100 gene locus_tag LOCUS_16350 1351 1100 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890111.1 protein_id gnl|my_center|LOCUS_16350 1650 2711 gene locus_tag LOCUS_16360 1650 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262521.1 protein_id gnl|my_center|LOCUS_16360 2766 3545 gene locus_tag LOCUS_16370 2766 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16370 3618 3806 gene locus_tag LOCUS_16380 3618 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 4869 4003 gene locus_tag LOCUS_16390 gene htpX 4869 4003 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KID0 protein_id gnl|my_center|LOCUS_16390 5777 5097 gene locus_tag LOCUS_16400 5777 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16400 >Feature sequence172 88 720 gene locus_tag LOCUS_16410 88 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1050 760 gene locus_tag LOCUS_16420 1050 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1477 1064 gene locus_tag LOCUS_16430 1477 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 5410 1526 gene locus_tag LOCUS_16440 5410 1526 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231026.2 protein_id gnl|my_center|LOCUS_16440 5934 5506 gene locus_tag LOCUS_16450 5934 5506 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461138.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence173 819 331 gene locus_tag LOCUS_16460 819 331 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978983.1 protein_id gnl|my_center|LOCUS_16460 2183 816 gene locus_tag LOCUS_16470 gene pcnB 2183 816 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2T5 protein_id gnl|my_center|LOCUS_16470 3267 2359 gene locus_tag LOCUS_16480 gene yadB 3267 2359 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1WN59 protein_id gnl|my_center|LOCUS_16480 3720 3277 gene locus_tag LOCUS_16490 gene dksA 3720 3277 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP03 protein_id gnl|my_center|LOCUS_16490 4594 3890 gene locus_tag LOCUS_16500 gene sfsA 4594 3890 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJP3 protein_id gnl|my_center|LOCUS_16500 4677 5972 gene locus_tag LOCUS_16510 4677 5972 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705640.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence174 <1 828 gene locus_tag LOCUS_16520 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070706.1:diguanylate cyclase 1926 919 gene locus_tag LOCUS_16530 gene gpsA 1926 919 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF08 protein_id gnl|my_center|LOCUS_16530 2413 1931 gene locus_tag LOCUS_16540 gene secB 2413 1931 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKP0 protein_id gnl|my_center|LOCUS_16540 2708 2451 gene locus_tag LOCUS_16550 gene grxC 2708 2451 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970079.1 protein_id gnl|my_center|LOCUS_16550 3155 2724 gene locus_tag LOCUS_16560 3155 2724 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070465.1 protein_id gnl|my_center|LOCUS_16560 3372 4916 gene locus_tag LOCUS_16570 gene gpmI 3372 4916 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_16570 4916 6046 gene locus_tag LOCUS_16580 4916 6046 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence175 1316 2080 gene locus_tag LOCUS_16590 1316 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2392 4998 gene locus_tag LOCUS_16600 2392 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5455 5006 gene locus_tag LOCUS_16610 gene b4373 5455 5006 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WJN3 protein_id gnl|my_center|LOCUS_16610 5738 5436 gene locus_tag LOCUS_16620 5738 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 5876 5800 gene locus_tag LOCUS_t00210 5876 5800 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence176 44 241 gene locus_tag LOCUS_16630 44 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1499 288 gene locus_tag LOCUS_16640 1499 288 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478826.1 protein_id gnl|my_center|LOCUS_16640 2286 1513 gene locus_tag LOCUS_16650 2286 1513 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_16650 2611 3741 gene locus_tag LOCUS_16660 gene czcB2 2611 3741 CDS product cation efflux system (czcB-like) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880852.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence177 2024 576 gene locus_tag LOCUS_16670 gene exaC 2024 576 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074108.1 protein_id gnl|my_center|LOCUS_16670 2182 3087 gene locus_tag LOCUS_16680 2182 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 4106 3102 gene locus_tag LOCUS_16690 gene sohB 4106 3102 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072837.1 protein_id gnl|my_center|LOCUS_16690 5146 4184 gene locus_tag LOCUS_16700 5146 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16700 <6378 5150 gene locus_tag LOCUS_16710 <6378 5150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072838.1:lipase note possible pseudo, internal stop codon >Feature sequence178 122 673 gene locus_tag LOCUS_16720 122 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_16720 2791 731 gene locus_tag LOCUS_16730 2791 731 CDS product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_16730 3081 5177 gene locus_tag LOCUS_16740 3081 5177 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071095.1 protein_id gnl|my_center|LOCUS_16740 5167 5655 gene locus_tag LOCUS_16750 5167 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence179 1252 272 gene locus_tag LOCUS_16760 1252 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706755.1 protein_id gnl|my_center|LOCUS_16760 1338 2009 gene locus_tag LOCUS_16770 1338 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252936.1 protein_id gnl|my_center|LOCUS_16770 2103 2019 gene locus_tag LOCUS_t00220 2103 2019 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2216 2737 gene locus_tag LOCUS_16780 2216 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3193 2726 gene locus_tag LOCUS_16790 3193 2726 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQZ5 protein_id gnl|my_center|LOCUS_16790 3727 3209 gene locus_tag LOCUS_16800 3727 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 4287 3829 gene locus_tag LOCUS_16810 4287 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 4605 5906 gene locus_tag LOCUS_16820 4605 5906 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456001.1 protein_id gnl|my_center|LOCUS_16820 6107 5940 gene locus_tag LOCUS_16830 6107 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence180 124 972 gene locus_tag LOCUS_16840 124 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16840 997 1344 gene locus_tag LOCUS_16850 997 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16850 1437 1628 gene locus_tag LOCUS_16860 gene csrA 1437 1628 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK11 protein_id gnl|my_center|LOCUS_16860 2135 1662 gene locus_tag LOCUS_16870 2135 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2568 2801 gene locus_tag LOCUS_16880 gene oadC 2568 2801 CDS product putative oxaloacetate decarboxylase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1WN04 protein_id gnl|my_center|LOCUS_16880 2816 4597 gene locus_tag LOCUS_16890 gene oadA 2816 4597 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261303.1 protein_id gnl|my_center|LOCUS_16890 4606 5736 gene locus_tag LOCUS_16900 gene oadB 4606 5736 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417780.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence181 2253 1288 gene locus_tag LOCUS_16910 2253 1288 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089234.1 protein_id gnl|my_center|LOCUS_16910 2542 3582 gene locus_tag LOCUS_16920 2542 3582 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_16920 3579 4319 gene locus_tag LOCUS_16930 3579 4319 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_16930 >Feature sequence182 906 2393 gene locus_tag LOCUS_16940 gene ubiD 906 2393 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR58 protein_id gnl|my_center|LOCUS_16940 2423 3136 gene locus_tag LOCUS_16950 gene fre 2423 3136 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459134.1 protein_id gnl|my_center|LOCUS_16950 4052 3342 gene locus_tag LOCUS_16960 4052 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4177 4500 gene locus_tag LOCUS_16970 4177 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 4547 5239 gene locus_tag LOCUS_16980 4547 5239 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479958.1 protein_id gnl|my_center|LOCUS_16980 5481 5299 gene locus_tag LOCUS_16990 5481 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 5702 5514 gene locus_tag LOCUS_17000 5702 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 5889 6296 gene locus_tag LOCUS_17010 5889 6296 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707727.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence183 65 538 gene locus_tag LOCUS_17020 65 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 931 2772 gene locus_tag LOCUS_17030 gene edd 931 2772 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072452.1 protein_id gnl|my_center|LOCUS_17030 2808 3428 gene locus_tag LOCUS_17040 2808 3428 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709432.1 protein_id gnl|my_center|LOCUS_17040 3443 4450 gene locus_tag LOCUS_17050 gene gapA 3443 4450 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN3 protein_id gnl|my_center|LOCUS_17050 5352 4678 gene locus_tag LOCUS_17060 gene rnt 5352 4678 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDJ2 protein_id gnl|my_center|LOCUS_17060 5529 6191 gene locus_tag LOCUS_17070 5529 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17070 >Feature sequence184 1624 992 gene locus_tag LOCUS_17080 1624 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3121 1799 gene locus_tag LOCUS_17090 3121 1799 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_17090 4491 3121 gene locus_tag LOCUS_17100 4491 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17100 5295 4564 gene locus_tag LOCUS_17110 5295 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17110 6236 6081 gene locus_tag LOCUS_17120 gene rpmG 6236 6081 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM33 protein_id gnl|my_center|LOCUS_17120 >Feature sequence185 244 918 gene locus_tag LOCUS_17130 244 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2938 1088 gene locus_tag LOCUS_17140 gene recG 2938 1088 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Z1 protein_id gnl|my_center|LOCUS_17140 3175 2945 gene locus_tag LOCUS_17150 3175 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17150 3893 3198 gene locus_tag LOCUS_17160 gene trmH 3893 3198 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KR25 protein_id gnl|my_center|LOCUS_17160 4424 3966 gene locus_tag LOCUS_17170 gene asnC 4424 3966 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707730.1 protein_id gnl|my_center|LOCUS_17170 4616 5611 gene locus_tag LOCUS_17180 gene asnA 4616 5611 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JHR0 protein_id gnl|my_center|LOCUS_17180 >Feature sequence186 940 2169 gene locus_tag LOCUS_17190 940 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2828 2340 gene locus_tag LOCUS_17200 2828 2340 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074293.1 protein_id gnl|my_center|LOCUS_17200 2981 4516 gene locus_tag LOCUS_17210 2981 4516 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074292.1 protein_id gnl|my_center|LOCUS_17210 4523 5215 gene locus_tag LOCUS_17220 4523 5215 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_17220 5766 5290 gene locus_tag LOCUS_17230 5766 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence187 1316 786 gene locus_tag LOCUS_17240 1316 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1698 3428 gene locus_tag LOCUS_17250 1698 3428 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482972.1 protein_id gnl|my_center|LOCUS_17250 5877 3697 gene locus_tag LOCUS_17260 5877 3697 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence188 236 1249 gene locus_tag LOCUS_17270 gene mccF 236 1249 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_17270 1494 2234 gene locus_tag LOCUS_17280 1494 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17280 4007 2685 gene locus_tag LOCUS_17290 gene yuiF 4007 2685 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072696.1 protein_id gnl|my_center|LOCUS_17290 5943 4009 gene locus_tag LOCUS_17300 5943 4009 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072203.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence189 2830 554 gene locus_tag LOCUS_17310 2830 554 CDS product LruC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263828.1 protein_id gnl|my_center|LOCUS_17310 3644 2994 gene locus_tag LOCUS_17320 3644 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17320 3947 3654 gene locus_tag LOCUS_17330 3947 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17330 4043 4984 gene locus_tag LOCUS_17340 4043 4984 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073535.1 protein_id gnl|my_center|LOCUS_17340 5169 6005 gene locus_tag LOCUS_17350 5169 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17350 >Feature sequence190 2972 2403 gene locus_tag LOCUS_17360 2972 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17360 4124 3060 gene locus_tag LOCUS_17370 4124 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17370 4249 4596 gene locus_tag LOCUS_17380 4249 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071955.1 protein_id gnl|my_center|LOCUS_17380 5919 5833 gene locus_tag LOCUS_t00230 5919 5833 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6025 5952 gene locus_tag LOCUS_t00240 6025 5952 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6118 6043 gene locus_tag LOCUS_t00250 6118 6043 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence191 663 1484 gene locus_tag LOCUS_17390 gene cysE 663 1484 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_17390 2895 1525 gene locus_tag LOCUS_17400 gene xseA 2895 1525 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S09 protein_id gnl|my_center|LOCUS_17400 3027 4496 gene locus_tag LOCUS_17410 gene guaB 3027 4496 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJR9 protein_id gnl|my_center|LOCUS_17410 >Feature sequence192 2053 2442 gene locus_tag LOCUS_17420 2053 2442 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933794.1 protein_id gnl|my_center|LOCUS_17420 2455 2883 gene locus_tag LOCUS_17430 gene hslJ 2455 2883 CDS product heat-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214605.1 protein_id gnl|my_center|LOCUS_17430 3136 5085 gene locus_tag LOCUS_17440 gene thiC 3136 5085 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFE6 protein_id gnl|my_center|LOCUS_17440 5276 5998 gene locus_tag LOCUS_17450 5276 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17450 >Feature sequence193 2907 136 gene locus_tag LOCUS_17460 2907 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17460 3459 2995 gene locus_tag LOCUS_17470 gene trmL 3459 2995 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEQ6 protein_id gnl|my_center|LOCUS_17470 3620 4096 gene locus_tag LOCUS_17480 3620 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17480 4097 4471 gene locus_tag LOCUS_17490 4097 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17490 5385 4423 gene locus_tag LOCUS_17500 gene pldB 5385 4423 CDS product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262839.1 protein_id gnl|my_center|LOCUS_17500 <6074 5385 gene locus_tag LOCUS_17510 <6074 5385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074106.1:two-component sensor histidine kinase >Feature sequence194 3622 1382 gene locus_tag LOCUS_17520 gene gidA 3622 1382 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947465.1 protein_id gnl|my_center|LOCUS_17520 4434 3619 gene locus_tag LOCUS_17530 4434 3619 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_17530 <6037 4537 gene locus_tag LOCUS_17540 <6037 4537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118098.1:surface-associated protein cshA precursor >Feature sequence195 647 192 gene locus_tag LOCUS_17550 647 192 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071322.1 protein_id gnl|my_center|LOCUS_17550 1049 681 gene locus_tag LOCUS_17560 1049 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1352 2047 gene locus_tag LOCUS_17570 1352 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 3029 2055 gene locus_tag LOCUS_17580 3029 2055 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706926.1 protein_id gnl|my_center|LOCUS_17580 3149 5689 gene locus_tag LOCUS_17590 3149 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17590 >Feature sequence196 619 143 gene locus_tag LOCUS_17600 619 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1491 652 gene locus_tag LOCUS_17610 1491 652 CDS product ATP synthase F0 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073539.1 protein_id gnl|my_center|LOCUS_17610 1627 4422 gene locus_tag LOCUS_17620 gene glnE 1627 4422 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPN4 protein_id gnl|my_center|LOCUS_17620 5077 4466 gene locus_tag LOCUS_17630 5077 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 <5954 5089 gene locus_tag LOCUS_17640 <5954 5089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JN09:lipid A biosynthesis lauroyltransferase >Feature sequence197 1098 100 gene locus_tag LOCUS_17650 1098 100 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479808.1 protein_id gnl|my_center|LOCUS_17650 1232 2326 gene locus_tag LOCUS_17660 1232 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029784.1 protein_id gnl|my_center|LOCUS_17660 2353 3174 gene locus_tag LOCUS_17670 2353 3174 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727351.1 protein_id gnl|my_center|LOCUS_17670 3392 3757 gene locus_tag LOCUS_17680 3392 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 4243 3851 gene locus_tag LOCUS_17690 4243 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence198 4591 1925 gene locus_tag LOCUS_17700 4591 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 5812 4979 gene locus_tag LOCUS_17710 5812 4979 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence199 3593 1029 gene locus_tag LOCUS_17720 3593 1029 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705867.1 protein_id gnl|my_center|LOCUS_17720 3861 4328 gene locus_tag LOCUS_17730 gene sixA 3861 4328 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262337.1 protein_id gnl|my_center|LOCUS_17730 4691 5773 gene locus_tag LOCUS_17740 4691 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17740 >Feature sequence200 561 704 gene locus_tag LOCUS_17750 561 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2658 934 gene locus_tag LOCUS_17760 2658 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 3888 2887 gene locus_tag LOCUS_17770 3888 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976394.1 protein_id gnl|my_center|LOCUS_17770 4826 4197 gene locus_tag LOCUS_17780 4826 4197 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071771.1 protein_id gnl|my_center|LOCUS_17780 5003 5266 gene locus_tag LOCUS_17790 5003 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence201 322 1332 gene locus_tag LOCUS_17800 gene gapA 322 1332 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 protein_id gnl|my_center|LOCUS_17800 1338 2531 gene locus_tag LOCUS_17810 1338 2531 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880869.1 protein_id gnl|my_center|LOCUS_17810 3144 2623 gene locus_tag LOCUS_17820 3144 2623 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_17820 3265 4158 gene locus_tag LOCUS_17830 3265 4158 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263913.1 protein_id gnl|my_center|LOCUS_17830 4847 4155 gene locus_tag LOCUS_17840 4847 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 <5833 4976 gene locus_tag LOCUS_17850 <5833 4976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261604.1:serine hydrolase >Feature sequence202 742 1086 gene locus_tag LOCUS_17860 742 1086 CDS product type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719767.1 protein_id gnl|my_center|LOCUS_17860 1148 1690 gene locus_tag LOCUS_17870 gene rpoE3 1148 1690 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263639.1 protein_id gnl|my_center|LOCUS_17870 1769 2509 gene locus_tag LOCUS_17880 gene arsH 1769 2509 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817076.1 protein_id gnl|my_center|LOCUS_17880 3105 3881 gene locus_tag LOCUS_17890 3105 3881 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038647.1 protein_id gnl|my_center|LOCUS_17890 3885 4799 gene locus_tag LOCUS_17900 3885 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 5481 4963 gene locus_tag LOCUS_17910 5481 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence203 21 206 gene locus_tag LOCUS_17920 21 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 867 328 gene locus_tag LOCUS_17930 867 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_17930 1358 864 gene locus_tag LOCUS_17940 1358 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705035.1 protein_id gnl|my_center|LOCUS_17940 1871 1377 gene locus_tag LOCUS_17950 1871 1377 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103433.1 protein_id gnl|my_center|LOCUS_17950 3123 1849 gene locus_tag LOCUS_17960 gene cfa 3123 1849 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263587.1 protein_id gnl|my_center|LOCUS_17960 3851 3126 gene locus_tag LOCUS_17970 3851 3126 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705032.1 protein_id gnl|my_center|LOCUS_17970 5103 3853 gene locus_tag LOCUS_17980 5103 3853 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263589.1 protein_id gnl|my_center|LOCUS_17980 <5802 5100 gene locus_tag LOCUS_17990 <5802 5100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073249.1:short-chain dehydrogenase >Feature sequence204 711 490 gene locus_tag LOCUS_18000 711 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 2065 1025 gene locus_tag LOCUS_18010 2065 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3534 2062 gene locus_tag LOCUS_18020 3534 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977453.1 protein_id gnl|my_center|LOCUS_18020 4870 4175 gene locus_tag LOCUS_18030 4870 4175 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262398.1 protein_id gnl|my_center|LOCUS_18030 <5779 4867 gene locus_tag LOCUS_18040 <5779 4867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EEB6:succinyl-diaminopimelate desuccinylase >Feature sequence205 704 1408 gene locus_tag LOCUS_18050 704 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3057 1495 gene locus_tag LOCUS_18060 3057 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3946 3059 gene locus_tag LOCUS_18070 3946 3059 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402933.1 protein_id gnl|my_center|LOCUS_18070 5511 4675 gene locus_tag LOCUS_18080 5511 4675 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477202.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence206 1694 1263 gene locus_tag LOCUS_18090 1694 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1896 1753 gene locus_tag LOCUS_18100 1896 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18100 2223 1903 gene locus_tag LOCUS_18110 2223 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18110 2787 4193 gene locus_tag LOCUS_18120 2787 4193 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861820.1 protein_id gnl|my_center|LOCUS_18120 5350 4334 gene locus_tag LOCUS_18130 gene hemH2 5350 4334 CDS product ferrochelatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ7 protein_id gnl|my_center|LOCUS_18130 >Feature sequence207 634 1266 gene locus_tag LOCUS_18140 634 1266 CDS product SOUL heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022600.1 protein_id gnl|my_center|LOCUS_18140 2475 1411 gene locus_tag LOCUS_18150 2475 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3250 3879 gene locus_tag LOCUS_18160 gene upp 3250 3879 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIA8 protein_id gnl|my_center|LOCUS_18160 4887 4384 gene locus_tag LOCUS_18170 4887 4384 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250801.1 protein_id gnl|my_center|LOCUS_18170 5516 5331 gene locus_tag LOCUS_18180 5516 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence208 1557 3095 gene locus_tag LOCUS_18190 1557 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 3505 4224 gene locus_tag LOCUS_18200 3505 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 4680 5648 gene locus_tag LOCUS_18210 gene dhaA 4680 5648 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T767 protein_id gnl|my_center|LOCUS_18210 >Feature sequence209 316 1029 gene locus_tag LOCUS_18220 316 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072994.1 protein_id gnl|my_center|LOCUS_18220 2610 1078 gene locus_tag LOCUS_18230 2610 1078 CDS product peptidase M17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071359.1 protein_id gnl|my_center|LOCUS_18230 4375 2684 gene locus_tag LOCUS_18240 gene cstA 4375 2684 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67304 protein_id gnl|my_center|LOCUS_18240 4714 5586 gene locus_tag LOCUS_18250 4714 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence210 95 1132 gene locus_tag LOCUS_18260 gene queA 95 1132 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ19 protein_id gnl|my_center|LOCUS_18260 1353 2477 gene locus_tag LOCUS_18270 gene tgt 1353 2477 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM3 protein_id gnl|my_center|LOCUS_18270 2507 2845 gene locus_tag LOCUS_18280 gene yajC 2507 2845 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460204.1 protein_id gnl|my_center|LOCUS_18280 2892 4733 gene locus_tag LOCUS_18290 gene secD 2892 4733 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D4 protein_id gnl|my_center|LOCUS_18290 4743 5627 gene locus_tag LOCUS_18300 gene secF 4743 5627 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S33 protein_id gnl|my_center|LOCUS_18300 >Feature sequence211 3249 1150 gene locus_tag LOCUS_18310 3249 1150 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705554.1 protein_id gnl|my_center|LOCUS_18310 4559 3630 gene locus_tag LOCUS_18320 4559 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479569.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence212 781 2 gene locus_tag LOCUS_18330 gene rsmJ 781 2 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8R9 protein_id gnl|my_center|LOCUS_18330 1981 833 gene locus_tag LOCUS_18340 1981 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 4181 2145 gene locus_tag LOCUS_18350 4181 2145 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence213 3 2174 gene locus_tag LOCUS_18360 3 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18360 2184 4490 gene locus_tag LOCUS_18370 2184 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18370 <5557 4619 gene locus_tag LOCUS_18380 <5557 4619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q51548:L-ornithine N(5)-monooxygenase >Feature sequence214 2437 716 gene locus_tag LOCUS_18390 2437 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2809 3558 gene locus_tag LOCUS_18400 2809 3558 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477336.1 protein_id gnl|my_center|LOCUS_18400 3631 3975 gene locus_tag LOCUS_18410 3631 3975 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005398278.1 protein_id gnl|my_center|LOCUS_18410 4076 4867 gene locus_tag LOCUS_18420 4076 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18420 >Feature sequence215 543 52 gene locus_tag LOCUS_18430 543 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229734.1 protein_id gnl|my_center|LOCUS_18430 2314 1427 gene locus_tag LOCUS_18440 2314 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074019.1 protein_id gnl|my_center|LOCUS_18440 2468 3619 gene locus_tag LOCUS_18450 2468 3619 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073043.1 protein_id gnl|my_center|LOCUS_18450 5455 3641 gene locus_tag LOCUS_18460 gene kefB 5455 3641 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071802.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence216 <1 558 gene locus_tag LOCUS_18470 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94514:sensory transduction protein LytT 592 1134 gene locus_tag LOCUS_18480 592 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1150 1509 gene locus_tag LOCUS_18490 1150 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1529 2392 gene locus_tag LOCUS_18500 1529 2392 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971752.1 protein_id gnl|my_center|LOCUS_18500 2572 3288 gene locus_tag LOCUS_18510 2572 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232567.2 protein_id gnl|my_center|LOCUS_18510 <5434 3557 gene locus_tag LOCUS_18520 <5434 3557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943409.1:acriflavine resistance protein B >Feature sequence217 2073 949 gene locus_tag LOCUS_18530 gene pdxB 2073 949 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR2 protein_id gnl|my_center|LOCUS_18530 2285 4741 gene locus_tag LOCUS_18540 gene fadE 2285 4741 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705468.1 protein_id gnl|my_center|LOCUS_18540 5185 4796 gene locus_tag LOCUS_18550 5185 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence218 434 129 gene locus_tag LOCUS_18560 434 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 982 2100 gene locus_tag LOCUS_18570 982 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 3976 2126 gene locus_tag LOCUS_18580 3976 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 <5395 4667 gene locus_tag LOCUS_18590 <5395 4667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920922.1:serine hydrolase >Feature sequence219 420 863 gene locus_tag LOCUS_18600 420 863 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105006.1 protein_id gnl|my_center|LOCUS_18600 1849 1286 gene locus_tag LOCUS_18610 1849 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2176 3000 gene locus_tag LOCUS_18620 2176 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4716 3013 gene locus_tag LOCUS_18630 4716 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence220 <1 1164 gene locus_tag LOCUS_18640 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074089.1:GGDEF domain-containing protein 1207 3630 gene locus_tag LOCUS_18650 1207 3630 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480202.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence221 1092 439 gene locus_tag LOCUS_18660 1092 439 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465748.1 protein_id gnl|my_center|LOCUS_18660 3124 1184 gene locus_tag LOCUS_18670 gene acsA 3124 1184 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KV59 protein_id gnl|my_center|LOCUS_18670 3517 4680 gene locus_tag LOCUS_18680 3517 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_18680 <5374 4874 gene locus_tag LOCUS_18690 <5374 4874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8X5Q1:ribosomal RNA large subunit methyltransferase J >Feature sequence222 1411 350 gene locus_tag LOCUS_18700 1411 350 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073374.1 protein_id gnl|my_center|LOCUS_18700 3327 1537 gene locus_tag LOCUS_18710 3327 1537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480797.1 protein_id gnl|my_center|LOCUS_18710 4754 3327 gene locus_tag LOCUS_18720 4754 3327 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFT0 protein_id gnl|my_center|LOCUS_18720 <5345 4754 gene locus_tag LOCUS_18730 <5345 4754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105836.1:3-methyladenine DNA glycosylase >Feature sequence223 461 1555 gene locus_tag LOCUS_18740 gene flgI 461 1555 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM38 protein_id gnl|my_center|LOCUS_18740 1653 2630 gene locus_tag LOCUS_18750 gene flgJ 1653 2630 CDS product peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X9J3 protein_id gnl|my_center|LOCUS_18750 2632 4638 gene locus_tag LOCUS_18760 gene flgK 2632 4638 CDS product flagellar hook protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706635.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence224 1 243 gene locus_tag LOCUS_18770 1 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 361 603 gene locus_tag LOCUS_18780 361 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18780 748 1386 gene locus_tag LOCUS_18790 748 1386 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_18790 1448 2173 gene locus_tag LOCUS_18800 1448 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3095 2196 gene locus_tag LOCUS_18810 3095 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18810 3599 3129 gene locus_tag LOCUS_18820 3599 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18820 5214 3760 gene locus_tag LOCUS_18830 5214 3760 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence225 1237 530 gene locus_tag LOCUS_18840 gene pgl 1237 530 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_18840 2709 1237 gene locus_tag LOCUS_18850 gene zwf 2709 1237 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGK2 protein_id gnl|my_center|LOCUS_18850 3209 2979 gene locus_tag LOCUS_18860 3209 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18860 4619 3285 gene locus_tag LOCUS_18870 gene pgi 4619 3285 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM2 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18870 >Feature sequence226 1836 856 gene locus_tag LOCUS_18880 gene pheS 1836 856 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFA0 protein_id gnl|my_center|LOCUS_18880 2627 1920 gene locus_tag LOCUS_18890 gene hda 2627 1920 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XEQ0 protein_id gnl|my_center|LOCUS_18890 3682 2627 gene locus_tag LOCUS_18900 3682 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706622.1 protein_id gnl|my_center|LOCUS_18900 4943 3753 gene locus_tag LOCUS_18910 4943 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence227 1306 2112 gene locus_tag LOCUS_18920 1306 2112 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH96 protein_id gnl|my_center|LOCUS_18920 2277 2951 gene locus_tag LOCUS_18930 gene mutH 2277 2951 CDS product DNA mismatch repair protein MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7P6 protein_id gnl|my_center|LOCUS_18930 3968 2961 gene locus_tag LOCUS_18940 gene glk 3968 2961 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR64 protein_id gnl|my_center|LOCUS_18940 <5263 3971 gene locus_tag LOCUS_18950 <5263 3971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919915.1:1,4-beta-D-glucan glucohydrolase >Feature sequence228 56 1057 gene locus_tag LOCUS_18960 56 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 1050 2228 gene locus_tag LOCUS_18970 1050 2228 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088058.1 protein_id gnl|my_center|LOCUS_18970 2225 3400 gene locus_tag LOCUS_18980 2225 3400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 3412 4281 gene locus_tag LOCUS_18990 3412 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18990 4285 4647 gene locus_tag LOCUS_19000 4285 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19000 >Feature sequence229 489 902 gene locus_tag LOCUS_19010 gene rulA 489 902 CDS product DNA polymerase V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074353.1 protein_id gnl|my_center|LOCUS_19010 1552 2163 gene locus_tag LOCUS_19020 1552 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2714 3250 gene locus_tag LOCUS_19030 2714 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 3523 4023 gene locus_tag LOCUS_19040 3523 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4581 4186 gene locus_tag LOCUS_19050 4581 4186 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263243.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence230 184 558 gene locus_tag LOCUS_19060 184 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 615 1235 gene locus_tag LOCUS_19070 gene dut 615 1235 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_19070 1922 1260 gene locus_tag LOCUS_19080 1922 1260 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_19080 1972 2541 gene locus_tag LOCUS_19090 gene nudE 1972 2541 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070586.1 protein_id gnl|my_center|LOCUS_19090 2544 3344 gene locus_tag LOCUS_19100 gene cysQ 2544 3344 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070587.1 protein_id gnl|my_center|LOCUS_19100 3532 3608 gene locus_tag LOCUS_t00260 3532 3608 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3667 3743 gene locus_tag LOCUS_t00270 3667 3743 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4240 4980 gene locus_tag LOCUS_19110 4240 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence231 323 2455 gene locus_tag LOCUS_19120 323 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 4714 2528 gene locus_tag LOCUS_19130 4714 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence232 615 184 gene locus_tag LOCUS_19140 615 184 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480394.1 protein_id gnl|my_center|LOCUS_19140 2012 618 gene locus_tag LOCUS_19150 gene phrA 2012 618 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNA8 protein_id gnl|my_center|LOCUS_19150 2977 2012 gene locus_tag LOCUS_19160 2977 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 protein_id gnl|my_center|LOCUS_19160 3649 2987 gene locus_tag LOCUS_19170 gene chrR 3649 2987 CDS product zinc-binding anti-sigmaE4 factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263592.1 protein_id gnl|my_center|LOCUS_19170 4211 3642 gene locus_tag LOCUS_19180 4211 3642 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707772.1 protein_id gnl|my_center|LOCUS_19180 4928 4377 gene locus_tag LOCUS_19190 4928 4377 CDS product peptidase S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072077.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence233 1130 192 gene locus_tag LOCUS_19200 1130 192 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749C5 protein_id gnl|my_center|LOCUS_19200 2369 1230 gene locus_tag LOCUS_19210 gene purK 2369 1230 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVT8 protein_id gnl|my_center|LOCUS_19210 2853 2371 gene locus_tag LOCUS_19220 gene purE 2853 2371 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE1 protein_id gnl|my_center|LOCUS_19220 4540 2972 gene locus_tag LOCUS_19230 4540 2972 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453913.1 protein_id gnl|my_center|LOCUS_19230 4952 4653 gene locus_tag LOCUS_19240 4952 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence234 2347 347 gene locus_tag LOCUS_19250 gene fdxB 2347 347 CDS product electron transfer protein FdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419325.1 protein_id gnl|my_center|LOCUS_19250 2472 3512 gene locus_tag LOCUS_19260 gene oruR 2472 3512 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947736.1 protein_id gnl|my_center|LOCUS_19260 4658 3732 gene locus_tag LOCUS_19270 gene etfA 4658 3732 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_19270 >Feature sequence235 434 1696 gene locus_tag LOCUS_19280 434 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095037.1 protein_id gnl|my_center|LOCUS_19280 1683 2240 gene locus_tag LOCUS_19290 1683 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2237 5023 gene locus_tag LOCUS_19300 2237 5023 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266671.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence236 601 80 gene locus_tag LOCUS_19310 601 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097831.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19310 741 1664 gene locus_tag LOCUS_19320 741 1664 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 protein_id gnl|my_center|LOCUS_19320 1767 2045 gene locus_tag LOCUS_19330 1767 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2181 2639 gene locus_tag LOCUS_19340 2181 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2737 3675 gene locus_tag LOCUS_19350 2737 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 3663 4301 gene locus_tag LOCUS_19360 3663 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence237 1818 700 gene locus_tag LOCUS_19370 gene pilU 1818 700 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073220.1 protein_id gnl|my_center|LOCUS_19370 2876 1830 gene locus_tag LOCUS_19380 gene pilT 2876 1830 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 protein_id gnl|my_center|LOCUS_19380 2907 3332 gene locus_tag LOCUS_19390 2907 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19390 3387 3590 gene locus_tag LOCUS_19400 3387 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19400 3603 4424 gene locus_tag LOCUS_19410 gene proC 3603 4424 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7S2 protein_id gnl|my_center|LOCUS_19410 4434 4967 gene locus_tag LOCUS_19420 4434 4967 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707386.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence238 315 2783 gene locus_tag LOCUS_19430 315 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3528 2752 gene locus_tag LOCUS_19440 3528 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072480.1 protein_id gnl|my_center|LOCUS_19440 3749 3531 gene locus_tag LOCUS_19450 3749 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 4058 3834 gene locus_tag LOCUS_19460 4058 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4243 4590 gene locus_tag LOCUS_19470 4243 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence239 192 785 gene locus_tag LOCUS_19480 192 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 986 2116 gene locus_tag LOCUS_19490 986 2116 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124033.1 protein_id gnl|my_center|LOCUS_19490 2403 2182 gene locus_tag LOCUS_19500 2403 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2477 3133 gene locus_tag LOCUS_19510 2477 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 3273 3605 gene locus_tag LOCUS_19520 3273 3605 CDS product UPF0060 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKX4 protein_id gnl|my_center|LOCUS_19520 4121 3687 gene locus_tag LOCUS_19530 4121 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 4477 4629 gene locus_tag LOCUS_19540 4477 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence240 767 1831 gene locus_tag LOCUS_19550 767 1831 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_19550 1842 2585 gene locus_tag LOCUS_19560 1842 2585 CDS product lipooligosaccharide biosynthesis protein LpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707882.1 protein_id gnl|my_center|LOCUS_19560 4945 2615 gene locus_tag LOCUS_19570 4945 2615 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764775.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence241 1297 872 gene locus_tag LOCUS_19580 1297 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 1650 1375 gene locus_tag LOCUS_19590 1650 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 2217 4358 gene locus_tag LOCUS_19600 2217 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225776.1 protein_id gnl|my_center|LOCUS_19600 4442 4777 gene locus_tag LOCUS_19610 4442 4777 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021110.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence242 1026 502 gene locus_tag LOCUS_19620 1026 502 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEB9 protein_id gnl|my_center|LOCUS_19620 3468 1555 gene locus_tag LOCUS_19630 3468 1555 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_19630 <4961 3535 gene locus_tag LOCUS_19640 <4961 3535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919497.1:TonB-dependent receptor >Feature sequence243 136 3402 gene locus_tag LOCUS_19650 136 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_19650 3590 4114 gene locus_tag LOCUS_19660 3590 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 4912 4166 gene locus_tag LOCUS_19670 4912 4166 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922396.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence244 2345 240 gene locus_tag LOCUS_19680 2345 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2604 3530 gene locus_tag LOCUS_19690 2604 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19690 3621 4505 gene locus_tag LOCUS_19700 3621 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19700 4775 4560 gene locus_tag LOCUS_19710 4775 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence245 720 205 gene locus_tag LOCUS_19720 720 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 2339 717 gene locus_tag LOCUS_19730 2339 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3671 2634 gene locus_tag LOCUS_19740 gene rsmC 3671 2634 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2W4 protein_id gnl|my_center|LOCUS_19740 4530 3805 gene locus_tag LOCUS_19750 gene trmB 4530 3805 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1WN01 protein_id gnl|my_center|LOCUS_19750 4657 4866 gene locus_tag LOCUS_19760 4657 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19760 >Feature sequence246 3320 993 gene locus_tag LOCUS_19770 3320 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 <4945 4392 gene locus_tag LOCUS_19780 <4945 4392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073374.1:porin >Feature sequence247 97 921 gene locus_tag LOCUS_19790 97 921 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073796.1 protein_id gnl|my_center|LOCUS_19790 914 2353 gene locus_tag LOCUS_19800 gene tldD 914 2353 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261176.1 protein_id gnl|my_center|LOCUS_19800 3802 2459 gene locus_tag LOCUS_19810 3802 2459 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 protein_id gnl|my_center|LOCUS_19810 4293 3826 gene locus_tag LOCUS_19820 4293 3826 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_19820 4772 4311 gene locus_tag LOCUS_19830 gene aroQ 4772 4311 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM50 protein_id gnl|my_center|LOCUS_19830 >Feature sequence248 51 845 gene locus_tag LOCUS_19840 gene dapD 51 845 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG0 protein_id gnl|my_center|LOCUS_19840 1494 907 gene locus_tag LOCUS_19850 1494 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1936 1496 gene locus_tag LOCUS_19860 1936 1496 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212126.1 protein_id gnl|my_center|LOCUS_19860 2670 1936 gene locus_tag LOCUS_19870 2670 1936 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705086.1 protein_id gnl|my_center|LOCUS_19870 3012 2692 gene locus_tag LOCUS_19880 gene yqcC 3012 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071775.1 protein_id gnl|my_center|LOCUS_19880 3150 4178 gene locus_tag LOCUS_19890 3150 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261355.1 protein_id gnl|my_center|LOCUS_19890 4178 4480 gene locus_tag LOCUS_19900 4178 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence249 1677 1027 gene locus_tag LOCUS_19910 1677 1027 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532149.1 protein_id gnl|my_center|LOCUS_19910 1760 2293 gene locus_tag LOCUS_19920 1760 2293 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112334.1 protein_id gnl|my_center|LOCUS_19920 3466 2666 gene locus_tag LOCUS_19930 3466 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 3889 3539 gene locus_tag LOCUS_19940 3889 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 4132 4878 gene locus_tag LOCUS_19950 4132 4878 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477064.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence250 198 482 gene locus_tag LOCUS_19960 198 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19960 519 638 gene locus_tag LOCUS_19970 519 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1033 659 gene locus_tag LOCUS_19980 gene folX 1033 659 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AC22 protein_id gnl|my_center|LOCUS_19980 1597 1043 gene locus_tag LOCUS_19990 gene folE2 1597 1043 CDS product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884Q3 protein_id gnl|my_center|LOCUS_19990 2232 1609 gene locus_tag LOCUS_20000 2232 1609 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096872.1 protein_id gnl|my_center|LOCUS_20000 2557 3369 gene locus_tag LOCUS_20010 2557 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 4216 3380 gene locus_tag LOCUS_20020 gene nadE 4216 3380 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87J41 protein_id gnl|my_center|LOCUS_20020 <4916 4281 gene locus_tag LOCUS_20030 <4916 4281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KLK3:UPF0502 protein >Feature sequence251 1156 692 gene locus_tag LOCUS_20040 1156 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 2095 1490 gene locus_tag LOCUS_20050 2095 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3150 2224 gene locus_tag LOCUS_20060 3150 2224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889267.1 protein_id gnl|my_center|LOCUS_20060 3280 3143 gene locus_tag LOCUS_20070 3280 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 4696 3506 gene locus_tag LOCUS_20080 4696 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence252 1884 400 gene locus_tag LOCUS_20090 gene opuE 1884 400 CDS product osmoregulated proline transporter OpuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06493 protein_id gnl|my_center|LOCUS_20090 2131 3360 gene locus_tag LOCUS_20100 2131 3360 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459985.1 protein_id gnl|my_center|LOCUS_20100 4165 3431 gene locus_tag LOCUS_20110 4165 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114777.1 protein_id gnl|my_center|LOCUS_20110 <4871 4166 gene locus_tag LOCUS_20120 <4871 4166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209700.1:c-type cytochrome biogenesis protein CcmI >Feature sequence253 1407 610 gene locus_tag LOCUS_20130 1407 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 1613 2185 gene locus_tag LOCUS_20140 gene def2 1613 2185 CDS product peptide deformylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHZ2 protein_id gnl|my_center|LOCUS_20140 2925 2260 gene locus_tag LOCUS_20150 2925 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 3557 3033 gene locus_tag LOCUS_20160 3557 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 4160 4555 gene locus_tag LOCUS_20170 4160 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence254 984 175 gene locus_tag LOCUS_20180 gene ybeX 984 175 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418183.1 protein_id gnl|my_center|LOCUS_20180 1554 1093 gene locus_tag LOCUS_20190 gene ybeY 1554 1093 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6U4 protein_id gnl|my_center|LOCUS_20190 2593 1559 gene locus_tag LOCUS_20200 2593 1559 CDS product PhoH-like ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_455238.1 protein_id gnl|my_center|LOCUS_20200 4044 2650 gene locus_tag LOCUS_20210 gene miaB 4044 2650 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTE0 protein_id gnl|my_center|LOCUS_20210 >Feature sequence255 1735 1016 gene locus_tag LOCUS_20220 1735 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2674 1799 gene locus_tag LOCUS_20230 2674 1799 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464972.1 protein_id gnl|my_center|LOCUS_20230 2874 3545 gene locus_tag LOCUS_20240 2874 3545 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602785.1 protein_id gnl|my_center|LOCUS_20240 3586 3906 gene locus_tag LOCUS_20250 3586 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20250 3910 4194 gene locus_tag LOCUS_20260 3910 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 4347 4634 gene locus_tag LOCUS_20270 4347 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence256 183 91 gene locus_tag LOCUS_t00280 183 91 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 773 399 gene locus_tag LOCUS_20280 773 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 1343 852 gene locus_tag LOCUS_20290 gene folA 1343 852 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_20290 2557 1400 gene locus_tag LOCUS_20300 gene obg 2557 1400 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGS9 protein_id gnl|my_center|LOCUS_20300 2968 2711 gene locus_tag LOCUS_20310 gene rpmA 2968 2711 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR69 protein_id gnl|my_center|LOCUS_20310 3300 2989 gene locus_tag LOCUS_20320 gene rplU 3300 2989 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E873 protein_id gnl|my_center|LOCUS_20320 3684 4655 gene locus_tag LOCUS_20330 3684 4655 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_230088.2 protein_id gnl|my_center|LOCUS_20330 >Feature sequence257 2052 445 gene locus_tag LOCUS_20340 gene ctpH 2052 445 CDS product methyl-accepting chemotaxis protein CtpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:G3XDA3 protein_id gnl|my_center|LOCUS_20340 2658 4340 gene locus_tag LOCUS_20350 2658 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence258 1377 2393 gene locus_tag LOCUS_20360 1377 2393 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902083.1 protein_id gnl|my_center|LOCUS_20360 2407 3423 gene locus_tag LOCUS_20370 2407 3423 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902083.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence259 291 824 gene locus_tag LOCUS_20380 291 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1018 1389 gene locus_tag LOCUS_20390 1018 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1399 2775 gene locus_tag LOCUS_20400 gene fumC 1399 2775 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRR3 protein_id gnl|my_center|LOCUS_20400 3026 4366 gene locus_tag LOCUS_20410 3026 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence260 1279 713 gene locus_tag LOCUS_20420 gene efp 1279 713 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KX9 protein_id gnl|my_center|LOCUS_20420 1345 2334 gene locus_tag LOCUS_20430 1345 2334 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815416.1 protein_id gnl|my_center|LOCUS_20430 2567 2352 gene locus_tag LOCUS_20440 2567 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2634 2927 gene locus_tag LOCUS_20450 2634 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070896.1 protein_id gnl|my_center|LOCUS_20450 3041 4015 gene locus_tag LOCUS_20460 3041 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence261 1362 2075 gene locus_tag LOCUS_20470 1362 2075 CDS product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703875.1 protein_id gnl|my_center|LOCUS_20470 2313 3524 gene locus_tag LOCUS_20480 2313 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817129.1 protein_id gnl|my_center|LOCUS_20480 3675 4478 gene locus_tag LOCUS_20490 3675 4478 CDS product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123674.1 protein_id gnl|my_center|LOCUS_20490 4665 4498 gene locus_tag LOCUS_20500 4665 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence262 1388 24 gene locus_tag LOCUS_20510 1388 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1867 1385 gene locus_tag LOCUS_20520 gene coaD 1867 1385 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEN4 protein_id gnl|my_center|LOCUS_20520 2115 2771 gene locus_tag LOCUS_20530 2115 2771 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074266.1 protein_id gnl|my_center|LOCUS_20530 2872 4329 gene locus_tag LOCUS_20540 gene thiI 2872 4329 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6Y5 protein_id gnl|my_center|LOCUS_20540 >Feature sequence263 1044 502 gene locus_tag LOCUS_20550 1044 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459288.1 protein_id gnl|my_center|LOCUS_20550 1753 1118 gene locus_tag LOCUS_20560 gene tonB2 1753 1118 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 protein_id gnl|my_center|LOCUS_20560 2345 2938 gene locus_tag LOCUS_20570 gene ribA 2345 2938 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5L2 protein_id gnl|my_center|LOCUS_20570 3031 3828 gene locus_tag LOCUS_20580 3031 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 3828 4289 gene locus_tag LOCUS_20590 gene recX 3828 4289 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56647 protein_id gnl|my_center|LOCUS_20590 >Feature sequence264 1657 962 gene locus_tag LOCUS_20600 1657 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3468 1804 gene locus_tag LOCUS_20610 3468 1804 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103785.1 protein_id gnl|my_center|LOCUS_20610 3787 3482 gene locus_tag LOCUS_20620 3787 3482 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_20620 3976 4317 gene locus_tag LOCUS_20630 3976 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45116 protein_id gnl|my_center|LOCUS_20630 >Feature sequence265 176 1816 gene locus_tag LOCUS_20640 176 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20640 1960 3018 gene locus_tag LOCUS_20650 1960 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3031 4665 gene locus_tag LOCUS_20660 3031 4665 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479531.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence266 2854 530 gene locus_tag LOCUS_20670 gene tex 2854 530 CDS product transcription accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074225.1 protein_id gnl|my_center|LOCUS_20670 3416 2943 gene locus_tag LOCUS_20680 gene greB 3416 2943 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TB8 protein_id gnl|my_center|LOCUS_20680 3598 4317 gene locus_tag LOCUS_20690 gene ompR 3598 4317 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074227.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence267 <1 714 gene locus_tag LOCUS_20700 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005768857.1:molybdopterin-synthase adenylyltransferase MoeB 1606 743 gene locus_tag LOCUS_20710 gene psd 1606 743 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW03 protein_id gnl|my_center|LOCUS_20710 2634 1660 gene locus_tag LOCUS_20720 gene rsgA 2634 1660 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NG98 protein_id gnl|my_center|LOCUS_20720 2919 3464 gene locus_tag LOCUS_20730 gene orn 2919 3464 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L01 protein_id gnl|my_center|LOCUS_20730 3920 4261 gene locus_tag LOCUS_20740 gene rpsF 3920 4261 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44375 protein_id gnl|my_center|LOCUS_20740 4292 4615 gene locus_tag LOCUS_20750 gene priB 4292 4615 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZB82 protein_id gnl|my_center|LOCUS_20750 >Feature sequence268 1087 134 gene locus_tag LOCUS_20760 gene rluC 1087 134 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU25 protein_id gnl|my_center|LOCUS_20760 >Feature sequence269 1670 528 gene locus_tag LOCUS_20770 1670 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1907 3280 gene locus_tag LOCUS_20780 1907 3280 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887578.1 protein_id gnl|my_center|LOCUS_20780 3273 4271 gene locus_tag LOCUS_20790 3273 4271 CDS product cytochrome bd ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984106.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence270 505 1389 gene locus_tag LOCUS_20800 gene pagO 505 1389 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_20800 2107 1406 gene locus_tag LOCUS_20810 2107 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 3969 2386 gene locus_tag LOCUS_20820 3969 2386 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 protein_id gnl|my_center|LOCUS_20820 <4672 4049 gene locus_tag LOCUS_20830 <4672 4049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87MG0:hydroxyacylglutathione hydrolase >Feature sequence271 1367 441 gene locus_tag LOCUS_20840 gene fabD 1367 441 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E410 protein_id gnl|my_center|LOCUS_20840 2467 1412 gene locus_tag LOCUS_20850 gene plsX 2467 1412 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH0 protein_id gnl|my_center|LOCUS_20850 2650 2480 gene locus_tag LOCUS_20860 gene rpmF 2650 2480 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH0 protein_id gnl|my_center|LOCUS_20860 3185 2661 gene locus_tag LOCUS_20870 3185 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174444.1 protein_id gnl|my_center|LOCUS_20870 3305 3907 gene locus_tag LOCUS_20880 3305 3907 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG7 protein_id gnl|my_center|LOCUS_20880 4528 3884 gene locus_tag LOCUS_20890 gene ppaX 4528 3884 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208277.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence272 1256 2254 gene locus_tag LOCUS_20900 1256 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2373 3128 gene locus_tag LOCUS_20910 gene ubiE 2373 3128 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMB8 protein_id gnl|my_center|LOCUS_20910 3137 3739 gene locus_tag LOCUS_20920 3137 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704117.1 protein_id gnl|my_center|LOCUS_20920 >Feature sequence273 2091 397 gene locus_tag LOCUS_20930 gene maeA 2091 397 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q92 protein_id gnl|my_center|LOCUS_20930 4029 2257 gene locus_tag LOCUS_20940 gene ggt 4029 2257 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225268.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence274 1639 1884 gene locus_tag LOCUS_20950 1639 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2852 2091 gene locus_tag LOCUS_20960 2852 2091 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707663.1 protein_id gnl|my_center|LOCUS_20960 2966 3985 gene locus_tag LOCUS_20970 2966 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4217 4604 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttcaaagctgcctgtgcggcagtgaac >Feature sequence275 124 291 gene locus_tag LOCUS_20980 124 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20980 303 1670 gene locus_tag LOCUS_20990 303 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_20990 1807 2766 gene locus_tag LOCUS_21000 1807 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072545.1 protein_id gnl|my_center|LOCUS_21000 2766 3515 gene locus_tag LOCUS_21010 2766 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21010 >Feature sequence276 903 691 gene locus_tag LOCUS_21020 903 691 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463371.1 protein_id gnl|my_center|LOCUS_21020 2921 1299 gene locus_tag LOCUS_21030 2921 1299 CDS product endonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458327.1 protein_id gnl|my_center|LOCUS_21030 3459 3202 gene locus_tag LOCUS_21040 3459 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 3999 3643 gene locus_tag LOCUS_21050 3999 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 4631 4293 gene locus_tag LOCUS_21060 4631 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 >Feature sequence277 539 1114 gene locus_tag LOCUS_21070 539 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705874.1 protein_id gnl|my_center|LOCUS_21070 1191 2234 gene locus_tag LOCUS_21080 gene aguA 1191 2234 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_21080 2236 3123 gene locus_tag LOCUS_21090 gene aguB 2236 3123 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence278 1391 627 gene locus_tag LOCUS_21100 1391 627 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095728.1 protein_id gnl|my_center|LOCUS_21100 1866 2624 gene locus_tag LOCUS_21110 1866 2624 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970645.1 protein_id gnl|my_center|LOCUS_21110 3607 2816 gene locus_tag LOCUS_21120 3607 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence279 696 1616 gene locus_tag LOCUS_21130 696 1616 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705213.1 protein_id gnl|my_center|LOCUS_21130 2163 1684 gene locus_tag LOCUS_21140 2163 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417389.1 protein_id gnl|my_center|LOCUS_21140 3575 2181 gene locus_tag LOCUS_21150 3575 2181 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 protein_id gnl|my_center|LOCUS_21150 4249 3572 gene locus_tag LOCUS_21160 4249 3572 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110874.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence280 <1 636 gene locus_tag LOCUS_21170 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703507.1:AraC family transcriptional regulator 957 1829 gene locus_tag LOCUS_21180 957 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 protein_id gnl|my_center|LOCUS_21180 2334 3647 gene locus_tag LOCUS_21190 gene cpsB 2334 3647 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079297.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence281 1564 2424 gene locus_tag LOCUS_21200 gene yraL 1564 2424 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2P1 protein_id gnl|my_center|LOCUS_21200 4321 3650 gene locus_tag LOCUS_21210 4321 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21210 >Feature sequence282 945 268 gene locus_tag LOCUS_21220 945 268 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_21220 1097 1978 gene locus_tag LOCUS_21230 1097 1978 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071881.1 protein_id gnl|my_center|LOCUS_21230 1990 4512 gene locus_tag LOCUS_21240 1990 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21240 >Feature sequence283 <1 1811 gene locus_tag LOCUS_21250 <1 1811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267518.1:chemotaxis protein 2987 1935 gene locus_tag LOCUS_21260 2987 1935 CDS product putative fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702326.1 protein_id gnl|my_center|LOCUS_21260 4024 2984 gene locus_tag LOCUS_21270 4024 2984 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727866.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence284 3449 294 gene locus_tag LOCUS_21280 3449 294 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_21280 <4552 3452 gene locus_tag LOCUS_21290 <4552 3452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071226.1:RND superfamily efflux pump MFP component >Feature sequence285 3581 1692 gene locus_tag LOCUS_21300 gene parE 3581 1692 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAK3 protein_id gnl|my_center|LOCUS_21300 4183 3617 gene locus_tag LOCUS_21310 4183 3617 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002345735.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence286 3228 1918 gene locus_tag LOCUS_21320 gene fadI 3228 1918 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK23 protein_id gnl|my_center|LOCUS_21320 >Feature sequence287 1757 246 gene locus_tag LOCUS_21330 gene pepA1 1757 246 CDS product putative cytosol aminopeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI85 protein_id gnl|my_center|LOCUS_21330 1973 3178 gene locus_tag LOCUS_21340 1973 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 3303 4352 gene locus_tag LOCUS_21350 3303 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 4445 4369 gene locus_tag LOCUS_t00290 4445 4369 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence288 178 2826 gene locus_tag LOCUS_21360 gene topA 178 2826 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QX7 protein_id gnl|my_center|LOCUS_21360 4175 2904 gene locus_tag LOCUS_21370 4175 2904 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070487.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence289 305 1189 gene locus_tag LOCUS_21380 gene kcnb2 305 1189 CDS product potassium voltage gated channel, Shab-related subfamily, member 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21380 4208 1293 gene locus_tag LOCUS_21390 4208 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence290 204 1661 gene locus_tag LOCUS_21400 204 1661 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_21400 2523 1612 gene locus_tag LOCUS_21410 2523 1612 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707407.1 protein_id gnl|my_center|LOCUS_21410 2644 3543 gene locus_tag LOCUS_21420 gene rlmF 2644 3543 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRM2 protein_id gnl|my_center|LOCUS_21420 4147 3566 gene locus_tag LOCUS_21430 gene tdk 4147 3566 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KST9 protein_id gnl|my_center|LOCUS_21430 >Feature sequence291 228 1334 gene locus_tag LOCUS_21440 228 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 2236 1331 gene locus_tag LOCUS_21450 gene yigM 2236 1331 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418680.1 protein_id gnl|my_center|LOCUS_21450 2540 2926 gene locus_tag LOCUS_21460 2540 2926 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366737.1 protein_id gnl|my_center|LOCUS_21460 3270 3028 gene locus_tag LOCUS_21470 3270 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence292 1217 30 gene locus_tag LOCUS_21480 gene hmp 1217 30 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMY3 protein_id gnl|my_center|LOCUS_21480 1585 3744 gene locus_tag LOCUS_21490 1585 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 3878 4027 gene locus_tag LOCUS_21500 3878 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 4192 4019 gene locus_tag LOCUS_21510 4192 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 >Feature sequence293 1570 230 gene locus_tag LOCUS_21520 1570 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21520 3106 1778 gene locus_tag LOCUS_21530 3106 1778 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence294 499 1128 gene locus_tag LOCUS_21540 gene ribC 499 1128 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072298.1 protein_id gnl|my_center|LOCUS_21540 1359 1156 gene locus_tag LOCUS_21550 1359 1156 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072299.1 protein_id gnl|my_center|LOCUS_21550 1804 1442 gene locus_tag LOCUS_21560 1804 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21560 2299 2018 gene locus_tag LOCUS_21570 2299 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2456 3151 gene locus_tag LOCUS_21580 2456 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 protein_id gnl|my_center|LOCUS_21580 3584 3387 gene locus_tag LOCUS_21590 3584 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence295 <1 1239 gene locus_tag LOCUS_21600 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001881538.1:paraquat-inducible protein B 1239 1829 gene locus_tag LOCUS_21610 1239 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2018 2209 gene locus_tag LOCUS_21620 2018 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 2271 3860 gene locus_tag LOCUS_21630 gene nutA 2271 3860 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22848 protein_id gnl|my_center|LOCUS_21630 4355 3918 gene locus_tag LOCUS_21640 4355 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 >Feature sequence296 373 1596 gene locus_tag LOCUS_21650 gene metB 373 1596 CDS product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073769.1 protein_id gnl|my_center|LOCUS_21650 1601 3949 gene locus_tag LOCUS_21660 gene metL 1601 3949 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704558.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence297 <1 1669 gene locus_tag LOCUS_21670 <1 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003420161.1:phosphoenolpyruvate--protein phosphotransferase 1766 2578 gene locus_tag LOCUS_21680 1766 2578 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH96 protein_id gnl|my_center|LOCUS_21680 2588 3376 gene locus_tag LOCUS_21690 gene lgt 2588 3376 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7P2 protein_id gnl|my_center|LOCUS_21690 3426 4277 gene locus_tag LOCUS_21700 gene thyA 3426 4277 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44420 protein_id gnl|my_center|LOCUS_21700 >Feature sequence298 323 36 gene locus_tag LOCUS_21710 323 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 821 381 gene locus_tag LOCUS_21720 821 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1252 1686 gene locus_tag LOCUS_21730 1252 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3243 1777 gene locus_tag LOCUS_21740 3243 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence299 93 2045 gene locus_tag LOCUS_21750 93 2045 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490914.1 protein_id gnl|my_center|LOCUS_21750 2205 2696 gene locus_tag LOCUS_21760 gene ybaK 2205 2696 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMZ8 protein_id gnl|my_center|LOCUS_21760 3979 2828 gene locus_tag LOCUS_21770 3979 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974439.1 protein_id gnl|my_center|LOCUS_21770 4286 4362 gene locus_tag LOCUS_t00300 4286 4362 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence300 <1 1710 gene locus_tag LOCUS_21780 <1 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787020.1:TonB-dependent receptor 1785 2783 gene locus_tag LOCUS_21790 1785 2783 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265511.1 protein_id gnl|my_center|LOCUS_21790 3214 2831 gene locus_tag LOCUS_21800 3214 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 4355 3387 gene locus_tag LOCUS_21810 4355 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence301 3505 404 gene locus_tag LOCUS_21820 3505 404 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_21820 <4335 3510 gene locus_tag LOCUS_21830 <4335 3510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038277.1:MexH family multidrug efflux RND transporter periplasmic adaptor subunit >Feature sequence302 2843 579 gene locus_tag LOCUS_21840 2843 579 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112659.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence303 762 385 gene locus_tag LOCUS_21850 762 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 980 1903 gene locus_tag LOCUS_21860 980 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2011 2841 gene locus_tag LOCUS_21870 2011 2841 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_21870 <4302 2935 gene locus_tag LOCUS_21880 <4302 2935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070944.1:peptidase S9 >Feature sequence304 305 1063 gene locus_tag LOCUS_21890 305 1063 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459884.1 protein_id gnl|my_center|LOCUS_21890 1088 1609 gene locus_tag LOCUS_21900 1088 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2412 1669 gene locus_tag LOCUS_21910 gene lpxH 2412 1669 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CHR1 protein_id gnl|my_center|LOCUS_21910 2993 2499 gene locus_tag LOCUS_21920 gene ppiB 2993 2499 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG23 protein_id gnl|my_center|LOCUS_21920 >Feature sequence305 124 48 gene locus_tag LOCUS_t00310 124 48 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1586 222 gene locus_tag LOCUS_21930 1586 222 CDS product TIGR03503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705466.1 protein_id gnl|my_center|LOCUS_21930 2309 1599 gene locus_tag LOCUS_21940 gene dnaQ 2309 1599 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705465.1 protein_id gnl|my_center|LOCUS_21940 2380 2847 gene locus_tag LOCUS_21950 gene rnhA 2380 2847 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EDN6 protein_id gnl|my_center|LOCUS_21950 3607 2849 gene locus_tag LOCUS_21960 gene yafS 3607 2849 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262415.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence306 528 1685 gene locus_tag LOCUS_21970 528 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478915.1 protein_id gnl|my_center|LOCUS_21970 2971 1856 gene locus_tag LOCUS_21980 2971 1856 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066664.1 protein_id gnl|my_center|LOCUS_21980 3787 3203 gene locus_tag LOCUS_21990 3787 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 >Feature sequence307 223 723 gene locus_tag LOCUS_22000 223 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 3935 795 gene locus_tag LOCUS_22010 3935 795 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence308 983 426 gene locus_tag LOCUS_22020 983 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1708 1253 gene locus_tag LOCUS_22030 1708 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 3311 1743 gene locus_tag LOCUS_22040 3311 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 3903 3352 gene locus_tag LOCUS_22050 3903 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence309 53 406 gene locus_tag LOCUS_22060 gene tusD 53 406 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072358.1 protein_id gnl|my_center|LOCUS_22060 388 762 gene locus_tag LOCUS_22070 388 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 759 1025 gene locus_tag LOCUS_22080 759 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 1027 1356 gene locus_tag LOCUS_22090 gene tusE 1027 1356 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZG65 protein_id gnl|my_center|LOCUS_22090 2660 1422 gene locus_tag LOCUS_22100 2660 1422 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038470.1 protein_id gnl|my_center|LOCUS_22100 4052 2670 gene locus_tag LOCUS_22110 4052 2670 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038469.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence310 2719 101 gene locus_tag LOCUS_22120 gene glnD 2719 101 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG1 protein_id gnl|my_center|LOCUS_22120 3797 3009 gene locus_tag LOCUS_22130 gene map 3797 3009 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BV1 protein_id gnl|my_center|LOCUS_22130 >Feature sequence311 <1 541 gene locus_tag LOCUS_22140 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789772.1:peptidase S9 720 1424 gene locus_tag LOCUS_22150 gene aruR 720 1424 CDS product transcriptional regulatory protein AruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUI2 protein_id gnl|my_center|LOCUS_22150 2932 1421 gene locus_tag LOCUS_22160 2932 1421 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707862.1 protein_id gnl|my_center|LOCUS_22160 3559 2951 gene locus_tag LOCUS_22170 gene yadS 3559 2951 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420789.1 protein_id gnl|my_center|LOCUS_22170 4051 3953 gene locus_tag LOCUS_r00010 4051 3953 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence312 1602 160 gene locus_tag LOCUS_22180 1602 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2586 1621 gene locus_tag LOCUS_22190 2586 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2921 2652 gene locus_tag LOCUS_22200 2921 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3151 2921 gene locus_tag LOCUS_22210 3151 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence313 656 1570 gene locus_tag LOCUS_22220 gene hemF 656 1570 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX7 protein_id gnl|my_center|LOCUS_22220 2127 1669 gene locus_tag LOCUS_22230 2127 1669 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070455.1 protein_id gnl|my_center|LOCUS_22230 2151 2969 gene locus_tag LOCUS_22240 gene aroE 2151 2969 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1R6 protein_id gnl|my_center|LOCUS_22240 2971 3210 gene locus_tag LOCUS_22250 2971 3210 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421512.1 protein_id gnl|my_center|LOCUS_22250 3735 3193 gene locus_tag LOCUS_22260 3735 3193 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461433.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence314 <1 1547 gene locus_tag LOCUS_22270 <1 1547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071723.1:diguanylate cyclase 1562 2902 gene locus_tag LOCUS_22280 1562 2902 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705076.1 protein_id gnl|my_center|LOCUS_22280 2899 3666 gene locus_tag LOCUS_22290 gene xni 2899 3666 CDS product Flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTK4 protein_id gnl|my_center|LOCUS_22290 3726 4115 gene locus_tag LOCUS_22300 3726 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence315 1572 208 gene locus_tag LOCUS_22310 gene ttpC 1572 208 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_22310 2277 1579 gene locus_tag LOCUS_22320 2277 1579 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_22320 3389 2742 gene locus_tag LOCUS_22330 3389 2742 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 protein_id gnl|my_center|LOCUS_22330 <4185 3452 gene locus_tag LOCUS_22340 <4185 3452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072585.1:leucine dehydrogenase >Feature sequence316 210 1385 gene locus_tag LOCUS_22350 gene anmK 210 1385 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q184N9 protein_id gnl|my_center|LOCUS_22350 1455 1925 gene locus_tag LOCUS_22360 1455 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1999 2487 gene locus_tag LOCUS_22370 1999 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 2881 2528 gene locus_tag LOCUS_22380 2881 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 3979 3224 gene locus_tag LOCUS_22390 3979 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence317 608 453 gene locus_tag LOCUS_22400 608 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2393 1380 gene locus_tag LOCUS_22410 gene galE-1 2393 1380 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_22410 3333 2467 gene locus_tag LOCUS_22420 3333 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 >Feature sequence318 343 1125 gene locus_tag LOCUS_22430 343 1125 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881385.1 protein_id gnl|my_center|LOCUS_22430 1520 1146 gene locus_tag LOCUS_22440 1520 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1615 2415 gene locus_tag LOCUS_22450 1615 2415 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229555.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence319 2798 465 gene locus_tag LOCUS_22460 gene fyuA 2798 465 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206764.1 protein_id gnl|my_center|LOCUS_22460 3390 3235 gene locus_tag LOCUS_22470 3390 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 >Feature sequence320 268 564 gene locus_tag LOCUS_22480 268 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22480 561 1172 gene locus_tag LOCUS_22490 gene gmhA 561 1172 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884059.1 protein_id gnl|my_center|LOCUS_22490 1165 2160 gene locus_tag LOCUS_22500 1165 2160 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546066.1 protein_id gnl|my_center|LOCUS_22500 2168 2830 gene locus_tag LOCUS_22510 2168 2830 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771848.1 protein_id gnl|my_center|LOCUS_22510 2838 3638 gene locus_tag LOCUS_22520 2838 3638 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence321 <1 864 gene locus_tag LOCUS_22530 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002037531.1:penicillin-binding protein 1235 1444 gene locus_tag LOCUS_22540 1235 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 1836 1991 gene locus_tag LOCUS_22550 1836 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2787 2014 gene locus_tag LOCUS_22560 2787 2014 CDS product structural protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762734.1 protein_id gnl|my_center|LOCUS_22560 2932 3342 gene locus_tag LOCUS_22570 2932 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 <4062 3487 gene locus_tag LOCUS_22580 <4062 3487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920091.1:alpha/beta hydrolase >Feature sequence322 2311 725 gene locus_tag LOCUS_22590 2311 725 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_22590 2476 2976 gene locus_tag LOCUS_22600 2476 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020320.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence323 1554 175 gene locus_tag LOCUS_22610 1554 175 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_22610 1960 2088 gene locus_tag LOCUS_22620 1960 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2580 2125 gene locus_tag LOCUS_22630 2580 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 3653 2610 gene locus_tag LOCUS_22640 3653 2610 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481869.1 protein_id gnl|my_center|LOCUS_22640 4028 3753 gene locus_tag LOCUS_22650 4028 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence324 2208 934 gene locus_tag LOCUS_22660 gene hisD 2208 934 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FL44 protein_id gnl|my_center|LOCUS_22660 2320 3063 gene locus_tag LOCUS_22670 2320 3063 CDS product L-xylulose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706481.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence325 1710 877 gene locus_tag LOCUS_22680 gene ampE 1710 877 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209326.1 protein_id gnl|my_center|LOCUS_22680 2263 1718 gene locus_tag LOCUS_22690 2263 1718 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 protein_id gnl|my_center|LOCUS_22690 2408 3274 gene locus_tag LOCUS_22700 gene nadC 2408 3274 CDS product nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707567.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence326 3425 315 gene locus_tag LOCUS_22710 3425 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence327 809 1876 gene locus_tag LOCUS_22720 809 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072833.1 protein_id gnl|my_center|LOCUS_22720 2689 1928 gene locus_tag LOCUS_22730 gene ivdG 2689 1928 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071833.1 protein_id gnl|my_center|LOCUS_22730 3585 2698 gene locus_tag LOCUS_22740 3585 2698 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H47 protein_id gnl|my_center|LOCUS_22740 >Feature sequence328 1016 216 gene locus_tag LOCUS_22750 gene cheR-3 1016 216 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706645.1 protein_id gnl|my_center|LOCUS_22750 1465 1034 gene locus_tag LOCUS_22760 1465 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22760 1966 1574 gene locus_tag LOCUS_22770 1966 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22770 2107 2814 gene locus_tag LOCUS_22780 gene flgA 2107 2814 CDS product flagellar basal body P-ring biosynthesis protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262377.1 protein_id gnl|my_center|LOCUS_22780 2882 3202 gene locus_tag LOCUS_22790 2882 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3195 3623 gene locus_tag LOCUS_22800 3195 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence329 293 1105 gene locus_tag LOCUS_22810 293 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22810 1247 1456 gene locus_tag LOCUS_22820 1247 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 1631 3706 gene locus_tag LOCUS_22830 1631 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence330 <1 952 gene locus_tag LOCUS_22840 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187933.1:LuxR family transcriptional regulator 1601 2935 gene locus_tag LOCUS_22850 1601 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 >Feature sequence331 1538 2116 gene locus_tag LOCUS_22860 1538 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 2172 3524 gene locus_tag LOCUS_22870 2172 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence332 645 16 gene locus_tag LOCUS_22880 645 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 854 3172 gene locus_tag LOCUS_22890 854 3172 CDS product aerobic respiration control sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPJ8 protein_id gnl|my_center|LOCUS_22890 3958 3236 gene locus_tag LOCUS_22900 gene arcA-1 3958 3236 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706824.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence333 1656 196 gene locus_tag LOCUS_22910 1656 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1870 1736 gene locus_tag LOCUS_22920 1870 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2942 1899 gene locus_tag LOCUS_22930 2942 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 3310 2939 gene locus_tag LOCUS_22940 3310 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence334 266 3490 gene locus_tag LOCUS_22950 266 3490 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K6 protein_id gnl|my_center|LOCUS_22950 >Feature sequence335 792 127 gene locus_tag LOCUS_22960 gene gph 792 127 CDS product phosphoglycolate phosphatase, bacterial inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_22960 1472 789 gene locus_tag LOCUS_22970 gene rpe 1472 789 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK14 protein_id gnl|my_center|LOCUS_22970 1699 1998 gene locus_tag LOCUS_22980 1699 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 3031 2189 gene locus_tag LOCUS_22990 gene dam 3031 2189 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2G2 protein_id gnl|my_center|LOCUS_22990 >Feature sequence336 295 1203 gene locus_tag LOCUS_23000 295 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 1254 1652 gene locus_tag LOCUS_23010 1254 1652 CDS product FosA family fosfomycin resistance glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704268.1 protein_id gnl|my_center|LOCUS_23010 3159 1717 gene locus_tag LOCUS_23020 3159 1717 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640003.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence337 369 848 gene locus_tag LOCUS_23030 369 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2522 876 gene locus_tag LOCUS_23040 gene tyrR 2522 876 CDS product TyrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705761.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence338 626 2737 gene locus_tag LOCUS_23050 626 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 <3904 2832 gene locus_tag LOCUS_23060 <3904 2832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000523648.1:methyl-accepting chemotaxis protein >Feature sequence339 869 2332 gene locus_tag LOCUS_23070 869 2332 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257472.1 protein_id gnl|my_center|LOCUS_23070 3004 2408 gene locus_tag LOCUS_23080 3004 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 3155 3628 gene locus_tag LOCUS_23090 3155 3628 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465952.1 protein_id gnl|my_center|LOCUS_23090 3901 3698 gene locus_tag LOCUS_23100 3901 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence340 2988 925 gene locus_tag LOCUS_23110 gene gspD 2988 925 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070563.1 protein_id gnl|my_center|LOCUS_23110 <3894 3013 gene locus_tag LOCUS_23120 <3894 3013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070562.1:type II secretion system protein GspC >Feature sequence341 <1 764 gene locus_tag LOCUS_23130 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088614.1:dehydrogenase 774 1775 gene locus_tag LOCUS_23140 774 1775 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975258.1 protein_id gnl|my_center|LOCUS_23140 1886 3442 gene locus_tag LOCUS_23150 1886 3442 CDS product glycine/betaine ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106258.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence342 290 523 gene locus_tag LOCUS_23160 290 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 1687 554 gene locus_tag LOCUS_23170 gene dnaJ 1687 554 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRG5 protein_id gnl|my_center|LOCUS_23170 3725 1803 gene locus_tag LOCUS_23180 gene dnaK 3725 1803 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQT1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence343 321 764 gene locus_tag LOCUS_23190 321 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23190 900 1586 gene locus_tag LOCUS_23200 900 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3055 1742 gene locus_tag LOCUS_23210 3055 1742 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559525.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence344 1909 692 gene locus_tag LOCUS_23220 1909 692 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969412.1 protein_id gnl|my_center|LOCUS_23220 3701 2052 gene locus_tag LOCUS_23230 gene betA 3701 2052 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H53 protein_id gnl|my_center|LOCUS_23230 3832 3710 gene locus_tag LOCUS_23240 3832 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence345 <1 1816 gene locus_tag LOCUS_23250 <1 1816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase <3832 1854 gene locus_tag LOCUS_23260 <3832 1854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070706.1:diguanylate cyclase >Feature sequence346 1267 746 gene locus_tag LOCUS_23270 gene hscB 1267 746 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S25 protein_id gnl|my_center|LOCUS_23270 1676 1353 gene locus_tag LOCUS_23280 gene iscA 1676 1353 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ34 protein_id gnl|my_center|LOCUS_23280 2071 1688 gene locus_tag LOCUS_23290 gene iscU 2071 1688 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ33 protein_id gnl|my_center|LOCUS_23290 3328 2114 gene locus_tag LOCUS_23300 gene iscS 3328 2114 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNC4 protein_id gnl|my_center|LOCUS_23300 3681 3352 gene locus_tag LOCUS_23310 3681 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23310 >Feature sequence347 557 2377 gene locus_tag LOCUS_23320 gene hemR 557 2377 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815406.1 protein_id gnl|my_center|LOCUS_23320 3333 2518 gene locus_tag LOCUS_23330 3333 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence348 504 1355 gene locus_tag LOCUS_23340 504 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 1366 2373 gene locus_tag LOCUS_23350 gene hemB 1366 2373 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8U8 protein_id gnl|my_center|LOCUS_23350 >Feature sequence349 2401 836 gene locus_tag LOCUS_23360 2401 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 3702 2539 gene locus_tag LOCUS_23370 3702 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence350 1171 449 gene locus_tag LOCUS_23380 gene kdkA 1171 449 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I7 protein_id gnl|my_center|LOCUS_23380 1310 2371 gene locus_tag LOCUS_23390 gene waaC 1310 2371 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074269.1 protein_id gnl|my_center|LOCUS_23390 2412 2966 gene locus_tag LOCUS_23400 gene gmhB 2412 2966 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDB1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence351 <1 820 gene locus_tag LOCUS_23410 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207455.1:alkaline phosphatase 933 3053 gene locus_tag LOCUS_23420 933 3053 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071497.1 protein_id gnl|my_center|LOCUS_23420 3467 3276 gene locus_tag LOCUS_23430 3467 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 3597 3445 gene locus_tag LOCUS_23440 3597 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence352 1379 141 gene locus_tag LOCUS_23450 1379 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23450 2147 1392 gene locus_tag LOCUS_23460 2147 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23460 <3780 2355 gene locus_tag LOCUS_23470 <3780 2355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002212080.1:methionine synthase >Feature sequence353 1103 423 gene locus_tag LOCUS_23480 1103 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 1432 3501 gene locus_tag LOCUS_23490 1432 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23490 >Feature sequence354 <1 2999 gene locus_tag LOCUS_23500 <1 2999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114080.1:two-component sensor >Feature sequence355 1405 1581 gene locus_tag LOCUS_23510 1405 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 1900 2439 gene locus_tag LOCUS_23520 1900 2439 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094966.1 protein_id gnl|my_center|LOCUS_23520 2530 3480 gene locus_tag LOCUS_23530 2530 3480 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094967.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence356 814 182 gene locus_tag LOCUS_23540 814 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1728 907 gene locus_tag LOCUS_23550 1728 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 3184 2036 gene locus_tag LOCUS_23560 3184 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence357 207 2603 gene locus_tag LOCUS_23570 207 2603 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_23570 2640 3389 gene locus_tag LOCUS_23580 2640 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence358 3 605 gene locus_tag LOCUS_23590 3 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1263 739 gene locus_tag LOCUS_23600 gene gpo 1263 739 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM1 protein_id gnl|my_center|LOCUS_23600 1396 2277 gene locus_tag LOCUS_23610 gene garR 1396 2277 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072707.1 protein_id gnl|my_center|LOCUS_23610 2794 2321 gene locus_tag LOCUS_23620 gene bcp 2794 2321 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071986.1 protein_id gnl|my_center|LOCUS_23620 3336 2803 gene locus_tag LOCUS_23630 gene gcvR 3336 2803 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071987.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence359 1206 502 gene locus_tag LOCUS_23640 1206 502 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073487.1 protein_id gnl|my_center|LOCUS_23640 2511 1255 gene locus_tag LOCUS_23650 2511 1255 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073489.1 protein_id gnl|my_center|LOCUS_23650 2851 3330 gene locus_tag LOCUS_23660 2851 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence360 1460 2266 gene locus_tag LOCUS_23670 1460 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 <3695 2324 gene locus_tag LOCUS_23680 <3695 2324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KTM7:proline--tRNA ligase >Feature sequence361 1491 106 gene locus_tag LOCUS_23690 1491 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 1670 2155 gene locus_tag LOCUS_23700 1670 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2165 2869 gene locus_tag LOCUS_23710 2165 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23710 2909 3043 gene locus_tag LOCUS_23720 2909 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 3053 3238 gene locus_tag LOCUS_23730 3053 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence362 279 1571 gene locus_tag LOCUS_23740 gene surA 279 1571 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB95 protein_id gnl|my_center|LOCUS_23740 1579 2568 gene locus_tag LOCUS_23750 gene pdxA 1579 2568 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGT9 protein_id gnl|my_center|LOCUS_23750 2568 3371 gene locus_tag LOCUS_23760 gene rsmA 2568 3371 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ST6 protein_id gnl|my_center|LOCUS_23760 >Feature sequence363 3560 2271 gene locus_tag LOCUS_23770 3560 2271 CDS product branched-chain amino acid transport system carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JR3 protein_id gnl|my_center|LOCUS_23770 >Feature sequence364 794 1519 gene locus_tag LOCUS_23780 794 1519 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_23780 1522 3480 gene locus_tag LOCUS_23790 1522 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence365 589 230 gene locus_tag LOCUS_23800 589 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23800 862 692 gene locus_tag LOCUS_23810 862 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23810 1575 877 gene locus_tag LOCUS_23820 1575 877 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW9 protein_id gnl|my_center|LOCUS_23820 2210 1572 gene locus_tag LOCUS_23830 gene rsxG 2210 1572 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32FE2 protein_id gnl|my_center|LOCUS_23830 3265 2207 gene locus_tag LOCUS_23840 gene rnfD 3265 2207 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EJ94 protein_id gnl|my_center|LOCUS_23840 3504 3262 gene locus_tag LOCUS_23850 3504 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence366 500 198 gene locus_tag LOCUS_23860 500 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 952 512 gene locus_tag LOCUS_23870 952 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1952 954 gene locus_tag LOCUS_23880 1952 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 2100 2318 gene locus_tag LOCUS_23890 2100 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 3423 2305 gene locus_tag LOCUS_23900 3423 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence367 2075 957 gene locus_tag LOCUS_23910 2075 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085074.1 protein_id gnl|my_center|LOCUS_23910 2854 3585 gene locus_tag LOCUS_23920 2854 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence368 <1 2291 gene locus_tag LOCUS_23930 <1 2291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261622.1:chitinase >Feature sequence369 1981 605 gene locus_tag LOCUS_23940 gene trkA 1981 605 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704263.1 protein_id gnl|my_center|LOCUS_23940 3277 1994 gene locus_tag LOCUS_23950 gene rsmB 3277 1994 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Q6 protein_id gnl|my_center|LOCUS_23950 3501 3277 gene locus_tag LOCUS_23960 3501 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23960 >Feature sequence370 443 132 gene locus_tag LOCUS_23970 443 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 2341 515 gene locus_tag LOCUS_23980 2341 515 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070916.1 protein_id gnl|my_center|LOCUS_23980 <3609 2391 gene locus_tag LOCUS_23990 <3609 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87RG4:glutamine--tRNA ligase >Feature sequence371 644 1303 gene locus_tag LOCUS_24000 644 1303 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085635.1 protein_id gnl|my_center|LOCUS_24000 1347 2021 gene locus_tag LOCUS_24010 1347 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24010 2043 2240 gene locus_tag LOCUS_24020 2043 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24020 2324 3445 gene locus_tag LOCUS_24030 gene prpC 2324 3445 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_24030 >Feature sequence372 674 1771 gene locus_tag LOCUS_24040 674 1771 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201948.1 protein_id gnl|my_center|LOCUS_24040 2670 1891 gene locus_tag LOCUS_24050 2670 1891 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706518.1 protein_id gnl|my_center|LOCUS_24050 3379 2663 gene locus_tag LOCUS_24060 3379 2663 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920935.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence373 79 4 gene locus_tag LOCUS_t00320 79 4 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 949 230 gene locus_tag LOCUS_24070 gene ybgF 949 230 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072685.1 protein_id gnl|my_center|LOCUS_24070 1528 992 gene locus_tag LOCUS_24080 gene pal 1528 992 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304908.1 protein_id gnl|my_center|LOCUS_24080 2925 1567 gene locus_tag LOCUS_24090 gene tolB 2925 1567 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QT9 protein_id gnl|my_center|LOCUS_24090 <3582 2934 gene locus_tag LOCUS_24100 <3582 2934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072688.1:protein TolA >Feature sequence374 42 476 gene locus_tag LOCUS_24110 42 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 protein_id gnl|my_center|LOCUS_24110 466 1071 gene locus_tag LOCUS_24120 gene rdgB 466 1071 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGJ7 protein_id gnl|my_center|LOCUS_24120 1119 2210 gene locus_tag LOCUS_24130 gene yggW 1119 2210 CDS product YggW family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261210.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence375 2046 403 gene locus_tag LOCUS_24140 gene yidC 2046 403 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQZ7 protein_id gnl|my_center|LOCUS_24140 2857 2429 gene locus_tag LOCUS_24150 gene rnpA 2857 2429 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT4 protein_id gnl|my_center|LOCUS_24150 2998 2864 gene locus_tag LOCUS_24160 gene rpmH 2998 2864 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66244 protein_id gnl|my_center|LOCUS_24160 >Feature sequence376 395 1129 gene locus_tag LOCUS_24170 395 1129 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX6 protein_id gnl|my_center|LOCUS_24170 1184 2140 gene locus_tag LOCUS_24180 gene gshB 1184 2140 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MPR3 protein_id gnl|my_center|LOCUS_24180 2188 2745 gene locus_tag LOCUS_24190 2188 2745 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LK0 protein_id gnl|my_center|LOCUS_24190 2757 3206 gene locus_tag LOCUS_24200 2757 3206 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ8 protein_id gnl|my_center|LOCUS_24200 >Feature sequence377 477 1583 gene locus_tag LOCUS_24210 477 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2794 1619 gene locus_tag LOCUS_24220 2794 1619 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706654.1 protein_id gnl|my_center|LOCUS_24220 <3545 2972 gene locus_tag LOCUS_24230 <3545 2972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263650.1:1-pyrroline-5-carboxylate dehydrogenase >Feature sequence378 <1 566 gene locus_tag LOCUS_24240 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E6W1:glutamate 5-kinase 634 1635 gene locus_tag LOCUS_24250 634 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1678 2043 gene locus_tag LOCUS_24260 1678 2043 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 protein_id gnl|my_center|LOCUS_24260 2208 3512 gene locus_tag LOCUS_24270 gene gltX 2208 3512 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KG28 protein_id gnl|my_center|LOCUS_24270 >Feature sequence379 1 507 gene locus_tag LOCUS_24280 1 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704016.1 protein_id gnl|my_center|LOCUS_24280 537 1550 gene locus_tag LOCUS_24290 gene tsaD 537 1550 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGI3 protein_id gnl|my_center|LOCUS_24290 2171 1575 gene locus_tag LOCUS_24300 gene plsY 2171 1575 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SL3 protein_id gnl|my_center|LOCUS_24300 2284 2640 gene locus_tag LOCUS_24310 gene folB 2284 2640 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5V5 protein_id gnl|my_center|LOCUS_24310 2642 3121 gene locus_tag LOCUS_24320 gene folK-2 2642 3121 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence380 2266 923 gene locus_tag LOCUS_24330 2266 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 <3536 2549 gene locus_tag LOCUS_24340 <3536 2549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038506.1:TonB-dependent receptor >Feature sequence381 960 217 gene locus_tag LOCUS_24350 gene deoC 960 217 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83P02 protein_id gnl|my_center|LOCUS_24350 1294 2718 gene locus_tag LOCUS_24360 gene cysG2 1294 2718 CDS product siroheme synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KP37 protein_id gnl|my_center|LOCUS_24360 >Feature sequence382 3 245 gene locus_tag LOCUS_24370 3 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 321 485 gene locus_tag LOCUS_24380 321 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 931 482 gene locus_tag LOCUS_24390 931 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 2323 1145 gene locus_tag LOCUS_24400 2323 1145 CDS product N-acylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036696.1 protein_id gnl|my_center|LOCUS_24400 3326 2334 gene locus_tag LOCUS_24410 gene scrK 3326 2334 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036695.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence383 501 1193 gene locus_tag LOCUS_24420 501 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 protein_id gnl|my_center|LOCUS_24420 1289 2518 gene locus_tag LOCUS_24430 1289 2518 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073255.1 protein_id gnl|my_center|LOCUS_24430 2558 2740 gene locus_tag LOCUS_24440 2558 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 3448 2804 gene locus_tag LOCUS_24450 3448 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence384 196 23 gene locus_tag LOCUS_24460 196 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1654 218 gene locus_tag LOCUS_24470 1654 218 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141814.1 protein_id gnl|my_center|LOCUS_24470 1878 3245 gene locus_tag LOCUS_24480 1878 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 >Feature sequence385 160 1710 gene locus_tag LOCUS_24490 160 1710 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268416.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence386 834 3284 gene locus_tag LOCUS_24500 gene mcrA 834 3284 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070652.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence387 569 1522 gene locus_tag LOCUS_24510 569 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 2407 1568 gene locus_tag LOCUS_24520 2407 1568 CDS product signal transduction superfamily protein with modified HD-GYP domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071477.1 protein_id gnl|my_center|LOCUS_24520 3349 2960 gene locus_tag LOCUS_24530 3349 2960 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262332.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence388 383 1336 gene locus_tag LOCUS_24540 383 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1338 2726 gene locus_tag LOCUS_24550 gene sypL 1338 2726 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263840.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence389 14 1396 gene locus_tag LOCUS_24560 14 1396 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_24560 1540 2337 gene locus_tag LOCUS_24570 1540 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_24570 2351 3376 gene locus_tag LOCUS_24580 2351 3376 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT26 protein_id gnl|my_center|LOCUS_24580 >Feature sequence390 <1 832 gene locus_tag LOCUS_24590 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867262.1:serine hydrolase 969 1475 gene locus_tag LOCUS_24600 969 1475 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636204.1 protein_id gnl|my_center|LOCUS_24600 1646 2044 gene locus_tag LOCUS_24610 1646 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2151 2288 gene locus_tag LOCUS_24620 2151 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2305 2772 gene locus_tag LOCUS_24630 2305 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 3035 3187 gene locus_tag LOCUS_24640 3035 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence391 <1 1479 gene locus_tag LOCUS_24650 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_797983.2:aminopeptidase 1480 1701 gene locus_tag LOCUS_24660 1480 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence392 2609 18 gene locus_tag LOCUS_24670 gene fyuA 2609 18 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038506.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence393 588 1673 gene locus_tag LOCUS_24680 588 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1874 2983 gene locus_tag LOCUS_24690 gene asd-1 1874 2983 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJM5 protein_id gnl|my_center|LOCUS_24690 >Feature sequence394 2117 1026 gene locus_tag LOCUS_24700 2117 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence395 676 1389 gene locus_tag LOCUS_24710 gene rph 676 1389 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L4 protein_id gnl|my_center|LOCUS_24710 1406 2047 gene locus_tag LOCUS_24720 gene pyrE 1406 2047 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T92 protein_id gnl|my_center|LOCUS_24720 >Feature sequence396 <1 761 gene locus_tag LOCUS_24730 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705254.1:acriflavine resistance protein B 947 1327 gene locus_tag LOCUS_24740 947 1327 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070678.1 protein_id gnl|my_center|LOCUS_24740 1877 1461 gene locus_tag LOCUS_24750 1877 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 2881 1937 gene locus_tag LOCUS_24760 2881 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence397 282 1367 gene locus_tag LOCUS_24770 282 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1379 2101 gene locus_tag LOCUS_24780 gene cobB 1379 2101 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67919 protein_id gnl|my_center|LOCUS_24780 2214 2807 gene locus_tag LOCUS_24790 2214 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 3351 2908 gene locus_tag LOCUS_24800 3351 2908 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105974.1 protein_id gnl|my_center|LOCUS_24800 >Feature sequence398 554 162 gene locus_tag LOCUS_24810 554 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 1861 677 gene locus_tag LOCUS_24820 1861 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 2776 1898 gene locus_tag LOCUS_24830 2776 1898 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705975.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence399 >Feature sequence400 2481 1234 gene locus_tag LOCUS_24840 gene fucP 2481 1234 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_24840 <3344 2605 gene locus_tag LOCUS_24850 <3344 2605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918883.1:TonB-dependent receptor >Feature sequence401 876 184 gene locus_tag LOCUS_24860 gene algR 876 184 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_24860 1940 873 gene locus_tag LOCUS_24870 1940 873 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_24870 2811 1942 gene locus_tag LOCUS_24880 2811 1942 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405425.1 protein_id gnl|my_center|LOCUS_24880 >Feature sequence402 983 198 gene locus_tag LOCUS_24890 gene csgG 983 198 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073480.1 protein_id gnl|my_center|LOCUS_24890 1428 985 gene locus_tag LOCUS_24900 gene csgF 1428 985 CDS product curli production assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073481.1 protein_id gnl|my_center|LOCUS_24900 1817 1431 gene locus_tag LOCUS_24910 1817 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 <3311 1854 gene locus_tag LOCUS_24920 <3311 1854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071155.1:curlin >Feature sequence403 869 1336 gene locus_tag LOCUS_24930 869 1336 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707488.1 protein_id gnl|my_center|LOCUS_24930 2119 1451 gene locus_tag LOCUS_24940 2119 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence404 500 1489 gene locus_tag LOCUS_24950 500 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 1985 1500 gene locus_tag LOCUS_24960 1985 1500 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7H4 protein_id gnl|my_center|LOCUS_24960 2905 2231 gene locus_tag LOCUS_24970 2905 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920508.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence405 301 1158 gene locus_tag LOCUS_24980 301 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24980 1278 2042 gene locus_tag LOCUS_24990 gene flgF 1278 2042 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM41 protein_id gnl|my_center|LOCUS_24990 2060 2848 gene locus_tag LOCUS_25000 gene flgG 2060 2848 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA0 protein_id gnl|my_center|LOCUS_25000 >Feature sequence406 834 349 gene locus_tag LOCUS_25010 834 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070894.1 protein_id gnl|my_center|LOCUS_25010 3071 978 gene locus_tag LOCUS_25020 3071 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25020 >Feature sequence407 1127 273 gene locus_tag LOCUS_25030 gene yfhH 1127 273 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995694.1 protein_id gnl|my_center|LOCUS_25030 1376 2230 gene locus_tag LOCUS_25040 1376 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25040 2303 2749 gene locus_tag LOCUS_25050 2303 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence408 >Feature sequence409 88 741 gene locus_tag LOCUS_25060 gene rluA 88 741 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MDZ6 protein_id gnl|my_center|LOCUS_25060 2066 759 gene locus_tag LOCUS_25070 2066 759 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_25070 <3202 2351 gene locus_tag LOCUS_25080 <3202 2351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KPK2:DNA topoisomerase 4 subunit A >Feature sequence410 1872 115 gene locus_tag LOCUS_25090 1872 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25090 2278 2742 gene locus_tag LOCUS_25100 2278 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence411 491 1804 gene locus_tag LOCUS_25110 491 1804 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107493.1 protein_id gnl|my_center|LOCUS_25110 1928 2095 gene locus_tag LOCUS_25120 1928 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2235 2375 gene locus_tag LOCUS_25130 2235 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence412 73 2664 gene locus_tag LOCUS_25140 gene acnD 73 2664 CDS product 2-methylcitrate dehydratase (2-methyl-trans-aconitate forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW3 protein_id gnl|my_center|LOCUS_25140 >Feature sequence413 1690 821 gene locus_tag LOCUS_25150 1690 821 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261545.1 protein_id gnl|my_center|LOCUS_25150 1938 1699 gene locus_tag LOCUS_25160 1938 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1832 2383 gene locus_tag LOCUS_25170 1832 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence414 295 44 gene locus_tag LOCUS_25180 295 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1196 642 gene locus_tag LOCUS_25190 1196 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 1523 1275 gene locus_tag LOCUS_25200 1523 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 1831 2541 gene locus_tag LOCUS_25210 1831 2541 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083769.1 protein_id gnl|my_center|LOCUS_25210 <3177 2578 gene locus_tag LOCUS_25220 <3177 2578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943398.1:transposase >Feature sequence415 339 1919 gene locus_tag LOCUS_25230 339 1919 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947198.1 protein_id gnl|my_center|LOCUS_25230 2102 2764 gene locus_tag LOCUS_25240 2102 2764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103923.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence416 1579 701 gene locus_tag LOCUS_25250 1579 701 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073194.1 protein_id gnl|my_center|LOCUS_25250 1750 2202 gene locus_tag LOCUS_25260 1750 2202 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482937.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence417 19 1449 gene locus_tag LOCUS_25270 19 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1829 2443 gene locus_tag LOCUS_25280 1829 2443 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071613.1 protein_id gnl|my_center|LOCUS_25280 2444 2743 gene locus_tag LOCUS_25290 2444 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence418 376 963 gene locus_tag LOCUS_25300 gene yihI 376 963 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TF6 protein_id gnl|my_center|LOCUS_25300 963 1478 gene locus_tag LOCUS_25310 963 1478 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001886251.1 protein_id gnl|my_center|LOCUS_25310 1587 2240 gene locus_tag LOCUS_25320 1587 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2233 2910 gene locus_tag LOCUS_25330 2233 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence419 2772 1399 gene locus_tag LOCUS_25340 2772 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence420 71 454 gene locus_tag LOCUS_25350 71 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25350 619 1029 gene locus_tag LOCUS_25360 gene flgB 619 1029 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC94 protein_id gnl|my_center|LOCUS_25360 1032 1466 gene locus_tag LOCUS_25370 gene flgC 1032 1466 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC95 protein_id gnl|my_center|LOCUS_25370 1481 2164 gene locus_tag LOCUS_25380 1481 2164 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YY9 protein_id gnl|my_center|LOCUS_25380 >Feature sequence421 <1 1898 gene locus_tag LOCUS_25390 <1 1898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704912.1:chitinase 2151 1969 gene locus_tag LOCUS_25400 2151 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 2353 2943 gene locus_tag LOCUS_25410 2353 2943 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence422 1723 287 gene locus_tag LOCUS_25420 1723 287 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483021.1 protein_id gnl|my_center|LOCUS_25420 2147 2935 gene locus_tag LOCUS_25430 2147 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence423 <1 500 gene locus_tag LOCUS_25440 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EHS5:carbamoyl-phosphate synthase (glutamine-hydrolyzing) 702 1178 gene locus_tag LOCUS_25450 gene greA 702 1178 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQ76 protein_id gnl|my_center|LOCUS_25450 1294 2367 gene locus_tag LOCUS_25460 1294 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2937 2497 gene locus_tag LOCUS_25470 gene gloA 2937 2497 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707961.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence424 2869 815 gene locus_tag LOCUS_25480 2869 815 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249703.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence425 269 958 gene locus_tag LOCUS_25490 269 958 CDS product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464070.1 protein_id gnl|my_center|LOCUS_25490 2846 972 gene locus_tag LOCUS_25500 2846 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence426 <3076 1001 gene locus_tag LOCUS_25510 <3076 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229634.1:alpha-1,2-mannosidase >Feature sequence427 600 268 gene locus_tag LOCUS_25520 600 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25520 2289 787 gene locus_tag LOCUS_25530 2289 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25530 <3071 2467 gene locus_tag LOCUS_25540 <3071 2467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482609.1:phenazine biosynthesis protein PhzF >Feature sequence428 450 1571 gene locus_tag LOCUS_25550 450 1571 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_25550 >Feature sequence429 173 382 gene locus_tag LOCUS_25560 173 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25560 522 2198 gene locus_tag LOCUS_25570 gene pilB 522 2198 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 protein_id gnl|my_center|LOCUS_25570 2259 2498 gene locus_tag LOCUS_25580 2259 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 3000 2539 gene locus_tag LOCUS_25590 3000 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 >Feature sequence430 290 760 gene locus_tag LOCUS_25600 gene rpsG 290 760 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8C0 protein_id gnl|my_center|LOCUS_25600 788 2902 gene locus_tag LOCUS_25610 gene fusA1 788 2902 CDS product elongation factor G 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L45 protein_id gnl|my_center|LOCUS_25610 >Feature sequence431 <1 2868 gene locus_tag LOCUS_25620 <1 2868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070535.1:peptidase M6 >Feature sequence432 709 1386 gene locus_tag LOCUS_25630 709 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 1383 1715 gene locus_tag LOCUS_25640 1383 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 >Feature sequence433 1490 24 gene locus_tag LOCUS_25650 1490 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence434 984 2018 gene locus_tag LOCUS_25660 984 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 <3007 2336 gene locus_tag LOCUS_25670 <3007 2336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EA75:ATP-dependent RNA helicase DeaD >Feature sequence435 870 406 gene locus_tag LOCUS_25680 870 406 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969220.1 protein_id gnl|my_center|LOCUS_25680 2150 1257 gene locus_tag LOCUS_25690 gene nhaR 2150 1257 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704639.1 protein_id gnl|my_center|LOCUS_25690 2274 2576 gene locus_tag LOCUS_25700 2274 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 >Feature sequence436 <1 523 gene locus_tag LOCUS_25710 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ED71:pyridoxine/pyridoxamine 5'-phosphate oxidase 774 589 gene locus_tag LOCUS_25720 774 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 873 1637 gene locus_tag LOCUS_25730 gene yjjV 873 1637 CDS product DNAse inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261271.1 protein_id gnl|my_center|LOCUS_25730 2224 1604 gene locus_tag LOCUS_25740 2224 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 2299 2847 gene locus_tag LOCUS_25750 2299 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25750 >Feature sequence437 416 2266 gene locus_tag LOCUS_25760 416 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence438 244 35 gene locus_tag LOCUS_25770 244 35 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 protein_id gnl|my_center|LOCUS_25770 570 2681 gene locus_tag LOCUS_25780 570 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 >Feature sequence439 125 460 gene locus_tag LOCUS_25790 125 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 619 1392 gene locus_tag LOCUS_25800 619 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 <2983 1692 gene locus_tag LOCUS_25810 <2983 1692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000584701.1:TonB-dependent receptor >Feature sequence440 631 2 gene locus_tag LOCUS_25820 631 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1261 1142 gene locus_tag LOCUS_25830 1261 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 1952 1296 gene locus_tag LOCUS_25840 1952 1296 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_25840 >Feature sequence441 2586 157 gene locus_tag LOCUS_25850 2586 157 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071669.1 protein_id gnl|my_center|LOCUS_25850 >Feature sequence442 68 1756 gene locus_tag LOCUS_25860 68 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 1962 2969 gene locus_tag LOCUS_25870 1962 2969 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071715.1 protein_id gnl|my_center|LOCUS_25870 >Feature sequence443 1247 24 gene locus_tag LOCUS_25880 1247 24 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_25880 2495 1257 gene locus_tag LOCUS_25890 2495 1257 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480719.1 protein_id gnl|my_center|LOCUS_25890 2671 2856 gene locus_tag LOCUS_25900 2671 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25900 >Feature sequence444 516 1277 gene locus_tag LOCUS_25910 516 1277 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 protein_id gnl|my_center|LOCUS_25910 2251 1358 gene locus_tag LOCUS_25920 2251 1358 CDS product TIGR03899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261128.1 protein_id gnl|my_center|LOCUS_25920 2731 2261 gene locus_tag LOCUS_25930 2731 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence445 427 2205 gene locus_tag LOCUS_25940 427 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence446 <1 775 gene locus_tag LOCUS_25950 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477129.1:ubiquinol-cytochrome c reductase note possible pseudo, internal stop codon 797 1204 gene locus_tag LOCUS_25960 797 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25960 1246 1395 gene locus_tag LOCUS_25970 1246 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 1459 1617 gene locus_tag LOCUS_25980 1459 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 2825 1638 gene locus_tag LOCUS_25990 2825 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 >Feature sequence447 1334 624 gene locus_tag LOCUS_26000 1334 624 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479043.1 protein_id gnl|my_center|LOCUS_26000 1489 1674 gene locus_tag LOCUS_26010 1489 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 1664 1960 gene locus_tag LOCUS_26020 1664 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 2494 2018 gene locus_tag LOCUS_26030 2494 2018 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190145.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence448 2748 1177 gene locus_tag LOCUS_26040 gene phoA 2748 1177 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence449 143 556 gene locus_tag LOCUS_26050 gene umuD 143 556 CDS product DNA polymerase V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419177.1 protein_id gnl|my_center|LOCUS_26050 1200 604 gene locus_tag LOCUS_26060 1200 604 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_26060 1505 1212 gene locus_tag LOCUS_26070 1505 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262427.1 protein_id gnl|my_center|LOCUS_26070 2177 1665 gene locus_tag LOCUS_26080 2177 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 <2929 2193 gene locus_tag LOCUS_26090 <2929 2193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HFY5:beta-lactamase >Feature sequence450 1062 328 gene locus_tag LOCUS_26100 1062 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1578 2630 gene locus_tag LOCUS_26110 1578 2630 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706923.1 protein_id gnl|my_center|LOCUS_26110 >Feature sequence451 726 226 gene locus_tag LOCUS_26120 726 226 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262753.1 protein_id gnl|my_center|LOCUS_26120 1090 743 gene locus_tag LOCUS_26130 gene arsR 1090 743 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070872.1 protein_id gnl|my_center|LOCUS_26130 2126 1242 gene locus_tag LOCUS_26140 2126 1242 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261918.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence452 254 60 gene locus_tag LOCUS_26150 254 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 1062 880 gene locus_tag LOCUS_26160 1062 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26160 1449 1075 gene locus_tag LOCUS_26170 1449 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26170 1981 1505 gene locus_tag LOCUS_26180 1981 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074250.1 protein_id gnl|my_center|LOCUS_26180 2809 2024 gene locus_tag LOCUS_26190 2809 2024 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_26190 >Feature sequence453 204 563 gene locus_tag LOCUS_26200 204 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 1304 564 gene locus_tag LOCUS_26210 1304 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 1831 1436 gene locus_tag LOCUS_26220 1831 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 2032 2778 gene locus_tag LOCUS_26230 2032 2778 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116045.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence454 2281 2649 gene locus_tag LOCUS_26240 2281 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence455 257 685 gene locus_tag LOCUS_26250 257 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1126 707 gene locus_tag LOCUS_26260 gene flgP 1126 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073139.1 protein_id gnl|my_center|LOCUS_26260 1278 2468 gene locus_tag LOCUS_26270 1278 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420415.1 protein_id gnl|my_center|LOCUS_26270 2867 2791 gene locus_tag LOCUS_t00330 2867 2791 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence456 339 749 gene locus_tag LOCUS_26280 339 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 760 1605 gene locus_tag LOCUS_26290 gene hslO 760 1605 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFS3 protein_id gnl|my_center|LOCUS_26290 >Feature sequence457 475 885 gene locus_tag LOCUS_26300 475 885 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_26300 894 1499 gene locus_tag LOCUS_26310 894 1499 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZF0 protein_id gnl|my_center|LOCUS_26310 1528 2814 gene locus_tag LOCUS_26320 1528 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829069.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence458 1003 1536 gene locus_tag LOCUS_26330 1003 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483274.1 protein_id gnl|my_center|LOCUS_26330 1508 1912 gene locus_tag LOCUS_26340 1508 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_26340 2235 2648 gene locus_tag LOCUS_26350 2235 2648 CDS product BluF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073432.1 protein_id gnl|my_center|LOCUS_26350 >Feature sequence459 <1 548 gene locus_tag LOCUS_26360 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478632.1:two-component system sensor histidine kinase NtrB 572 1972 gene locus_tag LOCUS_26370 572 1972 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456831.1 protein_id gnl|my_center|LOCUS_26370 2107 2271 gene locus_tag LOCUS_26380 2107 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 <2848 2325 gene locus_tag LOCUS_26390 <2848 2325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005483538.1:cysteine desulfurase-like protein >Feature sequence460 1828 1565 gene locus_tag LOCUS_26400 1828 1565 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence461 >Feature sequence462 <1 1212 gene locus_tag LOCUS_26410 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948334.1:cytosol aminopeptidase 2734 1265 gene locus_tag LOCUS_26420 gene pepD 2734 1265 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261447.1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence463 <1 1648 gene locus_tag LOCUS_26430 <1 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E6A2:aspartate--tRNA ligase 1944 2837 gene locus_tag LOCUS_26440 gene ttcA 1944 2837 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87PG9 protein_id gnl|my_center|LOCUS_26440 >Feature sequence464 527 1624 gene locus_tag LOCUS_26450 527 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 1618 2460 gene locus_tag LOCUS_26460 1618 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence465 453 31 gene locus_tag LOCUS_26470 453 31 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232796.2 protein_id gnl|my_center|LOCUS_26470 1338 580 gene locus_tag LOCUS_26480 1338 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071068.1 protein_id gnl|my_center|LOCUS_26480 2069 1656 gene locus_tag LOCUS_26490 2069 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence466 14 1180 gene locus_tag LOCUS_26500 gene gabD-2 14 1180 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103085.1 protein_id gnl|my_center|LOCUS_26500 1308 2195 gene locus_tag LOCUS_26510 1308 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070726.1 protein_id gnl|my_center|LOCUS_26510 >Feature sequence467 18 1364 gene locus_tag LOCUS_26520 18 1364 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881455.1 protein_id gnl|my_center|LOCUS_26520 1846 1400 gene locus_tag LOCUS_26530 gene elaA 1846 1400 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261122.1 protein_id gnl|my_center|LOCUS_26530 2651 1908 gene locus_tag LOCUS_26540 2651 1908 CDS product sporulation control protein Spo0M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261829.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence468 835 1611 gene locus_tag LOCUS_26550 835 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2461 1616 gene locus_tag LOCUS_26560 gene djlA 2461 1616 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUR8 protein_id gnl|my_center|LOCUS_26560 >Feature sequence469 982 410 gene locus_tag LOCUS_26570 982 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1686 1042 gene locus_tag LOCUS_26580 1686 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 2443 1730 gene locus_tag LOCUS_26590 2443 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 >Feature sequence470 565 209 gene locus_tag LOCUS_26600 565 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 1468 860 gene locus_tag LOCUS_26610 1468 860 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705228.1 protein_id gnl|my_center|LOCUS_26610 1566 2480 gene locus_tag LOCUS_26620 1566 2480 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529052.1 protein_id gnl|my_center|LOCUS_26620 >Feature sequence471 >Feature sequence472 1685 294 gene locus_tag LOCUS_26630 1685 294 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072292.1 protein_id gnl|my_center|LOCUS_26630 1781 2392 gene locus_tag LOCUS_26640 1781 2392 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194481.1 protein_id gnl|my_center|LOCUS_26640 >Feature sequence473 233 1306 gene locus_tag LOCUS_26650 233 1306 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369159.1 protein_id gnl|my_center|LOCUS_26650 1322 1873 gene locus_tag LOCUS_26660 1322 1873 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 protein_id gnl|my_center|LOCUS_26660 2173 2054 gene locus_tag LOCUS_26670 2173 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 2550 2338 gene locus_tag LOCUS_26680 2550 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 >Feature sequence474 <1 1167 gene locus_tag LOCUS_26690 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047707.1:amino acid ABC transporter 1962 1393 gene locus_tag LOCUS_26700 1962 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence475 680 450 gene locus_tag LOCUS_26710 680 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 <2710 1758 gene locus_tag LOCUS_26720 <2710 1758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001890356.1:peptidase >Feature sequence476 2289 1216 gene locus_tag LOCUS_26730 2289 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2708 2292 gene locus_tag LOCUS_26740 2708 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 >Feature sequence477 86 517 gene locus_tag LOCUS_26750 gene ndk 86 517 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU0 protein_id gnl|my_center|LOCUS_26750 699 1832 gene locus_tag LOCUS_26760 gene rlmN 699 1832 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC29 protein_id gnl|my_center|LOCUS_26760 >Feature sequence478 <2697 305 gene locus_tag LOCUS_26770 <2697 305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KEQ0:glycerol-3-phosphate acyltransferase >Feature sequence479 584 1750 gene locus_tag LOCUS_26780 gene dapE 584 1750 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MI6 protein_id gnl|my_center|LOCUS_26780 >Feature sequence480 3 1229 gene locus_tag LOCUS_26790 3 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 1324 2160 gene locus_tag LOCUS_26800 1324 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence481 200 988 gene locus_tag LOCUS_26810 200 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 <2689 996 gene locus_tag LOCUS_26820 <2689 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113216.1:bifunctional diguanylate cyclase/phosphodiesterase >Feature sequence482 392 168 gene locus_tag LOCUS_26830 392 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 2634 637 gene locus_tag LOCUS_26840 2634 637 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261723.1 protein_id gnl|my_center|LOCUS_26840 >Feature sequence483 <1 1611 gene locus_tag LOCUS_26850 <1 1611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KNY1:ribonuclease R 1617 2357 gene locus_tag LOCUS_26860 gene rlmB 1617 2357 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVE1 protein_id gnl|my_center|LOCUS_26860 >Feature sequence484 <2666 924 gene locus_tag LOCUS_26870 <2666 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114304.1:extracelullar DNA degradation protein EddB >Feature sequence485 823 395 gene locus_tag LOCUS_26880 823 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 1939 833 gene locus_tag LOCUS_26890 1939 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105922.1 protein_id gnl|my_center|LOCUS_26890 2383 2652 gene locus_tag LOCUS_26900 2383 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence486 1053 346 gene locus_tag LOCUS_26910 1053 346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_26910 2330 1086 gene locus_tag LOCUS_26920 2330 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence487 432 193 gene locus_tag LOCUS_26930 432 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 887 501 gene locus_tag LOCUS_26940 887 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1580 1783 gene locus_tag LOCUS_26950 1580 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2155 1787 gene locus_tag LOCUS_26960 2155 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence488 <1 507 gene locus_tag LOCUS_26970 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64RK7:dihydroorotase 630 1064 gene locus_tag LOCUS_26980 630 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 2118 1057 gene locus_tag LOCUS_26990 gene dinB 2118 1057 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MB4 protein_id gnl|my_center|LOCUS_26990 >Feature sequence489 1273 257 gene locus_tag LOCUS_27000 1273 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 1970 1515 gene locus_tag LOCUS_27010 1970 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 >Feature sequence490 1616 1230 gene locus_tag LOCUS_27020 1616 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 2608 1613 gene locus_tag LOCUS_27030 2608 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence491 449 1039 gene locus_tag LOCUS_27040 gene betI 449 1039 CDS product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGV8 protein_id gnl|my_center|LOCUS_27040 1042 2505 gene locus_tag LOCUS_27050 gene betB 1042 2505 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H52 protein_id gnl|my_center|LOCUS_27050 >Feature sequence492 1601 1071 gene locus_tag LOCUS_27060 1601 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27060 1853 1731 gene locus_tag LOCUS_27070 1853 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence493 284 1369 gene locus_tag LOCUS_27080 284 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 2087 1395 gene locus_tag LOCUS_27090 2087 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 >Feature sequence494 <1 529 gene locus_tag LOCUS_27100 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87KN8:tRNA/tmRNA (uracil-C(5))-methyltransferase 1410 781 gene locus_tag LOCUS_27110 1410 781 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KC3 protein_id gnl|my_center|LOCUS_27110 2053 1424 gene locus_tag LOCUS_27120 gene dsbA 2053 1424 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQT8 protein_id gnl|my_center|LOCUS_27120 <2588 2070 gene locus_tag LOCUS_27130 <2588 2070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EJX4:stress response kinase A >Feature sequence495 131 409 gene locus_tag LOCUS_27140 131 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 1225 1593 gene locus_tag LOCUS_27150 1225 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112985.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence496 954 109 gene locus_tag LOCUS_27160 954 109 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887515.1 protein_id gnl|my_center|LOCUS_27160 1083 1655 gene locus_tag LOCUS_27170 1083 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence497 <1 515 gene locus_tag LOCUS_27180 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EZP1:polyamine aminopropyltransferase 1 1959 1411 gene locus_tag LOCUS_27190 1959 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence498 <1 909 gene locus_tag LOCUS_27200 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070657.1:secretin 1107 1589 gene locus_tag LOCUS_27210 gene aroK 1107 1589 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN29 protein_id gnl|my_center|LOCUS_27210 >Feature sequence499 469 1221 gene locus_tag LOCUS_27220 469 1221 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_27220 >Feature sequence500 261 983 gene locus_tag LOCUS_27230 gene algR 261 983 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_27230 1219 2472 gene locus_tag LOCUS_27240 1219 2472 CDS product serine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463748.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence501 1444 287 gene locus_tag LOCUS_27250 1444 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence502 497 853 gene locus_tag LOCUS_27260 497 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 1956 1366 gene locus_tag LOCUS_27270 1956 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_27270 >Feature sequence503 1385 1002 gene locus_tag LOCUS_27280 1385 1002 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529414.1 protein_id gnl|my_center|LOCUS_27280 1551 2432 gene locus_tag LOCUS_27290 1551 2432 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704355.1 protein_id gnl|my_center|LOCUS_27290 >Feature sequence504 406 218 gene locus_tag LOCUS_27300 406 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 620 345 gene locus_tag LOCUS_27310 620 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 1036 848 gene locus_tag LOCUS_27320 1036 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 1676 1332 gene locus_tag LOCUS_27330 1676 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 2417 1782 gene locus_tag LOCUS_27340 2417 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence505 112 1650 gene locus_tag LOCUS_27350 112 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 1760 2227 gene locus_tag LOCUS_27360 1760 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 >Feature sequence506 13 195 gene locus_tag LOCUS_27370 13 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 686 237 gene locus_tag LOCUS_27380 686 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263360.1 protein_id gnl|my_center|LOCUS_27380 1739 747 gene locus_tag LOCUS_27390 1739 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106359.1 protein_id gnl|my_center|LOCUS_27390 >Feature sequence507 1703 168 gene locus_tag LOCUS_27400 1703 168 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704414.1 protein_id gnl|my_center|LOCUS_27400 <2466 1767 gene locus_tag LOCUS_27410 <2466 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63Q73:thiazole synthase >Feature sequence508 609 79 gene locus_tag LOCUS_27420 609 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 2080 599 gene locus_tag LOCUS_27430 2080 599 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266221.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence509 2415 562 gene locus_tag LOCUS_27440 2415 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence510 990 340 gene locus_tag LOCUS_27450 gene engB 990 340 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8S6 protein_id gnl|my_center|LOCUS_27450 1098 1898 gene locus_tag LOCUS_27460 1098 1898 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence511 1729 515 gene locus_tag LOCUS_27470 gene fabB 1729 515 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420034.1 protein_id gnl|my_center|LOCUS_27470 >Feature sequence512 231 938 gene locus_tag LOCUS_27480 gene cysQ 231 938 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071807.1 protein_id gnl|my_center|LOCUS_27480 2340 1006 gene locus_tag LOCUS_27490 2340 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 >Feature sequence513 1521 79 gene locus_tag LOCUS_27500 gene hldE 1521 79 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05074 protein_id gnl|my_center|LOCUS_27500 2123 1512 gene locus_tag LOCUS_27510 gene gmhA 2123 1512 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67054 protein_id gnl|my_center|LOCUS_27510 >Feature sequence514 760 404 gene locus_tag LOCUS_27520 760 404 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947851.1 protein_id gnl|my_center|LOCUS_27520 865 1632 gene locus_tag LOCUS_27530 865 1632 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947852.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence515 <1 1572 gene locus_tag LOCUS_27540 <1 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083253.1:peptidoglycan-binding protein >Feature sequence516 1936 1208 gene locus_tag LOCUS_27550 gene srlR 1936 1208 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339356.1 protein_id gnl|my_center|LOCUS_27550 >Feature sequence517 >Feature sequence518 702 1625 gene locus_tag LOCUS_27560 702 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence519 1983 808 gene locus_tag LOCUS_27570 1983 808 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_27570 >Feature sequence520 165 497 gene locus_tag LOCUS_27580 gene tatB 165 497 CDS product sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TH0 protein_id gnl|my_center|LOCUS_27580 510 1247 gene locus_tag LOCUS_27590 gene tatC 510 1247 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEG1 protein_id gnl|my_center|LOCUS_27590 1253 1702 gene locus_tag LOCUS_27600 1253 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1702 2076 gene locus_tag LOCUS_27610 1702 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27610 >Feature sequence521 847 2187 gene locus_tag LOCUS_27620 847 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence522 2229 313 gene locus_tag LOCUS_27630 2229 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence523 <1 592 gene locus_tag LOCUS_27640 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000069098.1:NAD(P)H-dependent oxidoreductase 589 1041 gene locus_tag LOCUS_27650 589 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393609.1 protein_id gnl|my_center|LOCUS_27650 1046 1714 gene locus_tag LOCUS_27660 1046 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 >Feature sequence524 923 420 gene locus_tag LOCUS_27670 923 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263638.1 protein_id gnl|my_center|LOCUS_27670 1321 998 gene locus_tag LOCUS_27680 1321 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 1553 1353 gene locus_tag LOCUS_27690 1553 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 2311 1628 gene locus_tag LOCUS_27700 gene pspA 2311 1628 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence525 1822 194 gene locus_tag LOCUS_27710 1822 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence526 1138 11 gene locus_tag LOCUS_27720 1138 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114811.1 protein_id gnl|my_center|LOCUS_27720 1628 1837 gene locus_tag LOCUS_27730 1628 1837 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375625.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence527 <1 573 gene locus_tag LOCUS_27740 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001884109.1:glutathione-disulfide reductase >Feature sequence528 >Feature sequence529 613 365 gene locus_tag LOCUS_27750 613 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27750 713 1831 gene locus_tag LOCUS_27760 gene cca 713 1831 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45269 protein_id gnl|my_center|LOCUS_27760 >Feature sequence530 >Feature sequence531 158 1507 gene locus_tag LOCUS_27770 gene norM 158 1507 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES3 protein_id gnl|my_center|LOCUS_27770 1485 2231 gene locus_tag LOCUS_27780 1485 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence532 198 1292 gene locus_tag LOCUS_27790 198 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27790 1630 1289 gene locus_tag LOCUS_27800 1630 1289 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804825.1 protein_id gnl|my_center|LOCUS_27800 <2318 1763 gene locus_tag LOCUS_27810 <2318 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072287.1:heat-shock protein IbpA >Feature sequence533 127 474 gene locus_tag LOCUS_27820 127 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104024.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence534 724 449 gene locus_tag LOCUS_27830 724 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 1272 853 gene locus_tag LOCUS_27840 1272 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035594.1 protein_id gnl|my_center|LOCUS_27840 <2313 1439 gene locus_tag LOCUS_27850 <2313 1439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704874.1:phosphodiesterase >Feature sequence535 >Feature sequence536 463 1092 gene locus_tag LOCUS_27860 gene udk 463 1092 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z9 protein_id gnl|my_center|LOCUS_27860 1110 2129 gene locus_tag LOCUS_27870 1110 2129 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK7 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27870 >Feature sequence537 >Feature sequence538 1347 841 gene locus_tag LOCUS_27880 1347 841 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315385.1 protein_id gnl|my_center|LOCUS_27880 >Feature sequence539 36 368 gene locus_tag LOCUS_27890 36 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 371 640 gene locus_tag LOCUS_27900 371 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 637 2199 gene locus_tag LOCUS_27910 637 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035397.1 protein_id gnl|my_center|LOCUS_27910 >Feature sequence540 <1 849 gene locus_tag LOCUS_27920 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87KH5:ATP-dependent RNA helicase RhlB >Feature sequence541 2001 82 gene locus_tag LOCUS_27930 2001 82 CDS product energy taxis-modulating methyl-accepting chemotaxis protein with Cache_1 sensory domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074086.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence542 >Feature sequence543 2004 682 gene locus_tag LOCUS_27940 2004 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence544 <2245 429 gene locus_tag LOCUS_27950 <2245 429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057589.1:peptidase M61 >Feature sequence545 <1 621 gene locus_tag LOCUS_27960 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706404.1:NADH dehydrogenase 1198 674 gene locus_tag LOCUS_27970 1198 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 1483 1226 gene locus_tag LOCUS_27980 1483 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 >Feature sequence546 <1 934 gene locus_tag LOCUS_27990 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXZ5:enolase 1083 2210 gene locus_tag LOCUS_28000 1083 2210 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481721.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence547 <1 1147 gene locus_tag LOCUS_28010 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074060.1:tryptophan 2,3-dioxygenase KynA >Feature sequence548 1553 273 gene locus_tag LOCUS_28020 1553 273 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence549 1 423 gene locus_tag LOCUS_28030 1 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1383 634 gene locus_tag LOCUS_28040 1383 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 2022 1465 gene locus_tag LOCUS_28050 2022 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence550 254 1384 gene locus_tag LOCUS_28060 254 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28060 >Feature sequence551 488 354 gene locus_tag LOCUS_28070 488 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 551 1498 gene locus_tag LOCUS_28080 551 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence552 1953 817 gene locus_tag LOCUS_28090 1953 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073502.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence553 <1 1684 gene locus_tag LOCUS_28100 <1 1684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87R23:transcription-repair-coupling factor >Feature sequence554 1374 493 gene locus_tag LOCUS_28110 1374 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 1533 1934 gene locus_tag LOCUS_28120 1533 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28120 >Feature sequence555 1237 1950 gene locus_tag LOCUS_28130 1237 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence556 1974 1003 gene locus_tag LOCUS_28140 1974 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966221.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence557 955 11 gene locus_tag LOCUS_28150 gene fmt 955 11 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KD4 protein_id gnl|my_center|LOCUS_28150 1497 988 gene locus_tag LOCUS_28160 gene def1 1497 988 CDS product peptide deformylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVU3 protein_id gnl|my_center|LOCUS_28160 >Feature sequence558 767 447 gene locus_tag LOCUS_28170 767 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 1208 777 gene locus_tag LOCUS_28180 1208 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence559 490 17 gene locus_tag LOCUS_28190 gene smg 490 17 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKQ5 protein_id gnl|my_center|LOCUS_28190 1593 493 gene locus_tag LOCUS_28200 gene dprA 1593 493 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262883.1 protein_id gnl|my_center|LOCUS_28200 <2178 1660 gene locus_tag LOCUS_28210 <2178 1660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704267.1:peptidoglycan-binding protein >Feature sequence560 627 929 gene locus_tag LOCUS_28220 627 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 1462 1629 gene locus_tag LOCUS_28230 1462 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 >Feature sequence561 1066 1185 gene locus_tag LOCUS_28240 1066 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 >Feature sequence562 139 1521 gene locus_tag LOCUS_28250 139 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 1805 2101 gene locus_tag LOCUS_28260 1805 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence563 <1 1280 gene locus_tag LOCUS_28270 <1 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403159.1:carboxypeptidase 1393 1932 gene locus_tag LOCUS_28280 1393 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 >Feature sequence564 >Feature sequence565 1553 828 gene locus_tag LOCUS_28290 gene cmoA 1553 828 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSU2 protein_id gnl|my_center|LOCUS_28290 >Feature sequence566 <1 809 gene locus_tag LOCUS_28300 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263241.1:transcriptional regulator >Feature sequence567 432 1205 gene locus_tag LOCUS_28310 gene uppS 432 1205 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ME1 protein_id gnl|my_center|LOCUS_28310 1217 2083 gene locus_tag LOCUS_28320 gene cdsA 1217 2083 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH0 protein_id gnl|my_center|LOCUS_28320 >Feature sequence568 653 1789 gene locus_tag LOCUS_28330 653 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262049.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence569 >Feature sequence570 275 709 gene locus_tag LOCUS_28340 gene zur 275 709 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 protein_id gnl|my_center|LOCUS_28340 836 1246 gene locus_tag LOCUS_28350 gene cheX 836 1246 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073661.1 protein_id gnl|my_center|LOCUS_28350 1243 1671 gene locus_tag LOCUS_28360 1243 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_28360 >Feature sequence571 1825 197 gene locus_tag LOCUS_28370 1825 197 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112293.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence572 >Feature sequence573 791 195 gene locus_tag LOCUS_28380 gene cysC 791 195 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E828 protein_id gnl|my_center|LOCUS_28380 <2126 804 gene locus_tag LOCUS_28390 <2126 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261126.1:SLC13 family permease >Feature sequence574 698 144 gene locus_tag LOCUS_28400 698 144 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882560.1 protein_id gnl|my_center|LOCUS_28400 792 2078 gene locus_tag LOCUS_28410 792 2078 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177846.1 protein_id gnl|my_center|LOCUS_28410 >Feature sequence575 236 1603 gene locus_tag LOCUS_28420 236 1603 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173612.1 protein_id gnl|my_center|LOCUS_28420 >Feature sequence576 421 1533 gene locus_tag LOCUS_28430 421 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence577 574 1647 gene locus_tag LOCUS_28440 574 1647 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT68 protein_id gnl|my_center|LOCUS_28440 >Feature sequence578 >Feature sequence579 957 19 gene locus_tag LOCUS_28450 957 19 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072204.1 protein_id gnl|my_center|LOCUS_28450 1859 957 gene locus_tag LOCUS_28460 1859 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_28460 >Feature sequence580 89 541 gene locus_tag LOCUS_28470 gene rplI 89 541 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q328J6 protein_id gnl|my_center|LOCUS_28470 817 1236 gene locus_tag LOCUS_28480 817 1236 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071144.1 protein_id gnl|my_center|LOCUS_28480 1208 1684 gene locus_tag LOCUS_28490 1208 1684 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071143.1 protein_id gnl|my_center|LOCUS_28490 >Feature sequence581 <1 1284 gene locus_tag LOCUS_28500 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918466.1:TonB-dependent receptor <2059 1357 gene locus_tag LOCUS_28510 <2059 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390393.1:glycerophosphoryl diester phosphodiesterase >Feature sequence582 336 761 gene locus_tag LOCUS_28520 336 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 1202 729 gene locus_tag LOCUS_28530 1202 729 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_28530 >Feature sequence583 337 1107 gene locus_tag LOCUS_28540 gene murI 337 1107 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E218 protein_id gnl|my_center|LOCUS_28540 1577 1104 gene locus_tag LOCUS_28550 1577 1104 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704113.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence584 <2043 151 gene locus_tag LOCUS_28560 <2043 151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704874.1:phosphodiesterase note possible pseudo, internal stop codon >Feature sequence585 1412 276 gene locus_tag LOCUS_28570 1412 276 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263749.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence586 1307 72 gene locus_tag LOCUS_28580 1307 72 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483538.1 protein_id gnl|my_center|LOCUS_28580 1949 1317 gene locus_tag LOCUS_28590 1949 1317 CDS product agglutination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263596.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence587 1386 487 gene locus_tag LOCUS_28600 1386 487 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269387.1 protein_id gnl|my_center|LOCUS_28600 >Feature sequence588 301 612 gene locus_tag LOCUS_28610 301 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 protein_id gnl|my_center|LOCUS_28610 1442 540 gene locus_tag LOCUS_28620 1442 540 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_28620 1947 1411 gene locus_tag LOCUS_28630 1947 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence589 170 559 gene locus_tag LOCUS_28640 170 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073858.1 protein_id gnl|my_center|LOCUS_28640 <2011 593 gene locus_tag LOCUS_28650 <2011 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707784.1:methyl-accepting chemotaxis protein >Feature sequence590 408 2000 gene locus_tag LOCUS_28660 408 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 >Feature sequence591 788 312 gene locus_tag LOCUS_28670 788 312 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477269.1 protein_id gnl|my_center|LOCUS_28670 985 1383 gene locus_tag LOCUS_28680 985 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 <2002 1436 gene locus_tag LOCUS_28690 <2002 1436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000728517.1:thiazole biosynthesis protein ThiJ >Feature sequence592 307 1359 gene locus_tag LOCUS_28700 gene purM 307 1359 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3H3 protein_id gnl|my_center|LOCUS_28700 >Feature sequence593 679 1317 gene locus_tag LOCUS_28710 679 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence594 <1 1288 gene locus_tag LOCUS_28720 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462399.1:acyl-CoA dehydrogenase >Feature sequence595 295 1056 gene locus_tag LOCUS_28730 295 1056 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence596 941 1459 gene locus_tag LOCUS_28740 941 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 >Feature sequence597 486 19 gene locus_tag LOCUS_28750 486 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 967 488 gene locus_tag LOCUS_28760 967 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 1959 961 gene locus_tag LOCUS_28770 gene pilW 1959 961 CDS product type IV minor pilin protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073360.1 protein_id gnl|my_center|LOCUS_28770 >Feature sequence598 1757 1832 gene locus_tag LOCUS_t00340 1757 1832 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1846 1921 gene locus_tag LOCUS_t00350 1846 1921 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence599 1562 1380 gene locus_tag LOCUS_28780 1562 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 >Feature sequence600 <1 1094 gene locus_tag LOCUS_28790 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110400.1:thiazole biosynthesis protein ThiJ 1875 1594 gene locus_tag LOCUS_28800 1875 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence601 828 1334 gene locus_tag LOCUS_28810 828 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940845.1 protein_id gnl|my_center|LOCUS_28810 >Feature sequence602 >Feature sequence603 861 478 gene locus_tag LOCUS_28820 gene cheB 861 478 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359271.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence604 319 1671 gene locus_tag LOCUS_28830 319 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_28830 >Feature sequence605 <1 501 gene locus_tag LOCUS_28840 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44881:Xaa-Pro aminopeptidase 511 1692 gene locus_tag LOCUS_28850 511 1692 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132411.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence606 481 1185 gene locus_tag LOCUS_28860 gene coaX 481 1185 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC1 protein_id gnl|my_center|LOCUS_28860 1307 1382 gene locus_tag LOCUS_t00360 1307 1382 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1431 1515 gene locus_tag LOCUS_t00370 1431 1515 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1562 1636 gene locus_tag LOCUS_t00380 1562 1636 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1649 1724 gene locus_tag LOCUS_t00390 1649 1724 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence607 >Feature sequence608 1172 720 gene locus_tag LOCUS_28870 gene fabZ 1172 720 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ME8 protein_id gnl|my_center|LOCUS_28870 <1902 1183 gene locus_tag LOCUS_28880 <1902 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KPW2:UDP-3-O-acylglucosamine N-acyltransferase >Feature sequence609 1223 240 gene locus_tag LOCUS_28890 gene pip 1223 240 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q890D8 protein_id gnl|my_center|LOCUS_28890 1419 1829 gene locus_tag LOCUS_28900 1419 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence610 >Feature sequence611 >Feature sequence612 <1889 626 gene locus_tag LOCUS_28910 <1889 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919915.1:1,4-beta-D-glucan glucohydrolase >Feature sequence613 <1888 224 gene locus_tag LOCUS_28920 <1888 224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P43820:phenylalanine--tRNA ligase beta subunit >Feature sequence614 <1 987 gene locus_tag LOCUS_28930 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098545.1:pitrilysin 1180 1587 gene locus_tag LOCUS_28940 gene exbD 1180 1587 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence615 1875 1345 gene locus_tag LOCUS_28950 1875 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence616 >Feature sequence617 704 1219 gene locus_tag LOCUS_28960 704 1219 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213751.1 protein_id gnl|my_center|LOCUS_28960 1688 1446 gene locus_tag LOCUS_28970 1688 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 >Feature sequence618 1140 781 gene locus_tag LOCUS_28980 1140 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 >Feature sequence619 <1 1447 gene locus_tag LOCUS_28990 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071157.1:collagenolytic serine protease >Feature sequence620 479 1054 gene locus_tag LOCUS_29000 479 1054 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096492.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence621 716 1684 gene locus_tag LOCUS_29010 716 1684 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263238.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence622 479 144 gene locus_tag LOCUS_29020 479 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 1342 980 gene locus_tag LOCUS_29030 1342 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 1463 1311 gene locus_tag LOCUS_29040 1463 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence623 <1 1278 gene locus_tag LOCUS_29050 <1 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87RP8:apolipoprotein N-acyltransferase >Feature sequence624 690 1229 gene locus_tag LOCUS_29060 690 1229 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262060.1 protein_id gnl|my_center|LOCUS_29060 >Feature sequence625 <1 1064 gene locus_tag LOCUS_29070 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074352.1:DNA polymerase V subunit UmuC <1820 1212 gene locus_tag LOCUS_29080 <1820 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057556.1:delta-9 desaturase >Feature sequence626 54 569 gene locus_tag LOCUS_29090 54 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 725 1438 gene locus_tag LOCUS_29100 725 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 >Feature sequence627 538 1263 gene locus_tag LOCUS_29110 538 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510899.1 protein_id gnl|my_center|LOCUS_29110 >Feature sequence628 929 330 gene locus_tag LOCUS_29120 929 330 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929712.1 protein_id gnl|my_center|LOCUS_29120 <1814 1008 gene locus_tag LOCUS_29130 <1814 1008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706804.1:sodium:phosphate symporter >Feature sequence629 291 1391 gene locus_tag LOCUS_29140 291 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 1452 1736 gene locus_tag LOCUS_29150 1452 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29150 >Feature sequence630 501 163 gene locus_tag LOCUS_29160 501 163 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460237.1 protein_id gnl|my_center|LOCUS_29160 <1805 504 gene locus_tag LOCUS_29170 <1805 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87S24:chaperone protein HscA >Feature sequence631 101 1063 gene locus_tag LOCUS_29180 101 1063 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706924.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence632 90 923 gene locus_tag LOCUS_29190 90 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072656.1 protein_id gnl|my_center|LOCUS_29190 1792 1010 gene locus_tag LOCUS_29200 1792 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence633 367 50 gene locus_tag LOCUS_29210 367 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 730 1491 gene locus_tag LOCUS_29220 gene dusA 730 1491 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L85 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29220 >Feature sequence634 >Feature sequence635 241 651 gene locus_tag LOCUS_29230 241 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 <1789 921 gene locus_tag LOCUS_29240 <1789 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037121.1:sensor histidine kinase >Feature sequence636 1572 1357 gene locus_tag LOCUS_29250 1572 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence637 1667 225 gene locus_tag LOCUS_29260 gene nhaD 1667 225 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence638 >Feature sequence639 944 1687 gene locus_tag LOCUS_29270 944 1687 CDS product sporulation-control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462606.1 protein_id gnl|my_center|LOCUS_29270 >Feature sequence640 337 131 gene locus_tag LOCUS_29280 337 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 750 493 gene locus_tag LOCUS_29290 750 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1250 897 gene locus_tag LOCUS_29300 1250 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 >Feature sequence641 >Feature sequence642 >Feature sequence643 1750 1379 gene locus_tag LOCUS_29310 1750 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence644 317 1054 gene locus_tag LOCUS_29320 317 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920698.1 protein_id gnl|my_center|LOCUS_29320 <1750 1072 gene locus_tag LOCUS_29330 <1750 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869424.1:aldo/keto reductase >Feature sequence645 740 1117 gene locus_tag LOCUS_29340 gene sdhC 740 1117 CDS product succinate dehydrogenase cytochrome b556 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705795.1 protein_id gnl|my_center|LOCUS_29340 1108 1455 gene locus_tag LOCUS_29350 gene sdhD 1108 1455 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSF7 protein_id gnl|my_center|LOCUS_29350 >Feature sequence646 69 1529 gene locus_tag LOCUS_29360 69 1529 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070484.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence647 1360 338 gene locus_tag LOCUS_29370 1360 338 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_29370 >Feature sequence648 >Feature sequence649 1666 1217 gene locus_tag LOCUS_29380 gene yjaB 1666 1217 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263862.1 protein_id gnl|my_center|LOCUS_29380 >Feature sequence650 >Feature sequence651 1143 607 gene locus_tag LOCUS_29390 1143 607 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIC6 protein_id gnl|my_center|LOCUS_29390 >Feature sequence652 1163 561 gene locus_tag LOCUS_29400 1163 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence653 <1 1035 gene locus_tag LOCUS_29410 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000074540.1:aminotransferase <1662 1086 gene locus_tag LOCUS_29420 <1662 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073351.1:LacI family transcriptional regulator >Feature sequence654 1271 915 gene locus_tag LOCUS_29430 gene raiA 1271 915 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073262.1 protein_id gnl|my_center|LOCUS_29430 1553 1478 gene locus_tag LOCUS_t00400 1553 1478 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence655 3 794 gene locus_tag LOCUS_29440 3 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 796 1266 gene locus_tag LOCUS_29450 796 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 1269 1460 gene locus_tag LOCUS_29460 1269 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 >Feature sequence656 358 963 gene locus_tag LOCUS_29470 358 963 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLT4 protein_id gnl|my_center|LOCUS_29470 >Feature sequence657 647 1525 gene locus_tag LOCUS_29480 647 1525 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816010.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence658 146 556 gene locus_tag LOCUS_29490 146 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 656 1570 gene locus_tag LOCUS_29500 656 1570 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490846.1 protein_id gnl|my_center|LOCUS_29500 >Feature sequence659 397 921 gene locus_tag LOCUS_29510 397 921 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LD5 protein_id gnl|my_center|LOCUS_29510 1103 1179 gene locus_tag LOCUS_t00410 1103 1179 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence660 1482 352 gene locus_tag LOCUS_29520 1482 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence661 <1 1049 gene locus_tag LOCUS_29530 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005457822.1:iron-regulated protein A >Feature sequence662 >Feature sequence663 <1 519 gene locus_tag LOCUS_29540 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072981.1:diguanylate cyclase 938 1324 gene locus_tag LOCUS_29550 938 1324 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537728.1 protein_id gnl|my_center|LOCUS_29550 1463 1326 gene locus_tag LOCUS_29560 1463 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence664 361 233 gene locus_tag LOCUS_29570 361 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence665 292 80 gene locus_tag LOCUS_29580 292 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 648 289 gene locus_tag LOCUS_29590 648 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence666 610 152 gene locus_tag LOCUS_29600 610 152 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105974.1 protein_id gnl|my_center|LOCUS_29600 968 699 gene locus_tag LOCUS_29610 968 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 1579 1175 gene locus_tag LOCUS_29620 1579 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 >Feature sequence667 <1 848 gene locus_tag LOCUS_29630 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KP37:UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase 890 1513 gene locus_tag LOCUS_29640 gene ubiX 890 1513 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SV7 protein_id gnl|my_center|LOCUS_29640 >Feature sequence668 <1 1262 gene locus_tag LOCUS_29650 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000513150.1:acyl-CoA synthetase >Feature sequence669 <1 894 gene locus_tag LOCUS_29660 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036635.1:sensor histidine kinase note possible pseudo, internal stop codon 925 1131 gene locus_tag LOCUS_29670 925 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence670 1136 594 gene locus_tag LOCUS_29680 1136 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 1359 1147 gene locus_tag LOCUS_29690 1359 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence671 >Feature sequence672 >Feature sequence673 1033 410 gene locus_tag LOCUS_29700 1033 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29700 1348 1124 gene locus_tag LOCUS_29710 1348 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence674 479 204 gene locus_tag LOCUS_29720 479 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 <1511 703 gene locus_tag LOCUS_29730 <1511 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895466.1:proton/glutamate symporter >Feature sequence675 864 283 gene locus_tag LOCUS_29740 864 283 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_29740 1045 848 gene locus_tag LOCUS_29750 1045 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence676 >Feature sequence677 <1 1074 gene locus_tag LOCUS_29760 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070462.1:carboxyl-terminal processing protease