>Feature sequence001 <1 2493 gene locus_tag LOCUS_00010 <1 2493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001256602.1:hybrid sensor histidine kinase/response regulator 2532 3155 gene locus_tag LOCUS_00020 2532 3155 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87GU2 protein_id gnl|my_center|LOCUS_00020 3266 4102 gene locus_tag LOCUS_00030 gene nadE 3266 4102 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF2 protein_id gnl|my_center|LOCUS_00030 4995 4099 gene locus_tag LOCUS_00040 4995 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5214 5933 gene locus_tag LOCUS_00050 5214 5933 CDS product dihydromonapterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366824.1 protein_id gnl|my_center|LOCUS_00050 5953 6507 gene locus_tag LOCUS_00060 gene folE2 5953 6507 CDS product GTP cyclohydrolase 1 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884Q3 protein_id gnl|my_center|LOCUS_00060 6512 6871 gene locus_tag LOCUS_00070 6512 6871 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098127.1 protein_id gnl|my_center|LOCUS_00070 7302 6868 gene locus_tag LOCUS_00080 7302 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114414.1 protein_id gnl|my_center|LOCUS_00080 7740 7369 gene locus_tag LOCUS_00090 7740 7369 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102982.1 protein_id gnl|my_center|LOCUS_00090 10106 7926 gene locus_tag LOCUS_00100 10106 7926 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459357.1 protein_id gnl|my_center|LOCUS_00100 14672 10275 gene locus_tag LOCUS_00110 14672 10275 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073572.1 protein_id gnl|my_center|LOCUS_00110 14557 14865 gene locus_tag LOCUS_00120 14557 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 18932 14877 gene locus_tag LOCUS_00130 18932 14877 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073572.1 protein_id gnl|my_center|LOCUS_00130 19181 19651 gene locus_tag LOCUS_00140 19181 19651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_00140 19777 20229 gene locus_tag LOCUS_00150 19777 20229 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073278.1 protein_id gnl|my_center|LOCUS_00150 20954 20298 gene locus_tag LOCUS_00160 20954 20298 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263283.1 protein_id gnl|my_center|LOCUS_00160 21078 21782 gene locus_tag LOCUS_00170 21078 21782 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461994.1 protein_id gnl|my_center|LOCUS_00170 21782 22081 gene locus_tag LOCUS_00180 21782 22081 CDS product branched-chain amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605630.1 protein_id gnl|my_center|LOCUS_00180 23263 22109 gene locus_tag LOCUS_00190 23263 22109 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817209.1 protein_id gnl|my_center|LOCUS_00190 23437 24309 gene locus_tag LOCUS_00200 23437 24309 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113868.1 protein_id gnl|my_center|LOCUS_00200 24405 24896 gene locus_tag LOCUS_00210 gene bsaA 24405 24896 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFT3 protein_id gnl|my_center|LOCUS_00210 25134 24946 gene locus_tag LOCUS_00220 25134 24946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25541 26338 gene locus_tag LOCUS_00230 25541 26338 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479062.1 protein_id gnl|my_center|LOCUS_00230 27864 26422 gene locus_tag LOCUS_00240 27864 26422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113004.1 protein_id gnl|my_center|LOCUS_00240 27981 28916 gene locus_tag LOCUS_00250 27981 28916 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266785.1 protein_id gnl|my_center|LOCUS_00250 29848 28994 gene locus_tag LOCUS_00260 29848 28994 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_00260 30172 30312 gene locus_tag LOCUS_00270 30172 30312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30524 30614 gene locus_tag LOCUS_t00010 30524 30614 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30666 30758 gene locus_tag LOCUS_t00020 30666 30758 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 31212 31688 gene locus_tag LOCUS_00280 31212 31688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32717 31929 gene locus_tag LOCUS_00290 32717 31929 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_00290 33847 32705 gene locus_tag LOCUS_00300 gene ybdL 33847 32705 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77806 protein_id gnl|my_center|LOCUS_00300 33938 34555 gene locus_tag LOCUS_00310 gene mtnB 33938 34555 CDS product methylthioribulose-1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLZ8 protein_id gnl|my_center|LOCUS_00310 34552 35238 gene locus_tag LOCUS_00320 gene mtnC 34552 35238 CDS product enolase-phosphatase E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVB8 protein_id gnl|my_center|LOCUS_00320 35235 35777 gene locus_tag LOCUS_00330 gene mtnD 35235 35777 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN79 protein_id gnl|my_center|LOCUS_00330 35802 36140 gene locus_tag LOCUS_00340 35802 36140 CDS product UDP-N-acetylmuramate--alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947223.1 protein_id gnl|my_center|LOCUS_00340 37162 36137 gene locus_tag LOCUS_00350 gene mtnA 37162 36137 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPY1 protein_id gnl|my_center|LOCUS_00350 37295 38512 gene locus_tag LOCUS_00360 gene mtnK 37295 38512 CDS product methylthioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP08 protein_id gnl|my_center|LOCUS_00360 40083 38602 gene locus_tag LOCUS_00370 gene glsF 40083 38602 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_00370 41911 40214 gene locus_tag LOCUS_00380 41911 40214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_00380 42346 43332 gene locus_tag LOCUS_00390 42346 43332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 43441 44196 gene locus_tag LOCUS_00400 gene ubiE 43441 44196 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMB8 protein_id gnl|my_center|LOCUS_00400 44237 44842 gene locus_tag LOCUS_00410 44237 44842 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054253.1 protein_id gnl|my_center|LOCUS_00410 44860 46464 gene locus_tag LOCUS_00420 gene ubiB 44860 46464 CDS product putative protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CS79 protein_id gnl|my_center|LOCUS_00420 46545 46784 gene locus_tag LOCUS_00430 gene tatA 46545 46784 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8V2 protein_id gnl|my_center|LOCUS_00430 46790 47122 gene locus_tag LOCUS_00440 46790 47122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 47170 47913 gene locus_tag LOCUS_00450 gene tatC 47170 47913 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8V0 protein_id gnl|my_center|LOCUS_00450 47914 48432 gene locus_tag LOCUS_00460 47914 48432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073888.1 protein_id gnl|my_center|LOCUS_00460 48432 49214 gene locus_tag LOCUS_00470 gene tatD 48432 49214 CDS product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUR3 protein_id gnl|my_center|LOCUS_00470 49217 51067 gene locus_tag LOCUS_00480 49217 51067 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073890.1 protein_id gnl|my_center|LOCUS_00480 51077 52084 gene locus_tag LOCUS_00490 gene hemB 51077 52084 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q8 protein_id gnl|my_center|LOCUS_00490 52227 54965 gene locus_tag LOCUS_00500 gene eddB 52227 54965 CDS product extracelullar DNA degradation protein EddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114304.1 protein_id gnl|my_center|LOCUS_00500 55473 55045 gene locus_tag LOCUS_00510 55473 55045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 57956 55872 gene locus_tag LOCUS_00520 gene fusA2 57956 55872 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7H2 protein_id gnl|my_center|LOCUS_00520 59285 58122 gene locus_tag LOCUS_00530 gene nagA3 59285 58122 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DYS7 protein_id gnl|my_center|LOCUS_00530 60211 59282 gene locus_tag LOCUS_00540 gene nagK 60211 59282 CDS product N-acetyl-D-glucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EIC0 protein_id gnl|my_center|LOCUS_00540 61340 60204 gene locus_tag LOCUS_00550 gene agaS 61340 60204 CDS product tagatose-6-phosphate ketose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263815.1 protein_id gnl|my_center|LOCUS_00550 62641 61358 gene locus_tag LOCUS_00560 gene kbaZ 62641 61358 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263816.1 protein_id gnl|my_center|LOCUS_00560 63454 62684 gene locus_tag LOCUS_00570 63454 62684 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098886.1 protein_id gnl|my_center|LOCUS_00570 63718 65091 gene locus_tag LOCUS_00580 gene nagA 63718 65091 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_00580 65188 68025 gene locus_tag LOCUS_00590 gene iroN 65188 68025 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035377.1 protein_id gnl|my_center|LOCUS_00590 68131 69423 gene locus_tag LOCUS_00600 68131 69423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121875.1 protein_id gnl|my_center|LOCUS_00600 70142 69420 gene locus_tag LOCUS_00610 70142 69420 CDS product transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRN2 protein_id gnl|my_center|LOCUS_00610 71858 70236 gene locus_tag LOCUS_00620 gene dpiB 71858 70236 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706287.1 protein_id gnl|my_center|LOCUS_00620 73412 71871 gene locus_tag LOCUS_00630 73412 71871 CDS product tripartite tricarboxylate transporter TctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464542.1 protein_id gnl|my_center|LOCUS_00630 73883 73416 gene locus_tag LOCUS_00640 73883 73416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881091.1 protein_id gnl|my_center|LOCUS_00640 74878 73895 gene locus_tag LOCUS_00650 74878 73895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911050.1 protein_id gnl|my_center|LOCUS_00650 76132 74891 gene locus_tag LOCUS_00660 76132 74891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 78058 76412 gene locus_tag LOCUS_00670 78058 76412 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262183.1 protein_id gnl|my_center|LOCUS_00670 78362 79639 gene locus_tag LOCUS_00680 78362 79639 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141272.1 protein_id gnl|my_center|LOCUS_00680 79636 80391 gene locus_tag LOCUS_00690 79636 80391 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_00690 80393 82846 gene locus_tag LOCUS_00700 80393 82846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141201.1 protein_id gnl|my_center|LOCUS_00700 82913 84298 gene locus_tag LOCUS_00710 82913 84298 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786303.1 protein_id gnl|my_center|LOCUS_00710 84299 85582 gene locus_tag LOCUS_00720 84299 85582 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107493.1 protein_id gnl|my_center|LOCUS_00720 85671 88619 gene locus_tag LOCUS_00730 85671 88619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 89992 89039 gene locus_tag LOCUS_00740 89992 89039 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E065 protein_id gnl|my_center|LOCUS_00740 90029 90148 gene locus_tag LOCUS_00750 90029 90148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 91089 90151 gene locus_tag LOCUS_00760 91089 90151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 91793 91086 gene locus_tag LOCUS_00770 91793 91086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 92162 92500 gene locus_tag LOCUS_00780 92162 92500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 >Feature sequence002 339 506 gene locus_tag LOCUS_00790 339 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 621 1490 gene locus_tag LOCUS_00800 621 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 2119 1541 gene locus_tag LOCUS_00810 2119 1541 CDS product UPF0312 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I690 protein_id gnl|my_center|LOCUS_00810 2677 2123 gene locus_tag LOCUS_00820 gene yceJ 2677 2123 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 protein_id gnl|my_center|LOCUS_00820 3720 2887 gene locus_tag LOCUS_00830 3720 2887 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L9 protein_id gnl|my_center|LOCUS_00830 4356 3736 gene locus_tag LOCUS_00840 4356 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210628.1 protein_id gnl|my_center|LOCUS_00840 5206 4349 gene locus_tag LOCUS_00850 5206 4349 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217214.1 protein_id gnl|my_center|LOCUS_00850 5630 7198 gene locus_tag LOCUS_00860 gene trpE 5630 7198 CDS product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KST2 protein_id gnl|my_center|LOCUS_00860 7200 7817 gene locus_tag LOCUS_00870 7200 7817 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706724.1 protein_id gnl|my_center|LOCUS_00870 7826 8899 gene locus_tag LOCUS_00880 gene trpD 7826 8899 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KST4 protein_id gnl|my_center|LOCUS_00880 8892 10256 gene locus_tag LOCUS_00890 gene trpC 8892 10256 CDS product tryptophan biosynthesis protein TrpCF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P22098 protein_id gnl|my_center|LOCUS_00890 10264 11448 gene locus_tag LOCUS_00900 gene trpB 10264 11448 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECV0 protein_id gnl|my_center|LOCUS_00900 11445 12275 gene locus_tag LOCUS_00910 gene trpA 11445 12275 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EI82 protein_id gnl|my_center|LOCUS_00910 12605 12336 gene locus_tag LOCUS_00920 gene hupA 12605 12336 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044511.1 protein_id gnl|my_center|LOCUS_00920 12780 13373 gene locus_tag LOCUS_00930 12780 13373 CDS product putative intracellular septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNW8 protein_id gnl|my_center|LOCUS_00930 13569 14075 gene locus_tag LOCUS_00940 13569 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 15566 14142 gene locus_tag LOCUS_00950 15566 14142 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4E6 protein_id gnl|my_center|LOCUS_00950 15883 16185 gene locus_tag LOCUS_00960 15883 16185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481648.1 protein_id gnl|my_center|LOCUS_00960 16404 16667 gene locus_tag LOCUS_00970 16404 16667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 16671 17345 gene locus_tag LOCUS_00980 16671 17345 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074241.1 protein_id gnl|my_center|LOCUS_00980 17339 18679 gene locus_tag LOCUS_00990 17339 18679 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074242.1 protein_id gnl|my_center|LOCUS_00990 18666 19076 gene locus_tag LOCUS_01000 18666 19076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 20129 19089 gene locus_tag LOCUS_01010 gene tqsA 20129 19089 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_01010 20262 21155 gene locus_tag LOCUS_01020 gene yfcH 20262 21155 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072827.1 protein_id gnl|my_center|LOCUS_01020 22226 21375 gene locus_tag LOCUS_01030 22226 21375 CDS product universal stress protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263859.1 protein_id gnl|my_center|LOCUS_01030 23724 22237 gene locus_tag LOCUS_01040 23724 22237 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263860.1 protein_id gnl|my_center|LOCUS_01040 24269 25105 gene locus_tag LOCUS_01050 24269 25105 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215772.1 protein_id gnl|my_center|LOCUS_01050 27026 25149 gene locus_tag LOCUS_01060 27026 25149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 28127 27036 gene locus_tag LOCUS_01070 28127 27036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 31250 28185 gene locus_tag LOCUS_01080 31250 28185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 32859 31684 gene locus_tag LOCUS_01090 32859 31684 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207520.1 protein_id gnl|my_center|LOCUS_01090 35477 32871 gene locus_tag LOCUS_01100 gene acnD 35477 32871 CDS product 2-methylcitrate dehydratase (2-methyl-trans-aconitate forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW3 protein_id gnl|my_center|LOCUS_01100 36748 35624 gene locus_tag LOCUS_01110 gene prpC 36748 35624 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJW2 protein_id gnl|my_center|LOCUS_01110 37652 36774 gene locus_tag LOCUS_01120 gene prpB 37652 36774 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSC2 protein_id gnl|my_center|LOCUS_01120 38428 37724 gene locus_tag LOCUS_01130 38428 37724 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085635.1 protein_id gnl|my_center|LOCUS_01130 38693 40129 gene locus_tag LOCUS_01140 gene rsmF 38693 40129 CDS product ribosomal RNA small subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87PA5 protein_id gnl|my_center|LOCUS_01140 40499 41323 gene locus_tag LOCUS_01150 40499 41323 CDS product chitooligosaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123674.1 protein_id gnl|my_center|LOCUS_01150 43173 41320 gene locus_tag LOCUS_01160 43173 41320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263581.1 protein_id gnl|my_center|LOCUS_01160 43960 43181 gene locus_tag LOCUS_01170 43960 43181 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482770.1 protein_id gnl|my_center|LOCUS_01170 44298 43972 gene locus_tag LOCUS_01180 gene pilZ 44298 43972 CDS product type 4 fimbrial biogenesis protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947130.1 protein_id gnl|my_center|LOCUS_01180 45202 44306 gene locus_tag LOCUS_01190 gene holB 45202 44306 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43748 protein_id gnl|my_center|LOCUS_01190 45833 45204 gene locus_tag LOCUS_01200 gene tmk 45833 45204 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQI2 protein_id gnl|my_center|LOCUS_01200 46889 45888 gene locus_tag LOCUS_01210 gene mltG 46889 45888 CDS product endolytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44720 protein_id gnl|my_center|LOCUS_01210 47725 46883 gene locus_tag LOCUS_01220 gene pabC 47725 46883 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262287.1 protein_id gnl|my_center|LOCUS_01220 49017 47779 gene locus_tag LOCUS_01230 gene fabF 49017 47779 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJ22 protein_id gnl|my_center|LOCUS_01230 49372 49136 gene locus_tag LOCUS_01240 gene acpP 49372 49136 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH5 protein_id gnl|my_center|LOCUS_01240 50359 49613 gene locus_tag LOCUS_01250 gene fabG 50359 49613 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 protein_id gnl|my_center|LOCUS_01250 51298 50372 gene locus_tag LOCUS_01260 51298 50372 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N21 protein_id gnl|my_center|LOCUS_01260 52401 51358 gene locus_tag LOCUS_01270 gene plsX 52401 51358 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDH0 protein_id gnl|my_center|LOCUS_01270 52584 52414 gene locus_tag LOCUS_01280 gene rpmF 52584 52414 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKH0 protein_id gnl|my_center|LOCUS_01280 53118 52594 gene locus_tag LOCUS_01290 53118 52594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210930.1 protein_id gnl|my_center|LOCUS_01290 53261 53854 gene locus_tag LOCUS_01300 53261 53854 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDG7 protein_id gnl|my_center|LOCUS_01300 54517 53873 gene locus_tag LOCUS_01310 54517 53873 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706097.1 protein_id gnl|my_center|LOCUS_01310 55473 54514 gene locus_tag LOCUS_01320 gene rluC 55473 54514 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU25 protein_id gnl|my_center|LOCUS_01320 56099 59566 gene locus_tag LOCUS_01330 56099 59566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 60241 59783 gene locus_tag LOCUS_01340 60241 59783 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975939.1 protein_id gnl|my_center|LOCUS_01340 60449 60222 gene locus_tag LOCUS_01350 60449 60222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 60949 60458 gene locus_tag LOCUS_01360 60949 60458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 61363 61163 gene locus_tag LOCUS_01370 61363 61163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 62321 61560 gene locus_tag LOCUS_01380 62321 61560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 62590 62405 gene locus_tag LOCUS_01390 62590 62405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 63670 62657 gene locus_tag LOCUS_01400 gene yejK 63670 62657 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4A3 protein_id gnl|my_center|LOCUS_01400 63733 63945 gene locus_tag LOCUS_01410 63733 63945 CDS product UPF0352 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF26 protein_id gnl|my_center|LOCUS_01410 63951 65447 gene locus_tag LOCUS_01420 63951 65447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 65524 66000 gene locus_tag LOCUS_01430 65524 66000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 66083 67801 gene locus_tag LOCUS_01440 gene aceK 66083 67801 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Y16 protein_id gnl|my_center|LOCUS_01440 67817 68755 gene locus_tag LOCUS_01450 gene nahR 67817 68755 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_01450 68923 69366 gene locus_tag LOCUS_01460 68923 69366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 69582 69977 gene locus_tag LOCUS_01470 gene exbD 69582 69977 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 protein_id gnl|my_center|LOCUS_01470 73034 70035 gene locus_tag LOCUS_01480 gene bfeA 73034 70035 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038158.1 protein_id gnl|my_center|LOCUS_01480 74152 73076 gene locus_tag LOCUS_01490 74152 73076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 74706 74149 gene locus_tag LOCUS_01500 74706 74149 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_01500 75091 76287 gene locus_tag LOCUS_01510 75091 76287 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706757.1 protein_id gnl|my_center|LOCUS_01510 76302 79475 gene locus_tag LOCUS_01520 76302 79475 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_01520 79599 80231 gene locus_tag LOCUS_01530 79599 80231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705874.1 protein_id gnl|my_center|LOCUS_01530 80319 81374 gene locus_tag LOCUS_01540 gene aguA 80319 81374 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941691.1 protein_id gnl|my_center|LOCUS_01540 81371 82264 gene locus_tag LOCUS_01550 gene aguB 81371 82264 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_01550 82309 85782 gene locus_tag LOCUS_01560 gene mfd 82309 85782 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJT3 protein_id gnl|my_center|LOCUS_01560 85782 86618 gene locus_tag LOCUS_01570 85782 86618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072266.1 protein_id gnl|my_center|LOCUS_01570 86637 86888 gene locus_tag LOCUS_01580 86637 86888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095983.1 protein_id gnl|my_center|LOCUS_01580 87425 86934 gene locus_tag LOCUS_01590 87425 86934 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_01590 88908 87553 gene locus_tag LOCUS_01600 88908 87553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071222.1 protein_id gnl|my_center|LOCUS_01600 91739 89022 gene locus_tag LOCUS_01610 91739 89022 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072403.1 protein_id gnl|my_center|LOCUS_01610 >Feature sequence003 323 901 gene locus_tag LOCUS_01620 323 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 894 1961 gene locus_tag LOCUS_01630 894 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 2231 2800 gene locus_tag LOCUS_01640 2231 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2793 3854 gene locus_tag LOCUS_01650 2793 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 3922 4953 gene locus_tag LOCUS_01660 3922 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 5151 5588 gene locus_tag LOCUS_01670 5151 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 5674 6870 gene locus_tag LOCUS_01680 5674 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 6963 8030 gene locus_tag LOCUS_01690 6963 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 9536 8250 gene locus_tag LOCUS_01700 9536 8250 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072292.1 protein_id gnl|my_center|LOCUS_01700 9733 10359 gene locus_tag LOCUS_01710 9733 10359 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531049.1 protein_id gnl|my_center|LOCUS_01710 10369 10803 gene locus_tag LOCUS_01720 10369 10803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 12998 11145 gene locus_tag LOCUS_01730 12998 11145 CDS product alkaline serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473082.1 protein_id gnl|my_center|LOCUS_01730 13703 13236 gene locus_tag LOCUS_01740 gene soxR 13703 13236 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708212.1 protein_id gnl|my_center|LOCUS_01740 13801 14265 gene locus_tag LOCUS_01750 13801 14265 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497611.1 protein_id gnl|my_center|LOCUS_01750 14298 14822 gene locus_tag LOCUS_01760 14298 14822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 14824 15444 gene locus_tag LOCUS_01770 14824 15444 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530472.1 protein_id gnl|my_center|LOCUS_01770 16101 15427 gene locus_tag LOCUS_01780 16101 15427 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_01780 17606 16095 gene locus_tag LOCUS_01790 17606 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 17823 18695 gene locus_tag LOCUS_01800 17823 18695 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071881.1 protein_id gnl|my_center|LOCUS_01800 18686 21844 gene locus_tag LOCUS_01810 18686 21844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 22178 21966 gene locus_tag LOCUS_01820 22178 21966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 22060 23226 gene locus_tag LOCUS_01830 22060 23226 CDS product putative sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUR0 protein_id gnl|my_center|LOCUS_01830 25551 23284 gene locus_tag LOCUS_01840 gene fhuA 25551 23284 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037795.1 protein_id gnl|my_center|LOCUS_01840 25808 26815 gene locus_tag LOCUS_01850 25808 26815 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919021.1 protein_id gnl|my_center|LOCUS_01850 26972 28177 gene locus_tag LOCUS_01860 26972 28177 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958165.1 protein_id gnl|my_center|LOCUS_01860 28174 29670 gene locus_tag LOCUS_01870 28174 29670 CDS product trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958166.1 protein_id gnl|my_center|LOCUS_01870 30842 30042 gene locus_tag LOCUS_01880 30842 30042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 31980 32672 gene locus_tag LOCUS_01890 gene csgD 31980 32672 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071154.1 protein_id gnl|my_center|LOCUS_01890 34030 33257 gene locus_tag LOCUS_01900 gene csgG 34030 33257 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073480.1 protein_id gnl|my_center|LOCUS_01900 34471 34031 gene locus_tag LOCUS_01910 gene csgF 34471 34031 CDS product curli production assembly protein CsgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073481.1 protein_id gnl|my_center|LOCUS_01910 34862 34461 gene locus_tag LOCUS_01920 34862 34461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 36410 34896 gene locus_tag LOCUS_01930 gene csgA 36410 34896 CDS product curlin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071155.1 protein_id gnl|my_center|LOCUS_01930 37002 39503 gene locus_tag LOCUS_01940 37002 39503 CDS product collagenolytic serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071157.1 protein_id gnl|my_center|LOCUS_01940 39748 41211 gene locus_tag LOCUS_01950 39748 41211 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021902.1 protein_id gnl|my_center|LOCUS_01950 41861 41343 gene locus_tag LOCUS_01960 41861 41343 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090707.1 protein_id gnl|my_center|LOCUS_01960 42041 42661 gene locus_tag LOCUS_01970 42041 42661 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090706.1 protein_id gnl|my_center|LOCUS_01970 42689 43381 gene locus_tag LOCUS_01980 42689 43381 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968227.1 protein_id gnl|my_center|LOCUS_01980 43503 43904 gene locus_tag LOCUS_01990 43503 43904 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073477.1 protein_id gnl|my_center|LOCUS_01990 45047 44103 gene locus_tag LOCUS_02000 gene scrK 45047 44103 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036695.1 protein_id gnl|my_center|LOCUS_02000 47570 45177 gene locus_tag LOCUS_02010 47570 45177 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919020.1 protein_id gnl|my_center|LOCUS_02010 48967 47738 gene locus_tag LOCUS_02020 48967 47738 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919017.1 protein_id gnl|my_center|LOCUS_02020 49144 50616 gene locus_tag LOCUS_02030 49144 50616 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974901.1 protein_id gnl|my_center|LOCUS_02030 51673 50642 gene locus_tag LOCUS_02040 51673 50642 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419400.1 protein_id gnl|my_center|LOCUS_02040 52148 54871 gene locus_tag LOCUS_02050 52148 54871 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480704.1 protein_id gnl|my_center|LOCUS_02050 55977 54961 gene locus_tag LOCUS_02060 55977 54961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902649.1 protein_id gnl|my_center|LOCUS_02060 57491 55992 gene locus_tag LOCUS_02070 57491 55992 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902650.1 protein_id gnl|my_center|LOCUS_02070 58531 57491 gene locus_tag LOCUS_02080 58531 57491 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902651.1 protein_id gnl|my_center|LOCUS_02080 59344 58532 gene locus_tag LOCUS_02090 59344 58532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 60138 60563 gene locus_tag LOCUS_02100 60138 60563 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404728.1 protein_id gnl|my_center|LOCUS_02100 60617 60895 gene locus_tag LOCUS_02110 60617 60895 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479216.1 protein_id gnl|my_center|LOCUS_02110 62417 61005 gene locus_tag LOCUS_02120 62417 61005 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707752.1 protein_id gnl|my_center|LOCUS_02120 62795 63295 gene locus_tag LOCUS_02130 62795 63295 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_02130 63343 64083 gene locus_tag LOCUS_02140 63343 64083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706507.1 protein_id gnl|my_center|LOCUS_02140 64811 64158 gene locus_tag LOCUS_02150 64811 64158 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104896.1 protein_id gnl|my_center|LOCUS_02150 66175 64955 gene locus_tag LOCUS_02160 66175 64955 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_02160 66658 66849 gene locus_tag LOCUS_02170 66658 66849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 67740 66889 gene locus_tag LOCUS_02180 67740 66889 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020826.1 protein_id gnl|my_center|LOCUS_02180 68406 69491 gene locus_tag LOCUS_02190 68406 69491 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_02190 70715 69741 gene locus_tag LOCUS_02200 70715 69741 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070524.1 protein_id gnl|my_center|LOCUS_02200 71109 71918 gene locus_tag LOCUS_02210 71109 71918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 72719 72105 gene locus_tag LOCUS_02220 72719 72105 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_02220 73463 72729 gene locus_tag LOCUS_02230 73463 72729 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707541.1 protein_id gnl|my_center|LOCUS_02230 73828 73463 gene locus_tag LOCUS_02240 73828 73463 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881580.1 protein_id gnl|my_center|LOCUS_02240 74049 76694 gene locus_tag LOCUS_02250 gene ppc 74049 76694 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFU8 protein_id gnl|my_center|LOCUS_02250 77091 77468 gene locus_tag LOCUS_02260 77091 77468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 77517 78449 gene locus_tag LOCUS_02270 gene cdd 77517 78449 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJH4 protein_id gnl|my_center|LOCUS_02270 79185 78430 gene locus_tag LOCUS_02280 gene udp 79185 78430 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIE7 protein_id gnl|my_center|LOCUS_02280 79615 80727 gene locus_tag LOCUS_02290 gene speB 79615 80727 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814Q2 protein_id gnl|my_center|LOCUS_02290 80852 81544 gene locus_tag LOCUS_02300 80852 81544 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407313.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence004 655 230 gene locus_tag LOCUS_02310 655 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 1745 831 gene locus_tag LOCUS_02320 1745 831 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262976.1 protein_id gnl|my_center|LOCUS_02320 2413 1838 gene locus_tag LOCUS_02330 2413 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 2891 4174 gene locus_tag LOCUS_02340 2891 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 4910 4233 gene locus_tag LOCUS_02350 4910 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5242 4913 gene locus_tag LOCUS_02360 gene tusE 5242 4913 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZG65 protein_id gnl|my_center|LOCUS_02360 5512 5246 gene locus_tag LOCUS_02370 5512 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 5865 5509 gene locus_tag LOCUS_02380 5865 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6215 5862 gene locus_tag LOCUS_02390 gene dsrE 6215 5862 CDS product sulfurtransferase TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_02390 6936 6271 gene locus_tag LOCUS_02400 gene yccA 6936 6271 CDS product BAX inhibitor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072357.1 protein_id gnl|my_center|LOCUS_02400 7189 7279 gene locus_tag LOCUS_t00030 7189 7279 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7722 7519 gene locus_tag LOCUS_02410 7722 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 8203 8988 gene locus_tag LOCUS_02420 8203 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 9859 10056 gene locus_tag LOCUS_02430 9859 10056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 10240 10635 gene locus_tag LOCUS_02440 10240 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10761 11222 gene locus_tag LOCUS_02450 10761 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706144.1 protein_id gnl|my_center|LOCUS_02450 11219 11497 gene locus_tag LOCUS_02460 11219 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 11513 12163 gene locus_tag LOCUS_02470 gene proQ 11513 12163 CDS product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDY8 protein_id gnl|my_center|LOCUS_02470 12190 14229 gene locus_tag LOCUS_02480 gene prc 12190 14229 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706142.1 protein_id gnl|my_center|LOCUS_02480 14413 15870 gene locus_tag LOCUS_02490 14413 15870 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_02490 15920 18514 gene locus_tag LOCUS_02500 15920 18514 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097275.1 protein_id gnl|my_center|LOCUS_02500 18518 18739 gene locus_tag LOCUS_02510 18518 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494961.1 protein_id gnl|my_center|LOCUS_02510 18986 21082 gene locus_tag LOCUS_02520 18986 21082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072547.1 protein_id gnl|my_center|LOCUS_02520 21093 22457 gene locus_tag LOCUS_02530 21093 22457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072546.1 protein_id gnl|my_center|LOCUS_02530 22611 23612 gene locus_tag LOCUS_02540 22611 23612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072545.1 protein_id gnl|my_center|LOCUS_02540 23612 25936 gene locus_tag LOCUS_02550 23612 25936 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_02550 26147 30988 gene locus_tag LOCUS_02560 gene gdh 26147 30988 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072543.1 protein_id gnl|my_center|LOCUS_02560 31103 32113 gene locus_tag LOCUS_02570 gene pyrD 31103 32113 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5B6 protein_id gnl|my_center|LOCUS_02570 32234 32764 gene locus_tag LOCUS_02580 gene zapC 32234 32764 CDS product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDZ9 protein_id gnl|my_center|LOCUS_02580 32854 34971 gene locus_tag LOCUS_02590 gene rlmL 32854 34971 CDS product ribosomal RNA large subunit methyltransferase K/L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKK7 protein_id gnl|my_center|LOCUS_02590 34964 35200 gene locus_tag LOCUS_02600 34964 35200 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706136.1 protein_id gnl|my_center|LOCUS_02600 35216 37135 gene locus_tag LOCUS_02610 35216 37135 CDS product ABC transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490212.1 protein_id gnl|my_center|LOCUS_02610 37147 38880 gene locus_tag LOCUS_02620 37147 38880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 39500 38991 gene locus_tag LOCUS_02630 39500 38991 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072737.1 protein_id gnl|my_center|LOCUS_02630 39726 41759 gene locus_tag LOCUS_02640 39726 41759 CDS product ComEC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816036.1 protein_id gnl|my_center|LOCUS_02640 41818 43563 gene locus_tag LOCUS_02650 gene msbA 41818 43563 CDS product lipid A export ATP-binding/permease protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLY2 protein_id gnl|my_center|LOCUS_02650 43560 44540 gene locus_tag LOCUS_02660 gene lpxK 43560 44540 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44491 protein_id gnl|my_center|LOCUS_02660 44530 44727 gene locus_tag LOCUS_02670 44530 44727 CDS product UPF0434 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMK8 protein_id gnl|my_center|LOCUS_02670 44715 45473 gene locus_tag LOCUS_02680 gene kdsB 44715 45473 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0E9 protein_id gnl|my_center|LOCUS_02680 45474 46151 gene locus_tag LOCUS_02690 45474 46151 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074068.1 protein_id gnl|my_center|LOCUS_02690 46152 46952 gene locus_tag LOCUS_02700 gene ygdL 46152 46952 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417869.1 protein_id gnl|my_center|LOCUS_02700 47362 46949 gene locus_tag LOCUS_02710 47362 46949 CDS product cysteine desulfurase, sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 protein_id gnl|my_center|LOCUS_02710 48590 47376 gene locus_tag LOCUS_02720 gene sufS 48590 47376 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_02720 50009 48723 gene locus_tag LOCUS_02730 gene gltA 50009 48723 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFP4 protein_id gnl|my_center|LOCUS_02730 50421 50798 gene locus_tag LOCUS_02740 gene sdhC 50421 50798 CDS product succinate dehydrogenase cytochrome b556 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705795.1 protein_id gnl|my_center|LOCUS_02740 50789 51136 gene locus_tag LOCUS_02750 gene sdhD 50789 51136 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PSF7 protein_id gnl|my_center|LOCUS_02750 51137 52909 gene locus_tag LOCUS_02760 gene sdhA 51137 52909 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJK5 protein_id gnl|my_center|LOCUS_02760 52920 53636 gene locus_tag LOCUS_02770 gene sdhB 52920 53636 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JR64 protein_id gnl|my_center|LOCUS_02770 53723 56542 gene locus_tag LOCUS_02780 gene sucA 53723 56542 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705799.1 protein_id gnl|my_center|LOCUS_02780 56546 58060 gene locus_tag LOCUS_02790 gene sucB 56546 58060 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFN9 protein_id gnl|my_center|LOCUS_02790 58237 59403 gene locus_tag LOCUS_02800 gene sucC 58237 59403 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFN8 protein_id gnl|my_center|LOCUS_02800 59403 60275 gene locus_tag LOCUS_02810 59403 60275 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJL0 protein_id gnl|my_center|LOCUS_02810 60491 62338 gene locus_tag LOCUS_02820 60491 62338 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073617.1 protein_id gnl|my_center|LOCUS_02820 63451 62381 gene locus_tag LOCUS_02830 63451 62381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072833.1 protein_id gnl|my_center|LOCUS_02830 63963 65624 gene locus_tag LOCUS_02840 gene glnS 63963 65624 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RG4 protein_id gnl|my_center|LOCUS_02840 66155 65715 gene locus_tag LOCUS_02850 gene fur 66155 65715 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072035.1 protein_id gnl|my_center|LOCUS_02850 66869 66342 gene locus_tag LOCUS_02860 gene fldA 66869 66342 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEP7 protein_id gnl|my_center|LOCUS_02860 67162 66884 gene locus_tag LOCUS_02870 gene ybfE 67162 66884 CDS product LexA regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040939.1 protein_id gnl|my_center|LOCUS_02870 67386 67165 gene locus_tag LOCUS_02880 67386 67165 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072324.1 protein_id gnl|my_center|LOCUS_02880 68274 67486 gene locus_tag LOCUS_02890 68274 67486 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705432.1 protein_id gnl|my_center|LOCUS_02890 68392 68976 gene locus_tag LOCUS_02900 gene seqA 68392 68976 CDS product negative modulator of initiation of replication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEP2 protein_id gnl|my_center|LOCUS_02900 68987 70624 gene locus_tag LOCUS_02910 gene pgm 68987 70624 CDS product phosphoglucomutase, alpha-D-glucose phosphate-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_02910 70709 71761 gene locus_tag LOCUS_02920 gene astE 70709 71761 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM71 protein_id gnl|my_center|LOCUS_02920 >Feature sequence005 <1 2589 gene locus_tag LOCUS_02930 <1 2589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706074.1:ATP-dependent helicase 2632 3039 gene locus_tag LOCUS_02940 2632 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 3048 3344 gene locus_tag LOCUS_02950 3048 3344 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407020.1 protein_id gnl|my_center|LOCUS_02950 4569 3379 gene locus_tag LOCUS_02960 gene rlmI 4569 3379 CDS product ribosomal RNA large subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P89 protein_id gnl|my_center|LOCUS_02960 4708 5373 gene locus_tag LOCUS_02970 gene yedJ 4708 5373 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261932.1 protein_id gnl|my_center|LOCUS_02970 5373 5762 gene locus_tag LOCUS_02980 5373 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 6759 5770 gene locus_tag LOCUS_02990 6759 5770 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_02990 10100 6759 gene locus_tag LOCUS_03000 10100 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 11330 10350 gene locus_tag LOCUS_03010 11330 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706755.1 protein_id gnl|my_center|LOCUS_03010 11416 12147 gene locus_tag LOCUS_03020 11416 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_03020 12327 12479 gene locus_tag LOCUS_03030 12327 12479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 12588 12504 gene locus_tag LOCUS_t00040 12588 12504 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 12701 13222 gene locus_tag LOCUS_03040 gene s4P 12701 13222 CDS product queD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072465.1 protein_id gnl|my_center|LOCUS_03040 13382 13684 gene locus_tag LOCUS_03050 13382 13684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 13891 14835 gene locus_tag LOCUS_03060 13891 14835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707265.1 protein_id gnl|my_center|LOCUS_03060 16500 14881 gene locus_tag LOCUS_03070 16500 14881 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072230.1 protein_id gnl|my_center|LOCUS_03070 16973 16734 gene locus_tag LOCUS_03080 16973 16734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466432.1 protein_id gnl|my_center|LOCUS_03080 17107 17634 gene locus_tag LOCUS_03090 17107 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 17759 19486 gene locus_tag LOCUS_03100 17759 19486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 20110 20421 gene locus_tag LOCUS_03110 20110 20421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 21482 20535 gene locus_tag LOCUS_03120 gene lipA 21482 20535 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6V9 protein_id gnl|my_center|LOCUS_03120 22150 21497 gene locus_tag LOCUS_03130 gene lipB 22150 21497 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ5 protein_id gnl|my_center|LOCUS_03130 22448 22170 gene locus_tag LOCUS_03140 22448 22170 CDS product UPF0250 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHQ4 protein_id gnl|my_center|LOCUS_03140 23830 22670 gene locus_tag LOCUS_03150 23830 22670 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488796.1 protein_id gnl|my_center|LOCUS_03150 24562 23885 gene locus_tag LOCUS_03160 gene rlpA 24562 23885 CDS product septal ring lipoprotein RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071396.1 protein_id gnl|my_center|LOCUS_03160 25764 24658 gene locus_tag LOCUS_03170 gene mrdB 25764 24658 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_03170 27629 25761 gene locus_tag LOCUS_03180 gene mrdA 27629 25761 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071399.1 protein_id gnl|my_center|LOCUS_03180 28097 27639 gene locus_tag LOCUS_03190 gene rlmH 28097 27639 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ4 protein_id gnl|my_center|LOCUS_03190 28463 28146 gene locus_tag LOCUS_03200 gene rsfS 28463 28146 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN92 protein_id gnl|my_center|LOCUS_03200 29152 28517 gene locus_tag LOCUS_03210 gene nadD 29152 28517 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN51 protein_id gnl|my_center|LOCUS_03210 30206 29169 gene locus_tag LOCUS_03220 gene holA 30206 29169 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071403.1 protein_id gnl|my_center|LOCUS_03220 30700 30206 gene locus_tag LOCUS_03230 gene lptE 30700 30206 CDS product LPS-assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RQ1 protein_id gnl|my_center|LOCUS_03230 33291 30703 gene locus_tag LOCUS_03240 gene leuS 33291 30703 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN87 protein_id gnl|my_center|LOCUS_03240 33467 33925 gene locus_tag LOCUS_03250 33467 33925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 34007 36415 gene locus_tag LOCUS_03260 34007 36415 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112820.1 protein_id gnl|my_center|LOCUS_03260 36418 36894 gene locus_tag LOCUS_03270 36418 36894 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KML0 protein_id gnl|my_center|LOCUS_03270 38380 36941 gene locus_tag LOCUS_03280 gene xylE 38380 36941 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036933.1 protein_id gnl|my_center|LOCUS_03280 39520 38411 gene locus_tag LOCUS_03290 39520 38411 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918866.1 protein_id gnl|my_center|LOCUS_03290 40085 39513 gene locus_tag LOCUS_03300 40085 39513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 40701 43892 gene locus_tag LOCUS_03310 gene iroN 40701 43892 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039035.1 protein_id gnl|my_center|LOCUS_03310 43971 45527 gene locus_tag LOCUS_03320 43971 45527 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 protein_id gnl|my_center|LOCUS_03320 45563 46309 gene locus_tag LOCUS_03330 45563 46309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 46296 47024 gene locus_tag LOCUS_03340 46296 47024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 47819 47190 gene locus_tag LOCUS_03350 47819 47190 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035367.1 protein_id gnl|my_center|LOCUS_03350 48979 47816 gene locus_tag LOCUS_03360 48979 47816 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035366.1 protein_id gnl|my_center|LOCUS_03360 49247 49660 gene locus_tag LOCUS_03370 49247 49660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918221.1 protein_id gnl|my_center|LOCUS_03370 49671 51167 gene locus_tag LOCUS_03380 49671 51167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918222.1 protein_id gnl|my_center|LOCUS_03380 51392 51919 gene locus_tag LOCUS_03390 51392 51919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 52466 51954 gene locus_tag LOCUS_03400 52466 51954 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262060.1 protein_id gnl|my_center|LOCUS_03400 52554 53291 gene locus_tag LOCUS_03410 52554 53291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 53466 56708 gene locus_tag LOCUS_03420 53466 56708 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ3 protein_id gnl|my_center|LOCUS_03420 57494 56841 gene locus_tag LOCUS_03430 57494 56841 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042743.1 protein_id gnl|my_center|LOCUS_03430 58253 57606 gene locus_tag LOCUS_03440 58253 57606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 59017 58274 gene locus_tag LOCUS_03450 59017 58274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 59628 59044 gene locus_tag LOCUS_03460 59628 59044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 59856 60572 gene locus_tag LOCUS_03470 59856 60572 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731358.1 protein_id gnl|my_center|LOCUS_03470 60640 61626 gene locus_tag LOCUS_03480 60640 61626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 62938 61712 gene locus_tag LOCUS_03490 62938 61712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 64600 63020 gene locus_tag LOCUS_03500 gene lnt 64600 63020 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHP1 protein_id gnl|my_center|LOCUS_03500 65462 64581 gene locus_tag LOCUS_03510 gene ybeX 65462 64581 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418183.1 protein_id gnl|my_center|LOCUS_03510 65943 65485 gene locus_tag LOCUS_03520 gene ybeY 65943 65485 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6U4 protein_id gnl|my_center|LOCUS_03520 67009 65948 gene locus_tag LOCUS_03530 67009 65948 CDS product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066204.1 protein_id gnl|my_center|LOCUS_03530 68505 67060 gene locus_tag LOCUS_03540 gene miaB 68505 67060 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTE0 protein_id gnl|my_center|LOCUS_03540 68759 69928 gene locus_tag LOCUS_03550 68759 69928 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490463.1 protein_id gnl|my_center|LOCUS_03550 >Feature sequence006 809 6 gene locus_tag LOCUS_03560 809 6 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 protein_id gnl|my_center|LOCUS_03560 2338 857 gene locus_tag LOCUS_03570 gene astD 2338 857 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN18 protein_id gnl|my_center|LOCUS_03570 3391 2357 gene locus_tag LOCUS_03580 3391 2357 CDS product arginine/ornithine succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232245.2 protein_id gnl|my_center|LOCUS_03580 4641 3436 gene locus_tag LOCUS_03590 gene argD 4641 3436 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN20 protein_id gnl|my_center|LOCUS_03590 4847 5275 gene locus_tag LOCUS_03600 4847 5275 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528746.1 protein_id gnl|my_center|LOCUS_03600 5487 6512 gene locus_tag LOCUS_03610 5487 6512 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998604.1 protein_id gnl|my_center|LOCUS_03610 7432 6509 gene locus_tag LOCUS_03620 7432 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 9436 7523 gene locus_tag LOCUS_03630 9436 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 10082 10381 gene locus_tag LOCUS_03640 10082 10381 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_03640 10392 12389 gene locus_tag LOCUS_03650 gene malQ 10392 12389 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU8 protein_id gnl|my_center|LOCUS_03650 12390 14618 gene locus_tag LOCUS_03660 gene glgB 12390 14618 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU7 protein_id gnl|my_center|LOCUS_03660 14602 16662 gene locus_tag LOCUS_03670 gene glgX 14602 16662 CDS product glycogen operon protein GlgX homolog inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU6 protein_id gnl|my_center|LOCUS_03670 16652 19177 gene locus_tag LOCUS_03680 gene glgP 16652 19177 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU5 protein_id gnl|my_center|LOCUS_03680 19192 20493 gene locus_tag LOCUS_03690 gene glgC 19192 20493 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGU3 protein_id gnl|my_center|LOCUS_03690 20525 22072 gene locus_tag LOCUS_03700 gene glgA 20525 22072 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071682.1 protein_id gnl|my_center|LOCUS_03700 22191 23402 gene locus_tag LOCUS_03710 22191 23402 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459079.1 protein_id gnl|my_center|LOCUS_03710 23419 24504 gene locus_tag LOCUS_03720 23419 24504 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071602.1 protein_id gnl|my_center|LOCUS_03720 24809 25732 gene locus_tag LOCUS_03730 gene rluF 24809 25732 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4I3 protein_id gnl|my_center|LOCUS_03730 28855 25793 gene locus_tag LOCUS_03740 28855 25793 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478902.1 protein_id gnl|my_center|LOCUS_03740 29939 28857 gene locus_tag LOCUS_03750 29939 28857 CDS product hemolysin secretion protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261804.1 protein_id gnl|my_center|LOCUS_03750 30041 30955 gene locus_tag LOCUS_03760 30041 30955 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072010.1 protein_id gnl|my_center|LOCUS_03760 30956 31261 gene locus_tag LOCUS_03770 gene adaA 30956 31261 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072490.1 protein_id gnl|my_center|LOCUS_03770 31909 31271 gene locus_tag LOCUS_03780 31909 31271 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707242.1 protein_id gnl|my_center|LOCUS_03780 32165 32461 gene locus_tag LOCUS_03790 32165 32461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 32675 33253 gene locus_tag LOCUS_03800 32675 33253 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707773.1 protein_id gnl|my_center|LOCUS_03800 33317 33943 gene locus_tag LOCUS_03810 33317 33943 CDS product RNA polymerase sigma factor ECF family 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072076.1 protein_id gnl|my_center|LOCUS_03810 33936 34598 gene locus_tag LOCUS_03820 gene chrR 33936 34598 CDS product zinc-binding anti-sigmaE4 factor ChrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263592.1 protein_id gnl|my_center|LOCUS_03820 34607 35560 gene locus_tag LOCUS_03830 34607 35560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 protein_id gnl|my_center|LOCUS_03830 35560 36954 gene locus_tag LOCUS_03840 gene phrB 35560 36954 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705028.1 protein_id gnl|my_center|LOCUS_03840 36938 37384 gene locus_tag LOCUS_03850 36938 37384 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480394.1 protein_id gnl|my_center|LOCUS_03850 37384 38094 gene locus_tag LOCUS_03860 37384 38094 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705030.1 protein_id gnl|my_center|LOCUS_03860 38091 39347 gene locus_tag LOCUS_03870 38091 39347 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889265.1 protein_id gnl|my_center|LOCUS_03870 39340 40074 gene locus_tag LOCUS_03880 39340 40074 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705032.1 protein_id gnl|my_center|LOCUS_03880 40101 41363 gene locus_tag LOCUS_03890 gene cfaS 40101 41363 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073246.1 protein_id gnl|my_center|LOCUS_03890 41898 42389 gene locus_tag LOCUS_03900 41898 42389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073244.1 protein_id gnl|my_center|LOCUS_03900 42391 42924 gene locus_tag LOCUS_03910 42391 42924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 protein_id gnl|my_center|LOCUS_03910 43133 43408 gene locus_tag LOCUS_03920 gene hupB 43133 43408 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A1R9 protein_id gnl|my_center|LOCUS_03920 43975 43478 gene locus_tag LOCUS_03930 gene ilvH 43975 43478 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_03930 45699 43975 gene locus_tag LOCUS_03940 gene ilvB-1 45699 43975 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGN4 protein_id gnl|my_center|LOCUS_03940 46241 49273 gene locus_tag LOCUS_03950 gene prtV 46241 49273 CDS product peptidase M6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070535.1 protein_id gnl|my_center|LOCUS_03950 50345 49338 gene locus_tag LOCUS_03960 50345 49338 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071715.1 protein_id gnl|my_center|LOCUS_03960 52379 50691 gene locus_tag LOCUS_03970 52379 50691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 52773 52390 gene locus_tag LOCUS_03980 52773 52390 CDS product DUF3192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071720.1 protein_id gnl|my_center|LOCUS_03980 53616 52843 gene locus_tag LOCUS_03990 gene xni 53616 52843 CDS product Flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHE3 protein_id gnl|my_center|LOCUS_03990 54974 53631 gene locus_tag LOCUS_04000 54974 53631 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705076.1 protein_id gnl|my_center|LOCUS_04000 56551 55016 gene locus_tag LOCUS_04010 56551 55016 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071723.1 protein_id gnl|my_center|LOCUS_04010 56769 58553 gene locus_tag LOCUS_04020 56769 58553 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_04020 59375 58575 gene locus_tag LOCUS_04030 59375 58575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 59593 61752 gene locus_tag LOCUS_04040 59593 61752 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_04040 64320 61903 gene locus_tag LOCUS_04050 64320 61903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 64816 66087 gene locus_tag LOCUS_04060 gene metY 64816 66087 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 protein_id gnl|my_center|LOCUS_04060 66239 66898 gene locus_tag LOCUS_04070 66239 66898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 67094 66906 gene locus_tag LOCUS_04080 67094 66906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 67660 67148 gene locus_tag LOCUS_04090 67660 67148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 68582 67845 gene locus_tag LOCUS_04100 68582 67845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070552.1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence007 2336 3 gene locus_tag LOCUS_04110 gene tex 2336 3 CDS product transcription accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074225.1 protein_id gnl|my_center|LOCUS_04110 3081 2500 gene locus_tag LOCUS_04120 3081 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 3440 3132 gene locus_tag LOCUS_04130 3440 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 4064 3585 gene locus_tag LOCUS_04140 gene greB 4064 3585 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TB8 protein_id gnl|my_center|LOCUS_04140 4252 4980 gene locus_tag LOCUS_04150 gene ompR 4252 4980 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074227.1 protein_id gnl|my_center|LOCUS_04150 4986 6290 gene locus_tag LOCUS_04160 gene envZ 4986 6290 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074228.1 protein_id gnl|my_center|LOCUS_04160 7462 6287 gene locus_tag LOCUS_04170 7462 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_04170 10475 7467 gene locus_tag LOCUS_04180 10475 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 13022 10980 gene locus_tag LOCUS_04190 gene susB 13022 10980 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072426.1 protein_id gnl|my_center|LOCUS_04190 13233 13862 gene locus_tag LOCUS_04200 13233 13862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268752.1 protein_id gnl|my_center|LOCUS_04200 13855 15078 gene locus_tag LOCUS_04210 13855 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 15146 16747 gene locus_tag LOCUS_04220 15146 16747 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114016.1 protein_id gnl|my_center|LOCUS_04220 17887 17024 gene locus_tag LOCUS_04230 gene speE 17887 17024 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P447 protein_id gnl|my_center|LOCUS_04230 18091 19968 gene locus_tag LOCUS_04240 gene speA 18091 19968 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFU5 protein_id gnl|my_center|LOCUS_04240 20033 20914 gene locus_tag LOCUS_04250 20033 20914 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070713.1 protein_id gnl|my_center|LOCUS_04250 21055 22314 gene locus_tag LOCUS_04260 21055 22314 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_04260 23425 22277 gene locus_tag LOCUS_04270 23425 22277 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261328.1 protein_id gnl|my_center|LOCUS_04270 23548 24342 gene locus_tag LOCUS_04280 23548 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 24420 25052 gene locus_tag LOCUS_04290 24420 25052 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710077.1 protein_id gnl|my_center|LOCUS_04290 26888 25107 gene locus_tag LOCUS_04300 26888 25107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478447.1 protein_id gnl|my_center|LOCUS_04300 26967 27365 gene locus_tag LOCUS_04310 26967 27365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071754.1 protein_id gnl|my_center|LOCUS_04310 27377 27565 gene locus_tag LOCUS_04320 27377 27565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 27575 28192 gene locus_tag LOCUS_04330 27575 28192 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704971.1 protein_id gnl|my_center|LOCUS_04330 28496 31378 gene locus_tag LOCUS_04340 gene btuB 28496 31378 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037606.1 protein_id gnl|my_center|LOCUS_04340 31400 35710 gene locus_tag LOCUS_04350 31400 35710 CDS product pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482097.1 protein_id gnl|my_center|LOCUS_04350 35836 36378 gene locus_tag LOCUS_04360 35836 36378 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121177.1 protein_id gnl|my_center|LOCUS_04360 36416 36979 gene locus_tag LOCUS_04370 36416 36979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 37275 38189 gene locus_tag LOCUS_04380 37275 38189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 40058 38277 gene locus_tag LOCUS_04390 gene phoD 40058 38277 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 protein_id gnl|my_center|LOCUS_04390 40482 40138 gene locus_tag LOCUS_04400 40482 40138 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338309.1 protein_id gnl|my_center|LOCUS_04400 40803 41105 gene locus_tag LOCUS_04410 40803 41105 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390365.1 protein_id gnl|my_center|LOCUS_04410 41110 44397 gene locus_tag LOCUS_04420 41110 44397 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479332.1 protein_id gnl|my_center|LOCUS_04420 44387 45448 gene locus_tag LOCUS_04430 gene czcB 44387 45448 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 protein_id gnl|my_center|LOCUS_04430 46118 45441 gene locus_tag LOCUS_04440 46118 45441 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_04440 46676 47557 gene locus_tag LOCUS_04450 46676 47557 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071881.1 protein_id gnl|my_center|LOCUS_04450 47569 51147 gene locus_tag LOCUS_04460 47569 51147 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071882.1 protein_id gnl|my_center|LOCUS_04460 51577 51203 gene locus_tag LOCUS_04470 51577 51203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_456974.1 protein_id gnl|my_center|LOCUS_04470 52171 52485 gene locus_tag LOCUS_04480 52171 52485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 52482 52811 gene locus_tag LOCUS_04490 52482 52811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 53041 53934 gene locus_tag LOCUS_04500 gene ydhF 53041 53934 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263285.1 protein_id gnl|my_center|LOCUS_04500 54754 54077 gene locus_tag LOCUS_04510 54754 54077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070887.1 protein_id gnl|my_center|LOCUS_04510 56234 55044 gene locus_tag LOCUS_04520 56234 55044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 56556 56356 gene locus_tag LOCUS_04530 56556 56356 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965790.1 protein_id gnl|my_center|LOCUS_04530 56984 56565 gene locus_tag LOCUS_04540 56984 56565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 57223 59163 gene locus_tag LOCUS_04550 57223 59163 CDS product cell envelope biogenesis protein AsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461597.1 protein_id gnl|my_center|LOCUS_04550 59441 59809 gene locus_tag LOCUS_04560 gene rplN 59441 59809 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF31 protein_id gnl|my_center|LOCUS_04560 59820 60134 gene locus_tag LOCUS_04570 gene rplX 59820 60134 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EPJ7 protein_id gnl|my_center|LOCUS_04570 60151 60690 gene locus_tag LOCUS_04580 gene rplE 60151 60690 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44346 protein_id gnl|my_center|LOCUS_04580 60701 61006 gene locus_tag LOCUS_04590 gene rpsN 60701 61006 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T00 protein_id gnl|my_center|LOCUS_04590 61028 61420 gene locus_tag LOCUS_04600 gene rpsH 61028 61420 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKH8 protein_id gnl|my_center|LOCUS_04600 61434 61967 gene locus_tag LOCUS_04610 gene rplF 61434 61967 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NLM4 protein_id gnl|my_center|LOCUS_04610 61977 62327 gene locus_tag LOCUS_04620 gene rplR 61977 62327 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK53 protein_id gnl|my_center|LOCUS_04620 62337 62843 gene locus_tag LOCUS_04630 gene rpsE 62337 62843 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59124 protein_id gnl|my_center|LOCUS_04630 62847 63029 gene locus_tag LOCUS_04640 gene rpmD 62847 63029 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF39 protein_id gnl|my_center|LOCUS_04640 63035 63469 gene locus_tag LOCUS_04650 gene rplO 63035 63469 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SZ4 protein_id gnl|my_center|LOCUS_04650 63480 64808 gene locus_tag LOCUS_04660 gene secY 63480 64808 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF41 protein_id gnl|my_center|LOCUS_04660 65064 65426 gene locus_tag LOCUS_04670 gene rpsM 65064 65426 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E892 protein_id gnl|my_center|LOCUS_04670 65439 65825 gene locus_tag LOCUS_04680 gene rpsK 65439 65825 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59375 protein_id gnl|my_center|LOCUS_04680 65847 66467 gene locus_tag LOCUS_04690 gene rpsD 65847 66467 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59131 protein_id gnl|my_center|LOCUS_04690 66492 67478 gene locus_tag LOCUS_04700 gene rpoA 66492 67478 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK47 protein_id gnl|my_center|LOCUS_04700 67518 67919 gene locus_tag LOCUS_04710 gene rplQ 67518 67919 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JS00 protein_id gnl|my_center|LOCUS_04710 >Feature sequence008 313 2319 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagccgcctgctcggcggtg 3011 2451 gene locus_tag LOCUS_04720 3011 2451 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350184.1 protein_id gnl|my_center|LOCUS_04720 4019 3021 gene locus_tag LOCUS_04730 4019 3021 CDS product CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_04730 4974 4021 gene locus_tag LOCUS_04740 4974 4021 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_04740 6299 4974 gene locus_tag LOCUS_04750 6299 4974 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_04750 6534 6331 gene locus_tag LOCUS_04760 6534 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 10086 6742 gene locus_tag LOCUS_04770 10086 6742 CDS product type I-F CRISPR-associated helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_04770 11000 10083 gene locus_tag LOCUS_04780 11000 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347432.1 protein_id gnl|my_center|LOCUS_04780 11313 10936 gene locus_tag LOCUS_04790 11313 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 12363 11488 gene locus_tag LOCUS_04800 gene xylC 12363 11488 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918705.1 protein_id gnl|my_center|LOCUS_04800 13062 12403 gene locus_tag LOCUS_04810 13062 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967724.1 protein_id gnl|my_center|LOCUS_04810 13989 13210 gene locus_tag LOCUS_04820 13989 13210 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532969.1 protein_id gnl|my_center|LOCUS_04820 14762 14031 gene locus_tag LOCUS_04830 14762 14031 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918668.1 protein_id gnl|my_center|LOCUS_04830 14998 16638 gene locus_tag LOCUS_04840 14998 16638 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_04840 16787 20017 gene locus_tag LOCUS_04850 16787 20017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 21104 20076 gene locus_tag LOCUS_04860 gene xsa 21104 20076 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002305469.1 protein_id gnl|my_center|LOCUS_04860 21285 22217 gene locus_tag LOCUS_04870 gene abnA 21285 22217 CDS product extracellular endo-alpha-(1->5)-L-arabinanase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94522 protein_id gnl|my_center|LOCUS_04870 22748 22314 gene locus_tag LOCUS_04880 22748 22314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 25209 22759 gene locus_tag LOCUS_04890 25209 22759 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_04890 26176 25232 gene locus_tag LOCUS_04900 26176 25232 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_04900 27528 26191 gene locus_tag LOCUS_04910 27528 26191 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 protein_id gnl|my_center|LOCUS_04910 30584 27777 gene locus_tag LOCUS_04920 gene cirA 30584 27777 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037153.1 protein_id gnl|my_center|LOCUS_04920 33951 31114 gene locus_tag LOCUS_04930 gene cirA 33951 31114 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037153.1 protein_id gnl|my_center|LOCUS_04930 34509 35471 gene locus_tag LOCUS_04940 34509 35471 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107223.1 protein_id gnl|my_center|LOCUS_04940 35980 39435 gene locus_tag LOCUS_04950 35980 39435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 39583 40443 gene locus_tag LOCUS_04960 39583 40443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 40455 42038 gene locus_tag LOCUS_04970 40455 42038 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QPP6 protein_id gnl|my_center|LOCUS_04970 42156 42572 gene locus_tag LOCUS_04980 42156 42572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 43628 42861 gene locus_tag LOCUS_04990 43628 42861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 46014 44044 gene locus_tag LOCUS_05000 46014 44044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 47953 45986 gene locus_tag LOCUS_05010 47953 45986 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_05010 49020 47953 gene locus_tag LOCUS_05020 gene galM 49020 47953 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_05020 49827 49237 gene locus_tag LOCUS_05030 49827 49237 CDS product carotenoid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183228.1 protein_id gnl|my_center|LOCUS_05030 51415 49916 gene locus_tag LOCUS_05040 gene araA 51415 49916 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FK3 protein_id gnl|my_center|LOCUS_05040 52139 51438 gene locus_tag LOCUS_05050 gene araD 52139 51438 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286765.1 protein_id gnl|my_center|LOCUS_05050 53788 52136 gene locus_tag LOCUS_05060 gene araB 53788 52136 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N7T7 protein_id gnl|my_center|LOCUS_05060 54027 54980 gene locus_tag LOCUS_05070 gene tal 54027 54980 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMY9 protein_id gnl|my_center|LOCUS_05070 57088 55088 gene locus_tag LOCUS_05080 gene tkt 57088 55088 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071210.1 protein_id gnl|my_center|LOCUS_05080 58775 59728 gene locus_tag LOCUS_05090 58775 59728 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192895.1 protein_id gnl|my_center|LOCUS_05090 59747 60199 gene locus_tag LOCUS_05100 59747 60199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 60520 61194 gene locus_tag LOCUS_05110 60520 61194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933017.1 protein_id gnl|my_center|LOCUS_05110 61188 62159 gene locus_tag LOCUS_05120 61188 62159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 62149 63309 gene locus_tag LOCUS_05130 62149 63309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 63306 64502 gene locus_tag LOCUS_05140 63306 64502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 64502 65737 gene locus_tag LOCUS_05150 64502 65737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_05150 >Feature sequence009 1543 836 gene locus_tag LOCUS_05160 1543 836 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705770.1 protein_id gnl|my_center|LOCUS_05160 2811 2020 gene locus_tag LOCUS_05170 2811 2020 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070911.1 protein_id gnl|my_center|LOCUS_05170 3071 4276 gene locus_tag LOCUS_05180 3071 4276 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_05180 4288 7398 gene locus_tag LOCUS_05190 4288 7398 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709359.1 protein_id gnl|my_center|LOCUS_05190 7506 7832 gene locus_tag LOCUS_05200 7506 7832 CDS product UPF0263 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZEI3 protein_id gnl|my_center|LOCUS_05200 7912 8709 gene locus_tag LOCUS_05210 7912 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_05210 8726 9178 gene locus_tag LOCUS_05220 8726 9178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 9725 9240 gene locus_tag LOCUS_05230 9725 9240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 10649 9738 gene locus_tag LOCUS_05240 10649 9738 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LM8 protein_id gnl|my_center|LOCUS_05240 10780 11031 gene locus_tag LOCUS_05250 10780 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH90 protein_id gnl|my_center|LOCUS_05250 11072 11443 gene locus_tag LOCUS_05260 11072 11443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 13028 11403 gene locus_tag LOCUS_05270 gene nadB 13028 11403 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD80 protein_id gnl|my_center|LOCUS_05270 13292 13873 gene locus_tag LOCUS_05280 gene rpoE 13292 13873 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_05280 13875 14486 gene locus_tag LOCUS_05290 13875 14486 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPA7 protein_id gnl|my_center|LOCUS_05290 14491 15447 gene locus_tag LOCUS_05300 gene rseB 14491 15447 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262552.1 protein_id gnl|my_center|LOCUS_05300 15460 15909 gene locus_tag LOCUS_05310 15460 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 15979 17766 gene locus_tag LOCUS_05320 gene lepA 15979 17766 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH83 protein_id gnl|my_center|LOCUS_05320 17806 18741 gene locus_tag LOCUS_05330 gene lepB 17806 18741 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGF1 protein_id gnl|my_center|LOCUS_05330 18744 19421 gene locus_tag LOCUS_05340 gene rnc 18744 19421 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPB2 protein_id gnl|my_center|LOCUS_05340 19411 20343 gene locus_tag LOCUS_05350 gene era 19411 20343 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZD71 protein_id gnl|my_center|LOCUS_05350 20361 21050 gene locus_tag LOCUS_05360 gene recO 20361 21050 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44642 protein_id gnl|my_center|LOCUS_05360 21113 21844 gene locus_tag LOCUS_05370 gene pdxJ 21113 21844 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH78 protein_id gnl|my_center|LOCUS_05370 22105 21914 gene locus_tag LOCUS_05380 22105 21914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 22333 22160 gene locus_tag LOCUS_05390 22333 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 22853 23098 gene locus_tag LOCUS_05400 22853 23098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 23109 24893 gene locus_tag LOCUS_05410 23109 24893 CDS product oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480900.1 protein_id gnl|my_center|LOCUS_05410 24905 26035 gene locus_tag LOCUS_05420 24905 26035 CDS product oxaloacetate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_05420 26175 26351 gene locus_tag LOCUS_05430 26175 26351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 27263 26838 gene locus_tag LOCUS_05440 27263 26838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 28950 27637 gene locus_tag LOCUS_05450 28950 27637 CDS product family M23 zinc metallopeptidase with OapA domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071525.1 protein_id gnl|my_center|LOCUS_05450 29101 30300 gene locus_tag LOCUS_05460 gene tyrS 29101 30300 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB3 protein_id gnl|my_center|LOCUS_05460 31311 30364 gene locus_tag LOCUS_05470 31311 30364 CDS product adenosylcobinamide-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461205.1 protein_id gnl|my_center|LOCUS_05470 32020 31313 gene locus_tag LOCUS_05480 gene mtnN 32020 31313 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHA7 protein_id gnl|my_center|LOCUS_05480 32716 32123 gene locus_tag LOCUS_05490 32716 32123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 33728 32808 gene locus_tag LOCUS_05500 gene folE2 33728 32808 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9T3 protein_id gnl|my_center|LOCUS_05500 33942 36266 gene locus_tag LOCUS_05510 33942 36266 CDS product aerobic respiration control sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SD7 protein_id gnl|my_center|LOCUS_05510 37010 36294 gene locus_tag LOCUS_05520 gene arcA-1 37010 36294 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706824.1 protein_id gnl|my_center|LOCUS_05520 37643 37119 gene locus_tag LOCUS_05530 37643 37119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 39211 37640 gene locus_tag LOCUS_05540 39211 37640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 40438 39413 gene locus_tag LOCUS_05550 gene rsmC 40438 39413 CDS product ribosomal RNA small subunit methyltransferase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LY1 protein_id gnl|my_center|LOCUS_05550 41197 40472 gene locus_tag LOCUS_05560 gene trmB 41197 40472 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBX8 protein_id gnl|my_center|LOCUS_05560 41364 42431 gene locus_tag LOCUS_05570 gene mutY 41364 42431 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073236.1 protein_id gnl|my_center|LOCUS_05570 42462 42734 gene locus_tag LOCUS_05580 42462 42734 CDS product putative Fe(2+)-trafficking protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LI5 protein_id gnl|my_center|LOCUS_05580 45555 42784 gene locus_tag LOCUS_05590 45555 42784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 46069 46144 gene locus_tag LOCUS_t00050 46069 46144 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 46216 46291 gene locus_tag LOCUS_t00060 46216 46291 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 46342 46417 gene locus_tag LOCUS_t00070 46342 46417 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 46924 48324 gene locus_tag LOCUS_05600 46924 48324 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106233.1 protein_id gnl|my_center|LOCUS_05600 48327 49628 gene locus_tag LOCUS_05610 48327 49628 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_05610 49625 52708 gene locus_tag LOCUS_05620 49625 52708 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_05620 52823 54175 gene locus_tag LOCUS_05630 52823 54175 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071733.1 protein_id gnl|my_center|LOCUS_05630 54349 54486 gene locus_tag LOCUS_05640 54349 54486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 54726 55643 gene locus_tag LOCUS_05650 54726 55643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 58228 55709 gene locus_tag LOCUS_05660 58228 55709 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_05660 59355 58363 gene locus_tag LOCUS_05670 59355 58363 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071842.1 protein_id gnl|my_center|LOCUS_05670 59939 59535 gene locus_tag LOCUS_05680 59939 59535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 63171 59923 gene locus_tag LOCUS_05690 63171 59923 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071845.1 protein_id gnl|my_center|LOCUS_05690 63402 63836 gene locus_tag LOCUS_05700 63402 63836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 63833 64030 gene locus_tag LOCUS_05710 63833 64030 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889079.1 protein_id gnl|my_center|LOCUS_05710 65278 64076 gene locus_tag LOCUS_05720 65278 64076 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087637.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence010 352 1014 gene locus_tag LOCUS_05730 352 1014 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705131.1 protein_id gnl|my_center|LOCUS_05730 4550 1011 gene locus_tag LOCUS_05740 4550 1011 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_05740 4732 5772 gene locus_tag LOCUS_05750 4732 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071615.1 protein_id gnl|my_center|LOCUS_05750 5913 6719 gene locus_tag LOCUS_05760 5913 6719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106433.1 protein_id gnl|my_center|LOCUS_05760 6719 8680 gene locus_tag LOCUS_05770 6719 8680 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477328.1 protein_id gnl|my_center|LOCUS_05770 8677 9570 gene locus_tag LOCUS_05780 8677 9570 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463595.1 protein_id gnl|my_center|LOCUS_05780 9639 10712 gene locus_tag LOCUS_05790 9639 10712 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463596.1 protein_id gnl|my_center|LOCUS_05790 10809 12059 gene locus_tag LOCUS_05800 10809 12059 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106432.1 protein_id gnl|my_center|LOCUS_05800 12142 12963 gene locus_tag LOCUS_05810 12142 12963 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477074.1 protein_id gnl|my_center|LOCUS_05810 13009 14256 gene locus_tag LOCUS_05820 13009 14256 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391251.1 protein_id gnl|my_center|LOCUS_05820 14280 14771 gene locus_tag LOCUS_05830 14280 14771 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_05830 15080 14820 gene locus_tag LOCUS_05840 15080 14820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 15906 15283 gene locus_tag LOCUS_05850 15906 15283 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072773.1 protein_id gnl|my_center|LOCUS_05850 17780 15942 gene locus_tag LOCUS_05860 17780 15942 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072774.1 protein_id gnl|my_center|LOCUS_05860 19624 17900 gene locus_tag LOCUS_05870 19624 17900 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072775.1 protein_id gnl|my_center|LOCUS_05870 19898 19635 gene locus_tag LOCUS_05880 19898 19635 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 protein_id gnl|my_center|LOCUS_05880 20288 23728 gene locus_tag LOCUS_05890 20288 23728 CDS product two-component sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114080.1 protein_id gnl|my_center|LOCUS_05890 26477 23826 gene locus_tag LOCUS_05900 26477 23826 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481511.1 protein_id gnl|my_center|LOCUS_05900 27948 26584 gene locus_tag LOCUS_05910 27948 26584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 29513 28152 gene locus_tag LOCUS_05920 29513 28152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 32294 29523 gene locus_tag LOCUS_05930 32294 29523 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_05930 32630 33550 gene locus_tag LOCUS_05940 32630 33550 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104455.1 protein_id gnl|my_center|LOCUS_05940 33547 34572 gene locus_tag LOCUS_05950 33547 34572 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 protein_id gnl|my_center|LOCUS_05950 34641 35210 gene locus_tag LOCUS_05960 34641 35210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 35219 38443 gene locus_tag LOCUS_05970 35219 38443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 39843 38491 gene locus_tag LOCUS_05980 39843 38491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 40207 39992 gene locus_tag LOCUS_05990 40207 39992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 43366 40469 gene locus_tag LOCUS_06000 43366 40469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 43596 44426 gene locus_tag LOCUS_06010 gene purU 43596 44426 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRL0 protein_id gnl|my_center|LOCUS_06010 45155 44502 gene locus_tag LOCUS_06020 gene tcsR 45155 44502 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 protein_id gnl|my_center|LOCUS_06020 47193 45253 gene locus_tag LOCUS_06030 gene acsA 47193 45253 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNI2 protein_id gnl|my_center|LOCUS_06030 47501 48664 gene locus_tag LOCUS_06040 47501 48664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639398.2 protein_id gnl|my_center|LOCUS_06040 48822 50942 gene locus_tag LOCUS_06050 gene fpvA1 48822 50942 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 protein_id gnl|my_center|LOCUS_06050 52086 51040 gene locus_tag LOCUS_06060 gene recA 52086 51040 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPG3 protein_id gnl|my_center|LOCUS_06060 52643 52155 gene locus_tag LOCUS_06070 52643 52155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167419.1 protein_id gnl|my_center|LOCUS_06070 52665 55235 gene locus_tag LOCUS_06080 gene mutS 52665 55235 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPG5 protein_id gnl|my_center|LOCUS_06080 56331 55336 gene locus_tag LOCUS_06090 gene rpoS 56331 55336 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR8 protein_id gnl|my_center|LOCUS_06090 57216 56392 gene locus_tag LOCUS_06100 gene nlpD 57216 56392 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262535.1 protein_id gnl|my_center|LOCUS_06100 57835 57257 gene locus_tag LOCUS_06110 57835 57257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704776.1 protein_id gnl|my_center|LOCUS_06110 58483 57845 gene locus_tag LOCUS_06120 gene pcm 58483 57845 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E332 protein_id gnl|my_center|LOCUS_06120 59237 58473 gene locus_tag LOCUS_06130 gene surE 59237 58473 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR5 protein_id gnl|my_center|LOCUS_06130 60267 59218 gene locus_tag LOCUS_06140 gene truD 60267 59218 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGH7 protein_id gnl|my_center|LOCUS_06140 60746 60264 gene locus_tag LOCUS_06150 gene ispF 60746 60264 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBR3 protein_id gnl|my_center|LOCUS_06150 61444 60743 gene locus_tag LOCUS_06160 gene ispD 61444 60743 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E328 protein_id gnl|my_center|LOCUS_06160 61724 61434 gene locus_tag LOCUS_06170 gene ftsB 61724 61434 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64163 protein_id gnl|my_center|LOCUS_06170 62415 61786 gene locus_tag LOCUS_06180 62415 61786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 62988 62506 gene locus_tag LOCUS_06190 62988 62506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458833.1 protein_id gnl|my_center|LOCUS_06190 63049 63288 gene locus_tag LOCUS_06200 63049 63288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 63340 64188 gene locus_tag LOCUS_06210 63340 64188 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089434.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence011 1030 2175 gene locus_tag LOCUS_06220 1030 2175 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073043.1 protein_id gnl|my_center|LOCUS_06220 4166 2190 gene locus_tag LOCUS_06230 gene kefB 4166 2190 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071802.1 protein_id gnl|my_center|LOCUS_06230 4317 5213 gene locus_tag LOCUS_06240 4317 5213 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_06240 5608 5261 gene locus_tag LOCUS_06250 5608 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 6912 5605 gene locus_tag LOCUS_06260 gene tilS 6912 5605 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3F6 protein_id gnl|my_center|LOCUS_06260 7976 7020 gene locus_tag LOCUS_06270 gene accA 7976 7020 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP64 protein_id gnl|my_center|LOCUS_06270 11484 7993 gene locus_tag LOCUS_06280 11484 7993 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MF2 protein_id gnl|my_center|LOCUS_06280 12080 11484 gene locus_tag LOCUS_06290 gene rnhB 12080 11484 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHH7 protein_id gnl|my_center|LOCUS_06290 13227 12070 gene locus_tag LOCUS_06300 gene lpxB 13227 12070 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHH6 protein_id gnl|my_center|LOCUS_06300 13606 15207 gene locus_tag LOCUS_06310 gene cydA 13606 15207 CDS product cytochrome bd oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261597.1 protein_id gnl|my_center|LOCUS_06310 15204 16343 gene locus_tag LOCUS_06320 gene cydB 15204 16343 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206958.1 protein_id gnl|my_center|LOCUS_06320 16357 16509 gene locus_tag LOCUS_06330 gene ybgT 16357 16509 CDS product cyd operon protein YbgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073165.1 protein_id gnl|my_center|LOCUS_06330 16499 18283 gene locus_tag LOCUS_06340 gene cydD 16499 18283 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941872.1 protein_id gnl|my_center|LOCUS_06340 18276 20009 gene locus_tag LOCUS_06350 18276 20009 CDS product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483528.1 protein_id gnl|my_center|LOCUS_06350 20386 20006 gene locus_tag LOCUS_06360 20386 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268871.1 protein_id gnl|my_center|LOCUS_06360 21300 20530 gene locus_tag LOCUS_06370 gene lpxA 21300 20530 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG3 protein_id gnl|my_center|LOCUS_06370 21755 21303 gene locus_tag LOCUS_06380 gene fabZ 21755 21303 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG4 protein_id gnl|my_center|LOCUS_06380 22806 21769 gene locus_tag LOCUS_06390 gene lpxD 22806 21769 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFY5 protein_id gnl|my_center|LOCUS_06390 23335 22817 gene locus_tag LOCUS_06400 23335 22817 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946255.1 protein_id gnl|my_center|LOCUS_06400 25818 23347 gene locus_tag LOCUS_06410 gene bamA 25818 23347 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG7 protein_id gnl|my_center|LOCUS_06410 27275 25923 gene locus_tag LOCUS_06420 gene rseP 27275 25923 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGG8 protein_id gnl|my_center|LOCUS_06420 28482 27277 gene locus_tag LOCUS_06430 gene dxr 28482 27277 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87ME3 protein_id gnl|my_center|LOCUS_06430 29345 28479 gene locus_tag LOCUS_06440 gene cdsA 29345 28479 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH0 protein_id gnl|my_center|LOCUS_06440 30142 29363 gene locus_tag LOCUS_06450 gene uppS 30142 29363 CDS product ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3E3 protein_id gnl|my_center|LOCUS_06450 30758 30201 gene locus_tag LOCUS_06460 gene frr 30758 30201 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3E2 protein_id gnl|my_center|LOCUS_06460 31522 30773 gene locus_tag LOCUS_06470 gene pyrH 31522 30773 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH3 protein_id gnl|my_center|LOCUS_06470 32533 31682 gene locus_tag LOCUS_06480 gene tsf 32533 31682 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGH4 protein_id gnl|my_center|LOCUS_06480 33367 32639 gene locus_tag LOCUS_06490 gene rpsB 33367 32639 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MD8 protein_id gnl|my_center|LOCUS_06490 33639 34424 gene locus_tag LOCUS_06500 gene map 33639 34424 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWS9 protein_id gnl|my_center|LOCUS_06500 34478 37096 gene locus_tag LOCUS_06510 gene glnD 34478 37096 CDS product bifunctional uridylyltransferase/uridylyl-removing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG1 protein_id gnl|my_center|LOCUS_06510 37106 37933 gene locus_tag LOCUS_06520 gene dapD 37106 37933 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHG0 protein_id gnl|my_center|LOCUS_06520 38174 39187 gene locus_tag LOCUS_06530 38174 39187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 40761 39733 gene locus_tag LOCUS_06540 40761 39733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098754.1 protein_id gnl|my_center|LOCUS_06540 41022 44132 gene locus_tag LOCUS_06550 41022 44132 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_06550 44129 45220 gene locus_tag LOCUS_06560 44129 45220 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389848.1 protein_id gnl|my_center|LOCUS_06560 45756 45283 gene locus_tag LOCUS_06570 45756 45283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 46339 46007 gene locus_tag LOCUS_06580 46339 46007 CDS product monovalent cation/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082083.1 protein_id gnl|my_center|LOCUS_06580 46620 46351 gene locus_tag LOCUS_06590 46620 46351 CDS product monovalent cation/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082079.1 protein_id gnl|my_center|LOCUS_06590 47150 46614 gene locus_tag LOCUS_06600 47150 46614 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112515.1 protein_id gnl|my_center|LOCUS_06600 48667 47150 gene locus_tag LOCUS_06610 48667 47150 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112516.1 protein_id gnl|my_center|LOCUS_06610 49011 48664 gene locus_tag LOCUS_06620 49011 48664 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082068.1 protein_id gnl|my_center|LOCUS_06620 51707 49011 gene locus_tag LOCUS_06630 51707 49011 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082059.1 protein_id gnl|my_center|LOCUS_06630 53189 52017 gene locus_tag LOCUS_06640 53189 52017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 54090 53212 gene locus_tag LOCUS_06650 54090 53212 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ25 protein_id gnl|my_center|LOCUS_06650 56355 54229 gene locus_tag LOCUS_06660 gene pnp 56355 54229 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU76 protein_id gnl|my_center|LOCUS_06660 56978 56709 gene locus_tag LOCUS_06670 gene rpsO 56978 56709 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7L2 protein_id gnl|my_center|LOCUS_06670 58037 57087 gene locus_tag LOCUS_06680 gene truB 58037 57087 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M04 protein_id gnl|my_center|LOCUS_06680 58479 58021 gene locus_tag LOCUS_06690 gene rbfA 58479 58021 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45141 protein_id gnl|my_center|LOCUS_06690 61248 58591 gene locus_tag LOCUS_06700 gene infB 61248 58591 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7L5 protein_id gnl|my_center|LOCUS_06700 62773 61274 gene locus_tag LOCUS_06710 gene nusA 62773 61274 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE4 protein_id gnl|my_center|LOCUS_06710 63267 62812 gene locus_tag LOCUS_06720 gene rimP 63267 62812 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7L7 protein_id gnl|my_center|LOCUS_06720 63664 63588 gene locus_tag LOCUS_t00080 63664 63588 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 64000 64464 gene locus_tag LOCUS_06730 64000 64464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence012 <1 1025 gene locus_tag LOCUS_06740 <1 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5DZH8:adenosylmethionine-8-amino-7-oxononanoate aminotransferase 1514 1080 gene locus_tag LOCUS_06750 1514 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072037.1 protein_id gnl|my_center|LOCUS_06750 1802 3199 gene locus_tag LOCUS_06760 gene asnS 1802 3199 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NH5 protein_id gnl|my_center|LOCUS_06760 3369 4910 gene locus_tag LOCUS_06770 3369 4910 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114989.1 protein_id gnl|my_center|LOCUS_06770 5108 6250 gene locus_tag LOCUS_06780 5108 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945912.1 protein_id gnl|my_center|LOCUS_06780 6615 7052 gene locus_tag LOCUS_06790 6615 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 8300 7449 gene locus_tag LOCUS_06800 8300 7449 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118789.1 protein_id gnl|my_center|LOCUS_06800 9320 8559 gene locus_tag LOCUS_06810 gene ivdG 9320 8559 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071833.1 protein_id gnl|my_center|LOCUS_06810 10214 9324 gene locus_tag LOCUS_06820 gene ivdF 10214 9324 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGC2 protein_id gnl|my_center|LOCUS_06820 11364 10219 gene locus_tag LOCUS_06830 gene ivdE 11364 10219 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071831.1 protein_id gnl|my_center|LOCUS_06830 12143 11364 gene locus_tag LOCUS_06840 gene ivdD 12143 11364 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071830.1 protein_id gnl|my_center|LOCUS_06840 13311 12154 gene locus_tag LOCUS_06850 gene ivdC 13311 12154 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071829.1 protein_id gnl|my_center|LOCUS_06850 14926 13436 gene locus_tag LOCUS_06860 gene ivdB 14926 13436 CDS product methylmalonate-semialdehyde dehydrogenase (acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071828.1 protein_id gnl|my_center|LOCUS_06860 16197 15016 gene locus_tag LOCUS_06870 gene ivdA 16197 15016 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071827.1 protein_id gnl|my_center|LOCUS_06870 16526 16960 gene locus_tag LOCUS_06880 gene liuR 16526 16960 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072005.1 protein_id gnl|my_center|LOCUS_06880 17024 18199 gene locus_tag LOCUS_06890 gene liuA 17024 18199 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072004.1 protein_id gnl|my_center|LOCUS_06890 18211 19818 gene locus_tag LOCUS_06900 gene liuB 18211 19818 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072003.1 protein_id gnl|my_center|LOCUS_06900 19829 20599 gene locus_tag LOCUS_06910 19829 20599 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106425.1 protein_id gnl|my_center|LOCUS_06910 20608 22584 gene locus_tag LOCUS_06920 gene liuD 20608 22584 CDS product 3-methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072001.1 protein_id gnl|my_center|LOCUS_06920 22577 23488 gene locus_tag LOCUS_06930 22577 23488 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106427.1 protein_id gnl|my_center|LOCUS_06930 23543 24241 gene locus_tag LOCUS_06940 gene dhcA 23543 24241 CDS product dehydrocarnitine CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088566.1 protein_id gnl|my_center|LOCUS_06940 24254 24910 gene locus_tag LOCUS_06950 gene liuG 24254 24910 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071998.1 protein_id gnl|my_center|LOCUS_06950 25272 26150 gene locus_tag LOCUS_06960 gene gcvA 25272 26150 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417875.1 protein_id gnl|my_center|LOCUS_06960 27596 26304 gene locus_tag LOCUS_06970 27596 26304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 27764 29281 gene locus_tag LOCUS_06980 gene pepA1 27764 29281 CDS product putative cytosol aminopeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI85 protein_id gnl|my_center|LOCUS_06980 29579 30247 gene locus_tag LOCUS_06990 29579 30247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097549.1 protein_id gnl|my_center|LOCUS_06990 30244 31179 gene locus_tag LOCUS_07000 30244 31179 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197226.1 protein_id gnl|my_center|LOCUS_07000 31242 31946 gene locus_tag LOCUS_07010 31242 31946 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096573.1 protein_id gnl|my_center|LOCUS_07010 31946 32971 gene locus_tag LOCUS_07020 31946 32971 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096574.1 protein_id gnl|my_center|LOCUS_07020 32964 33632 gene locus_tag LOCUS_07030 gene pcp 32964 33632 CDS product pyrrolidone-carboxylate peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JR34 protein_id gnl|my_center|LOCUS_07030 33787 35460 gene locus_tag LOCUS_07040 gene asnB 33787 35460 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 protein_id gnl|my_center|LOCUS_07040 35627 36292 gene locus_tag LOCUS_07050 35627 36292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 37051 36263 gene locus_tag LOCUS_07060 37051 36263 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073756.1 protein_id gnl|my_center|LOCUS_07060 38165 37194 gene locus_tag LOCUS_07070 38165 37194 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_07070 39397 38168 gene locus_tag LOCUS_07080 39397 38168 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551490.1 protein_id gnl|my_center|LOCUS_07080 39903 41483 gene locus_tag LOCUS_07090 gene betT 39903 41483 CDS product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262867.1 protein_id gnl|my_center|LOCUS_07090 42276 41566 gene locus_tag LOCUS_07100 42276 41566 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105985.1 protein_id gnl|my_center|LOCUS_07100 44175 42280 gene locus_tag LOCUS_07110 44175 42280 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421488.1 protein_id gnl|my_center|LOCUS_07110 47350 44270 gene locus_tag LOCUS_07120 47350 44270 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969721.1 protein_id gnl|my_center|LOCUS_07120 48318 47353 gene locus_tag LOCUS_07130 48318 47353 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969722.1 protein_id gnl|my_center|LOCUS_07130 48780 49121 gene locus_tag LOCUS_07140 48780 49121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 49617 50684 gene locus_tag LOCUS_07150 49617 50684 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973985.1 protein_id gnl|my_center|LOCUS_07150 52260 51253 gene locus_tag LOCUS_07160 52260 51253 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES8 protein_id gnl|my_center|LOCUS_07160 52476 53804 gene locus_tag LOCUS_07170 52476 53804 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072757.1 protein_id gnl|my_center|LOCUS_07170 53807 54637 gene locus_tag LOCUS_07180 53807 54637 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 protein_id gnl|my_center|LOCUS_07180 59037 54991 gene locus_tag LOCUS_07190 59037 54991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 59825 59379 gene locus_tag LOCUS_07200 59825 59379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 60535 60068 gene locus_tag LOCUS_07210 60535 60068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 60942 60649 gene locus_tag LOCUS_07220 60942 60649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence013 1241 426 gene locus_tag LOCUS_07230 1241 426 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_07230 1819 1352 gene locus_tag LOCUS_07240 1819 1352 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 protein_id gnl|my_center|LOCUS_07240 1975 2886 gene locus_tag LOCUS_07250 1975 2886 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_07250 3631 4680 gene locus_tag LOCUS_07260 3631 4680 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809346.1 protein_id gnl|my_center|LOCUS_07260 5204 4740 gene locus_tag LOCUS_07270 5204 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5686 8658 gene locus_tag LOCUS_07280 gene fecA 5686 8658 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037953.1 protein_id gnl|my_center|LOCUS_07280 8765 10300 gene locus_tag LOCUS_07290 8765 10300 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073349.1 protein_id gnl|my_center|LOCUS_07290 10308 11798 gene locus_tag LOCUS_07300 10308 11798 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918886.1 protein_id gnl|my_center|LOCUS_07300 14446 11870 gene locus_tag LOCUS_07310 gene celD 14446 11870 CDS product glucan 1,4-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637141.2 protein_id gnl|my_center|LOCUS_07310 14768 16096 gene locus_tag LOCUS_07320 14768 16096 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_07320 16140 17666 gene locus_tag LOCUS_07330 16140 17666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 17725 18726 gene locus_tag LOCUS_07340 17725 18726 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201011.1 protein_id gnl|my_center|LOCUS_07340 19730 18765 gene locus_tag LOCUS_07350 19730 18765 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073534.1 protein_id gnl|my_center|LOCUS_07350 19861 20808 gene locus_tag LOCUS_07360 19861 20808 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073535.1 protein_id gnl|my_center|LOCUS_07360 23775 20854 gene locus_tag LOCUS_07370 23775 20854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 24371 23862 gene locus_tag LOCUS_07380 24371 23862 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074064.1 protein_id gnl|my_center|LOCUS_07380 25336 24392 gene locus_tag LOCUS_07390 25336 24392 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705213.1 protein_id gnl|my_center|LOCUS_07390 25638 26807 gene locus_tag LOCUS_07400 25638 26807 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070805.1 protein_id gnl|my_center|LOCUS_07400 27290 26883 gene locus_tag LOCUS_07410 27290 26883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 28661 27549 gene locus_tag LOCUS_07420 28661 27549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 30361 28658 gene locus_tag LOCUS_07430 gene pvdE 30361 28658 CDS product pyoverdine biosynthesis protein PvdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103601.1 protein_id gnl|my_center|LOCUS_07430 30642 30469 gene locus_tag LOCUS_07440 30642 30469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 31287 30730 gene locus_tag LOCUS_07450 31287 30730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 32926 31559 gene locus_tag LOCUS_07460 32926 31559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 33976 33023 gene locus_tag LOCUS_07470 gene ambD 33976 33023 CDS product protein AmbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113096.1 protein_id gnl|my_center|LOCUS_07470 45604 34034 gene locus_tag LOCUS_07480 gene pvsA 45604 34034 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103865.1 protein_id gnl|my_center|LOCUS_07480 56172 46195 gene locus_tag LOCUS_07490 56172 46195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 <58914 56174 gene locus_tag LOCUS_07500 <58914 56174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105032.1:non-ribosomal peptide synthetase >Feature sequence014 485 2038 gene locus_tag LOCUS_07510 485 2038 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262057.1 protein_id gnl|my_center|LOCUS_07510 2154 3167 gene locus_tag LOCUS_07520 gene plcB 2154 3167 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111200.1 protein_id gnl|my_center|LOCUS_07520 3224 4357 gene locus_tag LOCUS_07530 3224 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 4354 4896 gene locus_tag LOCUS_07540 4354 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 5483 5037 gene locus_tag LOCUS_07550 gene ibpA 5483 5037 CDS product heat-shock protein IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072287.1 protein_id gnl|my_center|LOCUS_07550 5770 6267 gene locus_tag LOCUS_07560 5770 6267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 6391 8469 gene locus_tag LOCUS_07570 6391 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 8609 8872 gene locus_tag LOCUS_07580 gene grxA 8609 8872 CDS product glutaredoxin, GrxA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367533.1 protein_id gnl|my_center|LOCUS_07580 9033 10880 gene locus_tag LOCUS_07590 gene deaD 9033 10880 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSJ9 protein_id gnl|my_center|LOCUS_07590 12353 11040 gene locus_tag LOCUS_07600 12353 11040 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477129.1 protein_id gnl|my_center|LOCUS_07600 14066 12507 gene locus_tag LOCUS_07610 14066 12507 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070418.1 protein_id gnl|my_center|LOCUS_07610 14539 14228 gene locus_tag LOCUS_07620 14539 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 15655 14540 gene locus_tag LOCUS_07630 15655 14540 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_07630 16199 15645 gene locus_tag LOCUS_07640 16199 15645 CDS product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098148.1 protein_id gnl|my_center|LOCUS_07640 16565 17164 gene locus_tag LOCUS_07650 16565 17164 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021025.1 protein_id gnl|my_center|LOCUS_07650 17531 17178 gene locus_tag LOCUS_07660 17531 17178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 18216 17566 gene locus_tag LOCUS_07670 18216 17566 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070428.1 protein_id gnl|my_center|LOCUS_07670 18326 19171 gene locus_tag LOCUS_07680 18326 19171 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483391.1 protein_id gnl|my_center|LOCUS_07680 21189 19189 gene locus_tag LOCUS_07690 21189 19189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 22167 23327 gene locus_tag LOCUS_07700 22167 23327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 24506 23409 gene locus_tag LOCUS_07710 gene aroC 24506 23409 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKS7 protein_id gnl|my_center|LOCUS_07710 25509 24574 gene locus_tag LOCUS_07720 gene prmB 25509 24574 CDS product 50S ribosomal protein L3 glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKS8 protein_id gnl|my_center|LOCUS_07720 25657 26214 gene locus_tag LOCUS_07730 25657 26214 CDS product UPF0115 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK38 protein_id gnl|my_center|LOCUS_07730 26251 27174 gene locus_tag LOCUS_07740 26251 27174 CDS product malonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338408.1 protein_id gnl|my_center|LOCUS_07740 27915 27178 gene locus_tag LOCUS_07750 27915 27178 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116045.1 protein_id gnl|my_center|LOCUS_07750 29001 28423 gene locus_tag LOCUS_07760 29001 28423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 29619 29269 gene locus_tag LOCUS_07770 gene yoaB 29619 29269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 protein_id gnl|my_center|LOCUS_07770 30170 29694 gene locus_tag LOCUS_07780 gene sixA 30170 29694 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262337.1 protein_id gnl|my_center|LOCUS_07780 30351 33071 gene locus_tag LOCUS_07790 30351 33071 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894214.1 protein_id gnl|my_center|LOCUS_07790 33190 35361 gene locus_tag LOCUS_07800 33190 35361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 35561 35370 gene locus_tag LOCUS_07810 35561 35370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 36287 35715 gene locus_tag LOCUS_07820 36287 35715 CDS product elongation factor P-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5C9 protein_id gnl|my_center|LOCUS_07820 36490 36876 gene locus_tag LOCUS_07830 36490 36876 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_07830 37448 36930 gene locus_tag LOCUS_07840 37448 36930 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106219.1 protein_id gnl|my_center|LOCUS_07840 39887 37593 gene locus_tag LOCUS_07850 gene fadJ 39887 37593 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MM3 protein_id gnl|my_center|LOCUS_07850 41197 39887 gene locus_tag LOCUS_07860 gene fadI 41197 39887 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK76 protein_id gnl|my_center|LOCUS_07860 41483 42439 gene locus_tag LOCUS_07870 41483 42439 CDS product MoxR-like ATPase in aerotolerance operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072987.1 protein_id gnl|my_center|LOCUS_07870 42443 43387 gene locus_tag LOCUS_07880 42443 43387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072988.1 protein_id gnl|my_center|LOCUS_07880 43389 43826 gene locus_tag LOCUS_07890 43389 43826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 43819 44805 gene locus_tag LOCUS_07900 gene batA 43819 44805 CDS product VWR domain protein in aerotolerance operon BatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072990.1 protein_id gnl|my_center|LOCUS_07900 44805 46712 gene locus_tag LOCUS_07910 gene batB 44805 46712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072991.1 protein_id gnl|my_center|LOCUS_07910 46706 48352 gene locus_tag LOCUS_07920 gene batD 46706 48352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072992.1 protein_id gnl|my_center|LOCUS_07920 48423 48980 gene locus_tag LOCUS_07930 48423 48980 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK70 protein_id gnl|my_center|LOCUS_07930 48980 49783 gene locus_tag LOCUS_07940 48980 49783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072994.1 protein_id gnl|my_center|LOCUS_07940 49996 50835 gene locus_tag LOCUS_07950 49996 50835 CDS product preprotein translocase subunit Tim44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495957.1 protein_id gnl|my_center|LOCUS_07950 52138 50948 gene locus_tag LOCUS_07960 gene aspC 52138 50948 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH6 protein_id gnl|my_center|LOCUS_07960 52877 52218 gene locus_tag LOCUS_07970 52877 52218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 54589 52931 gene locus_tag LOCUS_07980 54589 52931 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268439.1 protein_id gnl|my_center|LOCUS_07980 54894 54589 gene locus_tag LOCUS_07990 54894 54589 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_07990 55052 55381 gene locus_tag LOCUS_08000 55052 55381 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309882.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence015 680 528 gene locus_tag LOCUS_08010 680 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 1104 625 gene locus_tag LOCUS_08020 1104 625 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQZ5 protein_id gnl|my_center|LOCUS_08020 1579 1145 gene locus_tag LOCUS_08030 1579 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2271 1804 gene locus_tag LOCUS_08040 2271 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2387 3679 gene locus_tag LOCUS_08050 gene yieG 2387 3679 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418149.1 protein_id gnl|my_center|LOCUS_08050 4781 4023 gene locus_tag LOCUS_08060 4781 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072596.1 protein_id gnl|my_center|LOCUS_08060 5099 6076 gene locus_tag LOCUS_08070 gene cysB 5099 6076 CDS product transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634254.1 protein_id gnl|my_center|LOCUS_08070 7512 6136 gene locus_tag LOCUS_08080 gene sdaA-2 7512 6136 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705997.1 protein_id gnl|my_center|LOCUS_08080 8205 7612 gene locus_tag LOCUS_08090 gene yeaB 8205 7612 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072244.1 protein_id gnl|my_center|LOCUS_08090 9557 8211 gene locus_tag LOCUS_08100 gene pabB 9557 8211 CDS product aminodeoxychorismate synthase, component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816166.1 protein_id gnl|my_center|LOCUS_08100 9723 11249 gene locus_tag LOCUS_08110 9723 11249 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NJ5 protein_id gnl|my_center|LOCUS_08110 11651 12691 gene locus_tag LOCUS_08120 gene ldh 11651 12691 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072585.1 protein_id gnl|my_center|LOCUS_08120 12785 13420 gene locus_tag LOCUS_08130 12785 13420 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 protein_id gnl|my_center|LOCUS_08130 13596 16490 gene locus_tag LOCUS_08140 13596 16490 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881117.1 protein_id gnl|my_center|LOCUS_08140 16660 17892 gene locus_tag LOCUS_08150 gene lasA 16660 17892 CDS product protease LasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14789 protein_id gnl|my_center|LOCUS_08150 18035 18859 gene locus_tag LOCUS_08160 18035 18859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_08160 18967 22149 gene locus_tag LOCUS_08170 18967 22149 CDS product bifunctional TolB-family protein/amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_08170 22940 22353 gene locus_tag LOCUS_08180 22940 22353 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071600.1 protein_id gnl|my_center|LOCUS_08180 23040 23513 gene locus_tag LOCUS_08190 23040 23513 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462762.1 protein_id gnl|my_center|LOCUS_08190 23918 23547 gene locus_tag LOCUS_08200 23918 23547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 24069 24821 gene locus_tag LOCUS_08210 24069 24821 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM26 protein_id gnl|my_center|LOCUS_08210 25620 24856 gene locus_tag LOCUS_08220 25620 24856 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881501.1 protein_id gnl|my_center|LOCUS_08220 26560 25673 gene locus_tag LOCUS_08230 26560 25673 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571234.1 protein_id gnl|my_center|LOCUS_08230 26850 28745 gene locus_tag LOCUS_08240 gene metE 26850 28745 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NFD2 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08240 28762 29136 gene locus_tag LOCUS_08250 28762 29136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08250 29322 29176 gene locus_tag LOCUS_08260 29322 29176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 29919 29377 gene locus_tag LOCUS_08270 29919 29377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 30158 30754 gene locus_tag LOCUS_08280 gene mlaC 30158 30754 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073690.1 protein_id gnl|my_center|LOCUS_08280 31015 32352 gene locus_tag LOCUS_08290 31015 32352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 32948 32484 gene locus_tag LOCUS_08300 32948 32484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 33499 32945 gene locus_tag LOCUS_08310 33499 32945 CDS product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207725.1 protein_id gnl|my_center|LOCUS_08310 33846 33499 gene locus_tag LOCUS_08320 33846 33499 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MH6 protein_id gnl|my_center|LOCUS_08320 35361 33901 gene locus_tag LOCUS_08330 gene yfgC 35361 33901 CDS product putative beta-barrel assembly-enhancing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED93 protein_id gnl|my_center|LOCUS_08330 36028 35363 gene locus_tag LOCUS_08340 36028 35363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 36165 36383 gene locus_tag LOCUS_08350 36165 36383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 36376 37449 gene locus_tag LOCUS_08360 36376 37449 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457764.1 protein_id gnl|my_center|LOCUS_08360 37613 39877 gene locus_tag LOCUS_08370 37613 39877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 40987 39959 gene locus_tag LOCUS_08380 gene nagR 40987 39959 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073351.1 protein_id gnl|my_center|LOCUS_08380 41337 42983 gene locus_tag LOCUS_08390 gene pgi 41337 42983 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM2 protein_id gnl|my_center|LOCUS_08390 43285 44757 gene locus_tag LOCUS_08400 gene zwf 43285 44757 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U679 protein_id gnl|my_center|LOCUS_08400 44760 45470 gene locus_tag LOCUS_08410 gene pgl 44760 45470 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072453.1 protein_id gnl|my_center|LOCUS_08410 46485 49136 gene locus_tag LOCUS_08420 gene fyuA 46485 49136 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038506.1 protein_id gnl|my_center|LOCUS_08420 50188 49187 gene locus_tag LOCUS_08430 50188 49187 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918885.1 protein_id gnl|my_center|LOCUS_08430 50252 50950 gene locus_tag LOCUS_08440 50252 50950 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918104.1 protein_id gnl|my_center|LOCUS_08440 51305 52009 gene locus_tag LOCUS_08450 51305 52009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 52214 53167 gene locus_tag LOCUS_08460 gene iaaA 52214 53167 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_08460 53367 53200 gene locus_tag LOCUS_08470 53367 53200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 53632 53360 gene locus_tag LOCUS_08480 53632 53360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 54573 53671 gene locus_tag LOCUS_08490 54573 53671 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071936.1 protein_id gnl|my_center|LOCUS_08490 55196 54576 gene locus_tag LOCUS_08500 55196 54576 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071938.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence016 411 250 gene locus_tag LOCUS_08510 411 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 523 2595 gene locus_tag LOCUS_08520 523 2595 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071387.1 protein_id gnl|my_center|LOCUS_08520 2585 3730 gene locus_tag LOCUS_08530 2585 3730 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071388.1 protein_id gnl|my_center|LOCUS_08530 4071 3760 gene locus_tag LOCUS_08540 4071 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 4130 6403 gene locus_tag LOCUS_08550 4130 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 6417 7358 gene locus_tag LOCUS_08560 6417 7358 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTA8 protein_id gnl|my_center|LOCUS_08560 7355 8233 gene locus_tag LOCUS_08570 7355 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 8722 8279 gene locus_tag LOCUS_08580 gene ntpA 8722 8279 CDS product NUDIX pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002240378.1 protein_id gnl|my_center|LOCUS_08580 9516 8788 gene locus_tag LOCUS_08590 9516 8788 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MIK9 protein_id gnl|my_center|LOCUS_08590 10234 9545 gene locus_tag LOCUS_08600 10234 9545 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036904.1 protein_id gnl|my_center|LOCUS_08600 11247 10351 gene locus_tag LOCUS_08610 11247 10351 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402385.1 protein_id gnl|my_center|LOCUS_08610 13093 11240 gene locus_tag LOCUS_08620 13093 11240 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141343.1 protein_id gnl|my_center|LOCUS_08620 13997 13146 gene locus_tag LOCUS_08630 13997 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039958.1 protein_id gnl|my_center|LOCUS_08630 15334 14444 gene locus_tag LOCUS_08640 15334 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070552.1 protein_id gnl|my_center|LOCUS_08640 17958 15562 gene locus_tag LOCUS_08650 17958 15562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 19118 18276 gene locus_tag LOCUS_08660 19118 18276 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 protein_id gnl|my_center|LOCUS_08660 19658 19155 gene locus_tag LOCUS_08670 19658 19155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479631.1 protein_id gnl|my_center|LOCUS_08670 20290 19658 gene locus_tag LOCUS_08680 20290 19658 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037903.1 protein_id gnl|my_center|LOCUS_08680 20762 20367 gene locus_tag LOCUS_08690 20762 20367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385268.1 protein_id gnl|my_center|LOCUS_08690 22359 21061 gene locus_tag LOCUS_08700 22359 21061 CDS product outer membrane beta barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071616.1 protein_id gnl|my_center|LOCUS_08700 22972 22478 gene locus_tag LOCUS_08710 22972 22478 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 protein_id gnl|my_center|LOCUS_08710 23308 24159 gene locus_tag LOCUS_08720 23308 24159 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072706.1 protein_id gnl|my_center|LOCUS_08720 24228 24800 gene locus_tag LOCUS_08730 24228 24800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 24793 26328 gene locus_tag LOCUS_08740 24793 26328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 26471 29314 gene locus_tag LOCUS_08750 26471 29314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 30494 29349 gene locus_tag LOCUS_08760 30494 29349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 31617 30541 gene locus_tag LOCUS_08770 31617 30541 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267342.1 protein_id gnl|my_center|LOCUS_08770 31981 32595 gene locus_tag LOCUS_08780 31981 32595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 32677 33465 gene locus_tag LOCUS_08790 32677 33465 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482609.1 protein_id gnl|my_center|LOCUS_08790 34711 33470 gene locus_tag LOCUS_08800 34711 33470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 36098 34698 gene locus_tag LOCUS_08810 36098 34698 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794226.1 protein_id gnl|my_center|LOCUS_08810 38559 36064 gene locus_tag LOCUS_08820 38559 36064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 39248 38556 gene locus_tag LOCUS_08830 39248 38556 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_08830 40516 39260 gene locus_tag LOCUS_08840 40516 39260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 40532 40714 gene locus_tag LOCUS_08850 40532 40714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 43231 40715 gene locus_tag LOCUS_08860 43231 40715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403224.1 protein_id gnl|my_center|LOCUS_08860 43520 44698 gene locus_tag LOCUS_08870 43520 44698 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106254.1 protein_id gnl|my_center|LOCUS_08870 44714 47845 gene locus_tag LOCUS_08880 44714 47845 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479898.1 protein_id gnl|my_center|LOCUS_08880 48442 48930 gene locus_tag LOCUS_08890 48442 48930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 49033 51108 gene locus_tag LOCUS_08900 49033 51108 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459357.1 protein_id gnl|my_center|LOCUS_08900 51157 51555 gene locus_tag LOCUS_08910 51157 51555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 52029 51556 gene locus_tag LOCUS_08920 52029 51556 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705037.1 protein_id gnl|my_center|LOCUS_08920 52379 52588 gene locus_tag LOCUS_08930 52379 52588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 53181 52585 gene locus_tag LOCUS_08940 53181 52585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477309.1 protein_id gnl|my_center|LOCUS_08940 53746 53210 gene locus_tag LOCUS_08950 53746 53210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706014.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence017 1296 814 gene locus_tag LOCUS_08960 1296 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2273 1284 gene locus_tag LOCUS_08970 gene pilW 2273 1284 CDS product type IV minor pilin protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073360.1 protein_id gnl|my_center|LOCUS_08970 2835 2275 gene locus_tag LOCUS_08980 2835 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3670 2969 gene locus_tag LOCUS_08990 gene algR 3670 2969 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247212.1 protein_id gnl|my_center|LOCUS_08990 4707 3667 gene locus_tag LOCUS_09000 4707 3667 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247213.1 protein_id gnl|my_center|LOCUS_09000 5675 4746 gene locus_tag LOCUS_09010 gene ispH 5675 4746 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG42 protein_id gnl|my_center|LOCUS_09010 6133 5675 gene locus_tag LOCUS_09020 gene fkpB 6133 5675 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG41 protein_id gnl|my_center|LOCUS_09020 6630 6130 gene locus_tag LOCUS_09030 gene lspA 6630 6130 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJE2 protein_id gnl|my_center|LOCUS_09030 9468 6640 gene locus_tag LOCUS_09040 gene ileS 9468 6640 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7N4 protein_id gnl|my_center|LOCUS_09040 10420 9494 gene locus_tag LOCUS_09050 gene ribF 10420 9494 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBI3 protein_id gnl|my_center|LOCUS_09050 12110 10530 gene locus_tag LOCUS_09060 12110 10530 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S92 protein_id gnl|my_center|LOCUS_09060 12366 12626 gene locus_tag LOCUS_09070 gene rpsT 12366 12626 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S93 protein_id gnl|my_center|LOCUS_09070 13102 12719 gene locus_tag LOCUS_09080 gene cheY 13102 12719 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AE67 protein_id gnl|my_center|LOCUS_09080 13212 13661 gene locus_tag LOCUS_09090 13212 13661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 14141 14719 gene locus_tag LOCUS_09100 14141 14719 CDS product Smr domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704977.1 protein_id gnl|my_center|LOCUS_09100 14881 14750 gene locus_tag LOCUS_09110 14881 14750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 15900 14980 gene locus_tag LOCUS_09120 15900 14980 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_09120 16070 17782 gene locus_tag LOCUS_09130 16070 17782 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_09130 18135 19559 gene locus_tag LOCUS_09140 18135 19559 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705253.1 protein_id gnl|my_center|LOCUS_09140 19579 20286 gene locus_tag LOCUS_09150 gene rstA 19579 20286 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_09150 21081 20410 gene locus_tag LOCUS_09160 21081 20410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 22496 21309 gene locus_tag LOCUS_09170 gene dapE 22496 21309 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN61 protein_id gnl|my_center|LOCUS_09170 24196 22778 gene locus_tag LOCUS_09180 24196 22778 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868530.1 protein_id gnl|my_center|LOCUS_09180 24434 25087 gene locus_tag LOCUS_09190 gene oprG 24434 25087 CDS product outer membrane protein OprG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093337.1 protein_id gnl|my_center|LOCUS_09190 25670 25134 gene locus_tag LOCUS_09200 25670 25134 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074286.1 protein_id gnl|my_center|LOCUS_09200 25782 26270 gene locus_tag LOCUS_09210 25782 26270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 27854 26298 gene locus_tag LOCUS_09220 gene tyrR 27854 26298 CDS product TyrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705761.1 protein_id gnl|my_center|LOCUS_09220 28107 30332 gene locus_tag LOCUS_09230 28107 30332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 30358 32349 gene locus_tag LOCUS_09240 30358 32349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 32342 35458 gene locus_tag LOCUS_09250 32342 35458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 35445 37718 gene locus_tag LOCUS_09260 35445 37718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 37702 38472 gene locus_tag LOCUS_09270 37702 38472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 38550 42797 gene locus_tag LOCUS_09280 38550 42797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 42799 46911 gene locus_tag LOCUS_09290 42799 46911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 47225 48439 gene locus_tag LOCUS_09300 47225 48439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 48857 50287 gene locus_tag LOCUS_09310 48857 50287 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707249.1 protein_id gnl|my_center|LOCUS_09310 50912 51958 gene locus_tag LOCUS_09320 gene hppD 50912 51958 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072057.1 protein_id gnl|my_center|LOCUS_09320 52112 53425 gene locus_tag LOCUS_09330 gene fahA 52112 53425 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818932.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence018 1493 879 gene locus_tag LOCUS_09340 gene yadS 1493 879 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420789.1 protein_id gnl|my_center|LOCUS_09340 2896 1610 gene locus_tag LOCUS_09350 2896 1610 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704205.1 protein_id gnl|my_center|LOCUS_09350 2909 3952 gene locus_tag LOCUS_09360 2909 3952 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_09360 5048 4017 gene locus_tag LOCUS_09370 gene cheB 5048 4017 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z5V2 protein_id gnl|my_center|LOCUS_09370 5676 5059 gene locus_tag LOCUS_09380 gene cheD1 5676 5059 CDS product putative chemoreceptor glutamine deamidase CheD 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF62 protein_id gnl|my_center|LOCUS_09380 6490 5669 gene locus_tag LOCUS_09390 gene cheR 6490 5669 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7D1A6 protein_id gnl|my_center|LOCUS_09390 9299 6612 gene locus_tag LOCUS_09400 9299 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 9832 9347 gene locus_tag LOCUS_09410 9832 9347 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083938.1 protein_id gnl|my_center|LOCUS_09410 11931 9829 gene locus_tag LOCUS_09420 11931 9829 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_09420 12309 11947 gene locus_tag LOCUS_09430 gene cheY 12309 11947 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_09430 12624 12319 gene locus_tag LOCUS_09440 12624 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 13397 12762 gene locus_tag LOCUS_09450 13397 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 14290 13382 gene locus_tag LOCUS_09460 gene cyoE1 14290 13382 CDS product protoheme IX farnesyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87IR2 protein_id gnl|my_center|LOCUS_09460 15288 14299 gene locus_tag LOCUS_09470 gene ctaA 15288 14299 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_09470 15800 15306 gene locus_tag LOCUS_09480 15800 15306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 16537 15797 gene locus_tag LOCUS_09490 16537 15797 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q0 protein_id gnl|my_center|LOCUS_09490 16550 16864 gene locus_tag LOCUS_09500 16550 16864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 17639 16764 gene locus_tag LOCUS_09510 gene coxC 17639 16764 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074205.1 protein_id gnl|my_center|LOCUS_09510 18202 17675 gene locus_tag LOCUS_09520 gene ctaG 18202 17675 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_09520 19800 18202 gene locus_tag LOCUS_09530 gene coxA 19800 18202 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8Q4 protein_id gnl|my_center|LOCUS_09530 20942 19800 gene locus_tag LOCUS_09540 20942 19800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 21981 21364 gene locus_tag LOCUS_09550 gene lexA 21981 21364 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q44069 protein_id gnl|my_center|LOCUS_09550 23138 22269 gene locus_tag LOCUS_09560 23138 22269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 24868 23138 gene locus_tag LOCUS_09570 24868 23138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 26890 24884 gene locus_tag LOCUS_09580 gene hsdS 26890 24884 CDS product type I restriction endonuclease EcoAI subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110093.1 protein_id gnl|my_center|LOCUS_09580 28680 26890 gene locus_tag LOCUS_09590 28680 26890 CDS product restriction endonuclease EcoEI subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387312.1 protein_id gnl|my_center|LOCUS_09590 31147 28709 gene locus_tag LOCUS_09600 31147 28709 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_09600 32085 31165 gene locus_tag LOCUS_09610 32085 31165 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257720.1 protein_id gnl|my_center|LOCUS_09610 32269 32099 gene locus_tag LOCUS_09620 32269 32099 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263390.1 protein_id gnl|my_center|LOCUS_09620 32458 32589 gene locus_tag LOCUS_09630 32458 32589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 32642 33301 gene locus_tag LOCUS_09640 32642 33301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 34117 34434 gene locus_tag LOCUS_09650 34117 34434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 34457 34723 gene locus_tag LOCUS_09660 34457 34723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 35917 34841 gene locus_tag LOCUS_09670 35917 34841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 36603 37223 gene locus_tag LOCUS_09680 36603 37223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 37282 37536 gene locus_tag LOCUS_09690 37282 37536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 37523 39457 gene locus_tag LOCUS_09700 37523 39457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 39460 40416 gene locus_tag LOCUS_09710 39460 40416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 40406 42082 gene locus_tag LOCUS_09720 40406 42082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 43087 42326 gene locus_tag LOCUS_09730 43087 42326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 43248 43691 gene locus_tag LOCUS_09740 43248 43691 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071322.1 protein_id gnl|my_center|LOCUS_09740 44098 43688 gene locus_tag LOCUS_09750 44098 43688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 44236 44952 gene locus_tag LOCUS_09760 44236 44952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 45065 45718 gene locus_tag LOCUS_09770 45065 45718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 46967 45786 gene locus_tag LOCUS_09780 gene hmp 46967 45786 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMY3 protein_id gnl|my_center|LOCUS_09780 48096 46978 gene locus_tag LOCUS_09790 48096 46978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_09790 48377 49945 gene locus_tag LOCUS_09800 48377 49945 CDS product regulatory protein LuxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155015.1 protein_id gnl|my_center|LOCUS_09800 50180 51229 gene locus_tag LOCUS_09810 gene rsgA2 50180 51229 CDS product putative ribosome biogenesis GTPase RsgA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FP9 protein_id gnl|my_center|LOCUS_09810 52209 51313 gene locus_tag LOCUS_09820 52209 51313 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721410.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence019 1226 24 gene locus_tag LOCUS_09830 gene argG 1226 24 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59605 protein_id gnl|my_center|LOCUS_09830 2157 1237 gene locus_tag LOCUS_09840 gene argF-1 2157 1237 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFV2 protein_id gnl|my_center|LOCUS_09840 2926 2165 gene locus_tag LOCUS_09850 gene argB 2926 2165 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFV1 protein_id gnl|my_center|LOCUS_09850 3937 2933 gene locus_tag LOCUS_09860 gene argC 3937 2933 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFV0 protein_id gnl|my_center|LOCUS_09860 4152 5300 gene locus_tag LOCUS_09870 gene argE 4152 5300 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFU9 protein_id gnl|my_center|LOCUS_09870 6989 5361 gene locus_tag LOCUS_09880 6989 5361 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071894.1 protein_id gnl|my_center|LOCUS_09880 7149 6958 gene locus_tag LOCUS_09890 7149 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 7263 9146 gene locus_tag LOCUS_09900 7263 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 9882 9202 gene locus_tag LOCUS_09910 9882 9202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 10649 9882 gene locus_tag LOCUS_09920 gene yadH 10649 9882 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2T0 protein_id gnl|my_center|LOCUS_09920 11582 10650 gene locus_tag LOCUS_09930 11582 10650 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073574.1 protein_id gnl|my_center|LOCUS_09930 12202 11582 gene locus_tag LOCUS_09940 gene ubiX 12202 11582 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP38 protein_id gnl|my_center|LOCUS_09940 13570 12215 gene locus_tag LOCUS_09950 gene mpl 13570 12215 CDS product UDP-N-acetylmuramate--L-alanyl-gamma-D-glutamyl-meso-2,6-diaminoheptandioate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP37 protein_id gnl|my_center|LOCUS_09950 14133 17066 gene locus_tag LOCUS_09960 gene btuB 14133 17066 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037702.1 protein_id gnl|my_center|LOCUS_09960 17947 17147 gene locus_tag LOCUS_09970 gene uppP 17947 17147 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K6 protein_id gnl|my_center|LOCUS_09970 18432 17944 gene locus_tag LOCUS_09980 18432 17944 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071505.1 protein_id gnl|my_center|LOCUS_09980 18790 18434 gene locus_tag LOCUS_09990 gene folB 18790 18434 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHD5 protein_id gnl|my_center|LOCUS_09990 19060 19674 gene locus_tag LOCUS_10000 gene plsY 19060 19674 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUJ7 protein_id gnl|my_center|LOCUS_10000 20690 19677 gene locus_tag LOCUS_10010 gene tsaD 20690 19677 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGI3 protein_id gnl|my_center|LOCUS_10010 21353 20763 gene locus_tag LOCUS_10020 21353 20763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073305.1 protein_id gnl|my_center|LOCUS_10020 21702 21346 gene locus_tag LOCUS_10030 21702 21346 CDS product zinc-finger-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073005.1 protein_id gnl|my_center|LOCUS_10030 21779 22186 gene locus_tag LOCUS_10040 21779 22186 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_10040 22237 23760 gene locus_tag LOCUS_10050 22237 23760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 protein_id gnl|my_center|LOCUS_10050 23881 24768 gene locus_tag LOCUS_10060 23881 24768 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989930.1 protein_id gnl|my_center|LOCUS_10060 24887 25507 gene locus_tag LOCUS_10070 24887 25507 CDS product SM-20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454888.1 protein_id gnl|my_center|LOCUS_10070 26388 25510 gene locus_tag LOCUS_10080 gene ubiA 26388 25510 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83IP7 protein_id gnl|my_center|LOCUS_10080 26930 26385 gene locus_tag LOCUS_10090 gene ubiC 26930 26385 CDS product putative chorismate pyruvate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKG2 protein_id gnl|my_center|LOCUS_10090 27085 27492 gene locus_tag LOCUS_10100 27085 27492 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070537.1 protein_id gnl|my_center|LOCUS_10100 28335 27514 gene locus_tag LOCUS_10110 gene glpG 28335 27514 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074262.1 protein_id gnl|my_center|LOCUS_10110 28649 28332 gene locus_tag LOCUS_10120 gene glpE 28649 28332 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMI9 protein_id gnl|my_center|LOCUS_10120 29741 28716 gene locus_tag LOCUS_10130 gene tdh 29741 28716 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J1 protein_id gnl|my_center|LOCUS_10130 30992 29796 gene locus_tag LOCUS_10140 gene kbl 30992 29796 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8J0 protein_id gnl|my_center|LOCUS_10140 31701 31147 gene locus_tag LOCUS_10150 gene gmhB 31701 31147 CDS product D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z989 protein_id gnl|my_center|LOCUS_10150 32756 31698 gene locus_tag LOCUS_10160 gene waaC 32756 31698 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074269.1 protein_id gnl|my_center|LOCUS_10160 32885 33607 gene locus_tag LOCUS_10170 gene kdkA 32885 33607 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEC7 protein_id gnl|my_center|LOCUS_10170 35050 33611 gene locus_tag LOCUS_10180 gene hldE 35050 33611 CDS product bifunctional protein HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAZ2 protein_id gnl|my_center|LOCUS_10180 35640 35050 gene locus_tag LOCUS_10190 gene gmhA 35640 35050 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67054 protein_id gnl|my_center|LOCUS_10190 37074 35674 gene locus_tag LOCUS_10200 37074 35674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 37282 38580 gene locus_tag LOCUS_10210 37282 38580 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891584.1 protein_id gnl|my_center|LOCUS_10210 38573 39136 gene locus_tag LOCUS_10220 38573 39136 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 protein_id gnl|my_center|LOCUS_10220 39499 39164 gene locus_tag LOCUS_10230 39499 39164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072130.1 protein_id gnl|my_center|LOCUS_10230 39691 39509 gene locus_tag LOCUS_10240 39691 39509 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096771.1 protein_id gnl|my_center|LOCUS_10240 42149 39684 gene locus_tag LOCUS_10250 42149 39684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 46206 42322 gene locus_tag LOCUS_10260 gene purL 46206 42322 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTN2 protein_id gnl|my_center|LOCUS_10260 46460 47980 gene locus_tag LOCUS_10270 gene mltF 46460 47980 CDS product membrane-bound lytic murein transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E750 protein_id gnl|my_center|LOCUS_10270 48115 48282 gene locus_tag LOCUS_10280 48115 48282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 48782 48279 gene locus_tag LOCUS_10290 gene tadA 48782 48279 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FIL3 protein_id gnl|my_center|LOCUS_10290 48962 50266 gene locus_tag LOCUS_10300 gene gsk 48962 50266 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671574.1 protein_id gnl|my_center|LOCUS_10300 51210 50287 gene locus_tag LOCUS_10310 gene glsA 51210 50287 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I387 protein_id gnl|my_center|LOCUS_10310 >Feature sequence020 <1 504 gene locus_tag LOCUS_10320 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071943.1:TonB-dependent receptor 1175 570 gene locus_tag LOCUS_10330 1175 570 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381738.1 protein_id gnl|my_center|LOCUS_10330 2162 1449 gene locus_tag LOCUS_10340 gene fadR 2162 1449 CDS product fatty acid metabolism regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL07 protein_id gnl|my_center|LOCUS_10340 2582 4165 gene locus_tag LOCUS_10350 gene nhaB 2582 4165 CDS product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED79 protein_id gnl|my_center|LOCUS_10350 4410 4162 gene locus_tag LOCUS_10360 4410 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 4412 4801 gene locus_tag LOCUS_10370 gene dsbB 4412 4801 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4B6 protein_id gnl|my_center|LOCUS_10370 4801 5103 gene locus_tag LOCUS_10380 4801 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5416 5120 gene locus_tag LOCUS_10390 5416 5120 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105744.1 protein_id gnl|my_center|LOCUS_10390 5678 5992 gene locus_tag LOCUS_10400 5678 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816169.1 protein_id gnl|my_center|LOCUS_10400 7584 6061 gene locus_tag LOCUS_10410 7584 6061 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110305.1 protein_id gnl|my_center|LOCUS_10410 7950 9173 gene locus_tag LOCUS_10420 7950 9173 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459985.1 protein_id gnl|my_center|LOCUS_10420 9974 9243 gene locus_tag LOCUS_10430 gene vacJ 9974 9243 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262344.1 protein_id gnl|my_center|LOCUS_10430 11264 9984 gene locus_tag LOCUS_10440 gene vacJ 11264 9984 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815901.1 protein_id gnl|my_center|LOCUS_10440 11726 11265 gene locus_tag LOCUS_10450 gene ccmH 11726 11265 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262346.1 protein_id gnl|my_center|LOCUS_10450 12295 11723 gene locus_tag LOCUS_10460 gene dsbE 12295 11723 CDS product thiol:disulfide interchange protein DsbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298853.1 protein_id gnl|my_center|LOCUS_10460 14259 12292 gene locus_tag LOCUS_10470 gene ccmF 14259 12292 CDS product c-type cytochrome biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420290.1 protein_id gnl|my_center|LOCUS_10470 14740 14261 gene locus_tag LOCUS_10480 gene ccmE 14740 14261 CDS product cytochrome c-type biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI35 protein_id gnl|my_center|LOCUS_10480 14940 14737 gene locus_tag LOCUS_10490 14940 14737 CDS product heme exporter protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI34 protein_id gnl|my_center|LOCUS_10490 15680 14943 gene locus_tag LOCUS_10500 gene ccmC 15680 14943 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705299.1 protein_id gnl|my_center|LOCUS_10500 16368 15682 gene locus_tag LOCUS_10510 gene ccmB 16368 15682 CDS product heme exporter protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJZ3 protein_id gnl|my_center|LOCUS_10510 16901 16368 gene locus_tag LOCUS_10520 gene ccmA 16901 16368 CDS product cytochrome c biogenesis ATP-binding export protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3S7 protein_id gnl|my_center|LOCUS_10520 17091 19775 gene locus_tag LOCUS_10530 17091 19775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 19779 20087 gene locus_tag LOCUS_10540 19779 20087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073086.1 protein_id gnl|my_center|LOCUS_10540 20505 20101 gene locus_tag LOCUS_10550 20505 20101 CDS product DUF2802 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073087.1 protein_id gnl|my_center|LOCUS_10550 21019 20522 gene locus_tag LOCUS_10560 21019 20522 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438733.1 protein_id gnl|my_center|LOCUS_10560 21836 21039 gene locus_tag LOCUS_10570 21836 21039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 22610 21840 gene locus_tag LOCUS_10580 22610 21840 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073090.1 protein_id gnl|my_center|LOCUS_10580 23578 22619 gene locus_tag LOCUS_10590 23578 22619 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705293.1 protein_id gnl|my_center|LOCUS_10590 24348 23584 gene locus_tag LOCUS_10600 gene motC 24348 23584 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083089.1 protein_id gnl|my_center|LOCUS_10600 25471 24341 gene locus_tag LOCUS_10610 gene cheB1 25471 24341 CDS product chemotaxis response regulator protein-glutamate methylesterase of group 1 operon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQD8 protein_id gnl|my_center|LOCUS_10610 27738 25540 gene locus_tag LOCUS_10620 gene cheA-2 27738 25540 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705290.1 protein_id gnl|my_center|LOCUS_10620 28517 27753 gene locus_tag LOCUS_10630 gene cheZ 28517 27753 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI22 protein_id gnl|my_center|LOCUS_10630 28918 28535 gene locus_tag LOCUS_10640 gene cheY 28918 28535 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 protein_id gnl|my_center|LOCUS_10640 29693 28959 gene locus_tag LOCUS_10650 gene fliA 29693 28959 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD3 protein_id gnl|my_center|LOCUS_10650 30556 29696 gene locus_tag LOCUS_10660 gene flhG 30556 29696 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECD2 protein_id gnl|my_center|LOCUS_10660 32030 30549 gene locus_tag LOCUS_10670 gene flhF 32030 30549 CDS product flagellar biosynthesis regulator FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262353.1 protein_id gnl|my_center|LOCUS_10670 34162 32054 gene locus_tag LOCUS_10680 gene flhA 34162 32054 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073098.1 protein_id gnl|my_center|LOCUS_10680 35388 34258 gene locus_tag LOCUS_10690 gene flhB 35388 34258 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073099.1 protein_id gnl|my_center|LOCUS_10690 36177 35398 gene locus_tag LOCUS_10700 gene fliR 36177 35398 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC7 protein_id gnl|my_center|LOCUS_10700 36448 36179 gene locus_tag LOCUS_10710 gene fliQ 36448 36179 CDS product flagellar export apparatus protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073101.1 protein_id gnl|my_center|LOCUS_10710 37232 36492 gene locus_tag LOCUS_10720 gene fliP 37232 36492 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECC5 protein_id gnl|my_center|LOCUS_10720 37620 37237 gene locus_tag LOCUS_10730 37620 37237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 38015 37617 gene locus_tag LOCUS_10740 38015 37617 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79YW6 protein_id gnl|my_center|LOCUS_10740 39129 38038 gene locus_tag LOCUS_10750 gene fliM 39129 38038 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI10 protein_id gnl|my_center|LOCUS_10750 39669 39139 gene locus_tag LOCUS_10760 gene fliL 39669 39139 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705278.1 protein_id gnl|my_center|LOCUS_10760 42165 39772 gene locus_tag LOCUS_10770 42165 39772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 42739 42293 gene locus_tag LOCUS_10780 42739 42293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 44073 42739 gene locus_tag LOCUS_10790 gene fliI 44073 42739 CDS product flagellum-specific ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 protein_id gnl|my_center|LOCUS_10790 44910 44092 gene locus_tag LOCUS_10800 gene fliH 44910 44092 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481084.1 protein_id gnl|my_center|LOCUS_10800 45954 44914 gene locus_tag LOCUS_10810 gene fliG 45954 44914 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB6 protein_id gnl|my_center|LOCUS_10810 47662 45947 gene locus_tag LOCUS_10820 gene fliF 47662 45947 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB5 protein_id gnl|my_center|LOCUS_10820 48015 47683 gene locus_tag LOCUS_10830 gene fliE 48015 47683 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECB4 protein_id gnl|my_center|LOCUS_10830 49672 48194 gene locus_tag LOCUS_10840 gene flrC 49672 48194 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262361.1 protein_id gnl|my_center|LOCUS_10840 50781 49669 gene locus_tag LOCUS_10850 gene flrB 50781 49669 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262362.1 protein_id gnl|my_center|LOCUS_10850 50922 51509 gene locus_tag LOCUS_10860 gene tag 50922 51509 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946355.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence021 973 2004 gene locus_tag LOCUS_10870 973 2004 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481503.1 protein_id gnl|my_center|LOCUS_10870 2573 2052 gene locus_tag LOCUS_10880 2573 2052 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464022.1 protein_id gnl|my_center|LOCUS_10880 2727 4067 gene locus_tag LOCUS_10890 2727 4067 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187694.1 protein_id gnl|my_center|LOCUS_10890 4099 4308 gene locus_tag LOCUS_10900 4099 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 4330 5814 gene locus_tag LOCUS_10910 4330 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 5815 6276 gene locus_tag LOCUS_10920 5815 6276 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_10920 6296 8257 gene locus_tag LOCUS_10930 6296 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 9248 8244 gene locus_tag LOCUS_10940 gene galR 9248 8244 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263241.1 protein_id gnl|my_center|LOCUS_10940 10591 9260 gene locus_tag LOCUS_10950 10591 9260 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 protein_id gnl|my_center|LOCUS_10950 11946 10612 gene locus_tag LOCUS_10960 11946 10612 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_10960 12186 13451 gene locus_tag LOCUS_10970 gene gluP 12186 13451 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225587.1 protein_id gnl|my_center|LOCUS_10970 13504 15975 gene locus_tag LOCUS_10980 gene celD 13504 15975 CDS product glucan 1,4-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_637141.2 protein_id gnl|my_center|LOCUS_10980 16097 16693 gene locus_tag LOCUS_10990 16097 16693 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071749.1 protein_id gnl|my_center|LOCUS_10990 17573 16632 gene locus_tag LOCUS_11000 17573 16632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 18834 17782 gene locus_tag LOCUS_11010 gene tas 18834 17782 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263655.1 protein_id gnl|my_center|LOCUS_11010 19281 18850 gene locus_tag LOCUS_11020 19281 18850 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070493.1 protein_id gnl|my_center|LOCUS_11020 19428 19631 gene locus_tag LOCUS_11030 19428 19631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 19698 20750 gene locus_tag LOCUS_11040 gene dinB 19698 20750 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6W7 protein_id gnl|my_center|LOCUS_11040 20926 22449 gene locus_tag LOCUS_11050 20926 22449 CDS product peptidase M17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071359.1 protein_id gnl|my_center|LOCUS_11050 24157 22520 gene locus_tag LOCUS_11060 24157 22520 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884185.1 protein_id gnl|my_center|LOCUS_11060 26560 24335 gene locus_tag LOCUS_11070 gene dpp4 26560 24335 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073719.1 protein_id gnl|my_center|LOCUS_11070 26677 27072 gene locus_tag LOCUS_11080 26677 27072 CDS product histidine triad protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104815.1 protein_id gnl|my_center|LOCUS_11080 27208 27951 gene locus_tag LOCUS_11090 27208 27951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 29719 28019 gene locus_tag LOCUS_11100 29719 28019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 30003 30842 gene locus_tag LOCUS_11110 30003 30842 CDS product signal transduction superfamily protein with modified HD-GYP domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071477.1 protein_id gnl|my_center|LOCUS_11110 31820 30909 gene locus_tag LOCUS_11120 gene rdgC 31820 30909 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU12 protein_id gnl|my_center|LOCUS_11120 33705 31942 gene locus_tag LOCUS_11130 33705 31942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 33989 34354 gene locus_tag LOCUS_11140 33989 34354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 34585 37002 gene locus_tag LOCUS_11150 gene thrA 34585 37002 CDS product bifunctional aspartokinase I/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231994.2 protein_id gnl|my_center|LOCUS_11150 37012 37938 gene locus_tag LOCUS_11160 gene thrB 37012 37938 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJC7 protein_id gnl|my_center|LOCUS_11160 37957 39240 gene locus_tag LOCUS_11170 gene thrC 37957 39240 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706814.1 protein_id gnl|my_center|LOCUS_11170 39703 39338 gene locus_tag LOCUS_11180 39703 39338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073276.1 protein_id gnl|my_center|LOCUS_11180 39976 41232 gene locus_tag LOCUS_11190 gene glyA1 39976 41232 CDS product serine hydroxymethyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTG1 protein_id gnl|my_center|LOCUS_11190 41335 41784 gene locus_tag LOCUS_11200 gene nrdR 41335 41784 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNH2 protein_id gnl|my_center|LOCUS_11200 41786 42928 gene locus_tag LOCUS_11210 41786 42928 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RU7 protein_id gnl|my_center|LOCUS_11210 42941 43594 gene locus_tag LOCUS_11220 42941 43594 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073315.1 protein_id gnl|my_center|LOCUS_11220 43624 44736 gene locus_tag LOCUS_11230 gene ribBA 43624 44736 CDS product 3,4-dihydroxy-2-butanone 4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP2 protein_id gnl|my_center|LOCUS_11230 44838 45302 gene locus_tag LOCUS_11240 gene ribH 44838 45302 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP3 protein_id gnl|my_center|LOCUS_11240 45318 45728 gene locus_tag LOCUS_11250 gene nusB 45318 45728 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP4 protein_id gnl|my_center|LOCUS_11250 45767 46747 gene locus_tag LOCUS_11260 gene thiL 45767 46747 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP5 protein_id gnl|my_center|LOCUS_11260 46744 47229 gene locus_tag LOCUS_11270 gene pgpA 46744 47229 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBP6 protein_id gnl|my_center|LOCUS_11270 >Feature sequence022 14 98 gene locus_tag LOCUS_t00090 14 98 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 903 2216 gene locus_tag LOCUS_11280 903 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2729 3937 gene locus_tag LOCUS_11290 2729 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 4132 4395 gene locus_tag LOCUS_11300 4132 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4514 6490 gene locus_tag LOCUS_11310 4514 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 6527 8263 gene locus_tag LOCUS_11320 6527 8263 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895452.1 protein_id gnl|my_center|LOCUS_11320 8260 9627 gene locus_tag LOCUS_11330 gene dctD 8260 9627 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073030.1 protein_id gnl|my_center|LOCUS_11330 9856 10818 gene locus_tag LOCUS_11340 9856 10818 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071726.1 protein_id gnl|my_center|LOCUS_11340 10830 12305 gene locus_tag LOCUS_11350 10830 12305 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_11350 12422 13846 gene locus_tag LOCUS_11360 12422 13846 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87I45 protein_id gnl|my_center|LOCUS_11360 14612 13887 gene locus_tag LOCUS_11370 14612 13887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 15193 16011 gene locus_tag LOCUS_11380 15193 16011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477260.1 protein_id gnl|my_center|LOCUS_11380 16141 17178 gene locus_tag LOCUS_11390 16141 17178 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340058.1 protein_id gnl|my_center|LOCUS_11390 18119 17175 gene locus_tag LOCUS_11400 18119 17175 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262928.1 protein_id gnl|my_center|LOCUS_11400 18238 19404 gene locus_tag LOCUS_11410 gene mexE 18238 19404 CDS product MexE family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073334.1 protein_id gnl|my_center|LOCUS_11410 19413 22568 gene locus_tag LOCUS_11420 gene mexF 19413 22568 CDS product resistance-nodulation-cell division multidrug efflux transporter MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 protein_id gnl|my_center|LOCUS_11420 22561 23937 gene locus_tag LOCUS_11430 gene oprN 22561 23937 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036632.1 protein_id gnl|my_center|LOCUS_11430 23955 24980 gene locus_tag LOCUS_11440 23955 24980 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066670.1 protein_id gnl|my_center|LOCUS_11440 25065 25469 gene locus_tag LOCUS_11450 25065 25469 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070816.1 protein_id gnl|my_center|LOCUS_11450 25511 25834 gene locus_tag LOCUS_11460 25511 25834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 26560 25937 gene locus_tag LOCUS_11470 26560 25937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 28215 26560 gene locus_tag LOCUS_11480 28215 26560 CDS product paraquat-inducible protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881538.1 protein_id gnl|my_center|LOCUS_11480 29451 28225 gene locus_tag LOCUS_11490 29451 28225 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457979.1 protein_id gnl|my_center|LOCUS_11490 29616 30377 gene locus_tag LOCUS_11500 29616 30377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 31181 30366 gene locus_tag LOCUS_11510 31181 30366 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267408.1 protein_id gnl|my_center|LOCUS_11510 31426 33342 gene locus_tag LOCUS_11520 gene dnaK 31426 33342 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJD5 protein_id gnl|my_center|LOCUS_11520 33521 34672 gene locus_tag LOCUS_11530 gene dnaJ 33521 34672 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHT6 protein_id gnl|my_center|LOCUS_11530 35210 35443 gene locus_tag LOCUS_11540 gene feoA1 35210 35443 CDS product iron transporter FeoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722680.1 protein_id gnl|my_center|LOCUS_11540 35440 37761 gene locus_tag LOCUS_11550 35440 37761 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRH5 protein_id gnl|my_center|LOCUS_11550 37847 38308 gene locus_tag LOCUS_11560 gene ybaK 37847 38308 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHT9 protein_id gnl|my_center|LOCUS_11560 38620 40875 gene locus_tag LOCUS_11570 38620 40875 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462399.1 protein_id gnl|my_center|LOCUS_11570 41189 41004 gene locus_tag LOCUS_11580 41189 41004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 41653 42603 gene locus_tag LOCUS_11590 41653 42603 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106521.1 protein_id gnl|my_center|LOCUS_11590 42605 43576 gene locus_tag LOCUS_11600 42605 43576 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_11600 44330 43578 gene locus_tag LOCUS_11610 44330 43578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 44626 45255 gene locus_tag LOCUS_11620 gene upp 44626 45255 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CS07 protein_id gnl|my_center|LOCUS_11620 45258 46490 gene locus_tag LOCUS_11630 45258 46490 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786153.1 protein_id gnl|my_center|LOCUS_11630 46640 48382 gene locus_tag LOCUS_11640 46640 48382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 48375 49595 gene locus_tag LOCUS_11650 48375 49595 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence023 1224 88 gene locus_tag LOCUS_11660 gene lapB 1224 88 CDS product lipopolysaccharide assembly protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87N48 protein_id gnl|my_center|LOCUS_11660 1508 1227 gene locus_tag LOCUS_11670 1508 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1817 1530 gene locus_tag LOCUS_11680 gene ihfB 1817 1530 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NAR1 protein_id gnl|my_center|LOCUS_11680 3547 1880 gene locus_tag LOCUS_11690 gene rpsA 3547 1880 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ93 protein_id gnl|my_center|LOCUS_11690 4351 3641 gene locus_tag LOCUS_11700 gene cmk 4351 3641 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ92 protein_id gnl|my_center|LOCUS_11700 5736 4459 gene locus_tag LOCUS_11710 gene aroA 5736 4459 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QX9 protein_id gnl|my_center|LOCUS_11710 6818 5736 gene locus_tag LOCUS_11720 gene serC 6818 5736 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJQ8 protein_id gnl|my_center|LOCUS_11720 9632 6933 gene locus_tag LOCUS_11730 gene gyrA 9632 6933 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH1 protein_id gnl|my_center|LOCUS_11730 9812 10522 gene locus_tag LOCUS_11740 gene ubiG 9812 10522 CDS product ubiquinone biosynthesis O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XWL2 protein_id gnl|my_center|LOCUS_11740 10522 11205 gene locus_tag LOCUS_11750 gene gph-1 10522 11205 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706174.1 protein_id gnl|my_center|LOCUS_11750 11607 13889 gene locus_tag LOCUS_11760 11607 13889 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNB6 protein_id gnl|my_center|LOCUS_11760 13959 15089 gene locus_tag LOCUS_11770 gene nrdB 13959 15089 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815971.1 protein_id gnl|my_center|LOCUS_11770 15089 15361 gene locus_tag LOCUS_11780 15089 15361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 15902 15366 gene locus_tag LOCUS_11790 15902 15366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 16044 18422 gene locus_tag LOCUS_11800 16044 18422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101985.1 protein_id gnl|my_center|LOCUS_11800 19110 18493 gene locus_tag LOCUS_11810 gene fklB 19110 18493 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHS8 protein_id gnl|my_center|LOCUS_11810 19601 19215 gene locus_tag LOCUS_11820 19601 19215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 19741 19651 gene locus_tag LOCUS_t00100 19741 19651 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20220 19843 gene locus_tag LOCUS_11830 20220 19843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 20971 20423 gene locus_tag LOCUS_11840 gene ydjA 20971 20423 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072654.1 protein_id gnl|my_center|LOCUS_11840 21656 21078 gene locus_tag LOCUS_11850 21656 21078 CDS product DoxD-like inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072655.1 protein_id gnl|my_center|LOCUS_11850 23781 21820 gene locus_tag LOCUS_11860 gene fadH 23781 21820 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072396.1 protein_id gnl|my_center|LOCUS_11860 24000 25865 gene locus_tag LOCUS_11870 gene sppA 24000 25865 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEG2 protein_id gnl|my_center|LOCUS_11870 25936 26946 gene locus_tag LOCUS_11880 gene ansA 25936 26946 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170162.1 protein_id gnl|my_center|LOCUS_11880 28406 27033 gene locus_tag LOCUS_11890 gene gnd 28406 27033 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFR5 protein_id gnl|my_center|LOCUS_11890 28811 30247 gene locus_tag LOCUS_11900 gene pykA 28811 30247 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE96 protein_id gnl|my_center|LOCUS_11900 31177 30353 gene locus_tag LOCUS_11910 31177 30353 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_11910 32247 31174 gene locus_tag LOCUS_11920 32247 31174 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_11920 32783 32421 gene locus_tag LOCUS_11930 gene rplT 32783 32421 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZDW8 protein_id gnl|my_center|LOCUS_11930 32999 32799 gene locus_tag LOCUS_11940 gene rpmI 32999 32799 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZDW7 protein_id gnl|my_center|LOCUS_11940 33771 33208 gene locus_tag LOCUS_11950 gene infC 33771 33208 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z6I3 protein_id gnl|my_center|LOCUS_11950 35741 33831 gene locus_tag LOCUS_11960 gene thrS 35741 33831 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER9 protein_id gnl|my_center|LOCUS_11960 36000 37013 gene locus_tag LOCUS_11970 36000 37013 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261788.1 protein_id gnl|my_center|LOCUS_11970 37080 37526 gene locus_tag LOCUS_11980 37080 37526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263360.1 protein_id gnl|my_center|LOCUS_11980 37727 39472 gene locus_tag LOCUS_11990 37727 39472 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072065.1 protein_id gnl|my_center|LOCUS_11990 40484 39555 gene locus_tag LOCUS_12000 40484 39555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_12000 41940 40486 gene locus_tag LOCUS_12010 41940 40486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122583.1 protein_id gnl|my_center|LOCUS_12010 42862 41984 gene locus_tag LOCUS_12020 42862 41984 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105232.1 protein_id gnl|my_center|LOCUS_12020 45357 42859 gene locus_tag LOCUS_12030 45357 42859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085762.1 protein_id gnl|my_center|LOCUS_12030 48836 45525 gene locus_tag LOCUS_12040 48836 45525 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390311.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence024 291 1004 gene locus_tag LOCUS_12050 291 1004 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096707.1 protein_id gnl|my_center|LOCUS_12050 1140 3053 gene locus_tag LOCUS_12060 gene htpG 1140 3053 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF7 protein_id gnl|my_center|LOCUS_12060 3234 3878 gene locus_tag LOCUS_12070 gene adk 3234 3878 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFF5 protein_id gnl|my_center|LOCUS_12070 4529 3948 gene locus_tag LOCUS_12080 gene tpx 4529 3948 CDS product 2-Cys peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073211.1 protein_id gnl|my_center|LOCUS_12080 4703 5707 gene locus_tag LOCUS_12090 gene cheC 4703 5707 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070910.1 protein_id gnl|my_center|LOCUS_12090 5712 6677 gene locus_tag LOCUS_12100 5712 6677 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_12100 7677 6796 gene locus_tag LOCUS_12110 gene uspE 7677 6796 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_12110 9197 7683 gene locus_tag LOCUS_12120 9197 7683 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706275.1 protein_id gnl|my_center|LOCUS_12120 10502 9219 gene locus_tag LOCUS_12130 10502 9219 CDS product UPF0229 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL05 protein_id gnl|my_center|LOCUS_12130 12455 10533 gene locus_tag LOCUS_12140 12455 10533 CDS product serine protein kinase PrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097060.1 protein_id gnl|my_center|LOCUS_12140 13216 12635 gene locus_tag LOCUS_12150 gene sodB 13216 12635 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6D0 protein_id gnl|my_center|LOCUS_12150 13493 13831 gene locus_tag LOCUS_12160 13493 13831 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI42 protein_id gnl|my_center|LOCUS_12160 15201 13861 gene locus_tag LOCUS_12170 15201 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 16529 15201 gene locus_tag LOCUS_12180 16529 15201 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073484.1 protein_id gnl|my_center|LOCUS_12180 17821 16613 gene locus_tag LOCUS_12190 17821 16613 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073485.1 protein_id gnl|my_center|LOCUS_12190 19146 17833 gene locus_tag LOCUS_12200 19146 17833 CDS product ABC macrolide family export system permease 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073486.1 protein_id gnl|my_center|LOCUS_12200 19860 19150 gene locus_tag LOCUS_12210 19860 19150 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073487.1 protein_id gnl|my_center|LOCUS_12210 21141 19888 gene locus_tag LOCUS_12220 21141 19888 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073489.1 protein_id gnl|my_center|LOCUS_12220 21933 26390 gene locus_tag LOCUS_12230 gene gltB 21933 26390 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706515.1 protein_id gnl|my_center|LOCUS_12230 26400 27815 gene locus_tag LOCUS_12240 gene gltD 26400 27815 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001888007.1 protein_id gnl|my_center|LOCUS_12240 29440 28070 gene locus_tag LOCUS_12250 29440 28070 CDS product D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_12250 30962 29985 gene locus_tag LOCUS_12260 30962 29985 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938071.1 protein_id gnl|my_center|LOCUS_12260 31827 31177 gene locus_tag LOCUS_12270 31827 31177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 32851 32285 gene locus_tag LOCUS_12280 32851 32285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 33536 33216 gene locus_tag LOCUS_12290 33536 33216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 33915 33640 gene locus_tag LOCUS_12300 33915 33640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 35847 34174 gene locus_tag LOCUS_12310 gene recN 35847 34174 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMI9 protein_id gnl|my_center|LOCUS_12310 36479 35940 gene locus_tag LOCUS_12320 36479 35940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 37493 36558 gene locus_tag LOCUS_12330 gene nadK 37493 36558 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMI8 protein_id gnl|my_center|LOCUS_12330 37543 38508 gene locus_tag LOCUS_12340 gene hrcA 37543 38508 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63R42 protein_id gnl|my_center|LOCUS_12340 38567 39175 gene locus_tag LOCUS_12350 gene grpE 38567 39175 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMI7 protein_id gnl|my_center|LOCUS_12350 40402 39203 gene locus_tag LOCUS_12360 40402 39203 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072290.1 protein_id gnl|my_center|LOCUS_12360 40595 41392 gene locus_tag LOCUS_12370 40595 41392 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 protein_id gnl|my_center|LOCUS_12370 42585 41464 gene locus_tag LOCUS_12380 gene ald 42585 41464 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6E8 protein_id gnl|my_center|LOCUS_12380 42726 43205 gene locus_tag LOCUS_12390 42726 43205 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378234.1 protein_id gnl|my_center|LOCUS_12390 43392 45860 gene locus_tag LOCUS_12400 43392 45860 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705741.1 protein_id gnl|my_center|LOCUS_12400 45861 46502 gene locus_tag LOCUS_12410 gene lolA 45861 46502 CDS product outer-membrane lipoprotein carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QP3 protein_id gnl|my_center|LOCUS_12410 46495 47838 gene locus_tag LOCUS_12420 46495 47838 CDS product recombinase RarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705743.1 protein_id gnl|my_center|LOCUS_12420 47849 48211 gene locus_tag LOCUS_12430 gene crcB 47849 48211 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE9 protein_id gnl|my_center|LOCUS_12430 >Feature sequence025 1082 468 gene locus_tag LOCUS_12440 gene hisI 1082 468 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06989 protein_id gnl|my_center|LOCUS_12440 1852 1073 gene locus_tag LOCUS_12450 gene hisF 1852 1073 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QK6 protein_id gnl|my_center|LOCUS_12450 2568 1834 gene locus_tag LOCUS_12460 gene hisA 2568 1834 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z5J7 protein_id gnl|my_center|LOCUS_12460 3197 2607 gene locus_tag LOCUS_12470 gene hisH 3197 2607 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSX0 protein_id gnl|my_center|LOCUS_12470 4255 3194 gene locus_tag LOCUS_12480 gene hisB 4255 3194 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E636 protein_id gnl|my_center|LOCUS_12480 5337 4252 gene locus_tag LOCUS_12490 gene hisC 5337 4252 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZFX6 protein_id gnl|my_center|LOCUS_12490 6628 5327 gene locus_tag LOCUS_12500 gene hisD 6628 5327 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QL1 protein_id gnl|my_center|LOCUS_12500 7532 6633 gene locus_tag LOCUS_12510 gene hisG 7532 6633 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKB9 protein_id gnl|my_center|LOCUS_12510 7894 8127 gene locus_tag LOCUS_12520 7894 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 9495 8215 gene locus_tag LOCUS_12530 9495 8215 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704405.1 protein_id gnl|my_center|LOCUS_12530 10081 12267 gene locus_tag LOCUS_12540 10081 12267 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704796.1 protein_id gnl|my_center|LOCUS_12540 12358 14223 gene locus_tag LOCUS_12550 12358 14223 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037204.1 protein_id gnl|my_center|LOCUS_12550 14415 16241 gene locus_tag LOCUS_12560 gene yoaA 14415 16241 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262264.1 protein_id gnl|my_center|LOCUS_12560 16255 16965 gene locus_tag LOCUS_12570 16255 16965 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220976.1 protein_id gnl|my_center|LOCUS_12570 17041 17370 gene locus_tag LOCUS_12580 17041 17370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 18828 17539 gene locus_tag LOCUS_12590 18828 17539 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463736.1 protein_id gnl|my_center|LOCUS_12590 18929 19780 gene locus_tag LOCUS_12600 18929 19780 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706060.1 protein_id gnl|my_center|LOCUS_12600 19901 21553 gene locus_tag LOCUS_12610 gene fadD 19901 21553 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169210.1 protein_id gnl|my_center|LOCUS_12610 21603 22733 gene locus_tag LOCUS_12620 gene rnd 21603 22733 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RC6 protein_id gnl|my_center|LOCUS_12620 23690 22818 gene locus_tag LOCUS_12630 23690 22818 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_12630 24525 23764 gene locus_tag LOCUS_12640 24525 23764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 26206 24527 gene locus_tag LOCUS_12650 26206 24527 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_12650 26901 26209 gene locus_tag LOCUS_12660 26901 26209 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_12660 28153 26939 gene locus_tag LOCUS_12670 28153 26939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 29224 28172 gene locus_tag LOCUS_12680 29224 28172 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_12680 30388 29228 gene locus_tag LOCUS_12690 30388 29228 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_12690 30551 31276 gene locus_tag LOCUS_12700 30551 31276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 32148 31273 gene locus_tag LOCUS_12710 32148 31273 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262591.1 protein_id gnl|my_center|LOCUS_12710 32881 32141 gene locus_tag LOCUS_12720 gene cutC 32881 32141 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3C5 protein_id gnl|my_center|LOCUS_12720 33281 36265 gene locus_tag LOCUS_12730 gene cirA 33281 36265 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037060.1 protein_id gnl|my_center|LOCUS_12730 36424 39273 gene locus_tag LOCUS_12740 36424 39273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 39390 40388 gene locus_tag LOCUS_12750 gene aspG 39390 40388 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_12750 40880 40611 gene locus_tag LOCUS_12760 gene minE 40880 40611 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KK55 protein_id gnl|my_center|LOCUS_12760 41691 40882 gene locus_tag LOCUS_12770 41691 40882 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZW12 protein_id gnl|my_center|LOCUS_12770 42401 41697 gene locus_tag LOCUS_12780 gene minC 42401 41697 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E447 protein_id gnl|my_center|LOCUS_12780 42571 42852 gene locus_tag LOCUS_12790 42571 42852 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE15 protein_id gnl|my_center|LOCUS_12790 42845 43873 gene locus_tag LOCUS_12800 gene mltB 42845 43873 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262256.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence026 576 1460 gene locus_tag LOCUS_12810 576 1460 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263754.1 protein_id gnl|my_center|LOCUS_12810 3195 1618 gene locus_tag LOCUS_12820 gene guaA 3195 1618 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJS0 protein_id gnl|my_center|LOCUS_12820 4768 3299 gene locus_tag LOCUS_12830 gene guaB 4768 3299 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44334 protein_id gnl|my_center|LOCUS_12830 4904 6238 gene locus_tag LOCUS_12840 gene xseA 4904 6238 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S09 protein_id gnl|my_center|LOCUS_12840 6916 6245 gene locus_tag LOCUS_12850 6916 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 7760 6942 gene locus_tag LOCUS_12860 gene cysE 7760 6942 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704210.1 protein_id gnl|my_center|LOCUS_12860 8096 8491 gene locus_tag LOCUS_12870 8096 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 8494 8814 gene locus_tag LOCUS_12880 8494 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 11864 8979 gene locus_tag LOCUS_12890 11864 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 12112 13068 gene locus_tag LOCUS_12900 12112 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 14428 13181 gene locus_tag LOCUS_12910 14428 13181 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073255.1 protein_id gnl|my_center|LOCUS_12910 15227 14526 gene locus_tag LOCUS_12920 15227 14526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 protein_id gnl|my_center|LOCUS_12920 15742 15365 gene locus_tag LOCUS_12930 15742 15365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073446.1 protein_id gnl|my_center|LOCUS_12930 16301 15822 gene locus_tag LOCUS_12940 gene folA 16301 15822 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_12940 17541 16387 gene locus_tag LOCUS_12950 gene obg 17541 16387 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB83 protein_id gnl|my_center|LOCUS_12950 17940 17683 gene locus_tag LOCUS_12960 gene rpmA 17940 17683 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66132 protein_id gnl|my_center|LOCUS_12960 18268 17957 gene locus_tag LOCUS_12970 gene rplU 18268 17957 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E873 protein_id gnl|my_center|LOCUS_12970 18691 19662 gene locus_tag LOCUS_12980 gene ispB 18691 19662 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261094.1 protein_id gnl|my_center|LOCUS_12980 20678 19743 gene locus_tag LOCUS_12990 gene mdh 20678 19743 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P82177 protein_id gnl|my_center|LOCUS_12990 20903 21370 gene locus_tag LOCUS_13000 gene argR 20903 21370 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIR6 protein_id gnl|my_center|LOCUS_13000 22289 21390 gene locus_tag LOCUS_13010 22289 21390 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071047.1 protein_id gnl|my_center|LOCUS_13010 23403 22354 gene locus_tag LOCUS_13020 23403 22354 CDS product iron(III) ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461276.1 protein_id gnl|my_center|LOCUS_13020 25034 23403 gene locus_tag LOCUS_13030 gene fbpB 25034 23403 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071050.1 protein_id gnl|my_center|LOCUS_13030 26038 25034 gene locus_tag LOCUS_13040 gene fbpA 26038 25034 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071051.1 protein_id gnl|my_center|LOCUS_13040 26964 27617 gene locus_tag LOCUS_13050 26964 27617 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FR05 protein_id gnl|my_center|LOCUS_13050 27694 28623 gene locus_tag LOCUS_13060 27694 28623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707004.1 protein_id gnl|my_center|LOCUS_13060 29478 28606 gene locus_tag LOCUS_13070 gene djlA 29478 28606 CDS product co-chaperone protein DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB99 protein_id gnl|my_center|LOCUS_13070 30177 29506 gene locus_tag LOCUS_13080 gene mpg1 30177 29506 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_13080 31181 30177 gene locus_tag LOCUS_13090 31181 30177 CDS product cell wall phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 protein_id gnl|my_center|LOCUS_13090 31285 33531 gene locus_tag LOCUS_13100 gene lptD 31285 33531 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB96 protein_id gnl|my_center|LOCUS_13100 33568 34863 gene locus_tag LOCUS_13110 gene surA 33568 34863 CDS product chaperone SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB95 protein_id gnl|my_center|LOCUS_13110 34867 35859 gene locus_tag LOCUS_13120 gene pdxA 34867 35859 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGT9 protein_id gnl|my_center|LOCUS_13120 35856 36665 gene locus_tag LOCUS_13130 gene rsmA 35856 36665 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGT8 protein_id gnl|my_center|LOCUS_13130 36649 37038 gene locus_tag LOCUS_13140 gene apaG 36649 37038 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NHF6 protein_id gnl|my_center|LOCUS_13140 37242 38057 gene locus_tag LOCUS_13150 gene apaH 37242 38057 CDS product bis(5'-nucleosyl)-tetraphosphatase, symmetrical inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRF6 protein_id gnl|my_center|LOCUS_13150 38191 40206 gene locus_tag LOCUS_13160 38191 40206 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073445.1 protein_id gnl|my_center|LOCUS_13160 41946 40462 gene locus_tag LOCUS_13170 gene gltX 41946 40462 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q884C8 protein_id gnl|my_center|LOCUS_13170 42381 42022 gene locus_tag LOCUS_13180 42381 42022 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482613.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence027 384 1364 gene locus_tag LOCUS_13190 gene pheS 384 1364 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFA0 protein_id gnl|my_center|LOCUS_13190 1380 3767 gene locus_tag LOCUS_13200 gene pheT 1380 3767 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CN07 protein_id gnl|my_center|LOCUS_13200 3770 4063 gene locus_tag LOCUS_13210 gene ihfA 3770 4063 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMM4 protein_id gnl|my_center|LOCUS_13210 4922 4122 gene locus_tag LOCUS_13220 4922 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 5099 6541 gene locus_tag LOCUS_13230 gene gapB 5099 6541 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN1 protein_id gnl|my_center|LOCUS_13230 6750 7880 gene locus_tag LOCUS_13240 6750 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106235.1 protein_id gnl|my_center|LOCUS_13240 8251 9756 gene locus_tag LOCUS_13250 gene acp 8251 9756 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207419.1 protein_id gnl|my_center|LOCUS_13250 9938 10264 gene locus_tag LOCUS_13260 9938 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 10266 10547 gene locus_tag LOCUS_13270 10266 10547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046792.1 protein_id gnl|my_center|LOCUS_13270 10537 13221 gene locus_tag LOCUS_13280 10537 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 13318 13872 gene locus_tag LOCUS_13290 13318 13872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 14137 14931 gene locus_tag LOCUS_13300 14137 14931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 15215 15517 gene locus_tag LOCUS_13310 15215 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 15603 17360 gene locus_tag LOCUS_13320 15603 17360 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706128.1 protein_id gnl|my_center|LOCUS_13320 17717 17382 gene locus_tag LOCUS_13330 17717 17382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071955.1 protein_id gnl|my_center|LOCUS_13330 17879 19606 gene locus_tag LOCUS_13340 17879 19606 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883904.1 protein_id gnl|my_center|LOCUS_13340 19606 23292 gene locus_tag LOCUS_13350 19606 23292 CDS product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704193.1 protein_id gnl|my_center|LOCUS_13350 23318 24133 gene locus_tag LOCUS_13360 23318 24133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_13360 24169 25050 gene locus_tag LOCUS_13370 24169 25050 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 protein_id gnl|my_center|LOCUS_13370 25950 25105 gene locus_tag LOCUS_13380 gene queF 25950 25105 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHE7 protein_id gnl|my_center|LOCUS_13380 26010 26549 gene locus_tag LOCUS_13390 26010 26549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 27363 26590 gene locus_tag LOCUS_13400 27363 26590 CDS product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705081.1 protein_id gnl|my_center|LOCUS_13400 27674 27381 gene locus_tag LOCUS_13410 27674 27381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 27967 27734 gene locus_tag LOCUS_13420 27967 27734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719760.1 protein_id gnl|my_center|LOCUS_13420 28121 28768 gene locus_tag LOCUS_13430 28121 28768 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071771.1 protein_id gnl|my_center|LOCUS_13430 29784 29485 gene locus_tag LOCUS_13440 29784 29485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 30861 29785 gene locus_tag LOCUS_13450 30861 29785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479038.1 protein_id gnl|my_center|LOCUS_13450 30918 31238 gene locus_tag LOCUS_13460 gene yqcC 30918 31238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071775.1 protein_id gnl|my_center|LOCUS_13460 31231 31995 gene locus_tag LOCUS_13470 31231 31995 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705086.1 protein_id gnl|my_center|LOCUS_13470 31995 32444 gene locus_tag LOCUS_13480 31995 32444 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212126.1 protein_id gnl|my_center|LOCUS_13480 34081 32495 gene locus_tag LOCUS_13490 34081 32495 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072517.1 protein_id gnl|my_center|LOCUS_13490 35024 34239 gene locus_tag LOCUS_13500 gene gloB 35024 34239 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPX6 protein_id gnl|my_center|LOCUS_13500 35077 35835 gene locus_tag LOCUS_13510 gene yafS 35077 35835 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262415.1 protein_id gnl|my_center|LOCUS_13510 36669 35806 gene locus_tag LOCUS_13520 36669 35806 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807247.1 protein_id gnl|my_center|LOCUS_13520 37222 36755 gene locus_tag LOCUS_13530 gene rnhA 37222 36755 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MG2 protein_id gnl|my_center|LOCUS_13530 37291 38004 gene locus_tag LOCUS_13540 gene dnaQ 37291 38004 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705465.1 protein_id gnl|my_center|LOCUS_13540 38025 39389 gene locus_tag LOCUS_13550 38025 39389 CDS product TIGR03503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705466.1 protein_id gnl|my_center|LOCUS_13550 39488 39564 gene locus_tag LOCUS_t00110 39488 39564 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 39592 39668 gene locus_tag LOCUS_t00120 39592 39668 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 39710 39784 gene locus_tag LOCUS_t00130 39710 39784 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence028 178 975 gene locus_tag LOCUS_13560 178 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13560 953 1255 gene locus_tag LOCUS_13570 953 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 4133 1269 gene locus_tag LOCUS_13580 4133 1269 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188699.1 protein_id gnl|my_center|LOCUS_13580 4451 6325 gene locus_tag LOCUS_13590 gene nagZ 4451 6325 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40406 protein_id gnl|my_center|LOCUS_13590 6343 7140 gene locus_tag LOCUS_13600 6343 7140 CDS product UPF0317 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MF66 protein_id gnl|my_center|LOCUS_13600 7153 7884 gene locus_tag LOCUS_13610 7153 7884 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87HS9 protein_id gnl|my_center|LOCUS_13610 7869 8735 gene locus_tag LOCUS_13620 7869 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147169.1 protein_id gnl|my_center|LOCUS_13620 8735 9592 gene locus_tag LOCUS_13630 8735 9592 CDS product cytochrome c551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947239.1 protein_id gnl|my_center|LOCUS_13630 10647 9667 gene locus_tag LOCUS_13640 10647 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001888877.1 protein_id gnl|my_center|LOCUS_13640 11434 12153 gene locus_tag LOCUS_13650 11434 12153 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168613.1 protein_id gnl|my_center|LOCUS_13650 12253 14277 gene locus_tag LOCUS_13660 12253 14277 CDS product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_13660 16506 14905 gene locus_tag LOCUS_13670 16506 14905 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0K4 protein_id gnl|my_center|LOCUS_13670 16763 18940 gene locus_tag LOCUS_13680 gene glcB 16763 18940 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I636 protein_id gnl|my_center|LOCUS_13680 19866 19141 gene locus_tag LOCUS_13690 19866 19141 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNF8 protein_id gnl|my_center|LOCUS_13690 20669 20034 gene locus_tag LOCUS_13700 20669 20034 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482630.1 protein_id gnl|my_center|LOCUS_13700 21348 20830 gene locus_tag LOCUS_13710 21348 20830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 23789 21348 gene locus_tag LOCUS_13720 23789 21348 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919028.1 protein_id gnl|my_center|LOCUS_13720 24095 24349 gene locus_tag LOCUS_13730 24095 24349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 24478 24717 gene locus_tag LOCUS_13740 24478 24717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 24794 26038 gene locus_tag LOCUS_13750 gene sbcD 24794 26038 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWB9 protein_id gnl|my_center|LOCUS_13750 26035 29676 gene locus_tag LOCUS_13760 gene sbcC 26035 29676 CDS product nuclease SbcCD subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVR0 protein_id gnl|my_center|LOCUS_13760 29686 30351 gene locus_tag LOCUS_13770 29686 30351 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704973.1 protein_id gnl|my_center|LOCUS_13770 30716 31375 gene locus_tag LOCUS_13780 30716 31375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 32982 31453 gene locus_tag LOCUS_13790 32982 31453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 34523 33060 gene locus_tag LOCUS_13800 gene dgt 34523 33060 CDS product putative deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4L1 protein_id gnl|my_center|LOCUS_13800 34727 35938 gene locus_tag LOCUS_13810 34727 35938 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405234.1 protein_id gnl|my_center|LOCUS_13810 36740 35997 gene locus_tag LOCUS_13820 36740 35997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 37500 36799 gene locus_tag LOCUS_13830 37500 36799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 37962 38963 gene locus_tag LOCUS_13840 gene rimK 37962 38963 CDS product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072232.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence029 1608 730 gene locus_tag LOCUS_13850 gene galU 1608 730 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNX2 protein_id gnl|my_center|LOCUS_13850 2495 1644 gene locus_tag LOCUS_13860 gene thyA 2495 1644 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44420 protein_id gnl|my_center|LOCUS_13860 3314 2511 gene locus_tag LOCUS_13870 gene lgt 3314 2511 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7P2 protein_id gnl|my_center|LOCUS_13870 4136 3327 gene locus_tag LOCUS_13880 4136 3327 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH96 protein_id gnl|my_center|LOCUS_13880 6491 4218 gene locus_tag LOCUS_13890 gene ptsI-1 6491 4218 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704635.1 protein_id gnl|my_center|LOCUS_13890 7030 6509 gene locus_tag LOCUS_13900 gene rppH 7030 6509 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU53 protein_id gnl|my_center|LOCUS_13900 7458 8129 gene locus_tag LOCUS_13910 gene mutH 7458 8129 CDS product DNA mismatch repair protein MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7P6 protein_id gnl|my_center|LOCUS_13910 9118 8144 gene locus_tag LOCUS_13920 9118 8144 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074093.1 protein_id gnl|my_center|LOCUS_13920 10609 9311 gene locus_tag LOCUS_13930 gene eno 10609 9311 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LQ0 protein_id gnl|my_center|LOCUS_13930 12283 10721 gene locus_tag LOCUS_13940 gene pyrG 12283 10721 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E325 protein_id gnl|my_center|LOCUS_13940 12243 12395 gene locus_tag LOCUS_13950 12243 12395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 13306 12494 gene locus_tag LOCUS_13960 gene mazG 13306 12494 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268591.1 protein_id gnl|my_center|LOCUS_13960 15471 13315 gene locus_tag LOCUS_13970 gene relA 15471 13315 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AG22 protein_id gnl|my_center|LOCUS_13970 16805 15480 gene locus_tag LOCUS_13980 gene rlmD 16805 15480 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBQ3 protein_id gnl|my_center|LOCUS_13980 16904 19669 gene locus_tag LOCUS_13990 16904 19669 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGG8 protein_id gnl|my_center|LOCUS_13990 20595 19666 gene locus_tag LOCUS_14000 20595 19666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 20723 21190 gene locus_tag LOCUS_14010 20723 21190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478450.1 protein_id gnl|my_center|LOCUS_14010 21408 21217 gene locus_tag LOCUS_14020 gene csrA 21408 21217 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LR5 protein_id gnl|my_center|LOCUS_14020 24698 22098 gene locus_tag LOCUS_14030 gene alaS 24698 22098 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56648 protein_id gnl|my_center|LOCUS_14030 25182 24718 gene locus_tag LOCUS_14040 25182 24718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 25970 25182 gene locus_tag LOCUS_14050 25970 25182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 26672 26049 gene locus_tag LOCUS_14060 gene ribA 26672 26049 CDS product GTP cyclohydrolase-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5L2 protein_id gnl|my_center|LOCUS_14060 26928 28010 gene locus_tag LOCUS_14070 gene tonB 26928 28010 CDS product cell envelope biogenesis protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073757.1 protein_id gnl|my_center|LOCUS_14070 28537 28085 gene locus_tag LOCUS_14080 28537 28085 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462468.1 protein_id gnl|my_center|LOCUS_14080 28825 28610 gene locus_tag LOCUS_14090 28825 28610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478080.1 protein_id gnl|my_center|LOCUS_14090 29650 29132 gene locus_tag LOCUS_14100 29650 29132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 30226 29720 gene locus_tag LOCUS_14110 30226 29720 CDS product medium chain reductase/dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459966.1 protein_id gnl|my_center|LOCUS_14110 30379 31017 gene locus_tag LOCUS_14120 gene tonB2 30379 31017 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 protein_id gnl|my_center|LOCUS_14120 31044 31595 gene locus_tag LOCUS_14130 31044 31595 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_14130 31582 32208 gene locus_tag LOCUS_14140 31582 32208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 33140 32361 gene locus_tag LOCUS_14150 33140 32361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 33962 33789 gene locus_tag LOCUS_14160 33962 33789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 35121 34039 gene locus_tag LOCUS_14170 35121 34039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 35344 36489 gene locus_tag LOCUS_14180 35344 36489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_14180 38081 36561 gene locus_tag LOCUS_14190 38081 36561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 38319 38092 gene locus_tag LOCUS_14200 38319 38092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence030 <1 690 gene locus_tag LOCUS_14210 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071191.1:transposase 1197 1772 gene locus_tag LOCUS_14220 1197 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1987 2169 gene locus_tag LOCUS_14230 1987 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2610 2930 gene locus_tag LOCUS_14240 2610 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3271 4125 gene locus_tag LOCUS_14250 3271 4125 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926911.1 protein_id gnl|my_center|LOCUS_14250 4305 4427 gene locus_tag LOCUS_14260 4305 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 4710 5360 gene locus_tag LOCUS_14270 gene yidC1 4710 5360 CDS product membrane protein insertase YidC 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y7A9 protein_id gnl|my_center|LOCUS_14270 6093 5461 gene locus_tag LOCUS_14280 6093 5461 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927463.1 protein_id gnl|my_center|LOCUS_14280 7334 6318 gene locus_tag LOCUS_14290 gene malR 7334 6318 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072259.1 protein_id gnl|my_center|LOCUS_14290 7674 8672 gene locus_tag LOCUS_14300 gene glk 7674 8672 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXA8 protein_id gnl|my_center|LOCUS_14300 8708 9721 gene locus_tag LOCUS_14310 gene nagR 8708 9721 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073351.1 protein_id gnl|my_center|LOCUS_14310 10121 12052 gene locus_tag LOCUS_14320 gene edd 10121 12052 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31961 protein_id gnl|my_center|LOCUS_14320 12085 12705 gene locus_tag LOCUS_14330 12085 12705 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_14330 12724 13728 gene locus_tag LOCUS_14340 gene gapA 12724 13728 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QS2 protein_id gnl|my_center|LOCUS_14340 14008 15132 gene locus_tag LOCUS_14350 14008 15132 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207152.1 protein_id gnl|my_center|LOCUS_14350 15320 17074 gene locus_tag LOCUS_14360 15320 17074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 18547 17273 gene locus_tag LOCUS_14370 18547 17273 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073737.1 protein_id gnl|my_center|LOCUS_14370 19349 18636 gene locus_tag LOCUS_14380 19349 18636 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBU8 protein_id gnl|my_center|LOCUS_14380 21595 19529 gene locus_tag LOCUS_14390 21595 19529 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921333.1 protein_id gnl|my_center|LOCUS_14390 23556 21769 gene locus_tag LOCUS_14400 gene atmA 23556 21769 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_14400 23734 24783 gene locus_tag LOCUS_14410 23734 24783 CDS product NADP-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 protein_id gnl|my_center|LOCUS_14410 24911 25408 gene locus_tag LOCUS_14420 24911 25408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 25516 27369 gene locus_tag LOCUS_14430 gene secD 25516 27369 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KLQ0 protein_id gnl|my_center|LOCUS_14430 27366 28292 gene locus_tag LOCUS_14440 gene secF 27366 28292 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM5 protein_id gnl|my_center|LOCUS_14440 29266 28361 gene locus_tag LOCUS_14450 gene ttcA 29266 28361 CDS product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JND8 protein_id gnl|my_center|LOCUS_14450 30267 29341 gene locus_tag LOCUS_14460 gene uspE 30267 29341 CDS product universal stress protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072342.1 protein_id gnl|my_center|LOCUS_14460 30992 30360 gene locus_tag LOCUS_14470 gene etrA 30992 30360 CDS product electron transport regulator A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46148 protein_id gnl|my_center|LOCUS_14470 31807 31136 gene locus_tag LOCUS_14480 31807 31136 CDS product cytochrome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261909.1 protein_id gnl|my_center|LOCUS_14480 31967 31800 gene locus_tag LOCUS_14490 gene ccoS 31967 31800 CDS product cytochrome oxidase maturation protein Cbb3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072345.1 protein_id gnl|my_center|LOCUS_14490 34339 31964 gene locus_tag LOCUS_14500 34339 31964 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261908.1 protein_id gnl|my_center|LOCUS_14500 34724 34350 gene locus_tag LOCUS_14510 34724 34350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 35956 34991 gene locus_tag LOCUS_14520 gene ccoP 35956 34991 CDS product Cbb3-type cytochrome c oxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKM0 protein_id gnl|my_center|LOCUS_14520 36138 35953 gene locus_tag LOCUS_14530 gene ccoQ 36138 35953 CDS product cytochrome oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300779.1 protein_id gnl|my_center|LOCUS_14530 36819 36145 gene locus_tag LOCUS_14540 gene ccoO 36819 36145 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072350.1 protein_id gnl|my_center|LOCUS_14540 <38223 36832 gene locus_tag LOCUS_14550 <38223 36832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072351.1:cytochrome c oxidase, cbb3-type subunit I >Feature sequence031 1459 377 gene locus_tag LOCUS_14560 gene proB 1459 377 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT8 protein_id gnl|my_center|LOCUS_14560 1610 2572 gene locus_tag LOCUS_14570 1610 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082086.1 protein_id gnl|my_center|LOCUS_14570 3060 2464 gene locus_tag LOCUS_14580 gene srtA 3060 2464 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072228.1 protein_id gnl|my_center|LOCUS_14580 5078 3057 gene locus_tag LOCUS_14590 5078 3057 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072227.1 protein_id gnl|my_center|LOCUS_14590 5855 5118 gene locus_tag LOCUS_14600 gene pdsO 5855 5118 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072226.1 protein_id gnl|my_center|LOCUS_14600 6080 6769 gene locus_tag LOCUS_14610 6080 6769 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072225.1 protein_id gnl|my_center|LOCUS_14610 6769 8901 gene locus_tag LOCUS_14620 6769 8901 CDS product proteobacterial dedicated sortase system histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072224.1 protein_id gnl|my_center|LOCUS_14620 9004 9162 gene locus_tag LOCUS_14630 9004 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 9213 9446 gene locus_tag LOCUS_14640 9213 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 9975 9475 gene locus_tag LOCUS_14650 9975 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020320.1 protein_id gnl|my_center|LOCUS_14650 11333 9984 gene locus_tag LOCUS_14660 11333 9984 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211556.1 protein_id gnl|my_center|LOCUS_14660 11878 11336 gene locus_tag LOCUS_14670 11878 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 13346 11880 gene locus_tag LOCUS_14680 13346 11880 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815766.1 protein_id gnl|my_center|LOCUS_14680 13378 13518 gene locus_tag LOCUS_14690 13378 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 13665 13892 gene locus_tag LOCUS_14700 13665 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 13915 14142 gene locus_tag LOCUS_14710 13915 14142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 14253 14489 gene locus_tag LOCUS_14720 14253 14489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 14502 14738 gene locus_tag LOCUS_14730 14502 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 14859 16523 gene locus_tag LOCUS_14740 14859 16523 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_14740 16760 16533 gene locus_tag LOCUS_14750 16760 16533 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073879.1 protein_id gnl|my_center|LOCUS_14750 17029 17685 gene locus_tag LOCUS_14760 17029 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 18515 17949 gene locus_tag LOCUS_14770 18515 17949 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_14770 20045 18750 gene locus_tag LOCUS_14780 20045 18750 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705640.1 protein_id gnl|my_center|LOCUS_14780 20136 20852 gene locus_tag LOCUS_14790 gene sfsA 20136 20852 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUC5 protein_id gnl|my_center|LOCUS_14790 21078 21521 gene locus_tag LOCUS_14800 gene dksA 21078 21521 CDS product RNA polymerase-binding transcription factor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG5 protein_id gnl|my_center|LOCUS_14800 21539 22483 gene locus_tag LOCUS_14810 gene yadB 21539 22483 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1WN59 protein_id gnl|my_center|LOCUS_14810 23061 24233 gene locus_tag LOCUS_14820 gene pcnB 23061 24233 CDS product poly(A) polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WBP7 protein_id gnl|my_center|LOCUS_14820 24230 24721 gene locus_tag LOCUS_14830 24230 24721 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454452.1 protein_id gnl|my_center|LOCUS_14830 24753 25547 gene locus_tag LOCUS_14840 gene panB 24753 25547 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG9 protein_id gnl|my_center|LOCUS_14840 25547 26398 gene locus_tag LOCUS_14850 gene panC 25547 26398 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888Q6 protein_id gnl|my_center|LOCUS_14850 26416 26655 gene locus_tag LOCUS_14860 26416 26655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 26992 28656 gene locus_tag LOCUS_14870 gene mdoG 26992 28656 CDS product glucans biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83RU3 protein_id gnl|my_center|LOCUS_14870 28628 30589 gene locus_tag LOCUS_14880 28628 30589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 31635 30667 gene locus_tag LOCUS_14890 gene pstS 31635 30667 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071729.1 protein_id gnl|my_center|LOCUS_14890 33055 31748 gene locus_tag LOCUS_14900 gene phoR 33055 31748 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705169.1 protein_id gnl|my_center|LOCUS_14900 33816 33127 gene locus_tag LOCUS_14910 33816 33127 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091117.1 protein_id gnl|my_center|LOCUS_14910 35506 34442 gene locus_tag LOCUS_14920 35506 34442 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316351.1 protein_id gnl|my_center|LOCUS_14920 36912 35737 gene locus_tag LOCUS_14930 gene pgk 36912 35737 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIB1 protein_id gnl|my_center|LOCUS_14930 37998 36982 gene locus_tag LOCUS_14940 gene epd 37998 36982 CDS product D-erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR81 protein_id gnl|my_center|LOCUS_14940 >Feature sequence032 1103 1906 gene locus_tag LOCUS_14950 1103 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1899 2846 gene locus_tag LOCUS_14960 1899 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 4559 2925 gene locus_tag LOCUS_14970 gene nutA 4559 2925 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ30 protein_id gnl|my_center|LOCUS_14970 4834 4637 gene locus_tag LOCUS_14980 4834 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5098 5841 gene locus_tag LOCUS_14990 5098 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 6311 5892 gene locus_tag LOCUS_15000 6311 5892 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532284.1 protein_id gnl|my_center|LOCUS_15000 6448 9345 gene locus_tag LOCUS_15010 6448 9345 CDS product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098545.1 protein_id gnl|my_center|LOCUS_15010 9477 9995 gene locus_tag LOCUS_15020 gene rpoE 9477 9995 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_15020 10008 10397 gene locus_tag LOCUS_15030 10008 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 10428 11021 gene locus_tag LOCUS_15040 10428 11021 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647882.1 protein_id gnl|my_center|LOCUS_15040 11172 11576 gene locus_tag LOCUS_15050 11172 11576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_15050 13837 11657 gene locus_tag LOCUS_15060 gene ycaO 13837 11657 CDS product protein involved in RimO-mediated beta-methylthiolation of ribosomal protein S12 YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071092.1 protein_id gnl|my_center|LOCUS_15060 14284 15363 gene locus_tag LOCUS_15070 14284 15363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882133.1 protein_id gnl|my_center|LOCUS_15070 15374 15790 gene locus_tag LOCUS_15080 15374 15790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271117.1 protein_id gnl|my_center|LOCUS_15080 17251 15869 gene locus_tag LOCUS_15090 17251 15869 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072447.1 protein_id gnl|my_center|LOCUS_15090 18460 17558 gene locus_tag LOCUS_15100 18460 17558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 18650 20170 gene locus_tag LOCUS_15110 18650 20170 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103256.1 protein_id gnl|my_center|LOCUS_15110 20900 21583 gene locus_tag LOCUS_15120 gene bla 20900 21583 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFY5 protein_id gnl|my_center|LOCUS_15120 22116 22313 gene locus_tag LOCUS_15130 22116 22313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639145.2 protein_id gnl|my_center|LOCUS_15130 24728 22461 gene locus_tag LOCUS_15140 gene katG2 24728 22461 CDS product catalase-peroxidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIV5 protein_id gnl|my_center|LOCUS_15140 26384 25044 gene locus_tag LOCUS_15150 26384 25044 CDS product L-cystine transporter tcyP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881009.1 protein_id gnl|my_center|LOCUS_15150 26709 27236 gene locus_tag LOCUS_15160 26709 27236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 28464 27322 gene locus_tag LOCUS_15170 28464 27322 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 protein_id gnl|my_center|LOCUS_15170 28575 29459 gene locus_tag LOCUS_15180 28575 29459 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096566.1 protein_id gnl|my_center|LOCUS_15180 30731 29463 gene locus_tag LOCUS_15190 30731 29463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347434.1 protein_id gnl|my_center|LOCUS_15190 32740 30851 gene locus_tag LOCUS_15200 32740 30851 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881100.1 protein_id gnl|my_center|LOCUS_15200 32993 33403 gene locus_tag LOCUS_15210 32993 33403 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114423.1 protein_id gnl|my_center|LOCUS_15210 34155 33400 gene locus_tag LOCUS_15220 34155 33400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 35248 34250 gene locus_tag LOCUS_15230 gene adiY 35248 34250 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208461.1 protein_id gnl|my_center|LOCUS_15230 35345 35794 gene locus_tag LOCUS_15240 35345 35794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 35784 36608 gene locus_tag LOCUS_15250 35784 36608 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706610.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence033 <1 1116 gene locus_tag LOCUS_15260 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EA43:phosphoribosylaminoimidazole-succinocarboxamide synthase 1280 1939 gene locus_tag LOCUS_15270 1280 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1932 4244 gene locus_tag LOCUS_15280 1932 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405354.1 protein_id gnl|my_center|LOCUS_15280 4231 5064 gene locus_tag LOCUS_15290 4231 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037665.1 protein_id gnl|my_center|LOCUS_15290 5064 5483 gene locus_tag LOCUS_15300 5064 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 5576 6643 gene locus_tag LOCUS_15310 5576 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 6640 6810 gene locus_tag LOCUS_15320 6640 6810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15320 6907 7035 gene locus_tag LOCUS_15330 6907 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15330 8088 7072 gene locus_tag LOCUS_15340 8088 7072 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074271.1 protein_id gnl|my_center|LOCUS_15340 8324 9559 gene locus_tag LOCUS_15350 8324 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 9492 10346 gene locus_tag LOCUS_15360 9492 10346 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203698.1 protein_id gnl|my_center|LOCUS_15360 11871 10315 gene locus_tag LOCUS_15370 11871 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 14356 12047 gene locus_tag LOCUS_15380 14356 12047 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388620.1 protein_id gnl|my_center|LOCUS_15380 15000 15326 gene locus_tag LOCUS_15390 15000 15326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 16448 15480 gene locus_tag LOCUS_15400 gene fbp 16448 15480 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAB6 protein_id gnl|my_center|LOCUS_15400 16661 19039 gene locus_tag LOCUS_15410 16661 19039 CDS product periplasmic metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070915.1 protein_id gnl|my_center|LOCUS_15410 19144 19917 gene locus_tag LOCUS_15420 19144 19917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 21612 19984 gene locus_tag LOCUS_15430 21612 19984 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106074.1 protein_id gnl|my_center|LOCUS_15430 22436 21738 gene locus_tag LOCUS_15440 gene rsuA 22436 21738 CDS product ribosomal small subunit pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGM2 protein_id gnl|my_center|LOCUS_15440 22495 23607 gene locus_tag LOCUS_15450 gene zapE 22495 23607 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAG1 protein_id gnl|my_center|LOCUS_15450 26747 23721 gene locus_tag LOCUS_15460 26747 23721 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071521.1 protein_id gnl|my_center|LOCUS_15460 27319 29460 gene locus_tag LOCUS_15470 27319 29460 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071523.1 protein_id gnl|my_center|LOCUS_15470 29797 29468 gene locus_tag LOCUS_15480 29797 29468 CDS product 5-carboxymethyl-2-hydroxymuconate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458871.1 protein_id gnl|my_center|LOCUS_15480 30402 29815 gene locus_tag LOCUS_15490 30402 29815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 30507 30977 gene locus_tag LOCUS_15500 gene creA 30507 30977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072222.1 protein_id gnl|my_center|LOCUS_15500 30993 31775 gene locus_tag LOCUS_15510 30993 31775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 31778 32401 gene locus_tag LOCUS_15520 31778 32401 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 protein_id gnl|my_center|LOCUS_15520 32436 32930 gene locus_tag LOCUS_15530 32436 32930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 32960 34504 gene locus_tag LOCUS_15540 32960 34504 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 protein_id gnl|my_center|LOCUS_15540 34577 35500 gene locus_tag LOCUS_15550 34577 35500 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence034 <1 2526 gene locus_tag LOCUS_15560 <1 2526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:type IV pili system adhesin PilY 2510 2932 gene locus_tag LOCUS_15570 gene pilE 2510 2932 CDS product type IV minor pilin protein PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073357.1 protein_id gnl|my_center|LOCUS_15570 3488 2955 gene locus_tag LOCUS_15580 3488 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 4108 3563 gene locus_tag LOCUS_15590 4108 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4304 4642 gene locus_tag LOCUS_15600 gene glnB 4304 4642 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420517.1 protein_id gnl|my_center|LOCUS_15600 5486 4725 gene locus_tag LOCUS_15610 5486 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 5628 6605 gene locus_tag LOCUS_15620 gene rluD 5628 6605 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PU17 protein_id gnl|my_center|LOCUS_15620 6615 7340 gene locus_tag LOCUS_15630 6615 7340 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44552 protein_id gnl|my_center|LOCUS_15630 7438 10014 gene locus_tag LOCUS_15640 gene clpB 7438 10014 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQE5 protein_id gnl|my_center|LOCUS_15640 11673 10126 gene locus_tag LOCUS_15650 11673 10126 CDS product aerotaxis receptor Aer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706482.1 protein_id gnl|my_center|LOCUS_15650 12161 13738 gene locus_tag LOCUS_15660 gene gshA 12161 13738 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG77 protein_id gnl|my_center|LOCUS_15660 13879 14487 gene locus_tag LOCUS_15670 13879 14487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073386.1 protein_id gnl|my_center|LOCUS_15670 15379 14543 gene locus_tag LOCUS_15680 15379 14543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_15680 16694 15516 gene locus_tag LOCUS_15690 16694 15516 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704627.1 protein_id gnl|my_center|LOCUS_15690 17652 16846 gene locus_tag LOCUS_15700 17652 16846 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261310.1 protein_id gnl|my_center|LOCUS_15700 17926 19305 gene locus_tag LOCUS_15710 gene ffh 17926 19305 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG22 protein_id gnl|my_center|LOCUS_15710 19567 19815 gene locus_tag LOCUS_15720 gene rpsP 19567 19815 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG23 protein_id gnl|my_center|LOCUS_15720 19833 20369 gene locus_tag LOCUS_15730 gene rimM 19833 20369 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUF9 protein_id gnl|my_center|LOCUS_15730 20369 21136 gene locus_tag LOCUS_15740 gene trmD 20369 21136 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK25 protein_id gnl|my_center|LOCUS_15740 21170 21529 gene locus_tag LOCUS_15750 gene rplS 21170 21529 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7E9 protein_id gnl|my_center|LOCUS_15750 21937 23070 gene locus_tag LOCUS_15760 gene tyrA 21937 23070 CDS product T-protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK33 protein_id gnl|my_center|LOCUS_15760 24298 23141 gene locus_tag LOCUS_15770 gene pheA 24298 23141 CDS product bifunctional chorismate mutase/prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705019.1 protein_id gnl|my_center|LOCUS_15770 24770 27649 gene locus_tag LOCUS_15780 24770 27649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 28920 27721 gene locus_tag LOCUS_15790 gene tyrP 28920 27721 CDS product tyrosine transporter TyrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072133.1 protein_id gnl|my_center|LOCUS_15790 29308 30210 gene locus_tag LOCUS_15800 gene pagO 29308 30210 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_15800 31129 30251 gene locus_tag LOCUS_15810 gene motY 31129 30251 CDS product smf-dependent flagellar motor protein MotY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072693.1 protein_id gnl|my_center|LOCUS_15810 31299 32042 gene locus_tag LOCUS_15820 gene rnt 31299 32042 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDJ2 protein_id gnl|my_center|LOCUS_15820 33651 32026 gene locus_tag LOCUS_15830 33651 32026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704456.1 protein_id gnl|my_center|LOCUS_15830 33952 34308 gene locus_tag LOCUS_tm00010 33952 34308 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 34543 34743 gene locus_tag LOCUS_15840 34543 34743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 34748 35296 gene locus_tag LOCUS_15850 34748 35296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 36221 35424 gene locus_tag LOCUS_15860 36221 35424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence035 89 3 gene locus_tag LOCUS_t00140 89 3 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 199 126 gene locus_tag LOCUS_t00150 199 126 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 301 226 gene locus_tag LOCUS_t00160 301 226 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1063 518 gene locus_tag LOCUS_15870 gene pgsA 1063 518 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071974.1 protein_id gnl|my_center|LOCUS_15870 2929 1106 gene locus_tag LOCUS_15880 gene uvrC 2929 1106 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NC4 protein_id gnl|my_center|LOCUS_15880 3589 2939 gene locus_tag LOCUS_15890 gene uvrY 3589 2939 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706579.1 protein_id gnl|my_center|LOCUS_15890 4849 3698 gene locus_tag LOCUS_15900 4849 3698 CDS product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706715.1 protein_id gnl|my_center|LOCUS_15900 5273 6241 gene locus_tag LOCUS_15910 gene cysK 5273 6241 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED64 protein_id gnl|my_center|LOCUS_15910 6429 6824 gene locus_tag LOCUS_15920 6429 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 9169 6893 gene locus_tag LOCUS_15930 9169 6893 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705253.1 protein_id gnl|my_center|LOCUS_15930 9350 11194 gene locus_tag LOCUS_15940 9350 11194 CDS product peptidase M2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_15940 12075 11281 gene locus_tag LOCUS_15950 12075 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 12666 12292 gene locus_tag LOCUS_15960 12666 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948976.1 protein_id gnl|my_center|LOCUS_15960 13580 12666 gene locus_tag LOCUS_15970 13580 12666 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071977.1 protein_id gnl|my_center|LOCUS_15970 14395 13577 gene locus_tag LOCUS_15980 14395 13577 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071978.1 protein_id gnl|my_center|LOCUS_15980 15700 14519 gene locus_tag LOCUS_15990 gene metC 15700 14519 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072223.1 protein_id gnl|my_center|LOCUS_15990 16669 15746 gene locus_tag LOCUS_16000 16669 15746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 17598 16804 gene locus_tag LOCUS_16010 gene gamA 17598 16804 CDS product putative glucosamine-6-phosphate deaminase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31458 protein_id gnl|my_center|LOCUS_16010 18957 17815 gene locus_tag LOCUS_16020 gene nagX 18957 17815 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_16020 20136 19018 gene locus_tag LOCUS_16030 gene nagA 20136 19018 CDS product N-acetylgalactosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBK8 protein_id gnl|my_center|LOCUS_16030 21050 20136 gene locus_tag LOCUS_16040 gene nagK 21050 20136 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073346.1 protein_id gnl|my_center|LOCUS_16040 21640 21428 gene locus_tag LOCUS_16050 21640 21428 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_16050 22070 21642 gene locus_tag LOCUS_16060 22070 21642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 22697 22191 gene locus_tag LOCUS_16070 22697 22191 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073331.1 protein_id gnl|my_center|LOCUS_16070 22852 23481 gene locus_tag LOCUS_16080 22852 23481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 23478 24224 gene locus_tag LOCUS_16090 23478 24224 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836846.1 protein_id gnl|my_center|LOCUS_16090 25684 24281 gene locus_tag LOCUS_16100 gene rhlE 25684 24281 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E175 protein_id gnl|my_center|LOCUS_16100 26733 25894 gene locus_tag LOCUS_16110 26733 25894 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455357.1 protein_id gnl|my_center|LOCUS_16110 26988 28190 gene locus_tag LOCUS_16120 26988 28190 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085686.1 protein_id gnl|my_center|LOCUS_16120 28903 28247 gene locus_tag LOCUS_16130 28903 28247 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964442.1 protein_id gnl|my_center|LOCUS_16130 29161 29484 gene locus_tag LOCUS_16140 29161 29484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 30120 29515 gene locus_tag LOCUS_16150 30120 29515 CDS product pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020556.1 protein_id gnl|my_center|LOCUS_16150 31990 30212 gene locus_tag LOCUS_16160 gene aspS 31990 30212 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6A2 protein_id gnl|my_center|LOCUS_16160 32193 33041 gene locus_tag LOCUS_16170 32193 33041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705417.1 protein_id gnl|my_center|LOCUS_16170 33080 33577 gene locus_tag LOCUS_16180 gene ygjP 33080 33577 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263044.1 protein_id gnl|my_center|LOCUS_16180 34519 33626 gene locus_tag LOCUS_16190 34519 33626 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071481.1 protein_id gnl|my_center|LOCUS_16190 34642 35898 gene locus_tag LOCUS_16200 gene purA 34642 35898 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5Y9 protein_id gnl|my_center|LOCUS_16200 >Feature sequence036 1409 537 gene locus_tag LOCUS_16210 1409 537 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463614.1 protein_id gnl|my_center|LOCUS_16210 1587 1799 gene locus_tag LOCUS_16220 1587 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2052 4184 gene locus_tag LOCUS_16230 gene dcp 2052 4184 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073393.1 protein_id gnl|my_center|LOCUS_16230 4329 5756 gene locus_tag LOCUS_16240 4329 5756 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_16240 5848 6693 gene locus_tag LOCUS_16250 gene yigM 5848 6693 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418680.1 protein_id gnl|my_center|LOCUS_16250 6763 8088 gene locus_tag LOCUS_16260 6763 8088 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390393.1 protein_id gnl|my_center|LOCUS_16260 8158 8892 gene locus_tag LOCUS_16270 8158 8892 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121775.1 protein_id gnl|my_center|LOCUS_16270 9824 8901 gene locus_tag LOCUS_16280 9824 8901 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261697.1 protein_id gnl|my_center|LOCUS_16280 9969 10652 gene locus_tag LOCUS_16290 9969 10652 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268356.1 protein_id gnl|my_center|LOCUS_16290 10756 11352 gene locus_tag LOCUS_16300 10756 11352 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406500.1 protein_id gnl|my_center|LOCUS_16300 11588 12427 gene locus_tag LOCUS_16310 gene yghU 11588 12427 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169755.1 protein_id gnl|my_center|LOCUS_16310 12975 12472 gene locus_tag LOCUS_16320 12975 12472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 13337 13936 gene locus_tag LOCUS_16330 gene azoR 13337 13936 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62DD3 protein_id gnl|my_center|LOCUS_16330 14156 14584 gene locus_tag LOCUS_16340 14156 14584 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096537.1 protein_id gnl|my_center|LOCUS_16340 15303 14692 gene locus_tag LOCUS_16350 15303 14692 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117903.1 protein_id gnl|my_center|LOCUS_16350 15398 16711 gene locus_tag LOCUS_16360 gene cry1 15398 16711 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR33 protein_id gnl|my_center|LOCUS_16360 18051 16792 gene locus_tag LOCUS_16370 18051 16792 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764988.1 protein_id gnl|my_center|LOCUS_16370 18388 19545 gene locus_tag LOCUS_16380 18388 19545 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974314.1 protein_id gnl|my_center|LOCUS_16380 20008 20973 gene locus_tag LOCUS_16390 gene scrK 20008 20973 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036695.1 protein_id gnl|my_center|LOCUS_16390 21143 22657 gene locus_tag LOCUS_16400 gene cry2 21143 22657 CDS product cryptochrome-like protein cry2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KS67 protein_id gnl|my_center|LOCUS_16400 22941 23495 gene locus_tag LOCUS_16410 22941 23495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 23839 25014 gene locus_tag LOCUS_16420 23839 25014 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 protein_id gnl|my_center|LOCUS_16420 25340 25077 gene locus_tag LOCUS_16430 25340 25077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 30690 25369 gene locus_tag LOCUS_16440 30690 25369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 protein_id gnl|my_center|LOCUS_16440 32874 30772 gene locus_tag LOCUS_16450 32874 30772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 protein_id gnl|my_center|LOCUS_16450 33560 32937 gene locus_tag LOCUS_16460 33560 32937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 protein_id gnl|my_center|LOCUS_16460 35268 33778 gene locus_tag LOCUS_16470 35268 33778 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266859.1 protein_id gnl|my_center|LOCUS_16470 35459 35629 gene locus_tag LOCUS_16480 35459 35629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence037 2222 234 gene locus_tag LOCUS_16490 2222 234 CDS product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839094.1 protein_id gnl|my_center|LOCUS_16490 3058 2387 gene locus_tag LOCUS_16500 3058 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D8 protein_id gnl|my_center|LOCUS_16500 4610 3090 gene locus_tag LOCUS_16510 4610 3090 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447090.1 protein_id gnl|my_center|LOCUS_16510 4825 5424 gene locus_tag LOCUS_16520 gene htrG 4825 5424 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262660.1 protein_id gnl|my_center|LOCUS_16520 6384 5926 gene locus_tag LOCUS_16530 6384 5926 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378234.1 protein_id gnl|my_center|LOCUS_16530 6579 10382 gene locus_tag LOCUS_16540 gene putA 6579 10382 CDS product bifunctional protein PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUU6 protein_id gnl|my_center|LOCUS_16540 10491 11687 gene locus_tag LOCUS_16550 10491 11687 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706654.1 protein_id gnl|my_center|LOCUS_16550 12760 11735 gene locus_tag LOCUS_16560 12760 11735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 13691 12774 gene locus_tag LOCUS_16570 13691 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 13820 14926 gene locus_tag LOCUS_16580 gene cca 13820 14926 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZI64 protein_id gnl|my_center|LOCUS_16580 15445 14936 gene locus_tag LOCUS_16590 15445 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 17115 15442 gene locus_tag LOCUS_16600 17115 15442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 17552 17220 gene locus_tag LOCUS_16610 17552 17220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 18267 17569 gene locus_tag LOCUS_16620 18267 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705682.1 protein_id gnl|my_center|LOCUS_16620 18544 19596 gene locus_tag LOCUS_16630 18544 19596 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 protein_id gnl|my_center|LOCUS_16630 19600 22698 gene locus_tag LOCUS_16640 19600 22698 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_16640 22849 23385 gene locus_tag LOCUS_16650 gene msrA 22849 23385 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_16650 25318 23474 gene locus_tag LOCUS_16660 gene btuB 25318 23474 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEE6 protein_id gnl|my_center|LOCUS_16660 26186 25704 gene locus_tag LOCUS_16670 26186 25704 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHB9 protein_id gnl|my_center|LOCUS_16670 26348 26701 gene locus_tag LOCUS_16680 26348 26701 CDS product teicoplanin resistance protein VanZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073586.1 protein_id gnl|my_center|LOCUS_16680 26694 27596 gene locus_tag LOCUS_16690 gene panE 26694 27596 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPQ9 protein_id gnl|my_center|LOCUS_16690 29083 27626 gene locus_tag LOCUS_16700 gene thiI 29083 27626 CDS product tRNA sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6Y5 protein_id gnl|my_center|LOCUS_16700 29838 29188 gene locus_tag LOCUS_16710 29838 29188 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074266.1 protein_id gnl|my_center|LOCUS_16710 30089 30571 gene locus_tag LOCUS_16720 gene coaD 30089 30571 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8I0 protein_id gnl|my_center|LOCUS_16720 30568 31971 gene locus_tag LOCUS_16730 30568 31971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 33020 32487 gene locus_tag LOCUS_16740 33020 32487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 33246 33037 gene locus_tag LOCUS_16750 33246 33037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 35387 33522 gene locus_tag LOCUS_16760 gene argH 35387 33522 CDS product bifunctional protein ArgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59620 protein_id gnl|my_center|LOCUS_16760 >Feature sequence038 <1 1253 gene locus_tag LOCUS_16770 <1 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478321.1:Ktr system potassium transporter B 1841 2026 gene locus_tag LOCUS_16780 1841 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2557 2231 gene locus_tag LOCUS_16790 2557 2231 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704510.1 protein_id gnl|my_center|LOCUS_16790 4552 2603 gene locus_tag LOCUS_16800 4552 2603 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072362.1 protein_id gnl|my_center|LOCUS_16800 4820 6124 gene locus_tag LOCUS_16810 4820 6124 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706404.1 protein_id gnl|my_center|LOCUS_16810 7523 6549 gene locus_tag LOCUS_16820 7523 6549 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071693.1 protein_id gnl|my_center|LOCUS_16820 8460 7711 gene locus_tag LOCUS_16830 8460 7711 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978021.1 protein_id gnl|my_center|LOCUS_16830 8759 10264 gene locus_tag LOCUS_16840 8759 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 11714 10317 gene locus_tag LOCUS_16850 gene eutP 11714 10317 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206269.1 protein_id gnl|my_center|LOCUS_16850 12635 11766 gene locus_tag LOCUS_16860 gene eutC 12635 11766 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX02 protein_id gnl|my_center|LOCUS_16860 14038 12632 gene locus_tag LOCUS_16870 gene eutB 14038 12632 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103255.1 protein_id gnl|my_center|LOCUS_16870 14284 15234 gene locus_tag LOCUS_16880 14284 15234 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205308.1 protein_id gnl|my_center|LOCUS_16880 15923 15258 gene locus_tag LOCUS_16890 15923 15258 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978021.1 protein_id gnl|my_center|LOCUS_16890 18769 16142 gene locus_tag LOCUS_16900 18769 16142 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482861.1 protein_id gnl|my_center|LOCUS_16900 20432 18837 gene locus_tag LOCUS_16910 20432 18837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 23691 20491 gene locus_tag LOCUS_16920 23691 20491 CDS product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261622.1 protein_id gnl|my_center|LOCUS_16920 24320 24120 gene locus_tag LOCUS_16930 24320 24120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 27065 24429 gene locus_tag LOCUS_16940 27065 24429 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919539.1 protein_id gnl|my_center|LOCUS_16940 27903 27253 gene locus_tag LOCUS_16950 27903 27253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 29990 28827 gene locus_tag LOCUS_16960 29990 28827 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072495.1 protein_id gnl|my_center|LOCUS_16960 31990 29987 gene locus_tag LOCUS_16970 31990 29987 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072496.1 protein_id gnl|my_center|LOCUS_16970 32404 32015 gene locus_tag LOCUS_16980 32404 32015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 32866 33129 gene locus_tag LOCUS_16990 32866 33129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 33153 34544 gene locus_tag LOCUS_17000 33153 34544 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072500.1 protein_id gnl|my_center|LOCUS_17000 35061 34624 gene locus_tag LOCUS_17010 35061 34624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence039 48 980 gene locus_tag LOCUS_17020 48 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073538.1 protein_id gnl|my_center|LOCUS_17020 1019 1918 gene locus_tag LOCUS_17030 1019 1918 CDS product ATP synthase F0 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073539.1 protein_id gnl|my_center|LOCUS_17030 1922 3643 gene locus_tag LOCUS_17040 gene speE 1922 3643 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAX8 protein_id gnl|my_center|LOCUS_17040 3723 4136 gene locus_tag LOCUS_17050 3723 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007645549.1 protein_id gnl|my_center|LOCUS_17050 4167 4859 gene locus_tag LOCUS_17060 4167 4859 CDS product phage shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073541.1 protein_id gnl|my_center|LOCUS_17060 4925 5563 gene locus_tag LOCUS_17070 4925 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073542.1 protein_id gnl|my_center|LOCUS_17070 5560 5877 gene locus_tag LOCUS_17080 5560 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 5941 6126 gene locus_tag LOCUS_17090 5941 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 6544 6146 gene locus_tag LOCUS_17100 6544 6146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 7032 6556 gene locus_tag LOCUS_17110 7032 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 8526 7150 gene locus_tag LOCUS_17120 gene fumC 8526 7150 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRR3 protein_id gnl|my_center|LOCUS_17120 8900 8535 gene locus_tag LOCUS_17130 8900 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 9178 8999 gene locus_tag LOCUS_17140 9178 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 9377 9967 gene locus_tag LOCUS_17150 9377 9967 CDS product methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_17150 11106 9964 gene locus_tag LOCUS_17160 11106 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813554.1 protein_id gnl|my_center|LOCUS_17160 12470 11106 gene locus_tag LOCUS_17170 12470 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 15186 12460 gene locus_tag LOCUS_17180 15186 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 15718 15260 gene locus_tag LOCUS_17190 15718 15260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 15862 17034 gene locus_tag LOCUS_17200 gene kynA 15862 17034 CDS product tryptophan 2,3-dioxygenase KynA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074060.1 protein_id gnl|my_center|LOCUS_17200 17036 18151 gene locus_tag LOCUS_17210 gene kynU 17036 18151 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074059.1 protein_id gnl|my_center|LOCUS_17210 18612 18154 gene locus_tag LOCUS_17220 18612 18154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 22020 18748 gene locus_tag LOCUS_17230 22020 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 22193 23611 gene locus_tag LOCUS_17240 22193 23611 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055873.1 protein_id gnl|my_center|LOCUS_17240 23971 23618 gene locus_tag LOCUS_17250 23971 23618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 26178 24073 gene locus_tag LOCUS_17260 26178 24073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 27021 26365 gene locus_tag LOCUS_17270 27021 26365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 27620 27249 gene locus_tag LOCUS_17280 27620 27249 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44956 protein_id gnl|my_center|LOCUS_17280 27710 28342 gene locus_tag LOCUS_17290 27710 28342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 30253 28409 gene locus_tag LOCUS_17300 30253 28409 CDS product cold-active zinc metallopeptidase M1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072084.1 protein_id gnl|my_center|LOCUS_17300 30397 31407 gene locus_tag LOCUS_17310 gene murB 30397 31407 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK85 protein_id gnl|my_center|LOCUS_17310 31404 32396 gene locus_tag LOCUS_17320 gene birA 31404 32396 CDS product bifunctional ligase/repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KP6 protein_id gnl|my_center|LOCUS_17320 32393 33088 gene locus_tag LOCUS_17330 gene coaX 32393 33088 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWC1 protein_id gnl|my_center|LOCUS_17330 33209 33284 gene locus_tag LOCUS_t00170 33209 33284 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 33324 33408 gene locus_tag LOCUS_t00180 33324 33408 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 33454 33528 gene locus_tag LOCUS_t00190 33454 33528 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 33541 33616 gene locus_tag LOCUS_t00200 33541 33616 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence040 611 3 gene locus_tag LOCUS_17340 gene recR 611 3 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MQ4 protein_id gnl|my_center|LOCUS_17340 946 620 gene locus_tag LOCUS_17350 946 620 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD5 protein_id gnl|my_center|LOCUS_17350 3359 1002 gene locus_tag LOCUS_17360 3359 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 3908 3363 gene locus_tag LOCUS_17370 gene apt 3908 3363 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG1 protein_id gnl|my_center|LOCUS_17370 4168 4046 gene locus_tag LOCUS_17380 4168 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 5000 4242 gene locus_tag LOCUS_17390 5000 4242 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072093.1 protein_id gnl|my_center|LOCUS_17390 5847 4993 gene locus_tag LOCUS_17400 5847 4993 CDS product UPF0276 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFG5 protein_id gnl|my_center|LOCUS_17400 6396 5935 gene locus_tag LOCUS_17410 6396 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072091.1 protein_id gnl|my_center|LOCUS_17410 6605 7561 gene locus_tag LOCUS_17420 gene dusC 6605 7561 CDS product tRNA-dihydrouridine(16) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KKD1 protein_id gnl|my_center|LOCUS_17420 7627 7977 gene locus_tag LOCUS_17430 7627 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 9004 7994 gene locus_tag LOCUS_17440 9004 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 10368 9109 gene locus_tag LOCUS_17450 10368 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 10997 10380 gene locus_tag LOCUS_17460 gene tonB2 10997 10380 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFY6 protein_id gnl|my_center|LOCUS_17460 11401 10997 gene locus_tag LOCUS_17470 gene exbD 11401 10997 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 protein_id gnl|my_center|LOCUS_17470 11940 11416 gene locus_tag LOCUS_17480 gene exbB 11940 11416 CDS product TonB2 energy transduction system inner membrane component ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071946.1 protein_id gnl|my_center|LOCUS_17480 13304 11940 gene locus_tag LOCUS_17490 gene ttpC 13304 11940 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071945.1 protein_id gnl|my_center|LOCUS_17490 14009 13311 gene locus_tag LOCUS_17500 14009 13311 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459021.1 protein_id gnl|my_center|LOCUS_17500 15352 15143 gene locus_tag LOCUS_17510 15352 15143 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_17510 16727 15675 gene locus_tag LOCUS_17520 gene pyrC 16727 15675 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB40 protein_id gnl|my_center|LOCUS_17520 16977 19346 gene locus_tag LOCUS_17530 16977 19346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 20734 19406 gene locus_tag LOCUS_17540 20734 19406 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704871.1 protein_id gnl|my_center|LOCUS_17540 21953 20892 gene locus_tag LOCUS_17550 gene bamC 21953 20892 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGP4 protein_id gnl|my_center|LOCUS_17550 22306 22839 gene locus_tag LOCUS_17560 gene gcvR 22306 22839 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071987.1 protein_id gnl|my_center|LOCUS_17560 22850 23326 gene locus_tag LOCUS_17570 22850 23326 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704834.1 protein_id gnl|my_center|LOCUS_17570 23853 23467 gene locus_tag LOCUS_17580 23853 23467 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530093.1 protein_id gnl|my_center|LOCUS_17580 24943 24062 gene locus_tag LOCUS_17590 24943 24062 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209850.1 protein_id gnl|my_center|LOCUS_17590 25658 25011 gene locus_tag LOCUS_17600 25658 25011 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073322.1 protein_id gnl|my_center|LOCUS_17600 25776 26669 gene locus_tag LOCUS_17610 25776 26669 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771227.1 protein_id gnl|my_center|LOCUS_17610 27414 27157 gene locus_tag LOCUS_17620 27414 27157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 27922 30345 gene locus_tag LOCUS_17630 27922 30345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 30600 30884 gene locus_tag LOCUS_17640 30600 30884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 <33359 30903 gene locus_tag LOCUS_17650 <33359 30903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036288.1:excinuclease ABC subunit A >Feature sequence041 <1 1317 gene locus_tag LOCUS_17660 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707113.1:acetyl-CoA carboxylase biotin carboxylase subunit 1446 1919 gene locus_tag LOCUS_17670 1446 1919 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704860.1 protein_id gnl|my_center|LOCUS_17670 1973 3292 gene locus_tag LOCUS_17680 gene amiB 1973 3292 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070931.1 protein_id gnl|my_center|LOCUS_17680 3309 5156 gene locus_tag LOCUS_17690 gene mutL 3309 5156 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z187 protein_id gnl|my_center|LOCUS_17690 5167 6084 gene locus_tag LOCUS_17700 gene miaA 5167 6084 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGS0 protein_id gnl|my_center|LOCUS_17700 6164 6427 gene locus_tag LOCUS_17710 gene hfq 6164 6427 CDS product RNA-binding protein Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2C8 protein_id gnl|my_center|LOCUS_17710 6444 7727 gene locus_tag LOCUS_17720 gene hflX 6444 7727 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGS2 protein_id gnl|my_center|LOCUS_17720 7834 9000 gene locus_tag LOCUS_17730 gene hflK 7834 9000 CDS product protease modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704866.1 protein_id gnl|my_center|LOCUS_17730 9006 9884 gene locus_tag LOCUS_17740 gene hflC 9006 9884 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGS4 protein_id gnl|my_center|LOCUS_17740 10102 11415 gene locus_tag LOCUS_17750 gene purA 10102 11415 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2D3 protein_id gnl|my_center|LOCUS_17750 11564 12187 gene locus_tag LOCUS_17760 11564 12187 CDS product sodium-type flagellar protein MotX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883957.1 protein_id gnl|my_center|LOCUS_17760 14116 12254 gene locus_tag LOCUS_17770 14116 12254 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704521.1 protein_id gnl|my_center|LOCUS_17770 15036 16142 gene locus_tag LOCUS_17780 gene proB 15036 16142 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S355 protein_id gnl|my_center|LOCUS_17780 16139 17386 gene locus_tag LOCUS_17790 gene proA 16139 17386 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S354 protein_id gnl|my_center|LOCUS_17790 17655 17580 gene locus_tag LOCUS_t00210 17655 17580 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17831 18220 gene locus_tag LOCUS_17800 17831 18220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 18221 18721 gene locus_tag LOCUS_17810 18221 18721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144704.1 protein_id gnl|my_center|LOCUS_17810 19830 18688 gene locus_tag LOCUS_17820 19830 18688 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545276.1 protein_id gnl|my_center|LOCUS_17820 20316 20855 gene locus_tag LOCUS_17830 20316 20855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268590.1 protein_id gnl|my_center|LOCUS_17830 20998 21321 gene locus_tag LOCUS_17840 20998 21321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 21482 22249 gene locus_tag LOCUS_17850 21482 22249 CDS product putative aldolase class 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYH5 protein_id gnl|my_center|LOCUS_17850 22278 23453 gene locus_tag LOCUS_17860 22278 23453 CDS product MR-MLE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236009.1 protein_id gnl|my_center|LOCUS_17860 23983 23603 gene locus_tag LOCUS_17870 23983 23603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 25586 24015 gene locus_tag LOCUS_17880 25586 24015 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_17880 26477 25635 gene locus_tag LOCUS_17890 26477 25635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55567 protein_id gnl|my_center|LOCUS_17890 27202 26474 gene locus_tag LOCUS_17900 27202 26474 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930638.1 protein_id gnl|my_center|LOCUS_17900 27700 27212 gene locus_tag LOCUS_17910 27700 27212 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EFH7 protein_id gnl|my_center|LOCUS_17910 29276 27777 gene locus_tag LOCUS_17920 29276 27777 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 protein_id gnl|my_center|LOCUS_17920 30341 29322 gene locus_tag LOCUS_17930 30341 29322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 30748 30449 gene locus_tag LOCUS_17940 30748 30449 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LM1 protein_id gnl|my_center|LOCUS_17940 30978 30748 gene locus_tag LOCUS_17950 30978 30748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103147.1 protein_id gnl|my_center|LOCUS_17950 31186 32052 gene locus_tag LOCUS_17960 gene yhiR 31186 32052 CDS product ribosomal RNA large subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X5Q1 protein_id gnl|my_center|LOCUS_17960 32919 32104 gene locus_tag LOCUS_17970 32919 32104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence042 1903 983 gene locus_tag LOCUS_17980 1903 983 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490863.1 protein_id gnl|my_center|LOCUS_17980 2027 2311 gene locus_tag LOCUS_17990 2027 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 2388 4409 gene locus_tag LOCUS_18000 2388 4409 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073445.1 protein_id gnl|my_center|LOCUS_18000 7127 4494 gene locus_tag LOCUS_18010 7127 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 7294 8760 gene locus_tag LOCUS_18020 gene ubiD 7294 8760 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CR58 protein_id gnl|my_center|LOCUS_18020 8847 9560 gene locus_tag LOCUS_18030 gene fre 8847 9560 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704132.1 protein_id gnl|my_center|LOCUS_18030 9666 9986 gene locus_tag LOCUS_18040 9666 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 10016 10729 gene locus_tag LOCUS_18050 10016 10729 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479958.1 protein_id gnl|my_center|LOCUS_18050 10838 11245 gene locus_tag LOCUS_18060 10838 11245 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880837.1 protein_id gnl|my_center|LOCUS_18060 12327 11317 gene locus_tag LOCUS_18070 12327 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 13468 12461 gene locus_tag LOCUS_18080 gene add 13468 12461 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TF3 protein_id gnl|my_center|LOCUS_18080 16287 13594 gene locus_tag LOCUS_18090 16287 13594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 17435 16326 gene locus_tag LOCUS_18100 17435 16326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 19297 17432 gene locus_tag LOCUS_18110 19297 17432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 20248 19298 gene locus_tag LOCUS_18120 gene hemC 20248 19298 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFH6 protein_id gnl|my_center|LOCUS_18120 21201 20299 gene locus_tag LOCUS_18130 21201 20299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 21883 21227 gene locus_tag LOCUS_18140 21883 21227 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072086.1 protein_id gnl|my_center|LOCUS_18140 22203 21880 gene locus_tag LOCUS_18150 gene cyaY 22203 21880 CDS product protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q329Y2 protein_id gnl|my_center|LOCUS_18150 22352 22546 gene locus_tag LOCUS_18160 22352 22546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 22546 23799 gene locus_tag LOCUS_18170 gene lysA 22546 23799 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KJ3 protein_id gnl|my_center|LOCUS_18170 23862 24692 gene locus_tag LOCUS_18180 gene dapF 23862 24692 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFI1 protein_id gnl|my_center|LOCUS_18180 24689 25321 gene locus_tag LOCUS_18190 24689 25321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 25318 26283 gene locus_tag LOCUS_18200 gene xerC 25318 26283 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFI3 protein_id gnl|my_center|LOCUS_18200 26296 27009 gene locus_tag LOCUS_18210 26296 27009 CDS product 2-haloalkanoic acid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478999.1 protein_id gnl|my_center|LOCUS_18210 27027 28139 gene locus_tag LOCUS_18220 27027 28139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 28148 28504 gene locus_tag LOCUS_18230 28148 28504 CDS product type III effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106301.1 protein_id gnl|my_center|LOCUS_18230 28907 28497 gene locus_tag LOCUS_18240 28907 28497 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073595.1 protein_id gnl|my_center|LOCUS_18240 29260 28955 gene locus_tag LOCUS_18250 29260 28955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 29346 30038 gene locus_tag LOCUS_18260 29346 30038 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PTX7 protein_id gnl|my_center|LOCUS_18260 30120 30494 gene locus_tag LOCUS_18270 30120 30494 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919513.1 protein_id gnl|my_center|LOCUS_18270 30504 31715 gene locus_tag LOCUS_18280 30504 31715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence043 1892 1056 gene locus_tag LOCUS_18290 1892 1056 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070486.1 protein_id gnl|my_center|LOCUS_18290 2269 1895 gene locus_tag LOCUS_18300 2269 1895 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070485.1 protein_id gnl|my_center|LOCUS_18300 2411 3883 gene locus_tag LOCUS_18310 2411 3883 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070484.1 protein_id gnl|my_center|LOCUS_18310 3887 4621 gene locus_tag LOCUS_18320 gene natA 3887 4621 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070483.1 protein_id gnl|my_center|LOCUS_18320 4618 5757 gene locus_tag LOCUS_18330 gene natB 4618 5757 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070482.1 protein_id gnl|my_center|LOCUS_18330 6558 6037 gene locus_tag LOCUS_18340 6558 6037 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SB6 protein_id gnl|my_center|LOCUS_18340 6651 7592 gene locus_tag LOCUS_18350 gene xerD 6651 7592 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPM0 protein_id gnl|my_center|LOCUS_18350 7657 8385 gene locus_tag LOCUS_18360 gene dsbC 7657 8385 CDS product thiol:disulfide interchange protein DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 protein_id gnl|my_center|LOCUS_18360 8461 10182 gene locus_tag LOCUS_18370 gene recJ 8461 10182 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707042.1 protein_id gnl|my_center|LOCUS_18370 10584 11435 gene locus_tag LOCUS_18380 gene prfB 10584 11435 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7P9 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18380 11462 12997 gene locus_tag LOCUS_18390 gene lysS 11462 12997 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7P8 protein_id gnl|my_center|LOCUS_18390 13272 13454 gene locus_tag LOCUS_18400 13272 13454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 13584 13676 gene locus_tag LOCUS_t00220 13584 13676 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13714 13790 gene locus_tag LOCUS_t00230 13714 13790 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13943 14019 gene locus_tag LOCUS_t00240 13943 14019 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14154 14230 gene locus_tag LOCUS_t00250 14154 14230 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14703 16070 gene locus_tag LOCUS_18410 14703 16070 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_18410 18244 16229 gene locus_tag LOCUS_18420 gene nicT 18244 16229 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071046.1 protein_id gnl|my_center|LOCUS_18420 18393 19730 gene locus_tag LOCUS_18430 18393 19730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 19784 21166 gene locus_tag LOCUS_18440 19784 21166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038887.1 protein_id gnl|my_center|LOCUS_18440 21176 22288 gene locus_tag LOCUS_18450 gene tcbD 21176 22288 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038888.1 protein_id gnl|my_center|LOCUS_18450 22285 23049 gene locus_tag LOCUS_18460 22285 23049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038889.1 protein_id gnl|my_center|LOCUS_18460 23166 24752 gene locus_tag LOCUS_18470 23166 24752 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403153.1 protein_id gnl|my_center|LOCUS_18470 24755 25660 gene locus_tag LOCUS_18480 24755 25660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204178.1 protein_id gnl|my_center|LOCUS_18480 25657 26592 gene locus_tag LOCUS_18490 gene murQ2 25657 26592 CDS product N-acetylmuramic acid 6-phosphate etherase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KU39 protein_id gnl|my_center|LOCUS_18490 26593 27783 gene locus_tag LOCUS_18500 26593 27783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_18500 27892 28416 gene locus_tag LOCUS_18510 27892 28416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence044 985 773 gene locus_tag LOCUS_18520 985 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 1352 1134 gene locus_tag LOCUS_18530 1352 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1642 1430 gene locus_tag LOCUS_18540 1642 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2775 2095 gene locus_tag LOCUS_18550 2775 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 4277 2826 gene locus_tag LOCUS_18560 gene trkH 4277 2826 CDS product Trk system potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR6 protein_id gnl|my_center|LOCUS_18560 4943 4329 gene locus_tag LOCUS_18570 4943 4329 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048716.1 protein_id gnl|my_center|LOCUS_18570 6334 5012 gene locus_tag LOCUS_18580 gene pepQ 6334 5012 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR8 protein_id gnl|my_center|LOCUS_18580 8309 6423 gene locus_tag LOCUS_18590 8309 6423 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_18590 8504 10663 gene locus_tag LOCUS_18600 gene fadB 8504 10663 CDS product fatty acid oxidation complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNI1 protein_id gnl|my_center|LOCUS_18600 10668 11837 gene locus_tag LOCUS_18610 gene fadA 10668 11837 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNI0 protein_id gnl|my_center|LOCUS_18610 12038 12277 gene locus_tag LOCUS_18620 gene tusA 12038 12277 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32AR4 protein_id gnl|my_center|LOCUS_18620 14119 12308 gene locus_tag LOCUS_18630 14119 12308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207273.1 protein_id gnl|my_center|LOCUS_18630 14624 14157 gene locus_tag LOCUS_18640 14624 14157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 15287 14838 gene locus_tag LOCUS_18650 15287 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 17418 15349 gene locus_tag LOCUS_18660 gene glyS 17418 15349 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8Y5 protein_id gnl|my_center|LOCUS_18660 18323 17421 gene locus_tag LOCUS_18670 gene glyQ 18323 17421 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS5 protein_id gnl|my_center|LOCUS_18670 20893 18467 gene locus_tag LOCUS_18680 gene gyrB 20893 18467 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKS9 protein_id gnl|my_center|LOCUS_18680 22000 20906 gene locus_tag LOCUS_18690 gene recF 22000 20906 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKT0 protein_id gnl|my_center|LOCUS_18690 23110 22007 gene locus_tag LOCUS_18700 gene dnaN 23110 22007 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEE7 protein_id gnl|my_center|LOCUS_18700 24515 23124 gene locus_tag LOCUS_18710 gene dnaA 24515 23124 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2N6 protein_id gnl|my_center|LOCUS_18710 25165 25590 gene locus_tag LOCUS_18720 gene rnpA 25165 25590 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQZ9 protein_id gnl|my_center|LOCUS_18720 25717 25992 gene locus_tag LOCUS_18730 gene yidD 25717 25992 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A8C8 protein_id gnl|my_center|LOCUS_18730 26001 27635 gene locus_tag LOCUS_18740 gene yidC 26001 27635 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQZ7 protein_id gnl|my_center|LOCUS_18740 >Feature sequence045 3770 546 gene locus_tag LOCUS_18750 3770 546 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640062.1 protein_id gnl|my_center|LOCUS_18750 4030 4170 gene locus_tag LOCUS_18760 4030 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 5705 4167 gene locus_tag LOCUS_18770 gene pckA 5705 4167 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKD3 protein_id gnl|my_center|LOCUS_18770 6817 5972 gene locus_tag LOCUS_18780 gene hslO 6817 5972 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFS3 protein_id gnl|my_center|LOCUS_18780 7249 6830 gene locus_tag LOCUS_18790 gene hslR 7249 6830 CDS product heat shock protein 15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CFW8 protein_id gnl|my_center|LOCUS_18790 7458 8405 gene locus_tag LOCUS_18800 gene gspC 7458 8405 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070562.1 protein_id gnl|my_center|LOCUS_18800 8429 10489 gene locus_tag LOCUS_18810 gene gspD 8429 10489 CDS product type II secretion system protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070563.1 protein_id gnl|my_center|LOCUS_18810 10482 12041 gene locus_tag LOCUS_18820 gene gspE 10482 12041 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070564.1 protein_id gnl|my_center|LOCUS_18820 12044 13279 gene locus_tag LOCUS_18830 gene epsF 12044 13279 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45780 protein_id gnl|my_center|LOCUS_18830 13348 13773 gene locus_tag LOCUS_18840 gene gspG 13348 13773 CDS product type II secretion system protein GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308483.1 protein_id gnl|my_center|LOCUS_18840 13823 14425 gene locus_tag LOCUS_18850 gene gspH 13823 14425 CDS product type II secretion system protein GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262829.1 protein_id gnl|my_center|LOCUS_18850 14425 14802 gene locus_tag LOCUS_18860 gene gspI 14425 14802 CDS product type II secretion system protein GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704544.1 protein_id gnl|my_center|LOCUS_18860 14803 15426 gene locus_tag LOCUS_18870 gene gspJ 14803 15426 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262827.1 protein_id gnl|my_center|LOCUS_18870 15416 16405 gene locus_tag LOCUS_18880 gene gspK 15416 16405 CDS product type II secretion system protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC2 protein_id gnl|my_center|LOCUS_18880 16402 17610 gene locus_tag LOCUS_18890 gene gspL 16402 17610 CDS product type II secretion system protein L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKC1 protein_id gnl|my_center|LOCUS_18890 17607 18080 gene locus_tag LOCUS_18900 17607 18080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 18084 18842 gene locus_tag LOCUS_18910 18084 18842 CDS product general secretion pathway protein GspN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459010.1 protein_id gnl|my_center|LOCUS_18910 18861 19481 gene locus_tag LOCUS_18920 18861 19481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 19687 19484 gene locus_tag LOCUS_18930 19687 19484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071752.1 protein_id gnl|my_center|LOCUS_18930 20046 19687 gene locus_tag LOCUS_18940 20046 19687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 20338 21768 gene locus_tag LOCUS_18950 gene ccoG 20338 21768 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074321.1 protein_id gnl|my_center|LOCUS_18950 21833 22810 gene locus_tag LOCUS_18960 gene rdoA 21833 22810 CDS product stress response kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJX4 protein_id gnl|my_center|LOCUS_18960 22840 23463 gene locus_tag LOCUS_18970 22840 23463 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KC3 protein_id gnl|my_center|LOCUS_18970 23498 24136 gene locus_tag LOCUS_18980 gene dsbA 23498 24136 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJX3 protein_id gnl|my_center|LOCUS_18980 24202 24651 gene locus_tag LOCUS_18990 24202 24651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707865.1 protein_id gnl|my_center|LOCUS_18990 25757 24657 gene locus_tag LOCUS_19000 gene trmA 25757 24657 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KN8 protein_id gnl|my_center|LOCUS_19000 26234 27355 gene locus_tag LOCUS_19010 26234 27355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 27419 28234 gene locus_tag LOCUS_19020 gene murI 27419 28234 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK90 protein_id gnl|my_center|LOCUS_19020 28676 28197 gene locus_tag LOCUS_19030 28676 28197 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704113.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence046 1643 1993 gene locus_tag LOCUS_19040 1643 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2029 2949 gene locus_tag LOCUS_19050 2029 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965075.1 protein_id gnl|my_center|LOCUS_19050 4079 3075 gene locus_tag LOCUS_19060 gene trpS-2 4079 3075 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN23 protein_id gnl|my_center|LOCUS_19060 4795 4130 gene locus_tag LOCUS_19070 gene gph-2 4795 4130 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN24 protein_id gnl|my_center|LOCUS_19070 5478 4795 gene locus_tag LOCUS_19080 gene rpe 5478 4795 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSC9 protein_id gnl|my_center|LOCUS_19080 5763 6056 gene locus_tag LOCUS_19090 5763 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 7060 6209 gene locus_tag LOCUS_19100 gene dam 7060 6209 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2G2 protein_id gnl|my_center|LOCUS_19100 8454 7114 gene locus_tag LOCUS_19110 8454 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 9524 8454 gene locus_tag LOCUS_19120 gene aroB 9524 8454 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK19 protein_id gnl|my_center|LOCUS_19120 10068 9550 gene locus_tag LOCUS_19130 gene aroK 10068 9550 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN29 protein_id gnl|my_center|LOCUS_19130 12337 10253 gene locus_tag LOCUS_19140 gene pilQ 12337 10253 CDS product secretin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070657.1 protein_id gnl|my_center|LOCUS_19140 12860 12324 gene locus_tag LOCUS_19150 gene pilP 12860 12324 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070656.1 protein_id gnl|my_center|LOCUS_19150 13477 12857 gene locus_tag LOCUS_19160 gene pilO 13477 12857 CDS product pilus assembly protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070655.1 protein_id gnl|my_center|LOCUS_19160 14040 13477 gene locus_tag LOCUS_19170 gene pilN 14040 13477 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070654.1 protein_id gnl|my_center|LOCUS_19170 15107 14028 gene locus_tag LOCUS_19180 gene pilM 15107 14028 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070653.1 protein_id gnl|my_center|LOCUS_19180 15240 17735 gene locus_tag LOCUS_19190 gene mcrA 15240 17735 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070652.1 protein_id gnl|my_center|LOCUS_19190 20159 17814 gene locus_tag LOCUS_19200 gene metL 20159 17814 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073768.1 protein_id gnl|my_center|LOCUS_19200 21428 20166 gene locus_tag LOCUS_19210 gene metB 21428 20166 CDS product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073769.1 protein_id gnl|my_center|LOCUS_19210 21664 21984 gene locus_tag LOCUS_19220 gene metJ 21664 21984 CDS product Met repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L49 protein_id gnl|my_center|LOCUS_19220 23335 22094 gene locus_tag LOCUS_19230 23335 22094 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465132.1 protein_id gnl|my_center|LOCUS_19230 24112 23900 gene locus_tag LOCUS_19240 gene rpmE 24112 23900 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUD0 protein_id gnl|my_center|LOCUS_19240 24346 26532 gene locus_tag LOCUS_19250 gene priA 24346 26532 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CTJ4 protein_id gnl|my_center|LOCUS_19250 26554 27084 gene locus_tag LOCUS_19260 26554 27084 CDS product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481405.1 protein_id gnl|my_center|LOCUS_19260 27165 27683 gene locus_tag LOCUS_19270 gene hslV 27165 27683 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T20 protein_id gnl|my_center|LOCUS_19270 >Feature sequence047 2122 1817 gene locus_tag LOCUS_19280 2122 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2534 2106 gene locus_tag LOCUS_19290 gene fliS 2534 2106 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ65 protein_id gnl|my_center|LOCUS_19290 3981 2563 gene locus_tag LOCUS_19300 gene fliD 3981 2563 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIY6 protein_id gnl|my_center|LOCUS_19300 4447 4013 gene locus_tag LOCUS_19310 4447 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 5487 4525 gene locus_tag LOCUS_19320 5487 4525 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIY4 protein_id gnl|my_center|LOCUS_19320 6621 5653 gene locus_tag LOCUS_19330 6621 5653 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIY3 protein_id gnl|my_center|LOCUS_19330 8001 7039 gene locus_tag LOCUS_19340 8001 7039 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIY4 protein_id gnl|my_center|LOCUS_19340 9571 8339 gene locus_tag LOCUS_19350 gene flgL 9571 8339 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706634.1 protein_id gnl|my_center|LOCUS_19350 11580 9574 gene locus_tag LOCUS_19360 gene flgK 11580 9574 CDS product flagellar hook protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706635.1 protein_id gnl|my_center|LOCUS_19360 12550 11582 gene locus_tag LOCUS_19370 gene flgJ 12550 11582 CDS product peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X9J3 protein_id gnl|my_center|LOCUS_19370 13833 12739 gene locus_tag LOCUS_19380 gene flgI 13833 12739 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM38 protein_id gnl|my_center|LOCUS_19380 14528 13845 gene locus_tag LOCUS_19390 gene flgH 14528 13845 CDS product flagellar L-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM39 protein_id gnl|my_center|LOCUS_19390 15335 14547 gene locus_tag LOCUS_19400 gene flgG 15335 14547 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECA0 protein_id gnl|my_center|LOCUS_19400 16121 15357 gene locus_tag LOCUS_19410 gene flgF 16121 15357 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM41 protein_id gnl|my_center|LOCUS_19410 17648 16281 gene locus_tag LOCUS_19420 gene flgE 17648 16281 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC97 protein_id gnl|my_center|LOCUS_19420 18384 17704 gene locus_tag LOCUS_19430 18384 17704 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ09 protein_id gnl|my_center|LOCUS_19430 18829 18398 gene locus_tag LOCUS_19440 gene flgC 18829 18398 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3M5 protein_id gnl|my_center|LOCUS_19440 19242 18832 gene locus_tag LOCUS_19450 gene flgB 19242 18832 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC94 protein_id gnl|my_center|LOCUS_19450 20273 19443 gene locus_tag LOCUS_19460 gene cheR 20273 19443 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073134.1 protein_id gnl|my_center|LOCUS_19460 21226 20294 gene locus_tag LOCUS_19470 21226 20294 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706646.1 protein_id gnl|my_center|LOCUS_19470 21368 22075 gene locus_tag LOCUS_19480 gene flgA 21368 22075 CDS product flagella basal body P-ring formation protein FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881906.1 protein_id gnl|my_center|LOCUS_19480 22154 22468 gene locus_tag LOCUS_19490 22154 22468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 22461 22892 gene locus_tag LOCUS_19500 22461 22892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 23841 23383 gene locus_tag LOCUS_19510 gene flgP 23841 23383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073139.1 protein_id gnl|my_center|LOCUS_19510 24004 25197 gene locus_tag LOCUS_19520 gene flgT 24004 25197 CDS product flagella assembly protein FlgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073141.1 protein_id gnl|my_center|LOCUS_19520 26083 25181 gene locus_tag LOCUS_19530 gene oxyR 26083 25181 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176059.1 protein_id gnl|my_center|LOCUS_19530 26198 26926 gene locus_tag LOCUS_19540 26198 26926 CDS product glutathione amide-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883987.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence048 95 20 gene locus_tag LOCUS_t00260 95 20 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 330 255 gene locus_tag LOCUS_t00270 330 255 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1123 578 gene locus_tag LOCUS_19550 gene orn 1123 578 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L01 protein_id gnl|my_center|LOCUS_19550 1245 2303 gene locus_tag LOCUS_19560 gene rsgA 1245 2303 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNT5 protein_id gnl|my_center|LOCUS_19560 2322 3188 gene locus_tag LOCUS_19570 gene psd 2322 3188 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K4PW03 protein_id gnl|my_center|LOCUS_19570 4055 3282 gene locus_tag LOCUS_19580 gene moeB 4055 3282 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768857.1 protein_id gnl|my_center|LOCUS_19580 5583 4048 gene locus_tag LOCUS_19590 5583 4048 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704414.1 protein_id gnl|my_center|LOCUS_19590 6414 5617 gene locus_tag LOCUS_19600 gene thiG 6414 5617 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q73 protein_id gnl|my_center|LOCUS_19600 6625 6416 gene locus_tag LOCUS_19610 6625 6416 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199938.1 protein_id gnl|my_center|LOCUS_19610 7635 6634 gene locus_tag LOCUS_19620 7635 6634 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701763.1 protein_id gnl|my_center|LOCUS_19620 9665 7713 gene locus_tag LOCUS_19630 gene thiC 9665 7713 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8W9 protein_id gnl|my_center|LOCUS_19630 10402 10001 gene locus_tag LOCUS_19640 10402 10001 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257335.1 protein_id gnl|my_center|LOCUS_19640 10922 10527 gene locus_tag LOCUS_19650 10922 10527 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933794.1 protein_id gnl|my_center|LOCUS_19650 11010 13136 gene locus_tag LOCUS_19660 11010 13136 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_19660 14189 13215 gene locus_tag LOCUS_19670 gene poxA 14189 13215 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2B8 protein_id gnl|my_center|LOCUS_19670 14811 14245 gene locus_tag LOCUS_19680 gene efp 14811 14245 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KX9 protein_id gnl|my_center|LOCUS_19680 14876 15865 gene locus_tag LOCUS_19690 gene yjeK 14876 15865 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262738.1 protein_id gnl|my_center|LOCUS_19690 16084 15875 gene locus_tag LOCUS_19700 16084 15875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 16156 16446 gene locus_tag LOCUS_19710 16156 16446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 16989 16492 gene locus_tag LOCUS_19720 16989 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070894.1 protein_id gnl|my_center|LOCUS_19720 17238 18251 gene locus_tag LOCUS_19730 gene galE-1 17238 18251 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705040.1 protein_id gnl|my_center|LOCUS_19730 18357 19193 gene locus_tag LOCUS_19740 18357 19193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 20007 19327 gene locus_tag LOCUS_19750 20007 19327 CDS product PKHD-type hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P182 protein_id gnl|my_center|LOCUS_19750 22275 20095 gene locus_tag LOCUS_19760 22275 20095 CDS product iron transport outer membrane receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112850.1 protein_id gnl|my_center|LOCUS_19760 22612 23376 gene locus_tag LOCUS_19770 22612 23376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 23373 24683 gene locus_tag LOCUS_19780 23373 24683 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172871.1 protein_id gnl|my_center|LOCUS_19780 24676 25047 gene locus_tag LOCUS_19790 24676 25047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 25052 25456 gene locus_tag LOCUS_19800 gene exbD2 25052 25456 CDS product biopolymer transport protein exbD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZHV9 protein_id gnl|my_center|LOCUS_19800 25458 26120 gene locus_tag LOCUS_19810 25458 26120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 26148 27533 gene locus_tag LOCUS_19820 26148 27533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058193.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence049 1165 224 gene locus_tag LOCUS_19830 1165 224 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098462.1 protein_id gnl|my_center|LOCUS_19830 2194 1289 gene locus_tag LOCUS_19840 2194 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2415 3092 gene locus_tag LOCUS_19850 2415 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 4318 3125 gene locus_tag LOCUS_19860 4318 3125 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_19860 4623 4378 gene locus_tag LOCUS_19870 gene yheU 4623 4378 CDS product UPF0270 protein YheU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A2P5 protein_id gnl|my_center|LOCUS_19870 5570 4620 gene locus_tag LOCUS_19880 gene yheT 5570 4620 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071169.1 protein_id gnl|my_center|LOCUS_19880 6117 6617 gene locus_tag LOCUS_19890 6117 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 6610 6831 gene locus_tag LOCUS_19900 6610 6831 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_19900 7248 7634 gene locus_tag LOCUS_19910 7248 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 8393 7980 gene locus_tag LOCUS_19920 8393 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 10302 8380 gene locus_tag LOCUS_19930 10302 8380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707314.1 protein_id gnl|my_center|LOCUS_19930 10446 10649 gene locus_tag LOCUS_19940 10446 10649 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704934.1 protein_id gnl|my_center|LOCUS_19940 10878 10663 gene locus_tag LOCUS_19950 gene slyX 10878 10663 CDS product protein SlyX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CUB6 protein_id gnl|my_center|LOCUS_19950 11863 10865 gene locus_tag LOCUS_19960 11863 10865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704937.1 protein_id gnl|my_center|LOCUS_19960 12066 12818 gene locus_tag LOCUS_19970 gene fklB 12066 12818 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHY9 protein_id gnl|my_center|LOCUS_19970 13924 12875 gene locus_tag LOCUS_19980 gene ykfA 13924 12875 CDS product putative murein peptide carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34851 protein_id gnl|my_center|LOCUS_19980 14568 14101 gene locus_tag LOCUS_19990 gene rsd 14568 14101 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070791.1 protein_id gnl|my_center|LOCUS_19990 15071 16135 gene locus_tag LOCUS_20000 gene hemE 15071 16135 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGD0 protein_id gnl|my_center|LOCUS_20000 17648 16221 gene locus_tag LOCUS_20010 gene sthA 17648 16221 CDS product soluble pyridine nucleotide transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZA97 protein_id gnl|my_center|LOCUS_20010 18795 17662 gene locus_tag LOCUS_20020 gene oel1 18795 17662 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 protein_id gnl|my_center|LOCUS_20020 18922 19545 gene locus_tag LOCUS_20030 gene fabR 18922 19545 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM60 protein_id gnl|my_center|LOCUS_20030 19646 20830 gene locus_tag LOCUS_20040 19646 20830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 20880 21548 gene locus_tag LOCUS_20050 20880 21548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 21550 24612 gene locus_tag LOCUS_20060 21550 24612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 24634 25659 gene locus_tag LOCUS_20070 24634 25659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 25677 26003 gene locus_tag LOCUS_20080 25677 26003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 26021 26626 gene locus_tag LOCUS_20090 26021 26626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 26647 27597 gene locus_tag LOCUS_20100 26647 27597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence050 11 86 gene locus_tag LOCUS_t00280 11 86 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 692 267 gene locus_tag LOCUS_20110 692 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_20110 1156 689 gene locus_tag LOCUS_20120 gene cheX 1156 689 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417353.1 protein_id gnl|my_center|LOCUS_20120 1671 1237 gene locus_tag LOCUS_20130 gene zur 1671 1237 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707398.1 protein_id gnl|my_center|LOCUS_20130 1765 2385 gene locus_tag LOCUS_20140 gene ychE 1765 2385 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E276 protein_id gnl|my_center|LOCUS_20140 2490 2960 gene locus_tag LOCUS_20150 2490 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 3136 4095 gene locus_tag LOCUS_20160 gene dusA 3136 4095 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD0 protein_id gnl|my_center|LOCUS_20160 4331 5002 gene locus_tag LOCUS_20170 gene pspA 4331 5002 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_20170 5014 5220 gene locus_tag LOCUS_20180 5014 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 5230 5553 gene locus_tag LOCUS_20190 5230 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 5655 6173 gene locus_tag LOCUS_20200 5655 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483350.1 protein_id gnl|my_center|LOCUS_20200 6182 7168 gene locus_tag LOCUS_20210 6182 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073652.1 protein_id gnl|my_center|LOCUS_20210 7172 7933 gene locus_tag LOCUS_20220 7172 7933 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 protein_id gnl|my_center|LOCUS_20220 8845 7958 gene locus_tag LOCUS_20230 8845 7958 CDS product TIGR03899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261128.1 protein_id gnl|my_center|LOCUS_20230 9344 8814 gene locus_tag LOCUS_20240 9344 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 9585 11780 gene locus_tag LOCUS_20250 9585 11780 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388417.1 protein_id gnl|my_center|LOCUS_20250 11875 14049 gene locus_tag LOCUS_20260 11875 14049 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHT0 protein_id gnl|my_center|LOCUS_20260 16879 14105 gene locus_tag LOCUS_20270 16879 14105 CDS product periplasmic peptidase family S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071716.1 protein_id gnl|my_center|LOCUS_20270 17680 17093 gene locus_tag LOCUS_20280 gene slmA 17680 17093 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEM5 protein_id gnl|my_center|LOCUS_20280 19055 17796 gene locus_tag LOCUS_20290 gene coaBC 19055 17796 CDS product coenzyme A biosynthesis bifunctional protein CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T89 protein_id gnl|my_center|LOCUS_20290 19167 19841 gene locus_tag LOCUS_20300 19167 19841 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8M5 protein_id gnl|my_center|LOCUS_20300 20119 20355 gene locus_tag LOCUS_20310 gene rpmB 20119 20355 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVC8 protein_id gnl|my_center|LOCUS_20310 20367 20522 gene locus_tag LOCUS_20320 gene rpmG 20367 20522 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM33 protein_id gnl|my_center|LOCUS_20320 21729 20611 gene locus_tag LOCUS_20330 21729 20611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 22844 21918 gene locus_tag LOCUS_20340 gene ppaC 22844 21918 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073874.1 protein_id gnl|my_center|LOCUS_20340 23017 23535 gene locus_tag LOCUS_20350 23017 23535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 23537 24346 gene locus_tag LOCUS_20360 gene mutM 23537 24346 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEN2 protein_id gnl|my_center|LOCUS_20360 24919 24419 gene locus_tag LOCUS_20370 24919 24419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417389.1 protein_id gnl|my_center|LOCUS_20370 26180 24930 gene locus_tag LOCUS_20380 26180 24930 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707300.1 protein_id gnl|my_center|LOCUS_20380 26869 26177 gene locus_tag LOCUS_20390 26869 26177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479652.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence051 2026 3000 gene locus_tag LOCUS_20400 2026 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3095 5140 gene locus_tag LOCUS_20410 3095 5140 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705839.1 protein_id gnl|my_center|LOCUS_20410 5318 5061 gene locus_tag LOCUS_20420 5318 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 5517 6563 gene locus_tag LOCUS_20430 5517 6563 CDS product catalase-related peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63YW9 protein_id gnl|my_center|LOCUS_20430 6563 7099 gene locus_tag LOCUS_20440 6563 7099 CDS product type-b cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969913.1 protein_id gnl|my_center|LOCUS_20440 7950 7171 gene locus_tag LOCUS_20450 7950 7171 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 protein_id gnl|my_center|LOCUS_20450 8151 8531 gene locus_tag LOCUS_20460 8151 8531 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888340.1 protein_id gnl|my_center|LOCUS_20460 8558 10102 gene locus_tag LOCUS_20470 8558 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 10326 11738 gene locus_tag LOCUS_20480 10326 11738 CDS product membrane-bound O-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379730.1 protein_id gnl|my_center|LOCUS_20480 11713 12933 gene locus_tag LOCUS_20490 11713 12933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 13156 14061 gene locus_tag LOCUS_20500 13156 14061 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402933.1 protein_id gnl|my_center|LOCUS_20500 14061 15581 gene locus_tag LOCUS_20510 14061 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140440.1 protein_id gnl|my_center|LOCUS_20510 17831 15669 gene locus_tag LOCUS_20520 17831 15669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 18253 17885 gene locus_tag LOCUS_20530 18253 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 18492 18268 gene locus_tag LOCUS_20540 18492 18268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 18709 18485 gene locus_tag LOCUS_20550 18709 18485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 19007 19597 gene locus_tag LOCUS_20560 gene betI 19007 19597 CDS product HTH-type transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZGV8 protein_id gnl|my_center|LOCUS_20560 19599 21062 gene locus_tag LOCUS_20570 gene betB 19599 21062 CDS product NAD/NADP-dependent betaine aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H52 protein_id gnl|my_center|LOCUS_20570 21062 22732 gene locus_tag LOCUS_20580 gene betA 21062 22732 CDS product oxygen-dependent choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H53 protein_id gnl|my_center|LOCUS_20580 22868 24085 gene locus_tag LOCUS_20590 22868 24085 CDS product choline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969412.1 protein_id gnl|my_center|LOCUS_20590 24118 24825 gene locus_tag LOCUS_20600 24118 24825 CDS product TIGR02001 family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_20600 25098 24883 gene locus_tag LOCUS_20610 25098 24883 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262957.1 protein_id gnl|my_center|LOCUS_20610 25652 25098 gene locus_tag LOCUS_20620 25652 25098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 26509 25655 gene locus_tag LOCUS_20630 26509 25655 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404392.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence052 1412 1999 gene locus_tag LOCUS_20640 1412 1999 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680361.1 protein_id gnl|my_center|LOCUS_20640 1999 2601 gene locus_tag LOCUS_20650 1999 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112977.1 protein_id gnl|my_center|LOCUS_20650 3765 2881 gene locus_tag LOCUS_20660 gene cyoE 3765 2881 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WCB5 protein_id gnl|my_center|LOCUS_20660 4171 3812 gene locus_tag LOCUS_20670 4171 3812 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409003.1 protein_id gnl|my_center|LOCUS_20670 4791 4171 gene locus_tag LOCUS_20680 4791 4171 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704586.1 protein_id gnl|my_center|LOCUS_20680 6791 4788 gene locus_tag LOCUS_20690 gene cyoB 6791 4788 CDS product cytochrome bo(3) ubiquinol oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I426 protein_id gnl|my_center|LOCUS_20690 7717 6794 gene locus_tag LOCUS_20700 gene cyoA 7717 6794 CDS product ubiquinol oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CK33 protein_id gnl|my_center|LOCUS_20700 8320 7964 gene locus_tag LOCUS_20710 8320 7964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 9503 9964 gene locus_tag LOCUS_20720 9503 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 11129 10071 gene locus_tag LOCUS_20730 11129 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919650.1 protein_id gnl|my_center|LOCUS_20730 11449 11276 gene locus_tag LOCUS_20740 11449 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 11885 11673 gene locus_tag LOCUS_20750 11885 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705066.1 protein_id gnl|my_center|LOCUS_20750 13001 11970 gene locus_tag LOCUS_20760 13001 11970 CDS product thiamin biosynthesis lipoprotein ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231920.2 protein_id gnl|my_center|LOCUS_20760 14328 13099 gene locus_tag LOCUS_20770 gene nqrF 14328 13099 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV4 protein_id gnl|my_center|LOCUS_20770 14956 14348 gene locus_tag LOCUS_20780 gene nqrE 14956 14348 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV5 protein_id gnl|my_center|LOCUS_20780 15599 14967 gene locus_tag LOCUS_20790 gene nqrD 15599 14967 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV6 protein_id gnl|my_center|LOCUS_20790 16363 15599 gene locus_tag LOCUS_20800 gene nqrC 16363 15599 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C6E0 protein_id gnl|my_center|LOCUS_20800 17558 16356 gene locus_tag LOCUS_20810 gene nqrB 17558 16356 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV8 protein_id gnl|my_center|LOCUS_20810 18957 17563 gene locus_tag LOCUS_20820 gene nqrA 18957 17563 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA6 protein_id gnl|my_center|LOCUS_20820 20476 19283 gene locus_tag LOCUS_20830 gene fabV 20476 19283 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP8 protein_id gnl|my_center|LOCUS_20830 20888 20577 gene locus_tag LOCUS_20840 gene bolA 20888 20577 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_20840 21528 20962 gene locus_tag LOCUS_20850 gene alkB 21528 20962 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035874.1 protein_id gnl|my_center|LOCUS_20850 21598 22746 gene locus_tag LOCUS_20860 gene rlmG 21598 22746 CDS product ribosomal RNA large subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JR10 protein_id gnl|my_center|LOCUS_20860 22749 23303 gene locus_tag LOCUS_20870 22749 23303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 23306 23926 gene locus_tag LOCUS_20880 gene ppiA 23306 23926 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAT0 protein_id gnl|my_center|LOCUS_20880 23970 25349 gene locus_tag LOCUS_20890 23970 25349 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456555.1 protein_id gnl|my_center|LOCUS_20890 25655 25416 gene locus_tag LOCUS_20900 25655 25416 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103251.1 protein_id gnl|my_center|LOCUS_20900 25976 26152 gene locus_tag LOCUS_20910 25976 26152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 26876 26538 gene locus_tag LOCUS_20920 gene erpA 26876 26538 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHC4 protein_id gnl|my_center|LOCUS_20920 >Feature sequence053 103 966 gene locus_tag LOCUS_20930 103 966 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989572.1 protein_id gnl|my_center|LOCUS_20930 2711 1512 gene locus_tag LOCUS_20940 gene mntH 2711 1512 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_20940 4383 3121 gene locus_tag LOCUS_20950 gene avtA 4383 3121 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260902.1 protein_id gnl|my_center|LOCUS_20950 4618 5631 gene locus_tag LOCUS_20960 4618 5631 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071380.1 protein_id gnl|my_center|LOCUS_20960 5987 6991 gene locus_tag LOCUS_20970 5987 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_20970 6991 9792 gene locus_tag LOCUS_20980 6991 9792 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_20980 9795 10916 gene locus_tag LOCUS_20990 9795 10916 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_312385.2 protein_id gnl|my_center|LOCUS_20990 12111 11047 gene locus_tag LOCUS_21000 12111 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881437.1 protein_id gnl|my_center|LOCUS_21000 12493 12912 gene locus_tag LOCUS_21010 12493 12912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 13136 12960 gene locus_tag LOCUS_21020 13136 12960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21020 14038 13409 gene locus_tag LOCUS_21030 14038 13409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232012.2 protein_id gnl|my_center|LOCUS_21030 14425 15582 gene locus_tag LOCUS_21040 14425 15582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21040 15650 16306 gene locus_tag LOCUS_21050 15650 16306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21050 17724 16414 gene locus_tag LOCUS_21060 gene amaA 17724 16414 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_21060 17776 18450 gene locus_tag LOCUS_21070 17776 18450 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107720.1 protein_id gnl|my_center|LOCUS_21070 18533 18952 gene locus_tag LOCUS_21080 18533 18952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 19042 19545 gene locus_tag LOCUS_21090 19042 19545 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206533.1 protein_id gnl|my_center|LOCUS_21090 19565 20356 gene locus_tag LOCUS_21100 19565 20356 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_21100 20584 21039 gene locus_tag LOCUS_21110 20584 21039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 21676 21218 gene locus_tag LOCUS_21120 21676 21218 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022414.1 protein_id gnl|my_center|LOCUS_21120 22834 21689 gene locus_tag LOCUS_21130 22834 21689 CDS product 50S ribosomal protein L16 arginine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705314.1 protein_id gnl|my_center|LOCUS_21130 24287 22917 gene locus_tag LOCUS_21140 24287 22917 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUG3 protein_id gnl|my_center|LOCUS_21140 24922 24320 gene locus_tag LOCUS_21150 gene hflD 24922 24320 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDV9 protein_id gnl|my_center|LOCUS_21150 26022 24922 gene locus_tag LOCUS_21160 gene mnmA 26022 24922 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJK3 protein_id gnl|my_center|LOCUS_21160 >Feature sequence054 2448 547 gene locus_tag LOCUS_21170 2448 547 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073024.1 protein_id gnl|my_center|LOCUS_21170 2819 2508 gene locus_tag LOCUS_21180 2819 2508 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767692.1 protein_id gnl|my_center|LOCUS_21180 2972 5134 gene locus_tag LOCUS_21190 2972 5134 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_21190 6509 5220 gene locus_tag LOCUS_21200 6509 5220 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQL9 protein_id gnl|my_center|LOCUS_21200 6686 7492 gene locus_tag LOCUS_21210 6686 7492 CDS product glycoside hydrolase family 73 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072339.1 protein_id gnl|my_center|LOCUS_21210 7485 8153 gene locus_tag LOCUS_21220 7485 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072340.1 protein_id gnl|my_center|LOCUS_21220 8359 8835 gene locus_tag LOCUS_21230 8359 8835 CDS product transcription elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261386.1 protein_id gnl|my_center|LOCUS_21230 9093 10487 gene locus_tag LOCUS_21240 9093 10487 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285013.1 protein_id gnl|my_center|LOCUS_21240 10487 11593 gene locus_tag LOCUS_21250 10487 11593 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113487.1 protein_id gnl|my_center|LOCUS_21250 11608 12120 gene locus_tag LOCUS_21260 11608 12120 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420250.1 protein_id gnl|my_center|LOCUS_21260 12941 12132 gene locus_tag LOCUS_21270 12941 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 13364 12954 gene locus_tag LOCUS_21280 13364 12954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 13728 14546 gene locus_tag LOCUS_21290 13728 14546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219484.1 protein_id gnl|my_center|LOCUS_21290 15651 14641 gene locus_tag LOCUS_21300 15651 14641 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095316.1 protein_id gnl|my_center|LOCUS_21300 15778 17685 gene locus_tag LOCUS_21310 gene fabY 15778 17685 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU15 protein_id gnl|my_center|LOCUS_21310 17871 19673 gene locus_tag LOCUS_21320 17871 19673 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070554.1 protein_id gnl|my_center|LOCUS_21320 19677 20318 gene locus_tag LOCUS_21330 19677 20318 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367455.1 protein_id gnl|my_center|LOCUS_21330 20408 20866 gene locus_tag LOCUS_21340 20408 20866 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380560.1 protein_id gnl|my_center|LOCUS_21340 20990 22546 gene locus_tag LOCUS_21350 20990 22546 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_21350 22815 24428 gene locus_tag LOCUS_21360 gene ybiT 22815 24428 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072485.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence055 694 320 gene locus_tag LOCUS_21370 694 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 1270 1431 gene locus_tag LOCUS_21380 1270 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2241 1405 gene locus_tag LOCUS_21390 gene int_ISSod25 2241 1405 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072110.1 protein_id gnl|my_center|LOCUS_21390 3085 2534 gene locus_tag LOCUS_21400 3085 2534 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112597.1 protein_id gnl|my_center|LOCUS_21400 4050 3589 gene locus_tag LOCUS_21410 4050 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 6673 4238 gene locus_tag LOCUS_21420 6673 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142422.1 protein_id gnl|my_center|LOCUS_21420 7498 6761 gene locus_tag LOCUS_21430 7498 6761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_21430 8766 7516 gene locus_tag LOCUS_21440 8766 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 8812 8982 gene locus_tag LOCUS_21450 8812 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 9111 10460 gene locus_tag LOCUS_21460 9111 10460 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_21460 10457 11752 gene locus_tag LOCUS_21470 10457 11752 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787744.1 protein_id gnl|my_center|LOCUS_21470 11979 12362 gene locus_tag LOCUS_21480 11979 12362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 12449 12715 gene locus_tag LOCUS_21490 12449 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 14761 12824 gene locus_tag LOCUS_21500 14761 12824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 15142 15058 gene locus_tag LOCUS_t00290 15142 15058 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15396 15896 gene locus_tag LOCUS_21510 15396 15896 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071580.1 protein_id gnl|my_center|LOCUS_21510 16996 15929 gene locus_tag LOCUS_21520 gene lptG 16996 15929 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071579.1 protein_id gnl|my_center|LOCUS_21520 18105 16993 gene locus_tag LOCUS_21530 gene lptF 18105 16993 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071578.1 protein_id gnl|my_center|LOCUS_21530 18370 19881 gene locus_tag LOCUS_21540 gene pepA 18370 19881 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPF3 protein_id gnl|my_center|LOCUS_21540 20056 20502 gene locus_tag LOCUS_21550 gene holC 20056 20502 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209309.1 protein_id gnl|my_center|LOCUS_21550 20563 23418 gene locus_tag LOCUS_21560 gene valS 20563 23418 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LG6 protein_id gnl|my_center|LOCUS_21560 24778 23516 gene locus_tag LOCUS_21570 gene fadL 24778 23516 CDS product long-chain fatty acid outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002347691.1 protein_id gnl|my_center|LOCUS_21570 25360 25187 gene locus_tag LOCUS_21580 25360 25187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 <25938 25369 gene locus_tag LOCUS_21590 <25938 25369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706654.1:phosphodiesterase >Feature sequence056 83 538 gene locus_tag LOCUS_21600 83 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2080 593 gene locus_tag LOCUS_21610 2080 593 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703157.1 protein_id gnl|my_center|LOCUS_21610 4160 2073 gene locus_tag LOCUS_21620 gene ppk 4160 2073 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM32 protein_id gnl|my_center|LOCUS_21620 4787 4281 gene locus_tag LOCUS_21630 4787 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 5147 7381 gene locus_tag LOCUS_21640 gene pstC 5147 7381 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706617.1 protein_id gnl|my_center|LOCUS_21640 7396 9045 gene locus_tag LOCUS_21650 7396 9045 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM16 protein_id gnl|my_center|LOCUS_21650 9073 9900 gene locus_tag LOCUS_21660 gene pstB 9073 9900 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM15 protein_id gnl|my_center|LOCUS_21660 9955 10656 gene locus_tag LOCUS_21670 gene phoU 9955 10656 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG81 protein_id gnl|my_center|LOCUS_21670 10828 11505 gene locus_tag LOCUS_21680 10828 11505 CDS product phosphate transport regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707482.1 protein_id gnl|my_center|LOCUS_21680 11545 12813 gene locus_tag LOCUS_21690 11545 12813 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAX0 protein_id gnl|my_center|LOCUS_21690 12891 13835 gene locus_tag LOCUS_21700 gene oxyR 12891 13835 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071537.1 protein_id gnl|my_center|LOCUS_21700 14101 14643 gene locus_tag LOCUS_21710 14101 14643 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_21710 14636 15226 gene locus_tag LOCUS_21720 14636 15226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 15238 16149 gene locus_tag LOCUS_21730 15238 16149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 16437 16213 gene locus_tag LOCUS_21740 16437 16213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 19166 16641 gene locus_tag LOCUS_21750 19166 16641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 19317 20366 gene locus_tag LOCUS_21760 gene queA 19317 20366 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ19 protein_id gnl|my_center|LOCUS_21760 20541 21668 gene locus_tag LOCUS_21770 gene tgt 20541 21668 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECM3 protein_id gnl|my_center|LOCUS_21770 21694 22032 gene locus_tag LOCUS_21780 gene yajC 21694 22032 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460204.1 protein_id gnl|my_center|LOCUS_21780 22052 23911 gene locus_tag LOCUS_21790 gene secD 22052 23911 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3D4 protein_id gnl|my_center|LOCUS_21790 23921 24868 gene locus_tag LOCUS_21800 gene secF 23921 24868 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S33 protein_id gnl|my_center|LOCUS_21800 >Feature sequence057 <1 1875 gene locus_tag LOCUS_21810 <1 1875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106322.1:9-hexadecenoic acid cis-trans isomerase 1999 3726 gene locus_tag LOCUS_21820 1999 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 4349 3732 gene locus_tag LOCUS_21830 4349 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 4495 5937 gene locus_tag LOCUS_21840 4495 5937 CDS product molybdate ABC transporter ATP-binding protein ModF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097518.1 protein_id gnl|my_center|LOCUS_21840 6233 6607 gene locus_tag LOCUS_21850 6233 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 6739 6915 gene locus_tag LOCUS_21860 6739 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 7532 9214 gene locus_tag LOCUS_21870 7532 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 10882 9332 gene locus_tag LOCUS_21880 10882 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 11250 11035 gene locus_tag LOCUS_21890 11250 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 12475 11597 gene locus_tag LOCUS_21900 12475 11597 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003568.1 protein_id gnl|my_center|LOCUS_21900 13970 12522 gene locus_tag LOCUS_21910 13970 12522 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263108.1 protein_id gnl|my_center|LOCUS_21910 14625 13951 gene locus_tag LOCUS_21920 14625 13951 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263107.1 protein_id gnl|my_center|LOCUS_21920 16649 14685 gene locus_tag LOCUS_21930 16649 14685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105914.1 protein_id gnl|my_center|LOCUS_21930 17014 16640 gene locus_tag LOCUS_21940 17014 16640 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUY6 protein_id gnl|my_center|LOCUS_21940 18341 17007 gene locus_tag LOCUS_21950 18341 17007 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236217.1 protein_id gnl|my_center|LOCUS_21950 19241 20890 gene locus_tag LOCUS_21960 gene ilvG 19241 20890 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D7 protein_id gnl|my_center|LOCUS_21960 20887 21129 gene locus_tag LOCUS_21970 gene ilvM 20887 21129 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074003.1 protein_id gnl|my_center|LOCUS_21970 21244 23100 gene locus_tag LOCUS_21980 gene ilvD 21244 23100 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EP43 protein_id gnl|my_center|LOCUS_21980 23103 24653 gene locus_tag LOCUS_21990 gene ilvA 23103 24653 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KB5 protein_id gnl|my_center|LOCUS_21990 >Feature sequence058 631 170 gene locus_tag LOCUS_22000 gene accB 631 170 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707112.1 protein_id gnl|my_center|LOCUS_22000 1117 665 gene locus_tag LOCUS_22010 gene aroQ 1117 665 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CRC4 protein_id gnl|my_center|LOCUS_22010 3174 1345 gene locus_tag LOCUS_22020 gene dsbD 3174 1345 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIY1 protein_id gnl|my_center|LOCUS_22020 3434 3174 gene locus_tag LOCUS_22030 3434 3174 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_22030 3706 4182 gene locus_tag LOCUS_22040 gene fxsA 3706 4182 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_22040 4336 4623 gene locus_tag LOCUS_22050 gene groS1 4336 4623 CDS product 10 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNR6 protein_id gnl|my_center|LOCUS_22050 4671 6317 gene locus_tag LOCUS_22060 gene groL1 4671 6317 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNR7 protein_id gnl|my_center|LOCUS_22060 6496 6909 gene locus_tag LOCUS_22070 gene rnk 6496 6909 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 protein_id gnl|my_center|LOCUS_22070 7147 7545 gene locus_tag LOCUS_22080 7147 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483188.1 protein_id gnl|my_center|LOCUS_22080 7777 7959 gene locus_tag LOCUS_22090 7777 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 9897 8005 gene locus_tag LOCUS_22100 9897 8005 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104451.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22100 11575 10085 gene locus_tag LOCUS_22110 11575 10085 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FMW5 protein_id gnl|my_center|LOCUS_22110 12608 11796 gene locus_tag LOCUS_22120 gene speD 12608 11796 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBJ7 protein_id gnl|my_center|LOCUS_22120 13110 12697 gene locus_tag LOCUS_22130 gene yhfA 13110 12697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148917.1 protein_id gnl|my_center|LOCUS_22130 13539 13192 gene locus_tag LOCUS_22140 13539 13192 CDS product topoisomerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072801.1 protein_id gnl|my_center|LOCUS_22140 15149 13680 gene locus_tag LOCUS_22150 gene astD 15149 13680 CDS product N-succinylglutamate 5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN18 protein_id gnl|my_center|LOCUS_22150 16181 15165 gene locus_tag LOCUS_22160 gene astA 16181 15165 CDS product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2G8 protein_id gnl|my_center|LOCUS_22160 17475 16270 gene locus_tag LOCUS_22170 gene argD 17475 16270 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN20 protein_id gnl|my_center|LOCUS_22170 19332 18172 gene locus_tag LOCUS_22180 19332 18172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 19971 19390 gene locus_tag LOCUS_22190 gene trpG 19971 19390 CDS product anthranilate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20576 protein_id gnl|my_center|LOCUS_22190 20240 20485 gene locus_tag LOCUS_22200 20240 20485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479911.1 protein_id gnl|my_center|LOCUS_22200 20661 22163 gene locus_tag LOCUS_22210 gene glpK1 20661 22163 CDS product glycerol kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY41 protein_id gnl|my_center|LOCUS_22210 22211 23704 gene locus_tag LOCUS_22220 gene glyD 22211 23704 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSI2 protein_id gnl|my_center|LOCUS_22220 24143 23712 gene locus_tag LOCUS_22230 24143 23712 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704482.1 protein_id gnl|my_center|LOCUS_22230 24142 24846 gene locus_tag LOCUS_22240 24142 24846 CDS product prolyl 4-hydroxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072041.1 protein_id gnl|my_center|LOCUS_22240 >Feature sequence059 1933 1589 gene locus_tag LOCUS_22250 1933 1589 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGD7 protein_id gnl|my_center|LOCUS_22250 2740 1943 gene locus_tag LOCUS_22260 gene phhA 2740 1943 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43334 protein_id gnl|my_center|LOCUS_22260 4134 2953 gene locus_tag LOCUS_22270 gene mdeA 4134 2953 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 protein_id gnl|my_center|LOCUS_22270 5321 4275 gene locus_tag LOCUS_22280 gene ycjF 5321 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263200.1 protein_id gnl|my_center|LOCUS_22280 6733 5318 gene locus_tag LOCUS_22290 gene ycjX 6733 5318 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071931.1 protein_id gnl|my_center|LOCUS_22290 7193 6792 gene locus_tag LOCUS_22300 gene pspC 7193 6792 CDS product phage-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071930.1 protein_id gnl|my_center|LOCUS_22300 7423 7190 gene locus_tag LOCUS_22310 gene pspB 7423 7190 CDS product phage shock protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071929.1 protein_id gnl|my_center|LOCUS_22310 8150 7491 gene locus_tag LOCUS_22320 gene pspA 8150 7491 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071928.1 protein_id gnl|my_center|LOCUS_22320 8338 9396 gene locus_tag LOCUS_22330 gene pspF 8338 9396 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071927.1 protein_id gnl|my_center|LOCUS_22330 9415 11022 gene locus_tag LOCUS_22340 gene sapA 9415 11022 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071926.1 protein_id gnl|my_center|LOCUS_22340 11022 12056 gene locus_tag LOCUS_22350 11022 12056 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400038.1 protein_id gnl|my_center|LOCUS_22350 12043 12936 gene locus_tag LOCUS_22360 gene sapC 12043 12936 CDS product antimicrobial peptide ABC transporter permease SapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705750.1 protein_id gnl|my_center|LOCUS_22360 12937 13929 gene locus_tag LOCUS_22370 gene sapD 12937 13929 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705749.1 protein_id gnl|my_center|LOCUS_22370 13929 14690 gene locus_tag LOCUS_22380 gene sapF 13929 14690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071922.1 protein_id gnl|my_center|LOCUS_22380 15460 15059 gene locus_tag LOCUS_22390 15460 15059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 17544 15640 gene locus_tag LOCUS_22400 gene ppiD 17544 15640 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG15 protein_id gnl|my_center|LOCUS_22400 18008 17715 gene locus_tag LOCUS_22410 18008 17715 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382341.1 protein_id gnl|my_center|LOCUS_22410 20563 18203 gene locus_tag LOCUS_22420 gene lon 20563 18203 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJU3 protein_id gnl|my_center|LOCUS_22420 21997 20714 gene locus_tag LOCUS_22430 gene clpX 21997 20714 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJU2 protein_id gnl|my_center|LOCUS_22430 22750 22133 gene locus_tag LOCUS_22440 gene clpP 22750 22133 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG19 protein_id gnl|my_center|LOCUS_22440 24219 22915 gene locus_tag LOCUS_22450 gene tig 24219 22915 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG20 protein_id gnl|my_center|LOCUS_22450 >Feature sequence060 1267 1010 gene locus_tag LOCUS_22460 1267 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1716 1267 gene locus_tag LOCUS_22470 1716 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2067 1723 gene locus_tag LOCUS_22480 2067 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2573 3031 gene locus_tag LOCUS_22490 gene mraZ 2573 3031 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPY1 protein_id gnl|my_center|LOCUS_22490 3061 3999 gene locus_tag LOCUS_22500 gene rsmH 3061 3999 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AJH1 protein_id gnl|my_center|LOCUS_22500 3996 4322 gene locus_tag LOCUS_22510 gene ftsL 3996 4322 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P1 protein_id gnl|my_center|LOCUS_22510 4319 6136 gene locus_tag LOCUS_22520 gene ftsI 4319 6136 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073906.1 protein_id gnl|my_center|LOCUS_22520 6123 7634 gene locus_tag LOCUS_22530 gene murE 6123 7634 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FWB6 protein_id gnl|my_center|LOCUS_22530 7631 9019 gene locus_tag LOCUS_22540 gene murF 7631 9019 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX6 protein_id gnl|my_center|LOCUS_22540 9013 10095 gene locus_tag LOCUS_22550 gene mraY 9013 10095 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P5 protein_id gnl|my_center|LOCUS_22550 10096 11421 gene locus_tag LOCUS_22560 gene murD 10096 11421 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45063 protein_id gnl|my_center|LOCUS_22560 11418 12593 gene locus_tag LOCUS_22570 gene ftsW 11418 12593 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P7 protein_id gnl|my_center|LOCUS_22570 12590 13699 gene locus_tag LOCUS_22580 gene murG 12590 13699 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CX35 protein_id gnl|my_center|LOCUS_22580 13700 15148 gene locus_tag LOCUS_22590 gene murC 13700 15148 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPX1 protein_id gnl|my_center|LOCUS_22590 15145 16065 gene locus_tag LOCUS_22600 gene ddlB 15145 16065 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJJ5 protein_id gnl|my_center|LOCUS_22600 16067 16846 gene locus_tag LOCUS_22610 gene ftsQ 16067 16846 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9P9 protein_id gnl|my_center|LOCUS_22610 16843 18075 gene locus_tag LOCUS_22620 gene ftsA 16843 18075 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q0 protein_id gnl|my_center|LOCUS_22620 18097 19341 gene locus_tag LOCUS_22630 gene ftsZ 18097 19341 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q1 protein_id gnl|my_center|LOCUS_22630 19445 20356 gene locus_tag LOCUS_22640 gene lpxC 19445 20356 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Q6 protein_id gnl|my_center|LOCUS_22640 21287 20613 gene locus_tag LOCUS_22650 21287 20613 CDS product dUMP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169692.1 protein_id gnl|my_center|LOCUS_22650 21832 21287 gene locus_tag LOCUS_22660 21832 21287 CDS product non-canonical purine NTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIC6 protein_id gnl|my_center|LOCUS_22660 22799 21900 gene locus_tag LOCUS_22670 22799 21900 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIG1 protein_id gnl|my_center|LOCUS_22670 22937 23806 gene locus_tag LOCUS_22680 22937 23806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 23884 24249 gene locus_tag LOCUS_22690 23884 24249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071848.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence061 609 154 gene locus_tag LOCUS_22700 609 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707790.1 protein_id gnl|my_center|LOCUS_22700 712 2544 gene locus_tag LOCUS_22710 gene recQ 712 2544 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260943.1 protein_id gnl|my_center|LOCUS_22710 2560 2859 gene locus_tag LOCUS_22720 2560 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2926 4635 gene locus_tag LOCUS_22730 2926 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 protein_id gnl|my_center|LOCUS_22730 4682 5254 gene locus_tag LOCUS_22740 4682 5254 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882634.1 protein_id gnl|my_center|LOCUS_22740 6385 5327 gene locus_tag LOCUS_22750 6385 5327 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261387.1 protein_id gnl|my_center|LOCUS_22750 7277 6372 gene locus_tag LOCUS_22760 gene rimK 7277 6372 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_22760 7716 7288 gene locus_tag LOCUS_22770 gene rimK2 7716 7288 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_22770 7866 8837 gene locus_tag LOCUS_22780 7866 8837 CDS product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073715.1 protein_id gnl|my_center|LOCUS_22780 10949 8844 gene locus_tag LOCUS_22790 10949 8844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 11377 11303 gene locus_tag LOCUS_t00300 11377 11303 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11634 11816 gene locus_tag LOCUS_22800 11634 11816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 12619 11813 gene locus_tag LOCUS_22810 12619 11813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 13251 12628 gene locus_tag LOCUS_22820 gene pnuT 13251 12628 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_22820 13528 13277 gene locus_tag LOCUS_22830 gene ykoF 13528 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 protein_id gnl|my_center|LOCUS_22830 13660 13899 gene locus_tag LOCUS_22840 13660 13899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071581.1 protein_id gnl|my_center|LOCUS_22840 14988 13909 gene locus_tag LOCUS_22850 gene alr1 14988 13909 CDS product alanine racemase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUY6 protein_id gnl|my_center|LOCUS_22850 16367 14988 gene locus_tag LOCUS_22860 gene dnaB 16367 14988 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH08 protein_id gnl|my_center|LOCUS_22860 17412 16468 gene locus_tag LOCUS_22870 17412 16468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 17900 17424 gene locus_tag LOCUS_22880 17900 17424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 18444 17893 gene locus_tag LOCUS_22890 18444 17893 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_22890 20468 18636 gene locus_tag LOCUS_22900 20468 18636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071140.1 protein_id gnl|my_center|LOCUS_22900 20992 20468 gene locus_tag LOCUS_22910 20992 20468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 21405 20992 gene locus_tag LOCUS_22920 21405 20992 CDS product PilD processed protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071142.1 protein_id gnl|my_center|LOCUS_22920 21854 21405 gene locus_tag LOCUS_22930 21854 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 22294 21857 gene locus_tag LOCUS_22940 22294 21857 CDS product type IV pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071144.1 protein_id gnl|my_center|LOCUS_22940 23024 22572 gene locus_tag LOCUS_22950 gene rplI 23024 22572 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L75 protein_id gnl|my_center|LOCUS_22950 23288 23061 gene locus_tag LOCUS_22960 gene rpsR 23288 23061 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUZ0 protein_id gnl|my_center|LOCUS_22960 23618 23301 gene locus_tag LOCUS_22970 gene priB 23618 23301 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZB82 protein_id gnl|my_center|LOCUS_22970 24014 23673 gene locus_tag LOCUS_22980 gene rpsF 24014 23673 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44375 protein_id gnl|my_center|LOCUS_22980 >Feature sequence062 2445 3452 gene locus_tag LOCUS_22990 2445 3452 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529706.1 protein_id gnl|my_center|LOCUS_22990 3449 4669 gene locus_tag LOCUS_23000 3449 4669 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244018.1 protein_id gnl|my_center|LOCUS_23000 4841 6013 gene locus_tag LOCUS_23010 4841 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070677.1 protein_id gnl|my_center|LOCUS_23010 6814 9372 gene locus_tag LOCUS_23020 gene fyuA 6814 9372 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038506.1 protein_id gnl|my_center|LOCUS_23020 9692 11011 gene locus_tag LOCUS_23030 9692 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 13145 10992 gene locus_tag LOCUS_23040 13145 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 13363 15924 gene locus_tag LOCUS_23050 gene fyuA 13363 15924 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038506.1 protein_id gnl|my_center|LOCUS_23050 16017 18065 gene locus_tag LOCUS_23060 16017 18065 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109778.1 protein_id gnl|my_center|LOCUS_23060 18296 18721 gene locus_tag LOCUS_23070 18296 18721 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019905.1 protein_id gnl|my_center|LOCUS_23070 19029 21353 gene locus_tag LOCUS_23080 19029 21353 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223350.1 protein_id gnl|my_center|LOCUS_23080 21604 22614 gene locus_tag LOCUS_23090 21604 22614 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113959.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence063 122 1279 gene locus_tag LOCUS_23100 122 1279 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707630.1 protein_id gnl|my_center|LOCUS_23100 2481 1438 gene locus_tag LOCUS_23110 2481 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122410.1 protein_id gnl|my_center|LOCUS_23110 3555 2494 gene locus_tag LOCUS_23120 3555 2494 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119629.1 protein_id gnl|my_center|LOCUS_23120 4035 3559 gene locus_tag LOCUS_23130 4035 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 5060 4167 gene locus_tag LOCUS_23140 5060 4167 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EF83 protein_id gnl|my_center|LOCUS_23140 6389 5085 gene locus_tag LOCUS_23150 6389 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_23150 6601 6380 gene locus_tag LOCUS_23160 6601 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 7117 6611 gene locus_tag LOCUS_23170 7117 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072164.1 protein_id gnl|my_center|LOCUS_23170 8264 7380 gene locus_tag LOCUS_23180 8264 7380 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539164.1 protein_id gnl|my_center|LOCUS_23180 8877 8257 gene locus_tag LOCUS_23190 8877 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 11320 9239 gene locus_tag LOCUS_23200 gene hgpB 11320 9239 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704907.1 protein_id gnl|my_center|LOCUS_23200 11527 12273 gene locus_tag LOCUS_23210 gene bhuT 11527 12273 CDS product hemin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040665.1 protein_id gnl|my_center|LOCUS_23210 12270 13316 gene locus_tag LOCUS_23220 12270 13316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883993.1 protein_id gnl|my_center|LOCUS_23220 13316 14107 gene locus_tag LOCUS_23230 gene hmuV 13316 14107 CDS product hemin import ATP-binding protein HmuV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EQ69 protein_id gnl|my_center|LOCUS_23230 14104 14838 gene locus_tag LOCUS_23240 14104 14838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112758.1 protein_id gnl|my_center|LOCUS_23240 15465 14965 gene locus_tag LOCUS_23250 15465 14965 CDS product glyoxalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008474277.1 protein_id gnl|my_center|LOCUS_23250 15569 16438 gene locus_tag LOCUS_23260 15569 16438 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459241.1 protein_id gnl|my_center|LOCUS_23260 16847 17296 gene locus_tag LOCUS_23270 16847 17296 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071886.1 protein_id gnl|my_center|LOCUS_23270 17741 17950 gene locus_tag LOCUS_23280 17741 17950 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_23280 18136 18345 gene locus_tag LOCUS_23290 18136 18345 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_23290 19431 18589 gene locus_tag LOCUS_23300 19431 18589 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038647.1 protein_id gnl|my_center|LOCUS_23300 19741 21918 gene locus_tag LOCUS_23310 gene katG 19741 21918 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 protein_id gnl|my_center|LOCUS_23310 22749 22078 gene locus_tag LOCUS_23320 gene azoR 22749 22078 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KN28 protein_id gnl|my_center|LOCUS_23320 >Feature sequence064 478 1311 gene locus_tag LOCUS_23330 478 1311 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841995.1 protein_id gnl|my_center|LOCUS_23330 3324 1870 gene locus_tag LOCUS_23340 3324 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 3662 3333 gene locus_tag LOCUS_23350 3662 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 4921 3824 gene locus_tag LOCUS_23360 4921 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 7413 4918 gene locus_tag LOCUS_23370 7413 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 8559 7438 gene locus_tag LOCUS_23380 8559 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 8728 9012 gene locus_tag LOCUS_23390 8728 9012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 9133 9341 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tatttccagctgcctactcggcagttcac 10063 9464 gene locus_tag LOCUS_23400 10063 9464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 11088 10060 gene locus_tag LOCUS_23410 11088 10060 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478111.1 protein_id gnl|my_center|LOCUS_23410 13139 11088 gene locus_tag LOCUS_23420 13139 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 14318 13143 gene locus_tag LOCUS_23430 14318 13143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 14825 15481 gene locus_tag LOCUS_23440 14825 15481 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105652.1 protein_id gnl|my_center|LOCUS_23440 15538 16302 gene locus_tag LOCUS_23450 15538 16302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 16607 16305 gene locus_tag LOCUS_23460 16607 16305 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009890.1 protein_id gnl|my_center|LOCUS_23460 16791 18566 gene locus_tag LOCUS_23470 16791 18566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963644.1 protein_id gnl|my_center|LOCUS_23470 18559 19785 gene locus_tag LOCUS_23480 18559 19785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 20829 19828 gene locus_tag LOCUS_23490 20829 19828 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463118.1 protein_id gnl|my_center|LOCUS_23490 22652 20832 gene locus_tag LOCUS_23500 22652 20832 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478346.1 protein_id gnl|my_center|LOCUS_23500 23274 22645 gene locus_tag LOCUS_23510 23274 22645 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106505.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence065 1632 724 gene locus_tag LOCUS_23520 1632 724 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399927.1 protein_id gnl|my_center|LOCUS_23520 2061 1699 gene locus_tag LOCUS_23530 2061 1699 CDS product cyclic diguanosine monophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD5 protein_id gnl|my_center|LOCUS_23530 4060 2387 gene locus_tag LOCUS_23540 gene ettA 4060 2387 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45127 protein_id gnl|my_center|LOCUS_23540 5053 4154 gene locus_tag LOCUS_23550 5053 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_23550 5221 6168 gene locus_tag LOCUS_23560 gene metA 5221 6168 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRM5 protein_id gnl|my_center|LOCUS_23560 6158 7225 gene locus_tag LOCUS_23570 6158 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23570 7236 9866 gene locus_tag LOCUS_23580 7236 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23580 10193 10951 gene locus_tag LOCUS_23590 10193 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071068.1 protein_id gnl|my_center|LOCUS_23590 11368 14475 gene locus_tag LOCUS_23600 11368 14475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 14737 14540 gene locus_tag LOCUS_23610 14737 14540 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UK08 protein_id gnl|my_center|LOCUS_23610 15702 15070 gene locus_tag LOCUS_23620 15702 15070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035410.1 protein_id gnl|my_center|LOCUS_23620 16055 17857 gene locus_tag LOCUS_23630 16055 17857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 17918 18412 gene locus_tag LOCUS_23640 17918 18412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 18587 21010 gene locus_tag LOCUS_23650 gene hrpB 18587 21010 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262606.1 protein_id gnl|my_center|LOCUS_23650 21124 21468 gene locus_tag LOCUS_23660 21124 21468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 21589 22002 gene locus_tag LOCUS_23670 21589 22002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 22428 22790 gene locus_tag LOCUS_23680 22428 22790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence066 670 299 gene locus_tag LOCUS_23690 gene cheY 670 299 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185006.1 protein_id gnl|my_center|LOCUS_23690 1266 724 gene locus_tag LOCUS_23700 1266 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1712 1263 gene locus_tag LOCUS_23710 1712 1263 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTM1 protein_id gnl|my_center|LOCUS_23710 1836 2372 gene locus_tag LOCUS_23720 gene blc 1836 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 protein_id gnl|my_center|LOCUS_23720 2620 4521 gene locus_tag LOCUS_23730 2620 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 4673 6277 gene locus_tag LOCUS_23740 4673 6277 CDS product putative lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67301 protein_id gnl|my_center|LOCUS_23740 6832 6497 gene locus_tag LOCUS_23750 6832 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 8439 6832 gene locus_tag LOCUS_23760 8439 6832 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073265.1 protein_id gnl|my_center|LOCUS_23760 8780 8436 gene locus_tag LOCUS_23770 8780 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 9040 9402 gene locus_tag LOCUS_23780 9040 9402 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_23780 9449 9823 gene locus_tag LOCUS_23790 9449 9823 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395273.1 protein_id gnl|my_center|LOCUS_23790 9816 10403 gene locus_tag LOCUS_23800 9816 10403 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894086.1 protein_id gnl|my_center|LOCUS_23800 10408 11163 gene locus_tag LOCUS_23810 10408 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 15296 11235 gene locus_tag LOCUS_23820 15296 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 15962 15402 gene locus_tag LOCUS_23830 15962 15402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 16094 16507 gene locus_tag LOCUS_23840 gene yaeJ 16094 16507 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 protein_id gnl|my_center|LOCUS_23840 17528 16509 gene locus_tag LOCUS_23850 gene hemH2 17528 16509 CDS product ferrochelatase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ7 protein_id gnl|my_center|LOCUS_23850 18953 17625 gene locus_tag LOCUS_23860 18953 17625 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072498.1 protein_id gnl|my_center|LOCUS_23860 19203 19568 gene locus_tag LOCUS_23870 gene cheY 19203 19568 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072504.1 protein_id gnl|my_center|LOCUS_23870 19565 20140 gene locus_tag LOCUS_23880 gene cheC 19565 20140 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072503.1 protein_id gnl|my_center|LOCUS_23880 20140 21414 gene locus_tag LOCUS_23890 20140 21414 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072502.1 protein_id gnl|my_center|LOCUS_23890 21500 22045 gene locus_tag LOCUS_23900 21500 22045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072197.1 protein_id gnl|my_center|LOCUS_23900 22038 22541 gene locus_tag LOCUS_23910 22038 22541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence067 1059 2408 gene locus_tag LOCUS_23920 1059 2408 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I000 protein_id gnl|my_center|LOCUS_23920 3312 2503 gene locus_tag LOCUS_23930 3312 2503 CDS product putative phosphoenolpyruvate synthase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDU8 protein_id gnl|my_center|LOCUS_23930 3467 5842 gene locus_tag LOCUS_23940 gene ppsA 3467 5842 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDU9 protein_id gnl|my_center|LOCUS_23940 6129 5920 gene locus_tag LOCUS_23950 6129 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 6279 9335 gene locus_tag LOCUS_23960 6279 9335 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612968.1 protein_id gnl|my_center|LOCUS_23960 10581 9391 gene locus_tag LOCUS_23970 10581 9391 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_23970 11793 10582 gene locus_tag LOCUS_23980 11793 10582 CDS product phage integrase family site specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_819027.1 protein_id gnl|my_center|LOCUS_23980 11936 12499 gene locus_tag LOCUS_23990 11936 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704661.1 protein_id gnl|my_center|LOCUS_23990 12938 12600 gene locus_tag LOCUS_24000 12938 12600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 13070 13261 gene locus_tag LOCUS_24010 13070 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 13258 15249 gene locus_tag LOCUS_24020 13258 15249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 15289 15606 gene locus_tag LOCUS_24030 15289 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 15873 16151 gene locus_tag LOCUS_24040 15873 16151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 16215 17861 gene locus_tag LOCUS_24050 16215 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 17874 18212 gene locus_tag LOCUS_24060 17874 18212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 18215 19456 gene locus_tag LOCUS_24070 18215 19456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 19544 19729 gene locus_tag LOCUS_24080 19544 19729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 19947 20357 gene locus_tag LOCUS_24090 19947 20357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 21415 20417 gene locus_tag LOCUS_24100 21415 20417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 21764 22150 gene locus_tag LOCUS_24110 21764 22150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence068 847 1593 gene locus_tag LOCUS_24120 847 1593 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072839.1 protein_id gnl|my_center|LOCUS_24120 2685 1816 gene locus_tag LOCUS_24130 2685 1816 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMC0 protein_id gnl|my_center|LOCUS_24130 3272 2682 gene locus_tag LOCUS_24140 gene scpB 3272 2682 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ6 protein_id gnl|my_center|LOCUS_24140 3873 3442 gene locus_tag LOCUS_24150 3873 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 4121 4927 gene locus_tag LOCUS_24160 4121 4927 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481860.1 protein_id gnl|my_center|LOCUS_24160 4933 5604 gene locus_tag LOCUS_24170 4933 5604 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417707.1 protein_id gnl|my_center|LOCUS_24170 5601 6413 gene locus_tag LOCUS_24180 gene rrmA 5601 6413 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211061.1 protein_id gnl|my_center|LOCUS_24180 6840 6394 gene locus_tag LOCUS_24190 6840 6394 CDS product UPF0208 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT06 protein_id gnl|my_center|LOCUS_24190 7159 8370 gene locus_tag LOCUS_24200 gene ackA 7159 8370 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED55 protein_id gnl|my_center|LOCUS_24200 8373 10523 gene locus_tag LOCUS_24210 8373 10523 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGN7 protein_id gnl|my_center|LOCUS_24210 10748 11146 gene locus_tag LOCUS_24220 10748 11146 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072256.1 protein_id gnl|my_center|LOCUS_24220 11146 11640 gene locus_tag LOCUS_24230 11146 11640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 11646 11993 gene locus_tag LOCUS_24240 gene yffB 11646 11993 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262396.1 protein_id gnl|my_center|LOCUS_24240 11990 13120 gene locus_tag LOCUS_24250 gene dapE 11990 13120 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB6 protein_id gnl|my_center|LOCUS_24250 13117 13818 gene locus_tag LOCUS_24260 13117 13818 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172351.1 protein_id gnl|my_center|LOCUS_24260 14680 13799 gene locus_tag LOCUS_24270 14680 13799 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_24270 15021 16385 gene locus_tag LOCUS_24280 15021 16385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706417.1 protein_id gnl|my_center|LOCUS_24280 16394 16819 gene locus_tag LOCUS_24290 16394 16819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072664.1 protein_id gnl|my_center|LOCUS_24290 16831 17466 gene locus_tag LOCUS_24300 16831 17466 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418930.1 protein_id gnl|my_center|LOCUS_24300 17487 17954 gene locus_tag LOCUS_24310 17487 17954 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072571.1 protein_id gnl|my_center|LOCUS_24310 19243 18026 gene locus_tag LOCUS_24320 19243 18026 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456922.1 protein_id gnl|my_center|LOCUS_24320 19694 19350 gene locus_tag LOCUS_24330 19694 19350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 19845 20450 gene locus_tag LOCUS_24340 19845 20450 CDS product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074160.1 protein_id gnl|my_center|LOCUS_24340 20447 21226 gene locus_tag LOCUS_24350 20447 21226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072480.1 protein_id gnl|my_center|LOCUS_24350 <22199 21177 gene locus_tag LOCUS_24360 <22199 21177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074251.1:diguanylate cyclase >Feature sequence069 <1 789 gene locus_tag LOCUS_24370 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707862.1:ATP-dependent protease 1510 803 gene locus_tag LOCUS_24380 gene aruR 1510 803 CDS product transcriptional regulatory protein AruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUI2 protein_id gnl|my_center|LOCUS_24380 4160 1665 gene locus_tag LOCUS_24390 4160 1665 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789772.1 protein_id gnl|my_center|LOCUS_24390 4332 5408 gene locus_tag LOCUS_24400 4332 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_24400 6625 5405 gene locus_tag LOCUS_24410 gene vieA 6625 5405 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037833.1 protein_id gnl|my_center|LOCUS_24410 6773 7786 gene locus_tag LOCUS_24420 6773 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 9151 7838 gene locus_tag LOCUS_24430 gene atoE 9151 7838 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071598.1 protein_id gnl|my_center|LOCUS_24430 10267 9317 gene locus_tag LOCUS_24440 gene cheV 10267 9317 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072079.1 protein_id gnl|my_center|LOCUS_24440 10430 11503 gene locus_tag LOCUS_24450 10430 11503 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037962.1 protein_id gnl|my_center|LOCUS_24450 12806 11775 gene locus_tag LOCUS_24460 12806 11775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261945.1 protein_id gnl|my_center|LOCUS_24460 13352 12894 gene locus_tag LOCUS_24470 13352 12894 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106124.1 protein_id gnl|my_center|LOCUS_24470 13429 14286 gene locus_tag LOCUS_24480 gene tesB 13429 14286 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167662.1 protein_id gnl|my_center|LOCUS_24480 16745 14301 gene locus_tag LOCUS_24490 gene plsB 16745 14301 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRU2 protein_id gnl|my_center|LOCUS_24490 17165 17476 gene locus_tag LOCUS_24500 gene rpsJ 17165 17476 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF20 protein_id gnl|my_center|LOCUS_24500 17504 18139 gene locus_tag LOCUS_24510 gene rplC 17504 18139 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T13 protein_id gnl|my_center|LOCUS_24510 18157 18762 gene locus_tag LOCUS_24520 gene rplD 18157 18762 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF22 protein_id gnl|my_center|LOCUS_24520 18759 19061 gene locus_tag LOCUS_24530 gene rplW 18759 19061 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF23 protein_id gnl|my_center|LOCUS_24530 19079 19903 gene locus_tag LOCUS_24540 gene rplB 19079 19903 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNY7 protein_id gnl|my_center|LOCUS_24540 19919 20197 gene locus_tag LOCUS_24550 gene rpsS 19919 20197 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK64 protein_id gnl|my_center|LOCUS_24550 20212 20544 gene locus_tag LOCUS_24560 gene rplV 20212 20544 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK63 protein_id gnl|my_center|LOCUS_24560 20556 21257 gene locus_tag LOCUS_24570 gene rpsC 20556 21257 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF27 protein_id gnl|my_center|LOCUS_24570 21270 21683 gene locus_tag LOCUS_24580 gene rplP 21270 21683 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FN58 protein_id gnl|my_center|LOCUS_24580 21683 21874 gene locus_tag LOCUS_24590 gene rpmC 21683 21874 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF29 protein_id gnl|my_center|LOCUS_24590 21874 22131 gene locus_tag LOCUS_24600 gene rpsQ 21874 22131 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF30 protein_id gnl|my_center|LOCUS_24600 >Feature sequence070 720 28 gene locus_tag LOCUS_24610 720 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 1260 865 gene locus_tag LOCUS_24620 1260 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2067 1627 gene locus_tag LOCUS_24630 2067 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 4143 2263 gene locus_tag LOCUS_24640 4143 2263 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073602.1 protein_id gnl|my_center|LOCUS_24640 5287 4259 gene locus_tag LOCUS_24650 5287 4259 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699793.1 protein_id gnl|my_center|LOCUS_24650 5823 5284 gene locus_tag LOCUS_24660 5823 5284 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480556.1 protein_id gnl|my_center|LOCUS_24660 6042 6539 gene locus_tag LOCUS_24670 gene rraA 6042 6539 CDS product regulator of ribonuclease activity A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R9 protein_id gnl|my_center|LOCUS_24670 6543 7589 gene locus_tag LOCUS_24680 gene hutG 6543 7589 CDS product formimidoylglutamase HutG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073881.1 protein_id gnl|my_center|LOCUS_24680 9357 7597 gene locus_tag LOCUS_24690 9357 7597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 10630 9383 gene locus_tag LOCUS_24700 gene hutI 10630 9383 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKJ7 protein_id gnl|my_center|LOCUS_24700 10740 11447 gene locus_tag LOCUS_24710 gene hutC 10740 11447 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070506.1 protein_id gnl|my_center|LOCUS_24710 11550 13223 gene locus_tag LOCUS_24720 gene hutU 11550 13223 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q76 protein_id gnl|my_center|LOCUS_24720 13226 14758 gene locus_tag LOCUS_24730 gene hutH 13226 14758 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKJ4 protein_id gnl|my_center|LOCUS_24730 15528 14755 gene locus_tag LOCUS_24740 15528 14755 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816712.1 protein_id gnl|my_center|LOCUS_24740 15643 17685 gene locus_tag LOCUS_24750 15643 17685 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478023.1 protein_id gnl|my_center|LOCUS_24750 17796 19169 gene locus_tag LOCUS_24760 17796 19169 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FNU4 protein_id gnl|my_center|LOCUS_24760 19743 19231 gene locus_tag LOCUS_24770 19743 19231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704279.1 protein_id gnl|my_center|LOCUS_24770 20327 19743 gene locus_tag LOCUS_24780 20327 19743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 20906 21109 gene locus_tag LOCUS_24790 20906 21109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 <21683 21084 gene locus_tag LOCUS_24800 <21683 21084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478649.1:cytochrome c >Feature sequence071 946 425 gene locus_tag LOCUS_24810 gene greA 946 425 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZBB3 protein_id gnl|my_center|LOCUS_24810 4169 951 gene locus_tag LOCUS_24820 gene carB 4169 951 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7M8 protein_id gnl|my_center|LOCUS_24820 5322 4186 gene locus_tag LOCUS_24830 gene carA 5322 4186 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPH8 protein_id gnl|my_center|LOCUS_24830 6327 5530 gene locus_tag LOCUS_24840 gene dapB 6327 5530 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPH7 protein_id gnl|my_center|LOCUS_24840 6599 7912 gene locus_tag LOCUS_24850 6599 7912 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559525.1 protein_id gnl|my_center|LOCUS_24850 7925 8770 gene locus_tag LOCUS_24860 7925 8770 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423373.1 protein_id gnl|my_center|LOCUS_24860 9386 8856 gene locus_tag LOCUS_24870 9386 8856 CDS product ribosomal-protein-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106347.1 protein_id gnl|my_center|LOCUS_24870 9839 9387 gene locus_tag LOCUS_24880 9839 9387 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706242.1 protein_id gnl|my_center|LOCUS_24880 11312 9987 gene locus_tag LOCUS_24890 11312 9987 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KP3 protein_id gnl|my_center|LOCUS_24890 11601 12551 gene locus_tag LOCUS_24900 11601 12551 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q99 protein_id gnl|my_center|LOCUS_24900 12879 15692 gene locus_tag LOCUS_24910 gene acnB 12879 15692 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_24910 15871 16587 gene locus_tag LOCUS_24920 gene aat 15871 16587 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJE0 protein_id gnl|my_center|LOCUS_24920 16580 17284 gene locus_tag LOCUS_24930 gene ate 16580 17284 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJD9 protein_id gnl|my_center|LOCUS_24930 17375 17593 gene locus_tag LOCUS_24940 gene infA 17375 17593 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65128 protein_id gnl|my_center|LOCUS_24940 20034 17770 gene locus_tag LOCUS_24950 gene clpA 20034 17770 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495889.1 protein_id gnl|my_center|LOCUS_24950 20412 20104 gene locus_tag LOCUS_24960 gene clpS 20412 20104 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJD6 protein_id gnl|my_center|LOCUS_24960 20622 20837 gene locus_tag LOCUS_24970 20622 20837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 >Feature sequence072 222 1922 gene locus_tag LOCUS_24980 222 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 2230 1982 gene locus_tag LOCUS_24990 2230 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462100.1 protein_id gnl|my_center|LOCUS_24990 2417 3565 gene locus_tag LOCUS_25000 2417 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071127.1 protein_id gnl|my_center|LOCUS_25000 3962 4309 gene locus_tag LOCUS_25010 3962 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 4860 5222 gene locus_tag LOCUS_25020 4860 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 6056 8176 gene locus_tag LOCUS_25030 gene phuR 6056 8176 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_25030 8454 8798 gene locus_tag LOCUS_25040 8454 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 9738 8866 gene locus_tag LOCUS_25050 9738 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 10470 9754 gene locus_tag LOCUS_25060 10470 9754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 11269 10619 gene locus_tag LOCUS_25070 11269 10619 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 protein_id gnl|my_center|LOCUS_25070 12405 11266 gene locus_tag LOCUS_25080 12405 11266 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036327.1 protein_id gnl|my_center|LOCUS_25080 13692 13105 gene locus_tag LOCUS_25090 13692 13105 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009839.1 protein_id gnl|my_center|LOCUS_25090 14888 13809 gene locus_tag LOCUS_25100 14888 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 15550 15975 gene locus_tag LOCUS_25110 15550 15975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 17242 16226 gene locus_tag LOCUS_25120 17242 16226 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035998.1 protein_id gnl|my_center|LOCUS_25120 17536 17907 gene locus_tag LOCUS_25130 17536 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 19969 18134 gene locus_tag LOCUS_25140 19969 18134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 >Feature sequence073 2418 13 gene locus_tag LOCUS_25150 gene cga 2418 13 CDS product glucan 14-alpha-glucosidase Cga inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072434.1 protein_id gnl|my_center|LOCUS_25150 3917 2433 gene locus_tag LOCUS_25160 gene malT 3917 2433 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072433.1 protein_id gnl|my_center|LOCUS_25160 5799 3907 gene locus_tag LOCUS_25170 5799 3907 CDS product O-glycosyl hydrolase family 13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072207.1 protein_id gnl|my_center|LOCUS_25170 7767 5923 gene locus_tag LOCUS_25180 gene susA 7767 5923 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_25180 9268 7781 gene locus_tag LOCUS_25190 9268 7781 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920649.1 protein_id gnl|my_center|LOCUS_25190 10781 9270 gene locus_tag LOCUS_25200 10781 9270 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920149.1 protein_id gnl|my_center|LOCUS_25200 13636 10886 gene locus_tag LOCUS_25210 gene malA 13636 10886 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920148.1 protein_id gnl|my_center|LOCUS_25210 14350 15975 gene locus_tag LOCUS_25220 gene algA 14350 15975 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072238.1 protein_id gnl|my_center|LOCUS_25220 16556 16248 gene locus_tag LOCUS_25230 16556 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 17994 17296 gene locus_tag LOCUS_25240 17994 17296 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073517.1 protein_id gnl|my_center|LOCUS_25240 <20201 18061 gene locus_tag LOCUS_25250 <20201 18061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071943.1:TonB-dependent receptor >Feature sequence074 1506 1234 gene locus_tag LOCUS_25260 gene ptsO 1506 1234 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073703.1 protein_id gnl|my_center|LOCUS_25260 2377 1535 gene locus_tag LOCUS_25270 2377 1535 CDS product nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ08 protein_id gnl|my_center|LOCUS_25270 3012 2560 gene locus_tag LOCUS_25280 gene ptsN 3012 2560 CDS product PTS IIA-like nitrogen-regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261179.1 protein_id gnl|my_center|LOCUS_25280 3304 3017 gene locus_tag LOCUS_25290 gene yfiA-2 3304 3017 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_25290 4829 3333 gene locus_tag LOCUS_25300 gene rpoN 4829 3333 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE5 protein_id gnl|my_center|LOCUS_25300 5621 4896 gene locus_tag LOCUS_25310 gene lptB 5621 4896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_25310 6151 5618 gene locus_tag LOCUS_25320 gene lptA 6151 5618 CDS product lipopolysaccharide export system protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAE7 protein_id gnl|my_center|LOCUS_25320 6695 6141 gene locus_tag LOCUS_25330 gene lptC 6695 6141 CDS product lipopolysaccharide export system protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45075 protein_id gnl|my_center|LOCUS_25330 7243 6692 gene locus_tag LOCUS_25340 gene kdsC 7243 6692 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073695.1 protein_id gnl|my_center|LOCUS_25340 8226 7243 gene locus_tag LOCUS_25350 gene kdsD 8226 7243 CDS product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7V9 protein_id gnl|my_center|LOCUS_25350 9211 8240 gene locus_tag LOCUS_25360 gene yrbG 9211 8240 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_25360 9479 10282 gene locus_tag LOCUS_25370 9479 10282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455119.1 protein_id gnl|my_center|LOCUS_25370 10282 11061 gene locus_tag LOCUS_25380 10282 11061 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455118.1 protein_id gnl|my_center|LOCUS_25380 11076 11624 gene locus_tag LOCUS_25390 11076 11624 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455116.1 protein_id gnl|my_center|LOCUS_25390 11631 12305 gene locus_tag LOCUS_25400 gene mlaC 11631 12305 CDS product toluene tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073690.1 protein_id gnl|my_center|LOCUS_25400 12298 12591 gene locus_tag LOCUS_25410 12298 12591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 12597 12854 gene locus_tag LOCUS_25420 12597 12854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306001.1 protein_id gnl|my_center|LOCUS_25420 12868 14127 gene locus_tag LOCUS_25430 gene murA 12868 14127 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP62 protein_id gnl|my_center|LOCUS_25430 15108 14167 gene locus_tag LOCUS_25440 15108 14167 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911599.1 protein_id gnl|my_center|LOCUS_25440 15044 15301 gene locus_tag LOCUS_25450 15044 15301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 16704 15352 gene locus_tag LOCUS_25460 gene degQ 16704 15352 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707600.1 protein_id gnl|my_center|LOCUS_25460 17353 16913 gene locus_tag LOCUS_25470 gene yhcB 17353 16913 CDS product cytochrome D ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262645.1 protein_id gnl|my_center|LOCUS_25470 17504 18592 gene locus_tag LOCUS_25480 gene yhcM 17504 18592 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2M8 protein_id gnl|my_center|LOCUS_25480 18905 19333 gene locus_tag LOCUS_25490 gene rplM 18905 19333 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SI5 protein_id gnl|my_center|LOCUS_25490 19345 19734 gene locus_tag LOCUS_25500 gene rpsI 19345 19734 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A7X3 protein_id gnl|my_center|LOCUS_25500 19658 19948 gene locus_tag LOCUS_25510 19658 19948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence075 910 377 gene locus_tag LOCUS_25520 910 377 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706248.1 protein_id gnl|my_center|LOCUS_25520 2260 914 gene locus_tag LOCUS_25530 gene astB 2260 914 CDS product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMV4 protein_id gnl|my_center|LOCUS_25530 2555 2325 gene locus_tag LOCUS_25540 2555 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 2664 2545 gene locus_tag LOCUS_25550 2664 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 3927 2917 gene locus_tag LOCUS_25560 3927 2917 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070761.1 protein_id gnl|my_center|LOCUS_25560 4464 4033 gene locus_tag LOCUS_25570 4464 4033 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263217.1 protein_id gnl|my_center|LOCUS_25570 4590 5018 gene locus_tag LOCUS_25580 gene ohr 4590 5018 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104171.1 protein_id gnl|my_center|LOCUS_25580 5460 7580 gene locus_tag LOCUS_25590 5460 7580 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071497.1 protein_id gnl|my_center|LOCUS_25590 8375 7848 gene locus_tag LOCUS_25600 8375 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 8428 8787 gene locus_tag LOCUS_25610 8428 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 8834 10030 gene locus_tag LOCUS_25620 8834 10030 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814294.1 protein_id gnl|my_center|LOCUS_25620 11166 10081 gene locus_tag LOCUS_25630 11166 10081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 11785 11156 gene locus_tag LOCUS_25640 11785 11156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 12285 11941 gene locus_tag LOCUS_25650 12285 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 13185 12853 gene locus_tag LOCUS_25660 13185 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 13677 13210 gene locus_tag LOCUS_25670 13677 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 14654 13800 gene locus_tag LOCUS_25680 14654 13800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 15030 14695 gene locus_tag LOCUS_25690 15030 14695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 15339 15064 gene locus_tag LOCUS_25700 15339 15064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 15912 15439 gene locus_tag LOCUS_25710 15912 15439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 16709 15915 gene locus_tag LOCUS_25720 16709 15915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 17895 17035 gene locus_tag LOCUS_25730 17895 17035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 >Feature sequence076 <1 1338 gene locus_tag LOCUS_25740 <1 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975979.1:pectate lyase 1906 1379 gene locus_tag LOCUS_25750 1906 1379 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497706.1 protein_id gnl|my_center|LOCUS_25750 2193 1975 gene locus_tag LOCUS_25760 2193 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704507.1 protein_id gnl|my_center|LOCUS_25760 2641 2201 gene locus_tag LOCUS_25770 2641 2201 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986713.1 protein_id gnl|my_center|LOCUS_25770 3092 2679 gene locus_tag LOCUS_25780 3092 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3802 3341 gene locus_tag LOCUS_25790 3802 3341 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206857.1 protein_id gnl|my_center|LOCUS_25790 4246 3812 gene locus_tag LOCUS_25800 4246 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096712.1 protein_id gnl|my_center|LOCUS_25800 4341 4676 gene locus_tag LOCUS_25810 4341 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25810 4727 5275 gene locus_tag LOCUS_25820 4727 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25820 5463 6311 gene locus_tag LOCUS_25830 5463 6311 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104043.1 protein_id gnl|my_center|LOCUS_25830 6786 6322 gene locus_tag LOCUS_25840 6786 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 7097 7501 gene locus_tag LOCUS_25850 7097 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 7831 9348 gene locus_tag LOCUS_25860 7831 9348 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217121.1 protein_id gnl|my_center|LOCUS_25860 10280 9408 gene locus_tag LOCUS_25870 gene myg1 10280 9408 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385747.1 protein_id gnl|my_center|LOCUS_25870 11703 10615 gene locus_tag LOCUS_25880 11703 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 11840 12820 gene locus_tag LOCUS_25890 11840 12820 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920427.1 protein_id gnl|my_center|LOCUS_25890 12892 13734 gene locus_tag LOCUS_25900 12892 13734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071178.1 protein_id gnl|my_center|LOCUS_25900 13756 14727 gene locus_tag LOCUS_25910 13756 14727 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767387.1 protein_id gnl|my_center|LOCUS_25910 15393 14818 gene locus_tag LOCUS_25920 15393 14818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 16282 15491 gene locus_tag LOCUS_25930 16282 15491 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_25930 17307 16279 gene locus_tag LOCUS_25940 17307 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 <19702 17396 gene locus_tag LOCUS_25950 <19702 17396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_637141.2:glucan 1,4-beta-glucosidase >Feature sequence077 103 29 gene locus_tag LOCUS_t00310 103 29 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 226 142 gene locus_tag LOCUS_t00320 226 142 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 385 311 gene locus_tag LOCUS_t00330 385 311 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 510 426 gene locus_tag LOCUS_t00340 510 426 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 754 678 gene locus_tag LOCUS_t00350 754 678 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 834 760 gene locus_tag LOCUS_t00360 834 760 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 957 873 gene locus_tag LOCUS_t00370 957 873 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1177 1101 gene locus_tag LOCUS_t00380 1177 1101 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2548 1457 gene locus_tag LOCUS_25960 gene ychF 2548 1457 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN05 protein_id gnl|my_center|LOCUS_25960 3167 2583 gene locus_tag LOCUS_25970 gene pth 3167 2583 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KQ21 protein_id gnl|my_center|LOCUS_25970 3790 3185 gene locus_tag LOCUS_25980 gene rplY 3790 3185 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C7 protein_id gnl|my_center|LOCUS_25980 4898 3951 gene locus_tag LOCUS_25990 gene prs 4898 3951 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN02 protein_id gnl|my_center|LOCUS_25990 5856 4999 gene locus_tag LOCUS_26000 gene ispE 5856 4999 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN01 protein_id gnl|my_center|LOCUS_26000 6445 5858 gene locus_tag LOCUS_26010 gene lolB 6445 5858 CDS product outer-membrane lipoprotein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C4 protein_id gnl|my_center|LOCUS_26010 6529 7785 gene locus_tag LOCUS_26020 gene hemA 6529 7785 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RN5 protein_id gnl|my_center|LOCUS_26020 7793 8878 gene locus_tag LOCUS_26030 gene prfA 7793 8878 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR3 protein_id gnl|my_center|LOCUS_26030 8881 9723 gene locus_tag LOCUS_26040 gene prmC 8881 9723 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR4 protein_id gnl|my_center|LOCUS_26040 9773 11314 gene locus_tag LOCUS_26050 9773 11314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 protein_id gnl|my_center|LOCUS_26050 11426 11800 gene locus_tag LOCUS_26060 11426 11800 CDS product SirB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073594.1 protein_id gnl|my_center|LOCUS_26060 11925 12752 gene locus_tag LOCUS_26070 11925 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481357.1 protein_id gnl|my_center|LOCUS_26070 12769 14022 gene locus_tag LOCUS_26080 12769 14022 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_26080 14032 14886 gene locus_tag LOCUS_26090 gene kdsA 14032 14886 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAR9 protein_id gnl|my_center|LOCUS_26090 15006 15902 gene locus_tag LOCUS_26100 gene gcvA 15006 15902 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303519.1 protein_id gnl|my_center|LOCUS_26100 15904 16542 gene locus_tag LOCUS_26110 15904 16542 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 protein_id gnl|my_center|LOCUS_26110 16568 16936 gene locus_tag LOCUS_26120 16568 16936 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765183.1 protein_id gnl|my_center|LOCUS_26120 16975 18060 gene locus_tag LOCUS_26130 gene rlmM 16975 18060 CDS product ribosomal RNA large subunit methyltransferase M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPA5 protein_id gnl|my_center|LOCUS_26130 18238 18591 gene locus_tag LOCUS_26140 18238 18591 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403950.1 protein_id gnl|my_center|LOCUS_26140 19396 18650 gene locus_tag LOCUS_26150 gene cysZ 19396 18650 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHL6 protein_id gnl|my_center|LOCUS_26150 >Feature sequence078 522 1 gene locus_tag LOCUS_26160 522 1 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481442.1 protein_id gnl|my_center|LOCUS_26160 642 881 gene locus_tag LOCUS_26170 642 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 2114 906 gene locus_tag LOCUS_26180 2114 906 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071942.1 protein_id gnl|my_center|LOCUS_26180 2440 4002 gene locus_tag LOCUS_26190 2440 4002 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453913.1 protein_id gnl|my_center|LOCUS_26190 4156 4638 gene locus_tag LOCUS_26200 gene purE 4156 4638 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE1 protein_id gnl|my_center|LOCUS_26200 4640 5788 gene locus_tag LOCUS_26210 gene purK 4640 5788 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVT8 protein_id gnl|my_center|LOCUS_26210 6038 5817 gene locus_tag LOCUS_26220 6038 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 6236 7009 gene locus_tag LOCUS_26230 6236 7009 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749C5 protein_id gnl|my_center|LOCUS_26230 7006 8175 gene locus_tag LOCUS_26240 7006 8175 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036340.1 protein_id gnl|my_center|LOCUS_26240 8280 10772 gene locus_tag LOCUS_26250 8280 10772 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070944.1 protein_id gnl|my_center|LOCUS_26250 11336 10800 gene locus_tag LOCUS_26260 11336 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 11476 13266 gene locus_tag LOCUS_26270 gene ggt 11476 13266 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814321.1 protein_id gnl|my_center|LOCUS_26270 13428 15122 gene locus_tag LOCUS_26280 gene maeA 13428 15122 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87Q92 protein_id gnl|my_center|LOCUS_26280 15249 15959 gene locus_tag LOCUS_26290 15249 15959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 17317 15968 gene locus_tag LOCUS_26300 17317 15968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 17832 18170 gene locus_tag LOCUS_26310 17832 18170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 18171 19070 gene locus_tag LOCUS_26320 18171 19070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence079 4305 3133 gene locus_tag LOCUS_26330 4305 3133 CDS product RND superfamily efflux pump MFP component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_26330 4432 4695 gene locus_tag LOCUS_26340 gene yeiW 4432 4695 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419964.1 protein_id gnl|my_center|LOCUS_26340 6596 4740 gene locus_tag LOCUS_26350 6596 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 6800 7312 gene locus_tag LOCUS_26360 gene msrA 6800 7312 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JF2 protein_id gnl|my_center|LOCUS_26360 7390 7770 gene locus_tag LOCUS_26370 7390 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 8371 7826 gene locus_tag LOCUS_26380 8371 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_26380 11318 8541 gene locus_tag LOCUS_26390 11318 8541 CDS product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266671.1 protein_id gnl|my_center|LOCUS_26390 11863 11318 gene locus_tag LOCUS_26400 11863 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 13149 11869 gene locus_tag LOCUS_26410 13149 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404706.1 protein_id gnl|my_center|LOCUS_26410 13730 14575 gene locus_tag LOCUS_26420 13730 14575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 14939 16342 gene locus_tag LOCUS_26430 gene lysC 14939 16342 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAC1 protein_id gnl|my_center|LOCUS_26430 17062 16319 gene locus_tag LOCUS_26440 17062 16319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 17216 18538 gene locus_tag LOCUS_26450 17216 18538 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073996.1 protein_id gnl|my_center|LOCUS_26450 18673 19104 gene locus_tag LOCUS_26460 18673 19104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence080 760 1221 gene locus_tag LOCUS_26470 760 1221 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256719.1 protein_id gnl|my_center|LOCUS_26470 1592 3505 gene locus_tag LOCUS_26480 gene speA 1592 3505 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZ86 protein_id gnl|my_center|LOCUS_26480 3507 4430 gene locus_tag LOCUS_26490 gene speB 3507 4430 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263658.1 protein_id gnl|my_center|LOCUS_26490 4882 4484 gene locus_tag LOCUS_26500 4882 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932596.1 protein_id gnl|my_center|LOCUS_26500 5891 4869 gene locus_tag LOCUS_26510 5891 4869 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209176.1 protein_id gnl|my_center|LOCUS_26510 7010 5901 gene locus_tag LOCUS_26520 7010 5901 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968776.1 protein_id gnl|my_center|LOCUS_26520 7186 7917 gene locus_tag LOCUS_26530 7186 7917 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_26530 7998 11393 gene locus_tag LOCUS_26540 gene smc 7998 11393 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ7 protein_id gnl|my_center|LOCUS_26540 11433 12185 gene locus_tag LOCUS_26550 11433 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 12279 14300 gene locus_tag LOCUS_26560 gene ligA 12279 14300 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3L1 protein_id gnl|my_center|LOCUS_26560 14293 14637 gene locus_tag LOCUS_26570 14293 14637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 14634 15137 gene locus_tag LOCUS_26580 14634 15137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 15166 15606 gene locus_tag LOCUS_26590 15166 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 15930 16370 gene locus_tag LOCUS_26600 15930 16370 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_26600 18225 16564 gene locus_tag LOCUS_26610 18225 16564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 19033 18958 gene locus_tag LOCUS_t00390 19033 18958 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence081 1424 945 gene locus_tag LOCUS_26620 gene smpB 1424 945 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI80 protein_id gnl|my_center|LOCUS_26620 1571 2008 gene locus_tag LOCUS_26630 gene yfjG 1571 2008 CDS product ubiquinone-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 protein_id gnl|my_center|LOCUS_26630 2008 2337 gene locus_tag LOCUS_26640 2008 2337 CDS product UPF0125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI82 protein_id gnl|my_center|LOCUS_26640 2757 2398 gene locus_tag LOCUS_26650 gene bamE 2757 2398 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KI84 protein_id gnl|my_center|LOCUS_26650 2877 3194 gene locus_tag LOCUS_26660 2877 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 4128 3232 gene locus_tag LOCUS_26670 4128 3232 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073748.1 protein_id gnl|my_center|LOCUS_26670 5332 4139 gene locus_tag LOCUS_26680 5332 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071063.1 protein_id gnl|my_center|LOCUS_26680 7327 5414 gene locus_tag LOCUS_26690 7327 5414 CDS product energy taxis-modulating methyl-accepting chemotaxis protein with Cache_1 sensory domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074086.1 protein_id gnl|my_center|LOCUS_26690 8993 7521 gene locus_tag LOCUS_26700 gene ilvC 8993 7521 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 protein_id gnl|my_center|LOCUS_26700 9158 10072 gene locus_tag LOCUS_26710 gene ilvY 9158 10072 CDS product transcriptional regulator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_26710 10373 10179 gene locus_tag LOCUS_26720 10373 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 10345 11085 gene locus_tag LOCUS_26730 gene mipA 10345 11085 CDS product outer membrane MltA-interaction protein MipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073410.1 protein_id gnl|my_center|LOCUS_26730 11087 11473 gene locus_tag LOCUS_26740 11087 11473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 11488 12180 gene locus_tag LOCUS_26750 gene rstA 11488 12180 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073412.1 protein_id gnl|my_center|LOCUS_26750 12187 13422 gene locus_tag LOCUS_26760 12187 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 13812 13594 gene locus_tag LOCUS_26770 13812 13594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073199.1 protein_id gnl|my_center|LOCUS_26770 14210 13929 gene locus_tag LOCUS_26780 14210 13929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 16084 14498 gene locus_tag LOCUS_26790 16084 14498 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418263.1 protein_id gnl|my_center|LOCUS_26790 16335 17078 gene locus_tag LOCUS_26800 16335 17078 CDS product sporulation-control protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462606.1 protein_id gnl|my_center|LOCUS_26800 17158 17610 gene locus_tag LOCUS_26810 gene elaA 17158 17610 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070867.1 protein_id gnl|my_center|LOCUS_26810 18934 17627 gene locus_tag LOCUS_26820 18934 17627 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881455.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence082 <1 818 gene locus_tag LOCUS_26830 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706481.1:diguanylate cyclase 851 2044 gene locus_tag LOCUS_26840 851 2044 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706206.1 protein_id gnl|my_center|LOCUS_26840 2044 2703 gene locus_tag LOCUS_26850 2044 2703 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_26850 3610 2813 gene locus_tag LOCUS_26860 3610 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 4410 3625 gene locus_tag LOCUS_26870 gene map 4410 3625 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I095 protein_id gnl|my_center|LOCUS_26870 4609 4403 gene locus_tag LOCUS_26880 4609 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 4994 4722 gene locus_tag LOCUS_26890 4994 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307315.1 protein_id gnl|my_center|LOCUS_26890 5060 7126 gene locus_tag LOCUS_26900 gene rep 5060 7126 CDS product ATP-dependent DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQV9 protein_id gnl|my_center|LOCUS_26900 9753 7174 gene locus_tag LOCUS_26910 9753 7174 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073983.1 protein_id gnl|my_center|LOCUS_26910 10333 9941 gene locus_tag LOCUS_26920 10333 9941 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262871.1 protein_id gnl|my_center|LOCUS_26920 11175 10525 gene locus_tag LOCUS_26930 11175 10525 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_26930 11743 14478 gene locus_tag LOCUS_26940 gene polA 11743 14478 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074260.1 protein_id gnl|my_center|LOCUS_26940 15424 14615 gene locus_tag LOCUS_26950 15424 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 16348 15428 gene locus_tag LOCUS_26960 16348 15428 CDS product lactonizing lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704485.1 protein_id gnl|my_center|LOCUS_26960 16786 17373 gene locus_tag LOCUS_26970 gene yceI 16786 17373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072802.1 protein_id gnl|my_center|LOCUS_26970 17373 17894 gene locus_tag LOCUS_26980 17373 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 18557 17895 gene locus_tag LOCUS_26990 gene engB 18557 17895 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVN0 protein_id gnl|my_center|LOCUS_26990 >Feature sequence083 607 1788 gene locus_tag LOCUS_27000 607 1788 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815728.1 protein_id gnl|my_center|LOCUS_27000 1788 3257 gene locus_tag LOCUS_27010 1788 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 3250 5313 gene locus_tag LOCUS_27020 3250 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 5310 5717 gene locus_tag LOCUS_27030 5310 5717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 5717 6163 gene locus_tag LOCUS_27040 5717 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 6160 8397 gene locus_tag LOCUS_27050 6160 8397 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477330.1 protein_id gnl|my_center|LOCUS_27050 10117 8417 gene locus_tag LOCUS_27060 10117 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 10668 10120 gene locus_tag LOCUS_27070 10668 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 11262 13250 gene locus_tag LOCUS_27080 11262 13250 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071086.1 protein_id gnl|my_center|LOCUS_27080 13247 13906 gene locus_tag LOCUS_27090 13247 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071085.1 protein_id gnl|my_center|LOCUS_27090 14259 16976 gene locus_tag LOCUS_27100 14259 16976 CDS product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095186.1 protein_id gnl|my_center|LOCUS_27100 17163 18119 gene locus_tag LOCUS_27110 17163 18119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence084 429 968 gene locus_tag LOCUS_27120 429 968 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168199.1 protein_id gnl|my_center|LOCUS_27120 965 1651 gene locus_tag LOCUS_27130 965 1651 CDS product anti-sigma K factor RskA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528491.1 protein_id gnl|my_center|LOCUS_27130 1829 3421 gene locus_tag LOCUS_27140 1829 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142973.1 protein_id gnl|my_center|LOCUS_27140 3433 3948 gene locus_tag LOCUS_27150 3433 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 4000 5007 gene locus_tag LOCUS_27160 4000 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142974.1 protein_id gnl|my_center|LOCUS_27160 5004 6122 gene locus_tag LOCUS_27170 5004 6122 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_27170 6263 6850 gene locus_tag LOCUS_27180 6263 6850 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089436.1 protein_id gnl|my_center|LOCUS_27180 7557 6943 gene locus_tag LOCUS_27190 7557 6943 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229664.1 protein_id gnl|my_center|LOCUS_27190 9104 7695 gene locus_tag LOCUS_27200 9104 7695 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706710.1 protein_id gnl|my_center|LOCUS_27200 12235 9104 gene locus_tag LOCUS_27210 gene vmeB 12235 9104 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074281.1 protein_id gnl|my_center|LOCUS_27210 13405 12248 gene locus_tag LOCUS_27220 gene acrA 13405 12248 CDS product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943335.1 protein_id gnl|my_center|LOCUS_27220 13556 13753 gene locus_tag LOCUS_27230 13556 13753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 15515 13815 gene locus_tag LOCUS_27240 15515 13815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence085 37 1494 gene locus_tag LOCUS_27250 gene uxaB 37 1494 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVN7 protein_id gnl|my_center|LOCUS_27250 1496 2983 gene locus_tag LOCUS_27260 1496 2983 CDS product altronate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703566.1 protein_id gnl|my_center|LOCUS_27260 2984 3940 gene locus_tag LOCUS_27270 gene kdgK 2984 3940 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44482 protein_id gnl|my_center|LOCUS_27270 4933 4181 gene locus_tag LOCUS_27280 4933 4181 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123287.1 protein_id gnl|my_center|LOCUS_27280 5044 5463 gene locus_tag LOCUS_27290 5044 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 5546 5959 gene locus_tag LOCUS_27300 gene rulA 5546 5959 CDS product DNA polymerase V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074353.1 protein_id gnl|my_center|LOCUS_27300 5947 7209 gene locus_tag LOCUS_27310 gene rulB 5947 7209 CDS product DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074352.1 protein_id gnl|my_center|LOCUS_27310 7696 7232 gene locus_tag LOCUS_27320 7696 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 8321 7803 gene locus_tag LOCUS_27330 8321 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070891.1 protein_id gnl|my_center|LOCUS_27330 8512 8318 gene locus_tag LOCUS_27340 8512 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_27340 8974 8693 gene locus_tag LOCUS_27350 8974 8693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 9212 8967 gene locus_tag LOCUS_27360 9212 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 9312 10121 gene locus_tag LOCUS_27370 9312 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 10626 10348 gene locus_tag LOCUS_27380 10626 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 10517 12577 gene locus_tag LOCUS_27390 10517 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 14688 12703 gene locus_tag LOCUS_27400 14688 12703 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267518.1 protein_id gnl|my_center|LOCUS_27400 15226 15492 gene locus_tag LOCUS_27410 15226 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27410 15544 16971 gene locus_tag LOCUS_27420 15544 16971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 18229 17087 gene locus_tag LOCUS_27430 gene asd 18229 17087 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P30903 protein_id gnl|my_center|LOCUS_27430 >Feature sequence086 162 311 gene locus_tag LOCUS_27440 162 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 753 1298 gene locus_tag LOCUS_27450 753 1298 CDS product N-acetyl-anhydromuranmyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_27450 1326 2177 gene locus_tag LOCUS_27460 gene ampE 1326 2177 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815577.1 protein_id gnl|my_center|LOCUS_27460 2504 3253 gene locus_tag LOCUS_27470 gene pdhR 2504 3253 CDS product transcriptional regulator PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707564.1 protein_id gnl|my_center|LOCUS_27470 3368 6034 gene locus_tag LOCUS_27480 3368 6034 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LU2 protein_id gnl|my_center|LOCUS_27480 6045 7946 gene locus_tag LOCUS_27490 6045 7946 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LU3 protein_id gnl|my_center|LOCUS_27490 8142 9569 gene locus_tag LOCUS_27500 gene lpdA 8142 9569 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPU9 protein_id gnl|my_center|LOCUS_27500 10374 9685 gene locus_tag LOCUS_27510 gene yibQ 10374 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 protein_id gnl|my_center|LOCUS_27510 11751 10492 gene locus_tag LOCUS_27520 11751 10492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 12941 11787 gene locus_tag LOCUS_27530 12941 11787 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_27530 14489 12945 gene locus_tag LOCUS_27540 gene gpmI 14489 12945 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU53 protein_id gnl|my_center|LOCUS_27540 14690 15121 gene locus_tag LOCUS_27550 14690 15121 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070465.1 protein_id gnl|my_center|LOCUS_27550 15153 15410 gene locus_tag LOCUS_27560 15153 15410 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918714.1 protein_id gnl|my_center|LOCUS_27560 15449 15937 gene locus_tag LOCUS_27570 gene secB 15449 15937 CDS product protein-export protein SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKP0 protein_id gnl|my_center|LOCUS_27570 15941 16948 gene locus_tag LOCUS_27580 gene gpsA 15941 16948 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6T0 protein_id gnl|my_center|LOCUS_27580 <18211 17022 gene locus_tag LOCUS_27590 <18211 17022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070706.1:diguanylate cyclase >Feature sequence087 1229 468 gene locus_tag LOCUS_27600 1229 468 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_27600 2053 1436 gene locus_tag LOCUS_27610 2053 1436 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_27610 2939 2043 gene locus_tag LOCUS_27620 2939 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 3159 2977 gene locus_tag LOCUS_27630 3159 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 5082 3193 gene locus_tag LOCUS_27640 gene pctB 5082 3193 CDS product methyl-accepting chemotaxis protein PctB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW91 protein_id gnl|my_center|LOCUS_27640 6775 5504 gene locus_tag LOCUS_27650 gene gluP 6775 5504 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225587.1 protein_id gnl|my_center|LOCUS_27650 7427 9157 gene locus_tag LOCUS_27660 7427 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073516.1 protein_id gnl|my_center|LOCUS_27660 9729 9229 gene locus_tag LOCUS_27670 9729 9229 CDS product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261383.1 protein_id gnl|my_center|LOCUS_27670 10226 9729 gene locus_tag LOCUS_27680 10226 9729 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U753 protein_id gnl|my_center|LOCUS_27680 12142 10322 gene locus_tag LOCUS_27690 12142 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_27690 12289 13557 gene locus_tag LOCUS_27700 12289 13557 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 protein_id gnl|my_center|LOCUS_27700 13754 16177 gene locus_tag LOCUS_27710 13754 16177 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071669.1 protein_id gnl|my_center|LOCUS_27710 17235 16225 gene locus_tag LOCUS_27720 17235 16225 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198321.1 protein_id gnl|my_center|LOCUS_27720 >Feature sequence088 1574 225 gene locus_tag LOCUS_27730 1574 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087885.1 protein_id gnl|my_center|LOCUS_27730 1905 1567 gene locus_tag LOCUS_27740 1905 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2579 2172 gene locus_tag LOCUS_27750 2579 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 3417 2794 gene locus_tag LOCUS_27760 3417 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 3724 3572 gene locus_tag LOCUS_27770 3724 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 4708 4301 gene locus_tag LOCUS_27780 4708 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 5651 7096 gene locus_tag LOCUS_27790 gene sbcB 5651 7096 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4R9 protein_id gnl|my_center|LOCUS_27790 7849 7145 gene locus_tag LOCUS_27800 7849 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 8586 7846 gene locus_tag LOCUS_27810 8586 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 8920 8573 gene locus_tag LOCUS_27820 8920 8573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530211.1 protein_id gnl|my_center|LOCUS_27820 10127 8913 gene locus_tag LOCUS_27830 10127 8913 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526222.1 protein_id gnl|my_center|LOCUS_27830 10876 10217 gene locus_tag LOCUS_27840 10876 10217 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_27840 11525 10878 gene locus_tag LOCUS_27850 11525 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_27850 12322 11528 gene locus_tag LOCUS_27860 12322 11528 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_27860 13008 12319 gene locus_tag LOCUS_27870 13008 12319 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_27870 14477 13005 gene locus_tag LOCUS_27880 14477 13005 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079865.1 protein_id gnl|my_center|LOCUS_27880 15115 14477 gene locus_tag LOCUS_27890 15115 14477 CDS product thermostable hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803562.1 protein_id gnl|my_center|LOCUS_27890 16239 15358 gene locus_tag LOCUS_27900 gene garR 16239 15358 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072707.1 protein_id gnl|my_center|LOCUS_27900 16362 16883 gene locus_tag LOCUS_27910 gene gpo 16362 16883 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLM1 protein_id gnl|my_center|LOCUS_27910 16840 17829 gene locus_tag LOCUS_27920 16840 17829 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707803.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence089 2117 69 gene locus_tag LOCUS_27930 2117 69 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_27930 2221 3078 gene locus_tag LOCUS_27940 2221 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 3373 3930 gene locus_tag LOCUS_27950 3373 3930 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633534.1 protein_id gnl|my_center|LOCUS_27950 5137 3944 gene locus_tag LOCUS_27960 5137 3944 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810851.1 protein_id gnl|my_center|LOCUS_27960 7311 5155 gene locus_tag LOCUS_27970 gene fhuA 7311 5155 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036583.1 protein_id gnl|my_center|LOCUS_27970 7965 7411 gene locus_tag LOCUS_27980 7965 7411 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_27980 8156 12646 gene locus_tag LOCUS_27990 8156 12646 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070706.1 protein_id gnl|my_center|LOCUS_27990 15371 12651 gene locus_tag LOCUS_28000 15371 12651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 16392 15505 gene locus_tag LOCUS_28010 16392 15505 CDS product zinc transporter ZitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097525.1 protein_id gnl|my_center|LOCUS_28010 >Feature sequence090 468 1031 gene locus_tag LOCUS_28020 468 1031 CDS product UPF0149 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPP0 protein_id gnl|my_center|LOCUS_28020 1063 2394 gene locus_tag LOCUS_28030 1063 2394 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703431.1 protein_id gnl|my_center|LOCUS_28030 2404 3588 gene locus_tag LOCUS_28040 2404 3588 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132411.1 protein_id gnl|my_center|LOCUS_28040 3585 4751 gene locus_tag LOCUS_28050 gene visC 3585 4751 CDS product 2-octaprenyl-6-methoxyphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262559.1 protein_id gnl|my_center|LOCUS_28050 4857 5984 gene locus_tag LOCUS_28060 4857 5984 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478836.1 protein_id gnl|my_center|LOCUS_28060 6895 6026 gene locus_tag LOCUS_28070 6895 6026 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973725.1 protein_id gnl|my_center|LOCUS_28070 7147 9780 gene locus_tag LOCUS_28080 7147 9780 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073350.1 protein_id gnl|my_center|LOCUS_28080 9817 11325 gene locus_tag LOCUS_28090 9817 11325 CDS product tryptophan halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918856.1 protein_id gnl|my_center|LOCUS_28090 11678 12769 gene locus_tag LOCUS_28100 11678 12769 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109360.1 protein_id gnl|my_center|LOCUS_28100 12787 13665 gene locus_tag LOCUS_28110 12787 13665 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_28110 13658 16201 gene locus_tag LOCUS_28120 gene hexB 13658 16201 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073347.1 protein_id gnl|my_center|LOCUS_28120 16410 17711 gene locus_tag LOCUS_28130 gene nagP 16410 17711 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073342.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence091 1119 1601 gene locus_tag LOCUS_28140 1119 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28140 1697 1876 gene locus_tag LOCUS_28150 1697 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 4253 1935 gene locus_tag LOCUS_28160 4253 1935 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704211.1 protein_id gnl|my_center|LOCUS_28160 5187 4246 gene locus_tag LOCUS_28170 gene kdgK 5187 4246 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209549.1 protein_id gnl|my_center|LOCUS_28170 6628 5180 gene locus_tag LOCUS_28180 6628 5180 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704305.1 protein_id gnl|my_center|LOCUS_28180 7173 6790 gene locus_tag LOCUS_28190 7173 6790 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368415.1 protein_id gnl|my_center|LOCUS_28190 8635 7166 gene locus_tag LOCUS_28200 gene dan 8635 7166 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550877.1 protein_id gnl|my_center|LOCUS_28200 9489 8638 gene locus_tag LOCUS_28210 9489 8638 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704308.1 protein_id gnl|my_center|LOCUS_28210 10749 9502 gene locus_tag LOCUS_28220 10749 9502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550878.1 protein_id gnl|my_center|LOCUS_28220 10951 13890 gene locus_tag LOCUS_28230 gene iroN 10951 13890 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038268.1 protein_id gnl|my_center|LOCUS_28230 14563 14027 gene locus_tag LOCUS_28240 14563 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 15114 14698 gene locus_tag LOCUS_28250 15114 14698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 15394 16986 gene locus_tag LOCUS_28260 15394 16986 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_28260 >Feature sequence092 106 354 gene locus_tag LOCUS_28270 106 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 421 4206 gene locus_tag LOCUS_28280 421 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 4175 5089 gene locus_tag LOCUS_28290 4175 5089 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268102.1 protein_id gnl|my_center|LOCUS_28290 5536 5156 gene locus_tag LOCUS_28300 5536 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071769.1 protein_id gnl|my_center|LOCUS_28300 6643 5699 gene locus_tag LOCUS_28310 6643 5699 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056892.1 protein_id gnl|my_center|LOCUS_28310 6744 7157 gene locus_tag LOCUS_28320 gene zntR 6744 7157 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001886208.1 protein_id gnl|my_center|LOCUS_28320 7391 7119 gene locus_tag LOCUS_28330 7391 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 7949 7557 gene locus_tag LOCUS_28340 7949 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 7963 8463 gene locus_tag LOCUS_28350 7963 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28350 8634 9755 gene locus_tag LOCUS_28360 8634 9755 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707330.1 protein_id gnl|my_center|LOCUS_28360 9848 10102 gene locus_tag LOCUS_28370 9848 10102 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706179.1 protein_id gnl|my_center|LOCUS_28370 10734 10099 gene locus_tag LOCUS_28380 10734 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 10931 11134 gene locus_tag LOCUS_28390 10931 11134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 11134 11538 gene locus_tag LOCUS_28400 11134 11538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 11577 16085 gene locus_tag LOCUS_28410 11577 16085 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070706.1 protein_id gnl|my_center|LOCUS_28410 16085 16219 gene locus_tag LOCUS_28420 16085 16219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 16209 16454 gene locus_tag LOCUS_28430 16209 16454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 <17152 16536 gene locus_tag LOCUS_28440 <17152 16536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207107.1:potassium voltage gated channel, Shab-related subfamily, member 2 >Feature sequence093 417 1406 gene locus_tag LOCUS_28450 417 1406 CDS product phosphopeptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543833.1 protein_id gnl|my_center|LOCUS_28450 1390 3981 gene locus_tag LOCUS_28460 1390 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 4526 3978 gene locus_tag LOCUS_28470 4526 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 4743 6212 gene locus_tag LOCUS_28480 4743 6212 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704261.1 protein_id gnl|my_center|LOCUS_28480 6218 7129 gene locus_tag LOCUS_28490 6218 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 7146 7724 gene locus_tag LOCUS_28500 7146 7724 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889231.1 protein_id gnl|my_center|LOCUS_28500 8611 7721 gene locus_tag LOCUS_28510 8611 7721 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880855.1 protein_id gnl|my_center|LOCUS_28510 8712 9233 gene locus_tag LOCUS_28520 8712 9233 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478430.1 protein_id gnl|my_center|LOCUS_28520 9212 9853 gene locus_tag LOCUS_28530 gene tpm 9212 9853 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q4 protein_id gnl|my_center|LOCUS_28530 10050 12392 gene locus_tag LOCUS_28540 gene dpp4 10050 12392 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_28540 12894 12583 gene locus_tag LOCUS_28550 12894 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 13003 13896 gene locus_tag LOCUS_28560 13003 13896 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_28560 14729 14085 gene locus_tag LOCUS_28570 14729 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 15577 14894 gene locus_tag LOCUS_28580 15577 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28580 16161 15493 gene locus_tag LOCUS_28590 16161 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28590 16441 16154 gene locus_tag LOCUS_28600 16441 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 >Feature sequence094 1310 456 gene locus_tag LOCUS_28610 1310 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2365 1307 gene locus_tag LOCUS_28620 2365 1307 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090704.1 protein_id gnl|my_center|LOCUS_28620 3459 2380 gene locus_tag LOCUS_28630 3459 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 4431 3472 gene locus_tag LOCUS_28640 4431 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 5101 4436 gene locus_tag LOCUS_28650 5101 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 6267 5107 gene locus_tag LOCUS_28660 6267 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 7570 6269 gene locus_tag LOCUS_28670 7570 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 8335 7580 gene locus_tag LOCUS_28680 8335 7580 CDS product sugar nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858404.1 protein_id gnl|my_center|LOCUS_28680 8936 8337 gene locus_tag LOCUS_28690 8936 8337 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707811.1 protein_id gnl|my_center|LOCUS_28690 11251 8933 gene locus_tag LOCUS_28700 11251 8933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891934.1 protein_id gnl|my_center|LOCUS_28700 12026 11253 gene locus_tag LOCUS_28710 12026 11253 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857879.1 protein_id gnl|my_center|LOCUS_28710 12523 12023 gene locus_tag LOCUS_28720 gene cysC 12523 12023 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858462.1 protein_id gnl|my_center|LOCUS_28720 13139 12525 gene locus_tag LOCUS_28730 13139 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088172.1 protein_id gnl|my_center|LOCUS_28730 14056 13136 gene locus_tag LOCUS_28740 14056 13136 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_28740 14856 14053 gene locus_tag LOCUS_28750 14856 14053 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546302.1 protein_id gnl|my_center|LOCUS_28750 15527 14865 gene locus_tag LOCUS_28760 15527 14865 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771848.1 protein_id gnl|my_center|LOCUS_28760 16533 15535 gene locus_tag LOCUS_28770 16533 15535 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81GI5 protein_id gnl|my_center|LOCUS_28770 >Feature sequence095 885 595 gene locus_tag LOCUS_28780 gene fis 885 595 CDS product DNA-binding protein Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6R3 protein_id gnl|my_center|LOCUS_28780 1886 906 gene locus_tag LOCUS_28790 gene dusB 1886 906 CDS product tRNA-dihydrouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E262 protein_id gnl|my_center|LOCUS_28790 3040 2159 gene locus_tag LOCUS_28800 gene prmA 3040 2159 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KU2 protein_id gnl|my_center|LOCUS_28800 4986 3109 gene locus_tag LOCUS_28810 gene rpoD 4986 3109 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHE1 protein_id gnl|my_center|LOCUS_28810 6836 5082 gene locus_tag LOCUS_28820 gene dnaG 6836 5082 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2J9 protein_id gnl|my_center|LOCUS_28820 7452 7006 gene locus_tag LOCUS_28830 7452 7006 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 protein_id gnl|my_center|LOCUS_28830 7688 7473 gene locus_tag LOCUS_28840 gene rpsU 7688 7473 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2K1 protein_id gnl|my_center|LOCUS_28840 8451 7852 gene locus_tag LOCUS_28850 gene rsmD 8451 7852 CDS product ribosomal RNA small subunit methyltransferase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S4 protein_id gnl|my_center|LOCUS_28850 8665 10605 gene locus_tag LOCUS_28860 8665 10605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 10658 11335 gene locus_tag LOCUS_28870 gene ftsE 10658 11335 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_28870 11332 12318 gene locus_tag LOCUS_28880 gene ftsX 11332 12318 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S7 protein_id gnl|my_center|LOCUS_28880 12543 13406 gene locus_tag LOCUS_28890 gene rpoH 12543 13406 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8S8 protein_id gnl|my_center|LOCUS_28890 13439 13711 gene locus_tag LOCUS_28900 13439 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 14006 15877 gene locus_tag LOCUS_28910 14006 15877 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074163.1 protein_id gnl|my_center|LOCUS_28910 16561 16025 gene locus_tag LOCUS_28920 16561 16025 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_28920 >Feature sequence096 122 607 gene locus_tag LOCUS_28930 122 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210014.1 protein_id gnl|my_center|LOCUS_28930 662 1069 gene locus_tag LOCUS_28940 662 1069 CDS product type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096444.1 protein_id gnl|my_center|LOCUS_28940 1094 2812 gene locus_tag LOCUS_28950 1094 2812 CDS product type VI secretion protein ImpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705811.1 protein_id gnl|my_center|LOCUS_28950 2809 3792 gene locus_tag LOCUS_28960 2809 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705810.1 protein_id gnl|my_center|LOCUS_28960 3820 6558 gene locus_tag LOCUS_28970 3820 6558 CDS product ClpV1 family T6SS ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480775.1 protein_id gnl|my_center|LOCUS_28970 6584 8614 gene locus_tag LOCUS_28980 6584 8614 CDS product type IV secretion protein Rhs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210012.1 protein_id gnl|my_center|LOCUS_28980 8632 9048 gene locus_tag LOCUS_28990 8632 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 9149 10222 gene locus_tag LOCUS_29000 9149 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 10212 11246 gene locus_tag LOCUS_29010 10212 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943804.1 protein_id gnl|my_center|LOCUS_29010 11248 12153 gene locus_tag LOCUS_29020 11248 12153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 12153 13229 gene locus_tag LOCUS_29030 12153 13229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 13230 16442 gene locus_tag LOCUS_29040 13230 16442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence097 811 362 gene locus_tag LOCUS_29050 811 362 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482841.1 protein_id gnl|my_center|LOCUS_29050 912 1505 gene locus_tag LOCUS_29060 912 1505 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482872.1 protein_id gnl|my_center|LOCUS_29060 1977 2645 gene locus_tag LOCUS_29070 1977 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29070 2701 3699 gene locus_tag LOCUS_29080 2701 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29080 3937 4356 gene locus_tag LOCUS_29090 3937 4356 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071100.1 protein_id gnl|my_center|LOCUS_29090 5397 4441 gene locus_tag LOCUS_29100 gene corA 5397 4441 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L5P6 protein_id gnl|my_center|LOCUS_29100 5734 6258 gene locus_tag LOCUS_29110 5734 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704628.1 protein_id gnl|my_center|LOCUS_29110 7292 6381 gene locus_tag LOCUS_29120 7292 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29120 8049 7285 gene locus_tag LOCUS_29130 8049 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29130 8502 8867 gene locus_tag LOCUS_29140 8502 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_29140 9140 10879 gene locus_tag LOCUS_29150 9140 10879 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072293.1 protein_id gnl|my_center|LOCUS_29150 11335 11000 gene locus_tag LOCUS_29160 gene phnA 11335 11000 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261944.1 protein_id gnl|my_center|LOCUS_29160 11526 12887 gene locus_tag LOCUS_29170 11526 12887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073676.1 protein_id gnl|my_center|LOCUS_29170 13068 14624 gene locus_tag LOCUS_29180 13068 14624 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883127.1 protein_id gnl|my_center|LOCUS_29180 14621 15301 gene locus_tag LOCUS_29190 14621 15301 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221472.1 protein_id gnl|my_center|LOCUS_29190 16212 15340 gene locus_tag LOCUS_29200 16212 15340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence098 2573 903 gene locus_tag LOCUS_29210 gene ggt 2573 903 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184536.1 protein_id gnl|my_center|LOCUS_29210 3202 2666 gene locus_tag LOCUS_29220 3202 2666 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_29220 3298 3666 gene locus_tag LOCUS_29230 3298 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 3963 5108 gene locus_tag LOCUS_29240 3963 5108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105922.1 protein_id gnl|my_center|LOCUS_29240 5119 5526 gene locus_tag LOCUS_29250 5119 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 7222 5597 gene locus_tag LOCUS_29260 7222 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 8488 7643 gene locus_tag LOCUS_29270 8488 7643 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 protein_id gnl|my_center|LOCUS_29270 10215 8557 gene locus_tag LOCUS_29280 10215 8557 CDS product alternate F1F0 ATPase, F1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022405.1 protein_id gnl|my_center|LOCUS_29280 11113 10208 gene locus_tag LOCUS_29290 11113 10208 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022406.1 protein_id gnl|my_center|LOCUS_29290 11398 11117 gene locus_tag LOCUS_29300 11398 11117 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UH07 protein_id gnl|my_center|LOCUS_29300 12169 11477 gene locus_tag LOCUS_29310 12169 11477 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022408.1 protein_id gnl|my_center|LOCUS_29310 12524 12159 gene locus_tag LOCUS_29320 12524 12159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 12873 12517 gene locus_tag LOCUS_29330 12873 12517 CDS product F0F1 ATP synthase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022410.1 protein_id gnl|my_center|LOCUS_29330 13293 12898 gene locus_tag LOCUS_29340 13293 12898 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022411.1 protein_id gnl|my_center|LOCUS_29340 14167 13277 gene locus_tag LOCUS_29350 14167 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29350 14798 14202 gene locus_tag LOCUS_29360 14798 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29360 16231 14795 gene locus_tag LOCUS_29370 16231 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 >Feature sequence099 151 969 gene locus_tag LOCUS_29380 151 969 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035527.1 protein_id gnl|my_center|LOCUS_29380 984 2267 gene locus_tag LOCUS_29390 gene purD 984 2267 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KS8 protein_id gnl|my_center|LOCUS_29390 2420 4885 gene locus_tag LOCUS_29400 2420 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 4953 5762 gene locus_tag LOCUS_29410 4953 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 protein_id gnl|my_center|LOCUS_29410 8257 5741 gene locus_tag LOCUS_29420 8257 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 8337 8633 gene locus_tag LOCUS_29430 8337 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 8711 10717 gene locus_tag LOCUS_29440 8711 10717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 10760 11602 gene locus_tag LOCUS_29450 10760 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 11586 12668 gene locus_tag LOCUS_29460 11586 12668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 12733 13281 gene locus_tag LOCUS_29470 12733 13281 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084991.1 protein_id gnl|my_center|LOCUS_29470 13266 14003 gene locus_tag LOCUS_29480 13266 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 14000 15241 gene locus_tag LOCUS_29490 14000 15241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 15931 15296 gene locus_tag LOCUS_29500 15931 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 >Feature sequence100 1592 729 gene locus_tag LOCUS_29510 1592 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939768.1 protein_id gnl|my_center|LOCUS_29510 2134 1658 gene locus_tag LOCUS_29520 2134 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206287.1 protein_id gnl|my_center|LOCUS_29520 3557 2148 gene locus_tag LOCUS_29530 gene mtaD 3557 2148 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206286.1 protein_id gnl|my_center|LOCUS_29530 3696 4601 gene locus_tag LOCUS_29540 gene yhjC 3696 4601 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005132457.1 protein_id gnl|my_center|LOCUS_29540 5913 4723 gene locus_tag LOCUS_29550 gene yeaN 5913 4723 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128501.1 protein_id gnl|my_center|LOCUS_29550 6941 5967 gene locus_tag LOCUS_29560 6941 5967 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943398.1 protein_id gnl|my_center|LOCUS_29560 7805 7224 gene locus_tag LOCUS_29570 7805 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 8428 7910 gene locus_tag LOCUS_29580 8428 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261682.1 protein_id gnl|my_center|LOCUS_29580 9246 8557 gene locus_tag LOCUS_29590 9246 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 10019 9546 gene locus_tag LOCUS_29600 gene phnB 10019 9546 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 protein_id gnl|my_center|LOCUS_29600 10210 10821 gene locus_tag LOCUS_29610 gene yhfK 10210 10821 CDS product putative sugar epimerase YhfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07609 protein_id gnl|my_center|LOCUS_29610 12750 11014 gene locus_tag LOCUS_29620 12750 11014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 13507 12809 gene locus_tag LOCUS_29630 13507 12809 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TX7 protein_id gnl|my_center|LOCUS_29630 13584 14816 gene locus_tag LOCUS_29640 gene srmB 13584 14816 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPC3 protein_id gnl|my_center|LOCUS_29640 15221 15544 gene locus_tag LOCUS_29650 15221 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence101 236 769 gene locus_tag LOCUS_29660 gene yrdA 236 769 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070458.1 protein_id gnl|my_center|LOCUS_29660 1020 766 gene locus_tag LOCUS_29670 1020 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 1841 1017 gene locus_tag LOCUS_29680 gene aroE 1841 1017 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1R6 protein_id gnl|my_center|LOCUS_29680 1909 2346 gene locus_tag LOCUS_29690 1909 2346 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070455.1 protein_id gnl|my_center|LOCUS_29690 2500 4047 gene locus_tag LOCUS_29700 2500 4047 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088888.1 protein_id gnl|my_center|LOCUS_29700 5015 4098 gene locus_tag LOCUS_29710 gene hemF 5015 4098 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX7 protein_id gnl|my_center|LOCUS_29710 5584 5018 gene locus_tag LOCUS_29720 gene tsaC 5584 5018 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRY6 protein_id gnl|my_center|LOCUS_29720 6194 5622 gene locus_tag LOCUS_29730 gene yrdD 6194 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070452.1 protein_id gnl|my_center|LOCUS_29730 6786 6268 gene locus_tag LOCUS_29740 gene smg 6786 6268 CDS product protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEX3 protein_id gnl|my_center|LOCUS_29740 7846 6764 gene locus_tag LOCUS_29750 gene dprA 7846 6764 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262883.1 protein_id gnl|my_center|LOCUS_29750 8997 7876 gene locus_tag LOCUS_29760 8997 7876 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070449.1 protein_id gnl|my_center|LOCUS_29760 9116 9622 gene locus_tag LOCUS_29770 gene def 9116 9622 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Q8 protein_id gnl|my_center|LOCUS_29770 9649 10602 gene locus_tag LOCUS_29780 gene fmt 9649 10602 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1Q7 protein_id gnl|my_center|LOCUS_29780 10595 11884 gene locus_tag LOCUS_29790 gene rsmB 10595 11884 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KD3 protein_id gnl|my_center|LOCUS_29790 11902 13278 gene locus_tag LOCUS_29800 gene trkA 11902 13278 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704263.1 protein_id gnl|my_center|LOCUS_29800 13541 15628 gene locus_tag LOCUS_29810 gene putA 13541 15628 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072936.1 protein_id gnl|my_center|LOCUS_29810 >Feature sequence102 1149 418 gene locus_tag LOCUS_29820 1149 418 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023261.1 protein_id gnl|my_center|LOCUS_29820 2017 1424 gene locus_tag LOCUS_29830 2017 1424 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113966.1 protein_id gnl|my_center|LOCUS_29830 2450 2004 gene locus_tag LOCUS_29840 2450 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 2557 3468 gene locus_tag LOCUS_29850 2557 3468 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_29850 4977 3616 gene locus_tag LOCUS_29860 gene gor 4977 3616 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421460.1 protein_id gnl|my_center|LOCUS_29860 5109 7160 gene locus_tag LOCUS_29870 5109 7160 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 protein_id gnl|my_center|LOCUS_29870 7287 8468 gene locus_tag LOCUS_29880 7287 8468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 8526 9281 gene locus_tag LOCUS_29890 gene rsmJ 8526 9281 CDS product ribosomal RNA small subunit methyltransferase J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8R9 protein_id gnl|my_center|LOCUS_29890 9403 11328 gene locus_tag LOCUS_29900 9403 11328 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074229.1 protein_id gnl|my_center|LOCUS_29900 11434 11907 gene locus_tag LOCUS_29910 11434 11907 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074234.1 protein_id gnl|my_center|LOCUS_29910 14067 12016 gene locus_tag LOCUS_29920 14067 12016 CDS product extracellular protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23314 protein_id gnl|my_center|LOCUS_29920 >Feature sequence103 250 1050 gene locus_tag LOCUS_29930 250 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118825.1 protein_id gnl|my_center|LOCUS_29930 1179 2354 gene locus_tag LOCUS_29940 1179 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104652.1 protein_id gnl|my_center|LOCUS_29940 2972 2502 gene locus_tag LOCUS_29950 2972 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 3418 2987 gene locus_tag LOCUS_29960 3418 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 5032 3635 gene locus_tag LOCUS_29970 5032 3635 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_29970 6588 5236 gene locus_tag LOCUS_29980 gene gdhA 6588 5236 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55990 protein_id gnl|my_center|LOCUS_29980 7456 6923 gene locus_tag LOCUS_29990 7456 6923 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_29990 7532 8296 gene locus_tag LOCUS_30000 7532 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947436.1 protein_id gnl|my_center|LOCUS_30000 8826 8293 gene locus_tag LOCUS_30010 8826 8293 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 protein_id gnl|my_center|LOCUS_30010 10080 8836 gene locus_tag LOCUS_30020 gene lolE 10080 8836 CDS product outer membrane-specific lipoprotein transporter subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_002346639.1 protein_id gnl|my_center|LOCUS_30020 10768 10070 gene locus_tag LOCUS_30030 gene lolD 10768 10070 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57066 protein_id gnl|my_center|LOCUS_30030 11837 10761 gene locus_tag LOCUS_30040 gene lolC 11837 10761 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263325.1 protein_id gnl|my_center|LOCUS_30040 11791 11973 gene locus_tag LOCUS_30050 11791 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 12985 12116 gene locus_tag LOCUS_30060 12985 12116 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072126.1 protein_id gnl|my_center|LOCUS_30060 13103 14224 gene locus_tag LOCUS_30070 13103 14224 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JU12 protein_id gnl|my_center|LOCUS_30070 14284 15126 gene locus_tag LOCUS_30080 14284 15126 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87K28 protein_id gnl|my_center|LOCUS_30080 15463 15080 gene locus_tag LOCUS_30090 15463 15080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 >Feature sequence104 310 2067 gene locus_tag LOCUS_30100 310 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 2813 2064 gene locus_tag LOCUS_30110 2813 2064 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704360.1 protein_id gnl|my_center|LOCUS_30110 3199 5217 gene locus_tag LOCUS_30120 3199 5217 CDS product NirV precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263653.1 protein_id gnl|my_center|LOCUS_30120 5356 6399 gene locus_tag LOCUS_30130 gene mreB 5356 6399 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007651015.1 protein_id gnl|my_center|LOCUS_30130 6471 7241 gene locus_tag LOCUS_30140 gene mreC 6471 7241 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFA8 protein_id gnl|my_center|LOCUS_30140 7234 7713 gene locus_tag LOCUS_30150 gene mreD 7234 7713 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFA9 protein_id gnl|my_center|LOCUS_30150 7713 8282 gene locus_tag LOCUS_30160 7713 8282 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7X6 protein_id gnl|my_center|LOCUS_30160 8284 9756 gene locus_tag LOCUS_30170 8284 9756 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461826.1 protein_id gnl|my_center|LOCUS_30170 9756 13601 gene locus_tag LOCUS_30180 9756 13601 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073797.1 protein_id gnl|my_center|LOCUS_30180 13613 14431 gene locus_tag LOCUS_30190 13613 14431 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704381.1 protein_id gnl|my_center|LOCUS_30190 >Feature sequence105 657 2618 gene locus_tag LOCUS_30200 657 2618 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 protein_id gnl|my_center|LOCUS_30200 3635 2697 gene locus_tag LOCUS_30210 3635 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 5133 3730 gene locus_tag LOCUS_30220 5133 3730 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_30220 5436 6746 gene locus_tag LOCUS_30230 gene dbpA 5436 6746 CDS product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263052.1 protein_id gnl|my_center|LOCUS_30230 7338 6754 gene locus_tag LOCUS_30240 7338 6754 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263300.1 protein_id gnl|my_center|LOCUS_30240 7418 10234 gene locus_tag LOCUS_30250 7418 10234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 11769 10510 gene locus_tag LOCUS_30260 gene rho 11769 10510 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8U3 protein_id gnl|my_center|LOCUS_30260 12277 11951 gene locus_tag LOCUS_30270 12277 11951 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KH6 protein_id gnl|my_center|LOCUS_30270 12368 13645 gene locus_tag LOCUS_30280 gene rhlB 12368 13645 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KH5 protein_id gnl|my_center|LOCUS_30280 13693 15186 gene locus_tag LOCUS_30290 gene gppA 13693 15186 CDS product guanosine-5'-triphosphate,3'-diphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KH4 protein_id gnl|my_center|LOCUS_30290 >Feature sequence106 4423 2435 gene locus_tag LOCUS_30300 gene irgA 4423 2435 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074140.1 protein_id gnl|my_center|LOCUS_30300 4544 5452 gene locus_tag LOCUS_30310 4544 5452 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074141.1 protein_id gnl|my_center|LOCUS_30310 5560 6249 gene locus_tag LOCUS_30320 5560 6249 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_30320 6872 6267 gene locus_tag LOCUS_30330 6872 6267 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073160.1 protein_id gnl|my_center|LOCUS_30330 7043 8092 gene locus_tag LOCUS_30340 7043 8092 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073161.1 protein_id gnl|my_center|LOCUS_30340 8092 11181 gene locus_tag LOCUS_30350 8092 11181 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073162.1 protein_id gnl|my_center|LOCUS_30350 11412 11804 gene locus_tag LOCUS_30360 11412 11804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 14842 12110 gene locus_tag LOCUS_30370 14842 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 >Feature sequence107 2125 308 gene locus_tag LOCUS_30380 gene aceK 2125 308 CDS product isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAR7 protein_id gnl|my_center|LOCUS_30380 2212 3177 gene locus_tag LOCUS_30390 gene nahR 2212 3177 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117795.1 protein_id gnl|my_center|LOCUS_30390 3324 3776 gene locus_tag LOCUS_30400 3324 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 5037 3778 gene locus_tag LOCUS_30410 gene icd 5037 3778 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_30410 5205 6017 gene locus_tag LOCUS_30420 5205 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 8708 6006 gene locus_tag LOCUS_30430 8708 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 10940 8739 gene locus_tag LOCUS_30440 gene fyuA 10940 8739 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036237.1 protein_id gnl|my_center|LOCUS_30440 13362 11116 gene locus_tag LOCUS_30450 13362 11116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30450 14328 13372 gene locus_tag LOCUS_30460 14328 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30460 14949 14398 gene locus_tag LOCUS_30470 14949 14398 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937337.1 protein_id gnl|my_center|LOCUS_30470 >Feature sequence108 1151 654 gene locus_tag LOCUS_30480 1151 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 3554 1581 gene locus_tag LOCUS_30490 gene recD 3554 1581 CDS product RecBCD enzyme subunit RecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FKH9 protein_id gnl|my_center|LOCUS_30490 7171 3551 gene locus_tag LOCUS_30500 gene recB 7171 3551 CDS product RecBCD enzyme subunit RecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPP6 protein_id gnl|my_center|LOCUS_30500 10466 7158 gene locus_tag LOCUS_30510 gene recC 10466 7158 CDS product RecBCD enzyme subunit RecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPP4 protein_id gnl|my_center|LOCUS_30510 11698 10634 gene locus_tag LOCUS_30520 11698 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 12822 11695 gene locus_tag LOCUS_30530 12822 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 <14925 12889 gene locus_tag LOCUS_30540 <14925 12889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038151.1:TonB-dependent receptor >Feature sequence109 747 319 gene locus_tag LOCUS_30550 gene rplK 747 319 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E232 protein_id gnl|my_center|LOCUS_30550 1521 964 gene locus_tag LOCUS_30560 gene nusG 1521 964 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQB0 protein_id gnl|my_center|LOCUS_30560 1903 1526 gene locus_tag LOCUS_30570 gene secE 1903 1526 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EK80 protein_id gnl|my_center|LOCUS_30570 2112 2036 gene locus_tag LOCUS_t00400 2112 2036 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2278 6267 gene locus_tag LOCUS_30580 2278 6267 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_30580 6388 7524 gene locus_tag LOCUS_30590 6388 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 8083 7583 gene locus_tag LOCUS_30600 8083 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 8840 8070 gene locus_tag LOCUS_30610 gene deoC2 8840 8070 CDS product deoxyribose-phosphate aldolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIQ4 protein_id gnl|my_center|LOCUS_30610 9096 10517 gene locus_tag LOCUS_30620 gene cysG1 9096 10517 CDS product siroheme synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JJS8 protein_id gnl|my_center|LOCUS_30620 10570 11469 gene locus_tag LOCUS_30630 gene cysD 10570 11469 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E831 protein_id gnl|my_center|LOCUS_30630 11469 12896 gene locus_tag LOCUS_30640 gene cysN 11469 12896 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB10 protein_id gnl|my_center|LOCUS_30640 12927 14651 gene locus_tag LOCUS_30650 gene yfbS 12927 14651 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261126.1 protein_id gnl|my_center|LOCUS_30650 >Feature sequence110 1271 573 gene locus_tag LOCUS_30660 1271 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 2466 1291 gene locus_tag LOCUS_30670 2466 1291 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_30670 3628 2468 gene locus_tag LOCUS_30680 3628 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 4343 3630 gene locus_tag LOCUS_30690 4343 3630 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_30690 5616 4348 gene locus_tag LOCUS_30700 5616 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 6761 5622 gene locus_tag LOCUS_30710 6761 5622 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964361.1 protein_id gnl|my_center|LOCUS_30710 7620 6754 gene locus_tag LOCUS_30720 7620 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 9292 8333 gene locus_tag LOCUS_30730 9292 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 10079 9285 gene locus_tag LOCUS_30740 10079 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 11181 10090 gene locus_tag LOCUS_30750 11181 10090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 12993 11533 gene locus_tag LOCUS_30760 12993 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 13831 13046 gene locus_tag LOCUS_30770 13831 13046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence111 558 175 gene locus_tag LOCUS_30780 gene wzd 558 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073079.1 protein_id gnl|my_center|LOCUS_30780 1848 673 gene locus_tag LOCUS_30790 1848 673 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462475.1 protein_id gnl|my_center|LOCUS_30790 2514 1888 gene locus_tag LOCUS_30800 2514 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30800 3103 2507 gene locus_tag LOCUS_30810 3103 2507 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481406.1 protein_id gnl|my_center|LOCUS_30810 4300 3104 gene locus_tag LOCUS_30820 4300 3104 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462479.1 protein_id gnl|my_center|LOCUS_30820 5394 4297 gene locus_tag LOCUS_30830 5394 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 6293 5403 gene locus_tag LOCUS_30840 6293 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 7592 6678 gene locus_tag LOCUS_30850 7592 6678 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010216700.1 protein_id gnl|my_center|LOCUS_30850 9087 7579 gene locus_tag LOCUS_30860 gene wzx 9087 7579 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073069.1 protein_id gnl|my_center|LOCUS_30860 9662 9096 gene locus_tag LOCUS_30870 gene vioB 9662 9096 CDS product transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323726.1 protein_id gnl|my_center|LOCUS_30870 10756 9665 gene locus_tag LOCUS_30880 10756 9665 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073073.1 protein_id gnl|my_center|LOCUS_30880 11634 10759 gene locus_tag LOCUS_30890 gene rmlA 11634 10759 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECF6 protein_id gnl|my_center|LOCUS_30890 12100 11741 gene locus_tag LOCUS_30900 12100 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_30900 13288 12167 gene locus_tag LOCUS_30910 13288 12167 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T48 protein_id gnl|my_center|LOCUS_30910 14532 13291 gene locus_tag LOCUS_30920 gene wbpA 14532 13291 CDS product UDP-N-acetyl-d-glucosamine 6-dehydrogenase WbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence112 1176 5045 gene locus_tag LOCUS_30930 1176 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 5304 8024 gene locus_tag LOCUS_30940 gene topA 5304 8024 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDN8 protein_id gnl|my_center|LOCUS_30940 8366 8124 gene locus_tag LOCUS_30950 8366 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073409.1 protein_id gnl|my_center|LOCUS_30950 8594 9142 gene locus_tag LOCUS_30960 8594 9142 CDS product UPF0114 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A9F2 protein_id gnl|my_center|LOCUS_30960 10380 9181 gene locus_tag LOCUS_30970 10380 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 11315 10377 gene locus_tag LOCUS_30980 11315 10377 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569679.1 protein_id gnl|my_center|LOCUS_30980 11705 13123 gene locus_tag LOCUS_30990 11705 13123 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073458.1 protein_id gnl|my_center|LOCUS_30990 >Feature sequence113 985 332 gene locus_tag LOCUS_31000 985 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 1156 2076 gene locus_tag LOCUS_31010 gene dapA 1156 2076 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03CW3 protein_id gnl|my_center|LOCUS_31010 2274 3575 gene locus_tag LOCUS_31020 2274 3575 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071592.1 protein_id gnl|my_center|LOCUS_31020 5258 3648 gene locus_tag LOCUS_31030 5258 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620446.1 protein_id gnl|my_center|LOCUS_31030 5424 5747 gene locus_tag LOCUS_31040 5424 5747 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896327.1 protein_id gnl|my_center|LOCUS_31040 5876 8113 gene locus_tag LOCUS_31050 5876 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_31050 8964 8164 gene locus_tag LOCUS_31060 8964 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 9551 9015 gene locus_tag LOCUS_31070 9551 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 11292 9694 gene locus_tag LOCUS_31080 gene abgT 11292 9694 CDS product aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262003.1 protein_id gnl|my_center|LOCUS_31080 11701 11399 gene locus_tag LOCUS_31090 11701 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 11961 11704 gene locus_tag LOCUS_31100 11961 11704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_233408.2 protein_id gnl|my_center|LOCUS_31100 12187 13023 gene locus_tag LOCUS_31110 12187 13023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 13090 14370 gene locus_tag LOCUS_31120 13090 14370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092515.1 protein_id gnl|my_center|LOCUS_31120 >Feature sequence114 1913 291 gene locus_tag LOCUS_31130 gene rtcR 1913 291 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122266.1 protein_id gnl|my_center|LOCUS_31130 2156 2225 gene locus_tag LOCUS_t00410 2156 2225 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2479 3648 gene locus_tag LOCUS_31140 2479 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112812.1 protein_id gnl|my_center|LOCUS_31140 3700 4923 gene locus_tag LOCUS_31150 gene rtcB 3700 4923 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVK1 protein_id gnl|my_center|LOCUS_31150 4934 5983 gene locus_tag LOCUS_31160 gene rtcA 4934 5983 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVJ9 protein_id gnl|my_center|LOCUS_31160 6013 7281 gene locus_tag LOCUS_31170 gene cca 6013 7281 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45269 protein_id gnl|my_center|LOCUS_31170 7268 8086 gene locus_tag LOCUS_31180 7268 8086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208237.1 protein_id gnl|my_center|LOCUS_31180 8136 8726 gene locus_tag LOCUS_31190 gene trmH 8136 8726 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67577 protein_id gnl|my_center|LOCUS_31190 8821 9393 gene locus_tag LOCUS_31200 8821 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 10962 9697 gene locus_tag LOCUS_31210 10962 9697 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884033.1 protein_id gnl|my_center|LOCUS_31210 11605 10964 gene locus_tag LOCUS_31220 11605 10964 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884034.1 protein_id gnl|my_center|LOCUS_31220 12104 11760 gene locus_tag LOCUS_31230 12104 11760 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122463.1 protein_id gnl|my_center|LOCUS_31230 12805 12104 gene locus_tag LOCUS_31240 gene prfH 12805 12104 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602135.1 protein_id gnl|my_center|LOCUS_31240 13992 12802 gene locus_tag LOCUS_31250 13992 12802 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114117.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence115 186 821 gene locus_tag LOCUS_31260 186 821 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267941.1 protein_id gnl|my_center|LOCUS_31260 885 1877 gene locus_tag LOCUS_31270 885 1877 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267940.1 protein_id gnl|my_center|LOCUS_31270 2647 2081 gene locus_tag LOCUS_31280 2647 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 2836 3252 gene locus_tag LOCUS_31290 2836 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262954.1 protein_id gnl|my_center|LOCUS_31290 4360 3551 gene locus_tag LOCUS_31300 4360 3551 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EH96 protein_id gnl|my_center|LOCUS_31300 4882 5856 gene locus_tag LOCUS_31310 4882 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 protein_id gnl|my_center|LOCUS_31310 5910 6974 gene locus_tag LOCUS_31320 5910 6974 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_31320 7508 7077 gene locus_tag LOCUS_31330 7508 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123965.1 protein_id gnl|my_center|LOCUS_31330 9381 7558 gene locus_tag LOCUS_31340 9381 7558 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070916.1 protein_id gnl|my_center|LOCUS_31340 10628 9702 gene locus_tag LOCUS_31350 gene etfA 10628 9702 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP7 protein_id gnl|my_center|LOCUS_31350 11378 10629 gene locus_tag LOCUS_31360 gene etfB 11378 10629 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZP6 protein_id gnl|my_center|LOCUS_31360 11574 13220 gene locus_tag LOCUS_31370 gene etfQ 11574 13220 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074085.1 protein_id gnl|my_center|LOCUS_31370 13360 13830 gene locus_tag LOCUS_31380 13360 13830 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705527.1 protein_id gnl|my_center|LOCUS_31380 >Feature sequence116 469 47 gene locus_tag LOCUS_31390 gene atpC 469 47 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58647 protein_id gnl|my_center|LOCUS_31390 1868 483 gene locus_tag LOCUS_31400 gene atpD 1868 483 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43715 protein_id gnl|my_center|LOCUS_31400 2762 1902 gene locus_tag LOCUS_31410 gene atpG 2762 1902 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B9 protein_id gnl|my_center|LOCUS_31410 4364 2823 gene locus_tag LOCUS_31420 gene atpA 4364 2823 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B8 protein_id gnl|my_center|LOCUS_31420 4912 4379 gene locus_tag LOCUS_31430 gene atpH 4912 4379 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQY1 protein_id gnl|my_center|LOCUS_31430 5398 4928 gene locus_tag LOCUS_31440 gene atpF 5398 4928 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B6 protein_id gnl|my_center|LOCUS_31440 5684 5451 gene locus_tag LOCUS_31450 gene atpE 5684 5451 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8B5 protein_id gnl|my_center|LOCUS_31450 6595 5753 gene locus_tag LOCUS_31460 gene atpB 6595 5753 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJG3 protein_id gnl|my_center|LOCUS_31460 6991 6611 gene locus_tag LOCUS_31470 gene atpI 6991 6611 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074336.1 protein_id gnl|my_center|LOCUS_31470 8051 7134 gene locus_tag LOCUS_31480 gene parB 8051 7134 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074337.1 protein_id gnl|my_center|LOCUS_31480 8854 8069 gene locus_tag LOCUS_31490 gene parA 8854 8069 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_31490 9489 8869 gene locus_tag LOCUS_31500 gene rsmG 9489 8869 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87K99 protein_id gnl|my_center|LOCUS_31500 11394 9505 gene locus_tag LOCUS_31510 gene mnmG 11394 9505 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E1M6 protein_id gnl|my_center|LOCUS_31510 12239 11823 gene locus_tag LOCUS_31520 12239 11823 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815249.1 protein_id gnl|my_center|LOCUS_31520 13698 12910 gene locus_tag LOCUS_31530 13698 12910 CDS product phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989337.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence117 2232 2651 gene locus_tag LOCUS_31540 2232 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 2686 3153 gene locus_tag LOCUS_31550 2686 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 3153 4493 gene locus_tag LOCUS_31560 3153 4493 CDS product type VI secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343637.1 protein_id gnl|my_center|LOCUS_31560 4507 5229 gene locus_tag LOCUS_31570 4507 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 5239 8955 gene locus_tag LOCUS_31580 gene icmF1 5239 8955 CDS product type VI secretion protein IcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895493.1 protein_id gnl|my_center|LOCUS_31580 8964 9956 gene locus_tag LOCUS_31590 8964 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 9953 11512 gene locus_tag LOCUS_31600 9953 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 11577 12098 gene locus_tag LOCUS_31610 11577 12098 CDS product type VI secretion system protein ImpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366297.1 protein_id gnl|my_center|LOCUS_31610 12109 13635 gene locus_tag LOCUS_31620 12109 13635 CDS product type VI secretion protein EvpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705647.1 protein_id gnl|my_center|LOCUS_31620 >Feature sequence118 1334 213 gene locus_tag LOCUS_31630 gene dapA 1334 213 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073716.1 protein_id gnl|my_center|LOCUS_31630 2545 1340 gene locus_tag LOCUS_31640 gene lysA 2545 1340 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225872.1 protein_id gnl|my_center|LOCUS_31640 3285 2545 gene locus_tag LOCUS_31650 gene dapD 3285 2545 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403729.1 protein_id gnl|my_center|LOCUS_31650 4185 3301 gene locus_tag LOCUS_31660 gene dapA 4185 3301 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6K9 protein_id gnl|my_center|LOCUS_31660 4702 5403 gene locus_tag LOCUS_31670 4702 5403 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105836.1 protein_id gnl|my_center|LOCUS_31670 5412 6827 gene locus_tag LOCUS_31680 5412 6827 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q813A5 protein_id gnl|my_center|LOCUS_31680 7295 8365 gene locus_tag LOCUS_31690 7295 8365 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073374.1 protein_id gnl|my_center|LOCUS_31690 8643 11240 gene locus_tag LOCUS_31700 8643 11240 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LW3 protein_id gnl|my_center|LOCUS_31700 11630 12262 gene locus_tag LOCUS_31710 11630 12262 CDS product agglutination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263596.1 protein_id gnl|my_center|LOCUS_31710 12272 13504 gene locus_tag LOCUS_31720 12272 13504 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483538.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence119 2 1210 gene locus_tag LOCUS_31730 gene uxaC 2 1210 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A874 protein_id gnl|my_center|LOCUS_31730 1260 3809 gene locus_tag LOCUS_31740 1260 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 4046 5131 gene locus_tag LOCUS_31750 4046 5131 CDS product family 88 glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_31750 5135 6802 gene locus_tag LOCUS_31760 5135 6802 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109159.1 protein_id gnl|my_center|LOCUS_31760 6803 7765 gene locus_tag LOCUS_31770 6803 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 9262 7835 gene locus_tag LOCUS_31780 gene pel 9262 7835 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_31780 9453 12416 gene locus_tag LOCUS_31790 9453 12416 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072483.1 protein_id gnl|my_center|LOCUS_31790 >Feature sequence120 81 857 gene locus_tag LOCUS_31800 81 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_31800 979 3654 gene locus_tag LOCUS_31810 979 3654 CDS product OtnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481418.1 protein_id gnl|my_center|LOCUS_31810 3752 4684 gene locus_tag LOCUS_31820 gene wzz 3752 4684 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_31820 4723 5724 gene locus_tag LOCUS_31830 4723 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 5725 6543 gene locus_tag LOCUS_31840 5725 6543 CDS product putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q48215 protein_id gnl|my_center|LOCUS_31840 6631 7662 gene locus_tag LOCUS_31850 6631 7662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 7659 8468 gene locus_tag LOCUS_31860 gene licD1 7659 8468 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_31860 8461 9507 gene locus_tag LOCUS_31870 8461 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 9500 10399 gene locus_tag LOCUS_31880 9500 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 10429 10878 gene locus_tag LOCUS_31890 gene tagD2 10429 10878 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880882.1 protein_id gnl|my_center|LOCUS_31890 10875 11474 gene locus_tag LOCUS_31900 10875 11474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 12092 12580 gene locus_tag LOCUS_31910 gene rfaH 12092 12580 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ENL4 protein_id gnl|my_center|LOCUS_31910 12880 13074 gene locus_tag LOCUS_31920 12880 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31920 13099 13341 gene locus_tag LOCUS_31930 13099 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31930 >Feature sequence121 1250 537 gene locus_tag LOCUS_31940 gene yggS 1250 537 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073222.1 protein_id gnl|my_center|LOCUS_31940 1253 2293 gene locus_tag LOCUS_31950 gene pilT 1253 2293 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073221.1 protein_id gnl|my_center|LOCUS_31950 2313 3443 gene locus_tag LOCUS_31960 gene pilU 2313 3443 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073220.1 protein_id gnl|my_center|LOCUS_31960 3445 4356 gene locus_tag LOCUS_31970 3445 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 4765 4319 gene locus_tag LOCUS_31980 4765 4319 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMY0 protein_id gnl|my_center|LOCUS_31980 5359 4802 gene locus_tag LOCUS_31990 5359 4802 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUP8 protein_id gnl|my_center|LOCUS_31990 6340 5387 gene locus_tag LOCUS_32000 gene gshB 6340 5387 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX7 protein_id gnl|my_center|LOCUS_32000 7129 6395 gene locus_tag LOCUS_32010 7129 6395 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KMX6 protein_id gnl|my_center|LOCUS_32010 7708 7235 gene locus_tag LOCUS_32020 7708 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 8632 7739 gene locus_tag LOCUS_32030 8632 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 8706 11504 gene locus_tag LOCUS_32040 gene glnE 8706 11504 CDS product glutamate-ammonia-ligase adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGC3 protein_id gnl|my_center|LOCUS_32040 12073 11501 gene locus_tag LOCUS_32050 12073 11501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 12916 12128 gene locus_tag LOCUS_32060 gene lpxL 12916 12128 CDS product lipid A biosynthesis lauroyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NX3 protein_id gnl|my_center|LOCUS_32060 >Feature sequence122 93 18 gene locus_tag LOCUS_t00420 93 18 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 240 165 gene locus_tag LOCUS_t00430 240 165 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1152 409 gene locus_tag LOCUS_32070 gene ybgF 1152 409 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072685.1 protein_id gnl|my_center|LOCUS_32070 1764 1165 gene locus_tag LOCUS_32080 gene pal 1764 1165 CDS product peptidoglycan-associated lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304908.1 protein_id gnl|my_center|LOCUS_32080 3101 1743 gene locus_tag LOCUS_32090 gene tolB 3101 1743 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR11 protein_id gnl|my_center|LOCUS_32090 4037 3111 gene locus_tag LOCUS_32100 gene tolA 4037 3111 CDS product protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261600.1 protein_id gnl|my_center|LOCUS_32100 4473 4039 gene locus_tag LOCUS_32110 gene tolR 4473 4039 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_32110 5164 4460 gene locus_tag LOCUS_32120 5164 4460 CDS product Tol-Pal system subunit TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 protein_id gnl|my_center|LOCUS_32120 7119 6112 gene locus_tag LOCUS_32130 gene ruvB 7119 6112 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPA2 protein_id gnl|my_center|LOCUS_32130 7744 7127 gene locus_tag LOCUS_32140 gene ruvA 7744 7127 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QU8 protein_id gnl|my_center|LOCUS_32140 8270 7746 gene locus_tag LOCUS_32150 gene ruvC 8270 7746 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KR00 protein_id gnl|my_center|LOCUS_32150 10893 8392 gene locus_tag LOCUS_32160 gene ybbP 10893 8392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072830.1 protein_id gnl|my_center|LOCUS_32160 11596 10883 gene locus_tag LOCUS_32170 gene ybbA 11596 10883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072831.1 protein_id gnl|my_center|LOCUS_32170 11597 12217 gene locus_tag LOCUS_32180 11597 12217 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707238.1 protein_id gnl|my_center|LOCUS_32180 12324 12400 gene locus_tag LOCUS_t00440 12324 12400 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <13321 12452 gene locus_tag LOCUS_32190 <13321 12452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289537.1:LD-carboxypeptidase >Feature sequence123 3206 66 gene locus_tag LOCUS_32200 3206 66 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 protein_id gnl|my_center|LOCUS_32200 4438 3218 gene locus_tag LOCUS_32210 4438 3218 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 protein_id gnl|my_center|LOCUS_32210 5694 4435 gene locus_tag LOCUS_32220 5694 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 6127 5747 gene locus_tag LOCUS_32230 6127 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 6290 7153 gene locus_tag LOCUS_32240 gene czcD 6290 7153 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_32240 7263 8339 gene locus_tag LOCUS_32250 7263 8339 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_32250 9037 11175 gene locus_tag LOCUS_32260 9037 11175 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 protein_id gnl|my_center|LOCUS_32260 11398 11871 gene locus_tag LOCUS_32270 gene brf1 11398 11871 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHV0 protein_id gnl|my_center|LOCUS_32270 11882 12346 gene locus_tag LOCUS_32280 gene bfr 11882 12346 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPS5 protein_id gnl|my_center|LOCUS_32280 12639 12445 gene locus_tag LOCUS_32290 12639 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 >Feature sequence124 223 459 gene locus_tag LOCUS_32300 223 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 578 1000 gene locus_tag LOCUS_32310 578 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 1321 1112 gene locus_tag LOCUS_32320 1321 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 1488 2642 gene locus_tag LOCUS_32330 1488 2642 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_32330 6799 3362 gene locus_tag LOCUS_32340 6799 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 7119 8036 gene locus_tag LOCUS_32350 7119 8036 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021841.1 protein_id gnl|my_center|LOCUS_32350 8267 11206 gene locus_tag LOCUS_32360 8267 11206 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107964.1 protein_id gnl|my_center|LOCUS_32360 11240 12949 gene locus_tag LOCUS_32370 11240 12949 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_32370 >Feature sequence125 495 656 gene locus_tag LOCUS_32380 495 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 643 870 gene locus_tag LOCUS_32390 643 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32390 969 1583 gene locus_tag LOCUS_32400 969 1583 CDS product alpha-ribazole-5'-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 protein_id gnl|my_center|LOCUS_32400 1653 1853 gene locus_tag LOCUS_32410 1653 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 1835 2671 gene locus_tag LOCUS_32420 gene btuD 1835 2671 CDS product ABC cobalamin uptake system ATPase BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071292.1 protein_id gnl|my_center|LOCUS_32420 2658 3653 gene locus_tag LOCUS_32430 gene btuC 2658 3653 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071293.1 protein_id gnl|my_center|LOCUS_32430 3658 4722 gene locus_tag LOCUS_32440 gene cobT 3658 4722 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI18 protein_id gnl|my_center|LOCUS_32440 4722 5519 gene locus_tag LOCUS_32450 gene cobS 4722 5519 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSL8 protein_id gnl|my_center|LOCUS_32450 5516 6043 gene locus_tag LOCUS_32460 gene cobU 5516 6043 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 protein_id gnl|my_center|LOCUS_32460 6040 7545 gene locus_tag LOCUS_32470 gene cobQ 6040 7545 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EI15 protein_id gnl|my_center|LOCUS_32470 7529 8128 gene locus_tag LOCUS_32480 7529 8128 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461596.1 protein_id gnl|my_center|LOCUS_32480 8128 8985 gene locus_tag LOCUS_32490 gene btuF 8128 8985 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_32490 8982 9644 gene locus_tag LOCUS_32500 gene ung 8982 9644 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPK8 protein_id gnl|my_center|LOCUS_32500 9942 9754 gene locus_tag LOCUS_32510 9942 9754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073377.1 protein_id gnl|my_center|LOCUS_32510 11070 10120 gene locus_tag LOCUS_32520 gene tal 11070 10120 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZIN2 protein_id gnl|my_center|LOCUS_32520 11321 12100 gene locus_tag LOCUS_32530 11321 12100 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SC0 protein_id gnl|my_center|LOCUS_32530 12201 13115 gene locus_tag LOCUS_32540 12201 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence126 1484 204 gene locus_tag LOCUS_32550 gene hemL 1484 204 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNY9 protein_id gnl|my_center|LOCUS_32550 2530 1514 gene locus_tag LOCUS_32560 gene pyrB 2530 1514 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071514.1 protein_id gnl|my_center|LOCUS_32560 3101 2667 gene locus_tag LOCUS_32570 3101 2667 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958512.1 protein_id gnl|my_center|LOCUS_32570 4803 3121 gene locus_tag LOCUS_32580 4803 3121 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_32580 5262 6095 gene locus_tag LOCUS_32590 5262 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 6107 6538 gene locus_tag LOCUS_32600 6107 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 6535 7254 gene locus_tag LOCUS_32610 gene rstA 6535 7254 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_32610 7256 8548 gene locus_tag LOCUS_32620 gene rstB 7256 8548 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073413.1 protein_id gnl|my_center|LOCUS_32620 9023 10702 gene locus_tag LOCUS_32630 9023 10702 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105582.1 protein_id gnl|my_center|LOCUS_32630 10699 12402 gene locus_tag LOCUS_32640 10699 12402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 protein_id gnl|my_center|LOCUS_32640 12432 12824 gene locus_tag LOCUS_32650 12432 12824 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87GN6 protein_id gnl|my_center|LOCUS_32650 >Feature sequence127 170 86 gene locus_tag LOCUS_t00450 170 86 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 603 253 gene locus_tag LOCUS_32660 gene secG 603 253 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001337627.1 protein_id gnl|my_center|LOCUS_32660 1354 605 gene locus_tag LOCUS_32670 gene tpiA 1354 605 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHL9 protein_id gnl|my_center|LOCUS_32670 2776 1427 gene locus_tag LOCUS_32680 gene glmM 2776 1427 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNE8 protein_id gnl|my_center|LOCUS_32680 3633 2779 gene locus_tag LOCUS_32690 gene folP 3633 2779 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHM1 protein_id gnl|my_center|LOCUS_32690 5634 3736 gene locus_tag LOCUS_32700 gene hflB 5634 3736 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNF0 protein_id gnl|my_center|LOCUS_32700 6375 5746 gene locus_tag LOCUS_32710 gene rlmE 6375 5746 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E7M3 protein_id gnl|my_center|LOCUS_32710 6464 6760 gene locus_tag LOCUS_32720 6464 6760 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480467.1 protein_id gnl|my_center|LOCUS_32720 7330 6854 gene locus_tag LOCUS_32730 7330 6854 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 protein_id gnl|my_center|LOCUS_32730 8493 7327 gene locus_tag LOCUS_32740 8493 7327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 8670 9425 gene locus_tag LOCUS_32750 8670 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 9530 10387 gene locus_tag LOCUS_32760 gene ompV 9530 10387 CDS product outer membrane protein OmpV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P06111 protein_id gnl|my_center|LOCUS_32760 10377 10769 gene locus_tag LOCUS_32770 10377 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 10783 11487 gene locus_tag LOCUS_32780 gene rstA 10783 11487 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_32780 11516 12811 gene locus_tag LOCUS_32790 11516 12811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 >Feature sequence128 2398 245 gene locus_tag LOCUS_32800 2398 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 4661 2796 gene locus_tag LOCUS_32810 gene dxs 4661 2796 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RU0 protein_id gnl|my_center|LOCUS_32810 5654 4767 gene locus_tag LOCUS_32820 5654 4767 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488700.1 protein_id gnl|my_center|LOCUS_32820 5900 5658 gene locus_tag LOCUS_32830 gene xseB 5900 5658 CDS product exodeoxyribonuclease 7 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6Y8 protein_id gnl|my_center|LOCUS_32830 6202 6969 gene locus_tag LOCUS_32840 gene pomA 6202 6969 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071707.1 protein_id gnl|my_center|LOCUS_32840 6972 7892 gene locus_tag LOCUS_32850 gene pomB 6972 7892 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071708.1 protein_id gnl|my_center|LOCUS_32850 8031 8513 gene locus_tag LOCUS_32860 8031 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 8586 10496 gene locus_tag LOCUS_32870 gene topB 8586 10496 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECS1 protein_id gnl|my_center|LOCUS_32870 11823 10513 gene locus_tag LOCUS_32880 11823 10513 CDS product putative amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705460.1 protein_id gnl|my_center|LOCUS_32880 11924 12781 gene locus_tag LOCUS_32890 gene ybbN 11924 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77395 protein_id gnl|my_center|LOCUS_32890 >Feature sequence129 469 2691 gene locus_tag LOCUS_32900 469 2691 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_32900 4081 2840 gene locus_tag LOCUS_32910 4081 2840 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038470.1 protein_id gnl|my_center|LOCUS_32910 5479 4094 gene locus_tag LOCUS_32920 5479 4094 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038469.1 protein_id gnl|my_center|LOCUS_32920 6358 5573 gene locus_tag LOCUS_32930 6358 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 6712 7077 gene locus_tag LOCUS_32940 6712 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 7831 7136 gene locus_tag LOCUS_32950 7831 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477484.1 protein_id gnl|my_center|LOCUS_32950 7963 8823 gene locus_tag LOCUS_32960 7963 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87PM1 protein_id gnl|my_center|LOCUS_32960 9007 9210 gene locus_tag LOCUS_32970 9007 9210 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072299.1 protein_id gnl|my_center|LOCUS_32970 9858 9229 gene locus_tag LOCUS_32980 gene ribC 9858 9229 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072298.1 protein_id gnl|my_center|LOCUS_32980 10035 11390 gene locus_tag LOCUS_32990 gene norM 10035 11390 CDS product putative multidrug resistance protein NorM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EES3 protein_id gnl|my_center|LOCUS_32990 11368 12438 gene locus_tag LOCUS_33000 11368 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105850.1 protein_id gnl|my_center|LOCUS_33000 12550 12626 gene locus_tag LOCUS_t00460 12550 12626 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12660 12736 gene locus_tag LOCUS_t00470 12660 12736 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence130 428 1483 gene locus_tag LOCUS_33010 428 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 1794 2042 gene locus_tag LOCUS_33020 1794 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 2035 2709 gene locus_tag LOCUS_33030 2035 2709 CDS product aspartyl/asparaginyl beta-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070575.1 protein_id gnl|my_center|LOCUS_33030 2717 3226 gene locus_tag LOCUS_33040 2717 3226 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070579.1 protein_id gnl|my_center|LOCUS_33040 3256 3537 gene locus_tag LOCUS_33050 3256 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 3596 4141 gene locus_tag LOCUS_33060 3596 4141 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070580.1 protein_id gnl|my_center|LOCUS_33060 4156 4686 gene locus_tag LOCUS_33070 4156 4686 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_33070 4699 5235 gene locus_tag LOCUS_33080 4699 5235 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_33080 5357 6604 gene locus_tag LOCUS_33090 5357 6604 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070583.1 protein_id gnl|my_center|LOCUS_33090 6606 7742 gene locus_tag LOCUS_33100 6606 7742 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070584.1 protein_id gnl|my_center|LOCUS_33100 7720 7650 gene locus_tag LOCUS_t00480 7720 7650 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence131 1326 403 gene locus_tag LOCUS_33110 gene yyaM 1326 403 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206550.1 protein_id gnl|my_center|LOCUS_33110 1418 2311 gene locus_tag LOCUS_33120 1418 2311 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460107.1 protein_id gnl|my_center|LOCUS_33120 2427 3254 gene locus_tag LOCUS_33130 2427 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 4695 3337 gene locus_tag LOCUS_33140 4695 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 >Feature sequence132 547 173 gene locus_tag LOCUS_33150 547 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099290.1 protein_id gnl|my_center|LOCUS_33150 639 1514 gene locus_tag LOCUS_33160 gene hdtR 639 1514 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072234.1 protein_id gnl|my_center|LOCUS_33160 1674 2591 gene locus_tag LOCUS_33170 1674 2591 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071726.1 protein_id gnl|my_center|LOCUS_33170 4663 2642 gene locus_tag LOCUS_33180 gene recG 4663 2642 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KNM1 protein_id gnl|my_center|LOCUS_33180 5470 4784 gene locus_tag LOCUS_33190 gene trmH 5470 4784 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8P8 protein_id gnl|my_center|LOCUS_33190 5983 5525 gene locus_tag LOCUS_33200 5983 5525 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008500198.1 protein_id gnl|my_center|LOCUS_33200 6182 7177 gene locus_tag LOCUS_33210 gene asnA 6182 7177 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUB0 protein_id gnl|my_center|LOCUS_33210 8833 7229 gene locus_tag LOCUS_33220 8833 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704456.1 protein_id gnl|my_center|LOCUS_33220 9379 8987 gene locus_tag LOCUS_33230 9379 8987 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_33230 11497 9392 gene locus_tag LOCUS_33240 gene spoT 11497 9392 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070723.1 protein_id gnl|my_center|LOCUS_33240 11901 11626 gene locus_tag LOCUS_33250 gene rpoZ 11901 11626 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KR23 protein_id gnl|my_center|LOCUS_33250 12639 12019 gene locus_tag LOCUS_33260 gene gmk 12639 12019 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJU6 protein_id gnl|my_center|LOCUS_33260 >Feature sequence133 3207 2527 gene locus_tag LOCUS_33270 3207 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 3635 3285 gene locus_tag LOCUS_33280 3635 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010674427.1 protein_id gnl|my_center|LOCUS_33280 4231 3653 gene locus_tag LOCUS_33290 4231 3653 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369194.1 protein_id gnl|my_center|LOCUS_33290 4581 4300 gene locus_tag LOCUS_33300 gene ppiC2 4581 4300 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWK5 protein_id gnl|my_center|LOCUS_33300 5239 4667 gene locus_tag LOCUS_33310 5239 4667 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EBZ6 protein_id gnl|my_center|LOCUS_33310 5364 5852 gene locus_tag LOCUS_33320 gene ywnH 5364 5852 CDS product putative phosphinothricin acetyltransferase YwnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71043 protein_id gnl|my_center|LOCUS_33320 5992 7905 gene locus_tag LOCUS_33330 5992 7905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 7972 9120 gene locus_tag LOCUS_33340 7972 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 10279 9146 gene locus_tag LOCUS_33350 gene queG 10279 9146 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L02 protein_id gnl|my_center|LOCUS_33350 11555 10350 gene locus_tag LOCUS_33360 11555 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 12361 11663 gene locus_tag LOCUS_33370 12361 11663 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706982.1 protein_id gnl|my_center|LOCUS_33370 12479 12679 gene locus_tag LOCUS_33380 12479 12679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence134 1788 592 gene locus_tag LOCUS_33390 1788 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 2135 1869 gene locus_tag LOCUS_33400 2135 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 3961 2270 gene locus_tag LOCUS_33410 3961 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 4628 4398 gene locus_tag LOCUS_33420 4628 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 4989 4789 gene locus_tag LOCUS_33430 4989 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 5896 5171 gene locus_tag LOCUS_33440 5896 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 7094 6228 gene locus_tag LOCUS_33450 7094 6228 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946714.1 protein_id gnl|my_center|LOCUS_33450 7731 8405 gene locus_tag LOCUS_33460 7731 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 8411 9517 gene locus_tag LOCUS_33470 8411 9517 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535005.1 protein_id gnl|my_center|LOCUS_33470 9536 10843 gene locus_tag LOCUS_33480 9536 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263396.1 protein_id gnl|my_center|LOCUS_33480 12284 11151 gene locus_tag LOCUS_33490 12284 11151 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_33490 >Feature sequence135 930 2615 gene locus_tag LOCUS_33500 930 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 2996 5287 gene locus_tag LOCUS_33510 2996 5287 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919836.1 protein_id gnl|my_center|LOCUS_33510 5410 5709 gene locus_tag LOCUS_33520 5410 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 5771 6427 gene locus_tag LOCUS_33530 gene yqaB 5771 6427 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209450.1 protein_id gnl|my_center|LOCUS_33530 6462 7310 gene locus_tag LOCUS_33540 6462 7310 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072236.1 protein_id gnl|my_center|LOCUS_33540 7375 8742 gene locus_tag LOCUS_33550 gene yegD 7375 8742 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072221.1 protein_id gnl|my_center|LOCUS_33550 9214 8750 gene locus_tag LOCUS_33560 gene mgsA 9214 8750 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTS3 protein_id gnl|my_center|LOCUS_33560 9867 9232 gene locus_tag LOCUS_33570 9867 9232 CDS product LysE type translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530934.1 protein_id gnl|my_center|LOCUS_33570 11066 9873 gene locus_tag LOCUS_33580 11066 9873 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106131.1 protein_id gnl|my_center|LOCUS_33580 11220 11693 gene locus_tag LOCUS_33590 11220 11693 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 protein_id gnl|my_center|LOCUS_33590 12201 11710 gene locus_tag LOCUS_33600 12201 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389620.1 protein_id gnl|my_center|LOCUS_33600 >Feature sequence136 1 282 gene locus_tag LOCUS_33610 1 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 306 1625 gene locus_tag LOCUS_33620 306 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 2032 1886 gene locus_tag LOCUS_33630 2032 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 3001 2798 gene locus_tag LOCUS_33640 3001 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 3107 4111 gene locus_tag LOCUS_33650 gene legI 3107 4111 CDS product N,N'-diacetyllegionaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8T1 protein_id gnl|my_center|LOCUS_33650 4108 5262 gene locus_tag LOCUS_33660 4108 5262 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545909.1 protein_id gnl|my_center|LOCUS_33660 5265 5951 gene locus_tag LOCUS_33670 5265 5951 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465710.1 protein_id gnl|my_center|LOCUS_33670 5948 7162 gene locus_tag LOCUS_33680 5948 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 7469 8368 gene locus_tag LOCUS_33690 7469 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 8399 9217 gene locus_tag LOCUS_33700 8399 9217 CDS product putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q48215 protein_id gnl|my_center|LOCUS_33700 9264 10196 gene locus_tag LOCUS_33710 9264 10196 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073060.1 protein_id gnl|my_center|LOCUS_33710 10212 10760 gene locus_tag LOCUS_33720 10212 10760 CDS product undecaprenyl-phosphate beta-N-acetyl-D-fucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261052.1 protein_id gnl|my_center|LOCUS_33720 11254 11625 gene locus_tag LOCUS_33730 11254 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_33730 >Feature sequence137 834 133 gene locus_tag LOCUS_33740 gene deoD-2 834 133 CDS product purine nucleoside phosphorylase DeoD-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPE1 protein_id gnl|my_center|LOCUS_33740 2066 834 gene locus_tag LOCUS_33750 gene deoB 2066 834 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK2 protein_id gnl|my_center|LOCUS_33750 2228 2887 gene locus_tag LOCUS_33760 gene udk 2228 2887 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z9 protein_id gnl|my_center|LOCUS_33760 2906 4129 gene locus_tag LOCUS_33770 2906 4129 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHK7 protein_id gnl|my_center|LOCUS_33770 4323 5042 gene locus_tag LOCUS_33780 4323 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707502.1 protein_id gnl|my_center|LOCUS_33780 5769 5047 gene locus_tag LOCUS_33790 5769 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707502.1 protein_id gnl|my_center|LOCUS_33790 6124 5915 gene locus_tag LOCUS_33800 6124 5915 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_33800 6740 8905 gene locus_tag LOCUS_33810 gene dcp 6740 8905 CDS product dipeptidyl carboxypeptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073033.1 protein_id gnl|my_center|LOCUS_33810 9807 9094 gene locus_tag LOCUS_33820 9807 9094 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KZN6 protein_id gnl|my_center|LOCUS_33820 11562 9874 gene locus_tag LOCUS_33830 11562 9874 CDS product cell signaling regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817287.1 protein_id gnl|my_center|LOCUS_33830 >Feature sequence138 <1 1067 gene locus_tag LOCUS_33840 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706495.1:motility protein FimV 1246 2040 gene locus_tag LOCUS_33850 gene truA 1246 2040 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MP1 protein_id gnl|my_center|LOCUS_33850 2201 3076 gene locus_tag LOCUS_33860 gene accD1 2201 3076 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MP2 protein_id gnl|my_center|LOCUS_33860 3102 4367 gene locus_tag LOCUS_33870 gene folC 3102 4367 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706492.1 protein_id gnl|my_center|LOCUS_33870 4379 5017 gene locus_tag LOCUS_33880 gene dedD 4379 5017 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171804.1 protein_id gnl|my_center|LOCUS_33880 5079 5573 gene locus_tag LOCUS_33890 gene cvpA 5079 5573 CDS product bacteriocin production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072963.1 protein_id gnl|my_center|LOCUS_33890 5592 7118 gene locus_tag LOCUS_33900 gene purF 5592 7118 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECR8 protein_id gnl|my_center|LOCUS_33900 7832 7233 gene locus_tag LOCUS_33910 7832 7233 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071909.1 protein_id gnl|my_center|LOCUS_33910 8084 8854 gene locus_tag LOCUS_33920 8084 8854 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459884.1 protein_id gnl|my_center|LOCUS_33920 9054 11279 gene locus_tag LOCUS_33930 9054 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence139 1296 961 gene locus_tag LOCUS_33940 gene rraB 1296 961 CDS product regulator of ribonuclease activity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNU5 protein_id gnl|my_center|LOCUS_33940 2009 1296 gene locus_tag LOCUS_33950 gene plsC 2009 1296 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJA1 protein_id gnl|my_center|LOCUS_33950 4458 2167 gene locus_tag LOCUS_33960 gene parC 4458 2167 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPK2 protein_id gnl|my_center|LOCUS_33960 5563 4469 gene locus_tag LOCUS_33970 5563 4469 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_33970 7773 5884 gene locus_tag LOCUS_33980 gene parE 7773 5884 CDS product DNA topoisomerase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EAK3 protein_id gnl|my_center|LOCUS_33980 8365 7805 gene locus_tag LOCUS_33990 8365 7805 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369652.1 protein_id gnl|my_center|LOCUS_33990 9144 8350 gene locus_tag LOCUS_34000 gene cpdA 9144 8350 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPL0 protein_id gnl|my_center|LOCUS_34000 9586 9128 gene locus_tag LOCUS_34010 9586 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833403.1 protein_id gnl|my_center|LOCUS_34010 10260 9631 gene locus_tag LOCUS_34020 10260 9631 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707476.1 protein_id gnl|my_center|LOCUS_34020 >Feature sequence140 1280 432 gene locus_tag LOCUS_34030 1280 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 2351 1347 gene locus_tag LOCUS_34040 2351 1347 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089288.1 protein_id gnl|my_center|LOCUS_34040 4518 2425 gene locus_tag LOCUS_34050 gene tmcA 4518 2425 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPS8 protein_id gnl|my_center|LOCUS_34050 6661 4496 gene locus_tag LOCUS_34060 6661 4496 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVF6 protein_id gnl|my_center|LOCUS_34060 6989 7213 gene locus_tag LOCUS_34070 6989 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074051.1 protein_id gnl|my_center|LOCUS_34070 7325 7693 gene locus_tag LOCUS_34080 7325 7693 CDS product UPF0231 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LW4 protein_id gnl|my_center|LOCUS_34080 7878 8501 gene locus_tag LOCUS_34090 gene dut 7878 8501 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_34090 9148 8498 gene locus_tag LOCUS_34100 9148 8498 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_34100 9204 9782 gene locus_tag LOCUS_34110 gene nudE 9204 9782 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459019.1 protein_id gnl|my_center|LOCUS_34110 9775 10572 gene locus_tag LOCUS_34120 gene cysQ 9775 10572 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070587.1 protein_id gnl|my_center|LOCUS_34120 10715 10791 gene locus_tag LOCUS_t00490 10715 10791 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10950 11026 gene locus_tag LOCUS_t00500 10950 11026 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11093 11169 gene locus_tag LOCUS_t00510 11093 11169 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence141 2023 557 gene locus_tag LOCUS_34130 gene der 2023 557 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC36 protein_id gnl|my_center|LOCUS_34130 3294 2116 gene locus_tag LOCUS_34140 gene bamB 3294 2116 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S13 protein_id gnl|my_center|LOCUS_34140 3924 3304 gene locus_tag LOCUS_34150 3924 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 protein_id gnl|my_center|LOCUS_34150 5221 3941 gene locus_tag LOCUS_34160 gene hisS 5221 3941 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E771 protein_id gnl|my_center|LOCUS_34160 6476 5358 gene locus_tag LOCUS_34170 gene ispG 6476 5358 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E772 protein_id gnl|my_center|LOCUS_34170 7354 6482 gene locus_tag LOCUS_34180 7354 6482 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482997.1 protein_id gnl|my_center|LOCUS_34180 9312 7351 gene locus_tag LOCUS_34190 9312 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 10558 9425 gene locus_tag LOCUS_34200 gene rlmN 10558 9425 CDS product dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EC29 protein_id gnl|my_center|LOCUS_34200 11161 10730 gene locus_tag LOCUS_34210 gene ndk 11161 10730 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU0 protein_id gnl|my_center|LOCUS_34210 >Feature sequence142 189 1580 gene locus_tag LOCUS_34220 189 1580 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_34220 2312 1680 gene locus_tag LOCUS_34230 gene nth 2312 1680 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW8 protein_id gnl|my_center|LOCUS_34230 3048 2350 gene locus_tag LOCUS_34240 3048 2350 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MW9 protein_id gnl|my_center|LOCUS_34240 3680 3045 gene locus_tag LOCUS_34250 gene rsxG 3680 3045 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z6Q7 protein_id gnl|my_center|LOCUS_34250 4675 3677 gene locus_tag LOCUS_34260 gene rnfD 4675 3677 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E6B9 protein_id gnl|my_center|LOCUS_34260 7293 4735 gene locus_tag LOCUS_34270 7293 4735 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MX2 protein_id gnl|my_center|LOCUS_34270 7857 7303 gene locus_tag LOCUS_34280 gene rnfB 7857 7303 CDS product electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLJ3 protein_id gnl|my_center|LOCUS_34280 8440 7859 gene locus_tag LOCUS_34290 gene rnfA 8440 7859 CDS product electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLJ2 protein_id gnl|my_center|LOCUS_34290 10633 8690 gene locus_tag LOCUS_34300 10633 8690 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072470.1 protein_id gnl|my_center|LOCUS_34300 10860 10784 gene locus_tag LOCUS_t00520 10860 10784 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10964 10888 gene locus_tag LOCUS_t00530 10964 10888 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 11064 10988 gene locus_tag LOCUS_t00540 11064 10988 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence143 <1 711 gene locus_tag LOCUS_34310 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000841995.1:integron integrase 1735 992 gene locus_tag LOCUS_34320 1735 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112983.1 protein_id gnl|my_center|LOCUS_34320 2570 1905 gene locus_tag LOCUS_34330 gene queE 2570 1905 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE87 protein_id gnl|my_center|LOCUS_34330 2722 3378 gene locus_tag LOCUS_34340 gene queC 2722 3378 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W2G5 protein_id gnl|my_center|LOCUS_34340 3884 3435 gene locus_tag LOCUS_34350 3884 3435 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462646.1 protein_id gnl|my_center|LOCUS_34350 4063 4305 gene locus_tag LOCUS_34360 4063 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 5363 4317 gene locus_tag LOCUS_34370 5363 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 6092 5424 gene locus_tag LOCUS_34380 6092 5424 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263773.1 protein_id gnl|my_center|LOCUS_34380 7028 6099 gene locus_tag LOCUS_34390 7028 6099 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072824.1 protein_id gnl|my_center|LOCUS_34390 9021 7021 gene locus_tag LOCUS_34400 gene uvrB 9021 7021 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL12 protein_id gnl|my_center|LOCUS_34400 10313 9018 gene locus_tag LOCUS_34410 10313 9018 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261057.1 protein_id gnl|my_center|LOCUS_34410 >Feature sequence144 4315 3086 gene locus_tag LOCUS_34420 gene amtB 4315 3086 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_34420 4663 4325 gene locus_tag LOCUS_34430 4663 4325 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005386570.1 protein_id gnl|my_center|LOCUS_34430 6072 4840 gene locus_tag LOCUS_34440 6072 4840 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387846.1 protein_id gnl|my_center|LOCUS_34440 6341 7858 gene locus_tag LOCUS_34450 6341 7858 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_34450 7906 8523 gene locus_tag LOCUS_34460 7906 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 8544 9140 gene locus_tag LOCUS_34470 gene ygfA 8544 9140 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E2Z7 protein_id gnl|my_center|LOCUS_34470 9194 9847 gene locus_tag LOCUS_34480 gene rpiA 9194 9847 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LL9 protein_id gnl|my_center|LOCUS_34480 >Feature sequence145 1437 286 gene locus_tag LOCUS_34490 gene metK 1437 286 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A820 protein_id gnl|my_center|LOCUS_34490 1712 3703 gene locus_tag LOCUS_34500 gene tktA 1712 3703 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGS3 protein_id gnl|my_center|LOCUS_34500 3897 4208 gene locus_tag LOCUS_34510 3897 4208 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DI8 protein_id gnl|my_center|LOCUS_34510 4390 4746 gene locus_tag LOCUS_34520 gene raiA 4390 4746 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073262.1 protein_id gnl|my_center|LOCUS_34520 4892 6124 gene locus_tag LOCUS_34530 4892 6124 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 protein_id gnl|my_center|LOCUS_34530 6509 6279 gene locus_tag LOCUS_34540 6509 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 8256 6577 gene locus_tag LOCUS_34550 gene pilB 8256 6577 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 protein_id gnl|my_center|LOCUS_34550 9028 8396 gene locus_tag LOCUS_34560 gene coaE 9028 8396 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CF11 protein_id gnl|my_center|LOCUS_34560 9797 9030 gene locus_tag LOCUS_34570 gene pilD 9797 9030 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJP8 protein_id gnl|my_center|LOCUS_34570 <10811 10302 gene locus_tag LOCUS_34580 <10811 10302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707570.1:type II secretion system protein F >Feature sequence146 744 3767 gene locus_tag LOCUS_34590 744 3767 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918330.1 protein_id gnl|my_center|LOCUS_34590 3993 5801 gene locus_tag LOCUS_34600 3993 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 6129 7598 gene locus_tag LOCUS_34610 6129 7598 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_34610 7621 8244 gene locus_tag LOCUS_34620 gene eda 7621 8244 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072451.1 protein_id gnl|my_center|LOCUS_34620 8336 9784 gene locus_tag LOCUS_34630 gene uxaC 8336 9784 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J0M5 protein_id gnl|my_center|LOCUS_34630 >Feature sequence147 129 1265 gene locus_tag LOCUS_34640 129 1265 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704790.1 protein_id gnl|my_center|LOCUS_34640 1347 3179 gene locus_tag LOCUS_34650 1347 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073230.1 protein_id gnl|my_center|LOCUS_34650 3318 4016 gene locus_tag LOCUS_34660 3318 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 4735 4019 gene locus_tag LOCUS_34670 4735 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232567.2 protein_id gnl|my_center|LOCUS_34670 4906 7560 gene locus_tag LOCUS_34680 gene yfiQ 4906 7560 CDS product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072179.1 protein_id gnl|my_center|LOCUS_34680 7571 8503 gene locus_tag LOCUS_34690 7571 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 8534 9574 gene locus_tag LOCUS_34700 8534 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 9571 10065 gene locus_tag LOCUS_34710 9571 10065 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859527.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence148 1495 440 gene locus_tag LOCUS_34720 1495 440 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090704.1 protein_id gnl|my_center|LOCUS_34720 2347 1499 gene locus_tag LOCUS_34730 2347 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 4125 2347 gene locus_tag LOCUS_34740 4125 2347 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261041.1 protein_id gnl|my_center|LOCUS_34740 4896 4126 gene locus_tag LOCUS_34750 4896 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 5951 4896 gene locus_tag LOCUS_34760 5951 4896 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771829.1 protein_id gnl|my_center|LOCUS_34760 6897 5941 gene locus_tag LOCUS_34770 6897 5941 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 protein_id gnl|my_center|LOCUS_34770 7559 6897 gene locus_tag LOCUS_34780 7559 6897 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771848.1 protein_id gnl|my_center|LOCUS_34780 8562 7567 gene locus_tag LOCUS_34790 8562 7567 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546066.1 protein_id gnl|my_center|LOCUS_34790 9840 8566 gene locus_tag LOCUS_34800 9840 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 >Feature sequence149 <1 744 gene locus_tag LOCUS_34810 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097860.1:pseudaminic acid synthase 750 998 gene locus_tag LOCUS_34820 750 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 995 2590 gene locus_tag LOCUS_34830 995 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 2580 4106 gene locus_tag LOCUS_34840 2580 4106 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513150.1 protein_id gnl|my_center|LOCUS_34840 5266 4112 gene locus_tag LOCUS_34850 5266 4112 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973788.1 protein_id gnl|my_center|LOCUS_34850 6459 5305 gene locus_tag LOCUS_34860 gene rkpM 6459 5305 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887051.1 protein_id gnl|my_center|LOCUS_34860 7457 6456 gene locus_tag LOCUS_34870 7457 6456 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707808.1 protein_id gnl|my_center|LOCUS_34870 7668 8453 gene locus_tag LOCUS_34880 gene fliC 7668 8453 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CK20 protein_id gnl|my_center|LOCUS_34880 8617 10053 gene locus_tag LOCUS_34890 gene flrA 8617 10053 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073116.1 protein_id gnl|my_center|LOCUS_34890 >Feature sequence150 2380 218 gene locus_tag LOCUS_34900 gene bfrI 2380 218 CDS product ferrisiderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039372.1 protein_id gnl|my_center|LOCUS_34900 2482 3624 gene locus_tag LOCUS_34910 2482 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106912.1 protein_id gnl|my_center|LOCUS_34910 3624 4091 gene locus_tag LOCUS_34920 3624 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 4293 5705 gene locus_tag LOCUS_34930 4293 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 6487 5750 gene locus_tag LOCUS_34940 6487 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 7039 6575 gene locus_tag LOCUS_34950 7039 6575 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404499.1 protein_id gnl|my_center|LOCUS_34950 7171 8337 gene locus_tag LOCUS_34960 7171 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 >Feature sequence151 3349 2960 gene locus_tag LOCUS_34970 gene gcvH 3349 2960 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EIQ7 protein_id gnl|my_center|LOCUS_34970 4650 3568 gene locus_tag LOCUS_34980 gene gcvT 4650 3568 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJ03 protein_id gnl|my_center|LOCUS_34980 5437 4838 gene locus_tag LOCUS_34990 5437 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 5564 6409 gene locus_tag LOCUS_35000 5564 6409 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887515.1 protein_id gnl|my_center|LOCUS_35000 6616 8766 gene locus_tag LOCUS_35010 6616 8766 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_35010 9234 9695 gene locus_tag LOCUS_35020 9234 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 >Feature sequence152 552 2516 gene locus_tag LOCUS_35030 552 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 3958 2642 gene locus_tag LOCUS_35040 3958 2642 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202760.1 protein_id gnl|my_center|LOCUS_35040 5358 3961 gene locus_tag LOCUS_35050 5358 3961 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_35050 5584 6837 gene locus_tag LOCUS_35060 5584 6837 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787749.1 protein_id gnl|my_center|LOCUS_35060 6849 7553 gene locus_tag LOCUS_35070 6849 7553 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_35070 >Feature sequence153 295 3240 gene locus_tag LOCUS_35080 295 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 3251 3916 gene locus_tag LOCUS_35090 3251 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 3968 4561 gene locus_tag LOCUS_35100 3968 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 4574 5254 gene locus_tag LOCUS_35110 4574 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881912.1 protein_id gnl|my_center|LOCUS_35110 5263 5922 gene locus_tag LOCUS_35120 5263 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 6063 6137 gene locus_tag LOCUS_t00550 6063 6137 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7612 6233 gene locus_tag LOCUS_35130 7612 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 8688 7609 gene locus_tag LOCUS_35140 8688 7609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 9835 9254 gene locus_tag LOCUS_35150 9835 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 >Feature sequence154 93 731 gene locus_tag LOCUS_35160 gene pdxH 93 731 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED71 protein_id gnl|my_center|LOCUS_35160 738 1511 gene locus_tag LOCUS_35170 738 1511 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882042.1 protein_id gnl|my_center|LOCUS_35170 2044 1478 gene locus_tag LOCUS_35180 2044 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 2395 3408 gene locus_tag LOCUS_35190 2395 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 5900 3414 gene locus_tag LOCUS_35200 5900 3414 CDS product pilus assembly protein PilZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071453.1 protein_id gnl|my_center|LOCUS_35200 6274 7659 gene locus_tag LOCUS_35210 gene radA 6274 7659 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPD6 protein_id gnl|my_center|LOCUS_35210 7818 8750 gene locus_tag LOCUS_35220 7818 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 9315 9608 gene locus_tag LOCUS_35230 9315 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 >Feature sequence155 641 1090 gene locus_tag LOCUS_35240 641 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 1185 2546 gene locus_tag LOCUS_35250 1185 2546 CDS product cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948334.1 protein_id gnl|my_center|LOCUS_35250 2956 2567 gene locus_tag LOCUS_35260 2956 2567 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072206.1 protein_id gnl|my_center|LOCUS_35260 4085 3009 gene locus_tag LOCUS_35270 gene fabH 4085 3009 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KH32 protein_id gnl|my_center|LOCUS_35270 4239 5552 gene locus_tag LOCUS_35280 4239 5552 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_35280 5561 5965 gene locus_tag LOCUS_35290 5561 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957955.1 protein_id gnl|my_center|LOCUS_35290 6009 7262 gene locus_tag LOCUS_35300 gene prrB 6009 7262 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073863.1 protein_id gnl|my_center|LOCUS_35300 7259 7789 gene locus_tag LOCUS_35310 gene prrA 7259 7789 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073862.1 protein_id gnl|my_center|LOCUS_35310 8120 7932 gene locus_tag LOCUS_35320 8120 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 8074 8478 gene locus_tag LOCUS_35330 8074 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 8522 8773 gene locus_tag LOCUS_35340 8522 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263413.1 protein_id gnl|my_center|LOCUS_35340 8976 9152 gene locus_tag LOCUS_35350 8976 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 >Feature sequence156 2590 1004 gene locus_tag LOCUS_35360 2590 1004 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211877.1 protein_id gnl|my_center|LOCUS_35360 2705 4807 gene locus_tag LOCUS_35370 2705 4807 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705823.1 protein_id gnl|my_center|LOCUS_35370 4823 5566 gene locus_tag LOCUS_35380 gene alcD 4823 5566 CDS product siderophore ferric iron reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814016.1 protein_id gnl|my_center|LOCUS_35380 6984 5626 gene locus_tag LOCUS_35390 gene glmU 6984 5626 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8C2 protein_id gnl|my_center|LOCUS_35390 9354 7225 gene locus_tag LOCUS_35400 9354 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 >Feature sequence157 <1 802 gene locus_tag LOCUS_35410 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816923.1:glycosyl transferase 925 2622 gene locus_tag LOCUS_35420 925 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 3089 3799 gene locus_tag LOCUS_35430 3089 3799 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072508.1 protein_id gnl|my_center|LOCUS_35430 3949 4137 gene locus_tag LOCUS_35440 3949 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 4440 5639 gene locus_tag LOCUS_35450 gene ackA 4440 5639 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC99 protein_id gnl|my_center|LOCUS_35450 5811 6626 gene locus_tag LOCUS_35460 5811 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 6629 7828 gene locus_tag LOCUS_35470 gene corA 6629 7828 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_35470 8140 8376 gene locus_tag LOCUS_35480 8140 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 >Feature sequence158 355 582 gene locus_tag LOCUS_35490 355 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 1862 819 gene locus_tag LOCUS_35500 gene sye4 1862 819 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073258.1 protein_id gnl|my_center|LOCUS_35500 2008 2589 gene locus_tag LOCUS_35510 2008 2589 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073259.1 protein_id gnl|my_center|LOCUS_35510 2662 3057 gene locus_tag LOCUS_35520 2662 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478908.1 protein_id gnl|my_center|LOCUS_35520 3319 5139 gene locus_tag LOCUS_35530 3319 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 5386 6486 gene locus_tag LOCUS_35540 5386 6486 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071377.1 protein_id gnl|my_center|LOCUS_35540 8920 6665 gene locus_tag LOCUS_35550 8920 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence159 467 1342 gene locus_tag LOCUS_35560 gene tus 467 1342 CDS product DNA replication terminus site-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FW31 protein_id gnl|my_center|LOCUS_35560 2548 1400 gene locus_tag LOCUS_35570 2548 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 3385 4623 gene locus_tag LOCUS_35580 gene parA 3385 4623 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074409.1 protein_id gnl|my_center|LOCUS_35580 4639 5601 gene locus_tag LOCUS_35590 4639 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 6014 9160 gene locus_tag LOCUS_35600 6014 9160 CDS product helicase/SNF2 family domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071804.1 protein_id gnl|my_center|LOCUS_35600 >Feature sequence160 949 4023 gene locus_tag LOCUS_35610 949 4023 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086886.1 protein_id gnl|my_center|LOCUS_35610 4016 4321 gene locus_tag LOCUS_35620 4016 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 5136 5420 gene locus_tag LOCUS_35630 5136 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 6148 5492 gene locus_tag LOCUS_35640 6148 5492 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421904.1 protein_id gnl|my_center|LOCUS_35640 6243 7211 gene locus_tag LOCUS_35650 6243 7211 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070762.1 protein_id gnl|my_center|LOCUS_35650 8753 7308 gene locus_tag LOCUS_35660 8753 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 >Feature sequence161 2979 277 gene locus_tag LOCUS_35670 gene fecA 2979 277 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_35670 4680 3076 gene locus_tag LOCUS_35680 4680 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918059.1 protein_id gnl|my_center|LOCUS_35680 6303 4996 gene locus_tag LOCUS_35690 6303 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829069.1 protein_id gnl|my_center|LOCUS_35690 6927 6322 gene locus_tag LOCUS_35700 6927 6322 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRU0 protein_id gnl|my_center|LOCUS_35700 7347 6937 gene locus_tag LOCUS_35710 7347 6937 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_35710 7925 7398 gene locus_tag LOCUS_35720 7925 7398 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_35720 <8957 7929 gene locus_tag LOCUS_35730 <8957 7929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071945.1:flagellar motor protein MotA >Feature sequence162 799 1524 gene locus_tag LOCUS_35740 gene cmoA 799 1524 CDS product carboxy-S-adenosyl-L-methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSU2 protein_id gnl|my_center|LOCUS_35740 1545 2513 gene locus_tag LOCUS_35750 gene cmoB 1545 2513 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIF5 protein_id gnl|my_center|LOCUS_35750 2714 3766 gene locus_tag LOCUS_35760 gene purM 2714 3766 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM24 protein_id gnl|my_center|LOCUS_35760 3766 4413 gene locus_tag LOCUS_35770 gene purN 3766 4413 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM25 protein_id gnl|my_center|LOCUS_35770 4433 5164 gene locus_tag LOCUS_35780 4433 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 6032 5268 gene locus_tag LOCUS_35790 6032 5268 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368120.1 protein_id gnl|my_center|LOCUS_35790 6332 8788 gene locus_tag LOCUS_35800 gene fadE 6332 8788 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705468.1 protein_id gnl|my_center|LOCUS_35800 >Feature sequence163 <1 645 gene locus_tag LOCUS_35810 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104453.1:3-phytase 1301 675 gene locus_tag LOCUS_35820 1301 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704776.1 protein_id gnl|my_center|LOCUS_35820 2352 1459 gene locus_tag LOCUS_35830 2352 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 2846 2514 gene locus_tag LOCUS_35840 2846 2514 CDS product zinc chelation protein SecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261999.1 protein_id gnl|my_center|LOCUS_35840 3828 2965 gene locus_tag LOCUS_35850 3828 2965 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073708.1 protein_id gnl|my_center|LOCUS_35850 4040 4258 gene locus_tag LOCUS_35860 4040 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 4343 5233 gene locus_tag LOCUS_35870 4343 5233 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106415.1 protein_id gnl|my_center|LOCUS_35870 5336 5704 gene locus_tag LOCUS_35880 5336 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 5701 6081 gene locus_tag LOCUS_35890 5701 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 6210 7844 gene locus_tag LOCUS_35900 6210 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070676.1 protein_id gnl|my_center|LOCUS_35900 8005 8571 gene locus_tag LOCUS_35910 8005 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 >Feature sequence164 222 791 gene locus_tag LOCUS_35920 222 791 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083508.1 protein_id gnl|my_center|LOCUS_35920 1243 797 gene locus_tag LOCUS_35930 1243 797 CDS product tellurium resistance terB-like protein subgroup 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074168.1 protein_id gnl|my_center|LOCUS_35930 1340 1711 gene locus_tag LOCUS_35940 1340 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 2308 1715 gene locus_tag LOCUS_35950 2308 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_35950 3414 2434 gene locus_tag LOCUS_35960 3414 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 4117 3518 gene locus_tag LOCUS_35970 gene leuD 4117 3518 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZI6 protein_id gnl|my_center|LOCUS_35970 5517 4117 gene locus_tag LOCUS_35980 gene leuC 5517 4117 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP81 protein_id gnl|my_center|LOCUS_35980 6669 5593 gene locus_tag LOCUS_35990 gene leuB 6669 5593 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGM8 protein_id gnl|my_center|LOCUS_35990 8219 6666 gene locus_tag LOCUS_36000 gene leuA 8219 6666 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGM9 protein_id gnl|my_center|LOCUS_36000 >Feature sequence165 856 1587 gene locus_tag LOCUS_36010 856 1587 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918668.1 protein_id gnl|my_center|LOCUS_36010 1990 2853 gene locus_tag LOCUS_36020 1990 2853 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 protein_id gnl|my_center|LOCUS_36020 2985 5393 gene locus_tag LOCUS_36030 gene ygcB 2985 5393 CDS product CRISPR-associated endonuclease/helicase Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38036 protein_id gnl|my_center|LOCUS_36030 5421 5966 gene locus_tag LOCUS_36040 gene casE 5421 5966 CDS product CRISPR system Cascade subunit CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46897 protein_id gnl|my_center|LOCUS_36040 5980 6396 gene locus_tag LOCUS_36050 5980 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 6444 7469 gene locus_tag LOCUS_36060 gene cse4 6444 7469 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942036.1 protein_id gnl|my_center|LOCUS_36060 7496 8143 gene locus_tag LOCUS_36070 7496 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 >Feature sequence166 107 475 gene locus_tag LOCUS_36080 107 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 562 1887 gene locus_tag LOCUS_36090 gene cusC 562 1887 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263307.1 protein_id gnl|my_center|LOCUS_36090 1877 3622 gene locus_tag LOCUS_36100 1877 3622 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482717.1 protein_id gnl|my_center|LOCUS_36100 3631 6753 gene locus_tag LOCUS_36110 gene cusA 3631 6753 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263309.1 protein_id gnl|my_center|LOCUS_36110 6881 7300 gene locus_tag LOCUS_36120 6881 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 7421 7867 gene locus_tag LOCUS_36130 7421 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 8134 8352 gene locus_tag LOCUS_36140 8134 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 >Feature sequence167 1823 462 gene locus_tag LOCUS_36150 1823 462 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482874.1 protein_id gnl|my_center|LOCUS_36150 2528 1902 gene locus_tag LOCUS_36160 gene sodA 2528 1902 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0F8 protein_id gnl|my_center|LOCUS_36160 3066 2560 gene locus_tag LOCUS_36170 3066 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 3648 3157 gene locus_tag LOCUS_36180 3648 3157 CDS product GCN5 family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454093.1 protein_id gnl|my_center|LOCUS_36180 8418 3676 gene locus_tag LOCUS_36190 8418 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 >Feature sequence168 2788 179 gene locus_tag LOCUS_36200 2788 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 3229 2849 gene locus_tag LOCUS_36210 3229 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 4636 3428 gene locus_tag LOCUS_36220 4636 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 5417 4629 gene locus_tag LOCUS_36230 5417 4629 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398469.1 protein_id gnl|my_center|LOCUS_36230 6223 5420 gene locus_tag LOCUS_36240 6223 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 6332 7957 gene locus_tag LOCUS_36250 6332 7957 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072703.1 protein_id gnl|my_center|LOCUS_36250 >Feature sequence169 <1 5163 gene locus_tag LOCUS_36260 <1 5163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582818.1:pectate lyase 6793 5774 gene locus_tag LOCUS_36270 6793 5774 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919363.1 protein_id gnl|my_center|LOCUS_36270 <8237 6984 gene locus_tag LOCUS_36280 <8237 6984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000378953.1:membrane protein >Feature sequence170 1700 810 gene locus_tag LOCUS_36290 1700 810 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068063.1 protein_id gnl|my_center|LOCUS_36290 2225 1701 gene locus_tag LOCUS_36300 2225 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106026.1 protein_id gnl|my_center|LOCUS_36300 3011 3616 gene locus_tag LOCUS_36310 3011 3616 CDS product tellurite resistance inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263037.1 protein_id gnl|my_center|LOCUS_36310 3609 6563 gene locus_tag LOCUS_36320 3609 6563 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894372.1 protein_id gnl|my_center|LOCUS_36320 7371 8144 gene locus_tag LOCUS_36330 7371 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 >Feature sequence171 1315 1043 gene locus_tag LOCUS_36340 1315 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 2496 2035 gene locus_tag LOCUS_36350 2496 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 5949 3124 gene locus_tag LOCUS_36360 gene uvrA 5949 3124 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EA79 protein_id gnl|my_center|LOCUS_36360 6114 7481 gene locus_tag LOCUS_36370 6114 7481 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073745.1 protein_id gnl|my_center|LOCUS_36370 7502 8227 gene locus_tag LOCUS_36380 7502 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 >Feature sequence172 2290 257 gene locus_tag LOCUS_36390 gene mnmC 2290 257 CDS product tRNA 5-methylaminomethyl-2-thiouridine biosynthesis bifunctional protein MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EJF7 protein_id gnl|my_center|LOCUS_36390 2459 3670 gene locus_tag LOCUS_36400 gene fabB 2459 3670 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420034.1 protein_id gnl|my_center|LOCUS_36400 3804 4898 gene locus_tag LOCUS_36410 gene pdxB 3804 4898 CDS product erythronate-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N5T2 protein_id gnl|my_center|LOCUS_36410 4950 5966 gene locus_tag LOCUS_36420 gene asd-2 4950 5966 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KLN9 protein_id gnl|my_center|LOCUS_36420 >Feature sequence173 88 2664 gene locus_tag LOCUS_36430 88 2664 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246690.1 protein_id gnl|my_center|LOCUS_36430 2772 4226 gene locus_tag LOCUS_36440 2772 4226 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530022.1 protein_id gnl|my_center|LOCUS_36440 5094 4180 gene locus_tag LOCUS_36450 5094 4180 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707407.1 protein_id gnl|my_center|LOCUS_36450 5218 6165 gene locus_tag LOCUS_36460 gene rlmF 5218 6165 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXI1 protein_id gnl|my_center|LOCUS_36460 6162 7175 gene locus_tag LOCUS_36470 6162 7175 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263355.1 protein_id gnl|my_center|LOCUS_36470 7742 7152 gene locus_tag LOCUS_36480 gene tdk 7742 7152 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87QJ8 protein_id gnl|my_center|LOCUS_36480 >Feature sequence174 465 2273 gene locus_tag LOCUS_36490 465 2273 CDS product sulfite reductase [NADPH] flavoprotein alpha-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNK9 protein_id gnl|my_center|LOCUS_36490 2342 4039 gene locus_tag LOCUS_36500 gene cysI 2342 4039 CDS product sulfite reductase [NADPH] hemoprotein beta-component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E840 protein_id gnl|my_center|LOCUS_36500 4083 4823 gene locus_tag LOCUS_36510 gene cysH 4083 4823 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z460 protein_id gnl|my_center|LOCUS_36510 4961 5695 gene locus_tag LOCUS_36520 4961 5695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 5730 6260 gene locus_tag LOCUS_36530 5730 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 7102 6257 gene locus_tag LOCUS_36540 7102 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 7349 7113 gene locus_tag LOCUS_36550 7349 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence175 90 14 gene locus_tag LOCUS_t00560 90 14 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 297 221 gene locus_tag LOCUS_t00570 297 221 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 646 1500 gene locus_tag LOCUS_36560 gene folD 646 1500 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Y1 protein_id gnl|my_center|LOCUS_36560 2457 1567 gene locus_tag LOCUS_36570 2457 1567 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477794.1 protein_id gnl|my_center|LOCUS_36570 4020 2641 gene locus_tag LOCUS_36580 gene cysS 4020 2641 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EG22 protein_id gnl|my_center|LOCUS_36580 4171 4662 gene locus_tag LOCUS_36590 4171 4662 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FSX1 protein_id gnl|my_center|LOCUS_36590 4752 5495 gene locus_tag LOCUS_36600 gene lpxH 4752 5495 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NL16 protein_id gnl|my_center|LOCUS_36600 5543 6322 gene locus_tag LOCUS_36610 5543 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 <7931 6371 gene locus_tag LOCUS_36620 <7931 6371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390269.1:PAS domain-containing sensor histidine kinase >Feature sequence176 963 1766 gene locus_tag LOCUS_36630 963 1766 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705600.1 protein_id gnl|my_center|LOCUS_36630 2642 1815 gene locus_tag LOCUS_36640 2642 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114256.1 protein_id gnl|my_center|LOCUS_36640 4511 2724 gene locus_tag LOCUS_36650 4511 2724 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895651.1 protein_id gnl|my_center|LOCUS_36650 5136 4606 gene locus_tag LOCUS_36660 5136 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36660 5986 5435 gene locus_tag LOCUS_36670 5986 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 6276 5956 gene locus_tag LOCUS_36680 6276 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 7582 6323 gene locus_tag LOCUS_36690 7582 6323 CDS product serine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463748.1 protein_id gnl|my_center|LOCUS_36690 >Feature sequence177 <1 4902 gene locus_tag LOCUS_36700 <1 4902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:GlyGly-CTERM sorting domain-containing protein 6437 4953 gene locus_tag LOCUS_36710 6437 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 7285 6434 gene locus_tag LOCUS_36720 7285 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 7700 7395 gene locus_tag LOCUS_36730 7700 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 >Feature sequence178 3554 837 gene locus_tag LOCUS_36740 gene iroN 3554 837 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035377.1 protein_id gnl|my_center|LOCUS_36740 4137 5024 gene locus_tag LOCUS_36750 4137 5024 CDS product pectinesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0B2 protein_id gnl|my_center|LOCUS_36750 5089 7173 gene locus_tag LOCUS_36760 5089 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 >Feature sequence179 1075 29 gene locus_tag LOCUS_36770 1075 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113385.1 protein_id gnl|my_center|LOCUS_36770 2555 1149 gene locus_tag LOCUS_36780 gene agcS-2 2555 1149 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706925.1 protein_id gnl|my_center|LOCUS_36780 2851 3459 gene locus_tag LOCUS_36790 2851 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 3539 4414 gene locus_tag LOCUS_36800 3539 4414 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529375.1 protein_id gnl|my_center|LOCUS_36800 5478 4498 gene locus_tag LOCUS_36810 5478 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 6713 5718 gene locus_tag LOCUS_36820 6713 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266144.1 protein_id gnl|my_center|LOCUS_36820 7635 6973 gene locus_tag LOCUS_36830 gene rhgT 7635 6973 CDS product rhamnogalacturonan acetylesterase RhgT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31523 protein_id gnl|my_center|LOCUS_36830 >Feature sequence180 1853 165 gene locus_tag LOCUS_36840 gene dld 1853 165 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CH75 protein_id gnl|my_center|LOCUS_36840 2259 1861 gene locus_tag LOCUS_36850 2259 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973855.1 protein_id gnl|my_center|LOCUS_36850 2847 2290 gene locus_tag LOCUS_36860 2847 2290 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973854.1 protein_id gnl|my_center|LOCUS_36860 3861 2977 gene locus_tag LOCUS_36870 3861 2977 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895491.1 protein_id gnl|my_center|LOCUS_36870 3976 4605 gene locus_tag LOCUS_36880 3976 4605 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861284.1 protein_id gnl|my_center|LOCUS_36880 4989 5996 gene locus_tag LOCUS_36890 4989 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 6014 6730 gene locus_tag LOCUS_36900 gene cobB 6014 6730 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67919 protein_id gnl|my_center|LOCUS_36900 >Feature sequence181 1889 66 gene locus_tag LOCUS_36910 1889 66 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211151.1 protein_id gnl|my_center|LOCUS_36910 2086 1907 gene locus_tag LOCUS_36920 2086 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 2410 3816 gene locus_tag LOCUS_36930 2410 3816 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TE8 protein_id gnl|my_center|LOCUS_36930 3934 4461 gene locus_tag LOCUS_36940 3934 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074099.1 protein_id gnl|my_center|LOCUS_36940 4552 5622 gene locus_tag LOCUS_36950 gene glnL 4552 5622 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478632.1 protein_id gnl|my_center|LOCUS_36950 5641 7026 gene locus_tag LOCUS_36960 gene ntrC 5641 7026 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260965.1 protein_id gnl|my_center|LOCUS_36960 >Feature sequence182 910 182 gene locus_tag LOCUS_36970 910 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 1949 1071 gene locus_tag LOCUS_36980 1949 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704306.1 protein_id gnl|my_center|LOCUS_36980 2264 1956 gene locus_tag LOCUS_36990 2264 1956 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704305.1 protein_id gnl|my_center|LOCUS_36990 3102 2365 gene locus_tag LOCUS_37000 gene bioH 3102 2365 CDS product pimeloyl-[acyl-carrier protein] methyl ester esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF11 protein_id gnl|my_center|LOCUS_37000 3161 3862 gene locus_tag LOCUS_37010 gene comF 3161 3862 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035643.1 protein_id gnl|my_center|LOCUS_37010 6431 3879 gene locus_tag LOCUS_37020 6431 3879 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_37020 6577 7152 gene locus_tag LOCUS_37030 gene nfuA 6577 7152 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E8P2 protein_id gnl|my_center|LOCUS_37030 >Feature sequence183 500 117 gene locus_tag LOCUS_37040 500 117 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947947.1 protein_id gnl|my_center|LOCUS_37040 810 1655 gene locus_tag LOCUS_37050 810 1655 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219805.1 protein_id gnl|my_center|LOCUS_37050 2029 1712 gene locus_tag LOCUS_37060 gene sugE 2029 1712 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 protein_id gnl|my_center|LOCUS_37060 3561 2029 gene locus_tag LOCUS_37070 3561 2029 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 protein_id gnl|my_center|LOCUS_37070 6161 3870 gene locus_tag LOCUS_37080 6161 3870 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009952308.1 protein_id gnl|my_center|LOCUS_37080 >Feature sequence184 945 583 gene locus_tag LOCUS_37090 945 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 1738 1073 gene locus_tag LOCUS_37100 gene fabG 1738 1073 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194184.1 protein_id gnl|my_center|LOCUS_37100 2648 1842 gene locus_tag LOCUS_37110 gene cfp32 2648 1842 CDS product putative glyoxylase CFP32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIR3 protein_id gnl|my_center|LOCUS_37110 3632 2922 gene locus_tag LOCUS_37120 3632 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 5555 3753 gene locus_tag LOCUS_37130 gene phoA 5555 3753 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_37130 7144 5555 gene locus_tag LOCUS_37140 gene phoA 7144 5555 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 protein_id gnl|my_center|LOCUS_37140 >Feature sequence185 457 843 gene locus_tag LOCUS_37150 457 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 2083 1064 gene locus_tag LOCUS_37160 2083 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37160 2899 2144 gene locus_tag LOCUS_37170 2899 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 3807 3085 gene locus_tag LOCUS_37180 3807 3085 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884094.1 protein_id gnl|my_center|LOCUS_37180 5138 3804 gene locus_tag LOCUS_37190 5138 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884099.1 protein_id gnl|my_center|LOCUS_37190 6003 5131 gene locus_tag LOCUS_37200 6003 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 >Feature sequence186 1780 152 gene locus_tag LOCUS_37210 1780 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 2534 1851 gene locus_tag LOCUS_37220 2534 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 2701 3378 gene locus_tag LOCUS_37230 gene dsbA 2701 3378 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJX3 protein_id gnl|my_center|LOCUS_37230 3359 3562 gene locus_tag LOCUS_37240 3359 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 3909 4583 gene locus_tag LOCUS_37250 3909 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 4697 5200 gene locus_tag LOCUS_37260 4697 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 5639 5214 gene locus_tag LOCUS_37270 5639 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 6160 5636 gene locus_tag LOCUS_37280 6160 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 6308 6598 gene locus_tag LOCUS_37290 6308 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 6639 7139 gene locus_tag LOCUS_37300 6639 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 >Feature sequence187 852 986 gene locus_tag LOCUS_37310 852 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 1178 2242 gene locus_tag LOCUS_37320 1178 2242 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_37320 2245 3228 gene locus_tag LOCUS_37330 2245 3228 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FN12 protein_id gnl|my_center|LOCUS_37330 4136 3309 gene locus_tag LOCUS_37340 4136 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123680.1 protein_id gnl|my_center|LOCUS_37340 4306 4827 gene locus_tag LOCUS_37350 4306 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 4824 5249 gene locus_tag LOCUS_37360 4824 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 5999 6826 gene locus_tag LOCUS_37370 gene dkgB 5999 6826 CDS product 2,5-diketo-D-gluconate reductase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704460.1 protein_id gnl|my_center|LOCUS_37370 6882 7169 gene locus_tag LOCUS_37380 6882 7169 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261920.1 protein_id gnl|my_center|LOCUS_37380 >Feature sequence188 <1 1656 gene locus_tag LOCUS_37390 <1 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230104.1:endo-1,3-beta-glucanase 1730 4723 gene locus_tag LOCUS_37400 gene iroN 1730 4723 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039035.1 protein_id gnl|my_center|LOCUS_37400 6269 4797 gene locus_tag LOCUS_37410 6269 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 >Feature sequence189 1586 12 gene locus_tag LOCUS_37420 1586 12 CDS product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477479.1 protein_id gnl|my_center|LOCUS_37420 2296 1727 gene locus_tag LOCUS_37430 gene ahpC 2296 1727 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071237.1 protein_id gnl|my_center|LOCUS_37430 2541 2960 gene locus_tag LOCUS_37440 2541 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 3018 3389 gene locus_tag LOCUS_37450 3018 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 3398 4201 gene locus_tag LOCUS_37460 3398 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 4204 5193 gene locus_tag LOCUS_37470 gene yulF 4204 5193 CDS product putative oxidoreductase YulF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05265 protein_id gnl|my_center|LOCUS_37470 >Feature sequence190 626 1603 gene locus_tag LOCUS_37480 626 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 protein_id gnl|my_center|LOCUS_37480 1635 2675 gene locus_tag LOCUS_37490 1635 2675 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_37490 6512 2931 gene locus_tag LOCUS_37500 6512 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 >Feature sequence191 730 2 gene locus_tag LOCUS_37510 730 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 925 1200 gene locus_tag LOCUS_37520 925 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 2286 1195 gene locus_tag LOCUS_37530 2286 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 3121 2465 gene locus_tag LOCUS_37540 3121 2465 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074052.1 protein_id gnl|my_center|LOCUS_37540 3210 4103 gene locus_tag LOCUS_37550 3210 4103 CDS product UPF0761 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEZ1 protein_id gnl|my_center|LOCUS_37550 4136 5089 gene locus_tag LOCUS_37560 gene pip 4136 5089 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYM6 protein_id gnl|my_center|LOCUS_37560 5077 5514 gene locus_tag LOCUS_37570 gene dtd 5077 5514 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44814 protein_id gnl|my_center|LOCUS_37570 6217 5528 gene locus_tag LOCUS_37580 6217 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence192 3402 2938 gene locus_tag LOCUS_37590 gene trmL 3402 2938 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEQ6 protein_id gnl|my_center|LOCUS_37590 3511 4422 gene locus_tag LOCUS_37600 gene fieF 3511 4422 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704209.1 protein_id gnl|my_center|LOCUS_37600 5351 4398 gene locus_tag LOCUS_37610 gene lypA 5351 4398 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074319.1 protein_id gnl|my_center|LOCUS_37610 6547 5354 gene locus_tag LOCUS_37620 gene cpxA 6547 5354 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074106.1 protein_id gnl|my_center|LOCUS_37620 >Feature sequence193 808 203 gene locus_tag LOCUS_37630 808 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 1342 1073 gene locus_tag LOCUS_37640 1342 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 1823 1347 gene locus_tag LOCUS_37650 1823 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 2125 2619 gene locus_tag LOCUS_37660 2125 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 3821 2616 gene locus_tag LOCUS_37670 gene anmK 3821 2616 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q184N9 protein_id gnl|my_center|LOCUS_37670 4023 6767 gene locus_tag LOCUS_37680 4023 6767 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_37680 >Feature sequence194 31 2181 gene locus_tag LOCUS_37690 31 2181 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073784.1 protein_id gnl|my_center|LOCUS_37690 3102 2224 gene locus_tag LOCUS_37700 3102 2224 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146407.1 protein_id gnl|my_center|LOCUS_37700 3214 4182 gene locus_tag LOCUS_37710 3214 4182 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617198.1 protein_id gnl|my_center|LOCUS_37710 5104 4247 gene locus_tag LOCUS_37720 5104 4247 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703507.1 protein_id gnl|my_center|LOCUS_37720 6588 5233 gene locus_tag LOCUS_37730 6588 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 >Feature sequence195 2423 1836 gene locus_tag LOCUS_37740 gene dcd 2423 1836 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CQW5 protein_id gnl|my_center|LOCUS_37740 3506 2427 gene locus_tag LOCUS_37750 3506 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 3683 5707 gene locus_tag LOCUS_37760 gene metG 3683 5707 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX2 protein_id gnl|my_center|LOCUS_37760 6080 6241 gene locus_tag LOCUS_37770 6080 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 >Feature sequence196 <1 622 gene locus_tag LOCUS_37780 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070729.1:sulfotransferase family protein 724 1296 gene locus_tag LOCUS_37790 724 1296 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104701.1 protein_id gnl|my_center|LOCUS_37790 4072 1370 gene locus_tag LOCUS_37800 4072 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 4654 4133 gene locus_tag LOCUS_37810 4654 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 5933 5421 gene locus_tag LOCUS_37820 5933 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 6105 6332 gene locus_tag LOCUS_37830 6105 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 >Feature sequence197 486 55 gene locus_tag LOCUS_37840 486 55 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532319.1 protein_id gnl|my_center|LOCUS_37840 615 1916 gene locus_tag LOCUS_37850 gene hmgA 615 1916 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDA2 protein_id gnl|my_center|LOCUS_37850 1924 2553 gene locus_tag LOCUS_37860 1924 2553 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930265.1 protein_id gnl|my_center|LOCUS_37860 2793 2560 gene locus_tag LOCUS_37870 2793 2560 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 protein_id gnl|my_center|LOCUS_37870 2975 3277 gene locus_tag LOCUS_37880 2975 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 3343 3609 gene locus_tag LOCUS_37890 3343 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076091.1 protein_id gnl|my_center|LOCUS_37890 5277 3652 gene locus_tag LOCUS_37900 5277 3652 CDS product diacylglycerol kinase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478677.1 protein_id gnl|my_center|LOCUS_37900 6553 5552 gene locus_tag LOCUS_37910 6553 5552 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002243977.1 protein_id gnl|my_center|LOCUS_37910 >Feature sequence198 1269 844 gene locus_tag LOCUS_37920 1269 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 1529 2560 gene locus_tag LOCUS_37930 1529 2560 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478363.1 protein_id gnl|my_center|LOCUS_37930 2602 3219 gene locus_tag LOCUS_37940 2602 3219 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478031.1 protein_id gnl|my_center|LOCUS_37940 3439 5061 gene locus_tag LOCUS_37950 3439 5061 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263384.1 protein_id gnl|my_center|LOCUS_37950 6075 5158 gene locus_tag LOCUS_37960 6075 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 >Feature sequence199 2221 602 gene locus_tag LOCUS_37970 2221 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 3840 2533 gene locus_tag LOCUS_37980 3840 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829069.1 protein_id gnl|my_center|LOCUS_37980 4479 3874 gene locus_tag LOCUS_37990 4479 3874 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRU0 protein_id gnl|my_center|LOCUS_37990 4900 4490 gene locus_tag LOCUS_38000 4900 4490 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_38000 5478 4951 gene locus_tag LOCUS_38010 5478 4951 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707201.1 protein_id gnl|my_center|LOCUS_38010 <6510 5482 gene locus_tag LOCUS_38020 <6510 5482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071945.1:flagellar motor protein MotA >Feature sequence200 <1 862 gene locus_tag LOCUS_38030 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942659.1:GGDEF domain-containing protein 1798 935 gene locus_tag LOCUS_38040 1798 935 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142129.1 protein_id gnl|my_center|LOCUS_38040 3504 1930 gene locus_tag LOCUS_38050 3504 1930 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070804.1 protein_id gnl|my_center|LOCUS_38050 3797 3501 gene locus_tag LOCUS_38060 3797 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070803.1 protein_id gnl|my_center|LOCUS_38060 4056 3787 gene locus_tag LOCUS_38070 4056 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 4178 6229 gene locus_tag LOCUS_38080 4178 6229 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074135.1 protein_id gnl|my_center|LOCUS_38080 >Feature sequence201 1594 2175 gene locus_tag LOCUS_38090 1594 2175 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073380.1 protein_id gnl|my_center|LOCUS_38090 2165 2794 gene locus_tag LOCUS_38100 2165 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 2882 3145 gene locus_tag LOCUS_38110 2882 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 3145 4365 gene locus_tag LOCUS_38120 3145 4365 CDS product hipA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232961.1 protein_id gnl|my_center|LOCUS_38120 <6374 4391 gene locus_tag LOCUS_38130 <6374 4391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015947.1:hemin receptor >Feature sequence202 419 862 gene locus_tag LOCUS_38140 419 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 859 1062 gene locus_tag LOCUS_38150 859 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 1059 1955 gene locus_tag LOCUS_38160 1059 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 2008 2334 gene locus_tag LOCUS_38170 2008 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 2355 2699 gene locus_tag LOCUS_38180 2355 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 2659 6057 gene locus_tag LOCUS_38190 2659 6057 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104844.1 protein_id gnl|my_center|LOCUS_38190 >Feature sequence203 1205 63 gene locus_tag LOCUS_38200 1205 63 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 protein_id gnl|my_center|LOCUS_38200 2651 1737 gene locus_tag LOCUS_38210 2651 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 3139 2876 gene locus_tag LOCUS_38220 3139 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 3567 3226 gene locus_tag LOCUS_38230 3567 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 4665 3625 gene locus_tag LOCUS_38240 4665 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 5256 4873 gene locus_tag LOCUS_38250 5256 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 <6287 5430 gene locus_tag LOCUS_38260 <6287 5430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070914.1:ATPase >Feature sequence204 3455 1023 gene locus_tag LOCUS_38270 3455 1023 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87NC2 protein_id gnl|my_center|LOCUS_38270 3474 5549 gene locus_tag LOCUS_38280 gene dinG 3474 5549 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071940.1 protein_id gnl|my_center|LOCUS_38280 >Feature sequence205 164 1237 gene locus_tag LOCUS_38290 164 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 1365 1745 gene locus_tag LOCUS_38300 1365 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 2611 3120 gene locus_tag LOCUS_38310 2611 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 4550 3195 gene locus_tag LOCUS_38320 4550 3195 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941624.1 protein_id gnl|my_center|LOCUS_38320 5373 5567 gene locus_tag LOCUS_38330 5373 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 5667 5921 gene locus_tag LOCUS_38340 5667 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 >Feature sequence206 154 229 gene locus_tag LOCUS_t00580 154 229 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 871 1338 gene locus_tag LOCUS_38350 871 1338 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_38350 3125 1830 gene locus_tag LOCUS_38360 gene nagP 3125 1830 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073342.1 protein_id gnl|my_center|LOCUS_38360 6030 3382 gene locus_tag LOCUS_38370 6030 3382 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914817.1 protein_id gnl|my_center|LOCUS_38370 >Feature sequence207 1414 215 gene locus_tag LOCUS_38380 1414 215 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261000.1 protein_id gnl|my_center|LOCUS_38380 2673 1408 gene locus_tag LOCUS_38390 gene wecC 2673 1408 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZAE4 protein_id gnl|my_center|LOCUS_38390 3981 2857 gene locus_tag LOCUS_38400 3981 2857 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756756.1 protein_id gnl|my_center|LOCUS_38400 <6182 4267 gene locus_tag LOCUS_38410 <6182 4267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104560.1:tyrosine protein kinase >Feature sequence208 261 1472 gene locus_tag LOCUS_38420 261 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 4634 1482 gene locus_tag LOCUS_38430 gene res 4634 1482 CDS product type III restriction-modification system restriction subunit Res inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070731.1 protein_id gnl|my_center|LOCUS_38430 5971 4958 gene locus_tag LOCUS_38440 5971 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888392.1 protein_id gnl|my_center|LOCUS_38440 >Feature sequence209 4193 3078 gene locus_tag LOCUS_38450 gene aba2 4193 3078 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207945.1 protein_id gnl|my_center|LOCUS_38450 4297 5184 gene locus_tag LOCUS_38460 4297 5184 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106356.1 protein_id gnl|my_center|LOCUS_38460 5579 5334 gene locus_tag LOCUS_38470 5579 5334 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071475.1 protein_id gnl|my_center|LOCUS_38470 >Feature sequence210 3839 543 gene locus_tag LOCUS_38480 3839 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 5478 3925 gene locus_tag LOCUS_38490 gene aer-2 5478 3925 CDS product aerotaxis receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103804.1 protein_id gnl|my_center|LOCUS_38490 >Feature sequence211 4199 2217 gene locus_tag LOCUS_38500 4199 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 5413 4196 gene locus_tag LOCUS_38510 5413 4196 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q07 protein_id gnl|my_center|LOCUS_38510 5929 5747 gene locus_tag LOCUS_38520 5929 5747 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263379.1 protein_id gnl|my_center|LOCUS_38520 >Feature sequence212 1971 1126 gene locus_tag LOCUS_38530 1971 1126 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172731.1 protein_id gnl|my_center|LOCUS_38530 2452 4899 gene locus_tag LOCUS_38540 2452 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 >Feature sequence213 1157 825 gene locus_tag LOCUS_38550 1157 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 2352 1957 gene locus_tag LOCUS_38560 2352 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 5487 2779 gene locus_tag LOCUS_38570 gene secA 5487 2779 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9Q5 protein_id gnl|my_center|LOCUS_38570 >Feature sequence214 131 541 gene locus_tag LOCUS_38580 131 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 3340 1823 gene locus_tag LOCUS_38590 3340 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 3835 3638 gene locus_tag LOCUS_38600 3835 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 3983 4414 gene locus_tag LOCUS_38610 3983 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 4396 5139 gene locus_tag LOCUS_38620 4396 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 5218 5373 gene locus_tag LOCUS_38630 5218 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 >Feature sequence215 2003 2752 gene locus_tag LOCUS_38640 2003 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 3876 3019 gene locus_tag LOCUS_38650 3876 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 5044 3899 gene locus_tag LOCUS_38660 5044 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 >Feature sequence216 1 459 gene locus_tag LOCUS_38670 gene gloA 1 459 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HU72 protein_id gnl|my_center|LOCUS_38670 1396 533 gene locus_tag LOCUS_38680 gene htpX 1396 533 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KID0 protein_id gnl|my_center|LOCUS_38680 2219 1536 gene locus_tag LOCUS_38690 gene bioD 2219 1536 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC9 protein_id gnl|my_center|LOCUS_38690 3056 2238 gene locus_tag LOCUS_38700 3056 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 4207 3053 gene locus_tag LOCUS_38710 gene bioF 4207 3053 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NA75 protein_id gnl|my_center|LOCUS_38710 5303 4263 gene locus_tag LOCUS_38720 gene bioB 5303 4263 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIC6 protein_id gnl|my_center|LOCUS_38720 >Feature sequence217 462 1709 gene locus_tag LOCUS_38730 462 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 1702 2373 gene locus_tag LOCUS_38740 1702 2373 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_38740 2374 4737 gene locus_tag LOCUS_38750 2374 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 4746 5195 gene locus_tag LOCUS_38760 4746 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 5197 5577 gene locus_tag LOCUS_38770 5197 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 >Feature sequence218 309 103 gene locus_tag LOCUS_38780 309 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 1316 306 gene locus_tag LOCUS_38790 1316 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38790 1794 1390 gene locus_tag LOCUS_38800 1794 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 3065 1842 gene locus_tag LOCUS_38810 3065 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 3293 4165 gene locus_tag LOCUS_38820 3293 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 4629 4369 gene locus_tag LOCUS_38830 4629 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 >Feature sequence219 1795 278 gene locus_tag LOCUS_38840 1795 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 4494 1855 gene locus_tag LOCUS_38850 gene fyuA 4494 1855 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038506.1 protein_id gnl|my_center|LOCUS_38850 5178 5038 gene locus_tag LOCUS_38860 5178 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 >Feature sequence220 467 4264 gene locus_tag LOCUS_38870 467 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 4276 4791 gene locus_tag LOCUS_38880 4276 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 >Feature sequence221 3206 129 gene locus_tag LOCUS_38890 gene oar 3206 129 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_38890 <5385 3481 gene locus_tag LOCUS_38900 <5385 3481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640052.1:Oar protein >Feature sequence222 321 3869 gene locus_tag LOCUS_38910 321 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 >Feature sequence223 558 986 gene locus_tag LOCUS_38920 558 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38920 1960 5124 gene locus_tag LOCUS_38930 gene oar 1960 5124 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence224 58 2127 gene locus_tag LOCUS_38940 gene pepO 58 2127 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070787.1 protein_id gnl|my_center|LOCUS_38940 2947 3822 gene locus_tag LOCUS_38950 2947 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070726.1 protein_id gnl|my_center|LOCUS_38950 3803 4945 gene locus_tag LOCUS_38960 3803 4945 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070727.1 protein_id gnl|my_center|LOCUS_38960 >Feature sequence225 204 1631 gene locus_tag LOCUS_38970 204 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 1615 4389 gene locus_tag LOCUS_38980 1615 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 >Feature sequence226 264 1175 gene locus_tag LOCUS_38990 264 1175 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490825.1 protein_id gnl|my_center|LOCUS_38990 1284 2198 gene locus_tag LOCUS_39000 1284 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 2200 2604 gene locus_tag LOCUS_39010 2200 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 2696 4207 gene locus_tag LOCUS_39020 2696 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 <5151 4282 gene locus_tag LOCUS_39030 <5151 4282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289537.1:LD-carboxypeptidase >Feature sequence227 721 32 gene locus_tag LOCUS_39040 gene neuA 721 32 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261007.1 protein_id gnl|my_center|LOCUS_39040 1692 718 gene locus_tag LOCUS_39050 1692 718 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261006.1 protein_id gnl|my_center|LOCUS_39050 2747 1689 gene locus_tag LOCUS_39060 2747 1689 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261005.1 protein_id gnl|my_center|LOCUS_39060 3397 2750 gene locus_tag LOCUS_39070 gene neuD 3397 2750 CDS product sialic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261004.1 protein_id gnl|my_center|LOCUS_39070 4460 3390 gene locus_tag LOCUS_39080 gene neuB 4460 3390 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261003.1 protein_id gnl|my_center|LOCUS_39080 <5141 4468 gene locus_tag LOCUS_39090 <5141 4468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005459665.1:UDP-N-acetyl glucosamine 2-epimerase >Feature sequence228 2690 456 gene locus_tag LOCUS_39100 gene wzc 2690 456 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261021.1 protein_id gnl|my_center|LOCUS_39100 3139 2705 gene locus_tag LOCUS_39110 gene etp 3139 2705 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261020.1 protein_id gnl|my_center|LOCUS_39110 4266 3148 gene locus_tag LOCUS_39120 gene gfcE 4266 3148 CDS product polysaccharide export protein Wza inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261018.1 protein_id gnl|my_center|LOCUS_39120 >Feature sequence229 713 441 gene locus_tag LOCUS_39130 713 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 1604 810 gene locus_tag LOCUS_39140 1604 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 2053 1733 gene locus_tag LOCUS_39150 2053 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 2524 2138 gene locus_tag LOCUS_39160 2524 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 3102 2638 gene locus_tag LOCUS_39170 3102 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 3526 3215 gene locus_tag LOCUS_39180 3526 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 4002 3631 gene locus_tag LOCUS_39190 4002 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 4620 4111 gene locus_tag LOCUS_39200 4620 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 >Feature sequence230 727 2133 gene locus_tag LOCUS_39210 727 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480236.1 protein_id gnl|my_center|LOCUS_39210 2146 3312 gene locus_tag LOCUS_39220 gene iadA 2146 3312 CDS product isoaspartyl dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y1L2 protein_id gnl|my_center|LOCUS_39220 4637 3339 gene locus_tag LOCUS_39230 gene ytfL 4637 3339 CDS product UPF0053 inner membrane protein YtfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AE45 protein_id gnl|my_center|LOCUS_39230 >Feature sequence231 514 227 gene locus_tag LOCUS_39240 514 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 739 990 gene locus_tag LOCUS_39250 gene rpmE2 739 990 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_309357.1 protein_id gnl|my_center|LOCUS_39250 993 1136 gene locus_tag LOCUS_39260 gene rpmJ 993 1136 CDS product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EDY2 protein_id gnl|my_center|LOCUS_39260 1598 1209 gene locus_tag LOCUS_39270 1598 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 1733 2827 gene locus_tag LOCUS_39280 1733 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 4662 2890 gene locus_tag LOCUS_39290 4662 2890 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 protein_id gnl|my_center|LOCUS_39290 >Feature sequence232 447 935 gene locus_tag LOCUS_39300 447 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 1500 1045 gene locus_tag LOCUS_39310 1500 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 1485 2666 gene locus_tag LOCUS_39320 1485 2666 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_39320 3587 2832 gene locus_tag LOCUS_39330 3587 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 >Feature sequence233 1575 511 gene locus_tag LOCUS_39340 1575 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 4618 1568 gene locus_tag LOCUS_39350 4618 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 >Feature sequence234 967 86 gene locus_tag LOCUS_39360 967 86 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073848.1 protein_id gnl|my_center|LOCUS_39360 1525 986 gene locus_tag LOCUS_39370 1525 986 CDS product phosphatidylethanolamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072051.1 protein_id gnl|my_center|LOCUS_39370 2657 1557 gene locus_tag LOCUS_39380 gene sye3 2657 1557 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073850.1 protein_id gnl|my_center|LOCUS_39380 3101 2697 gene locus_tag LOCUS_39390 3101 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 3214 4107 gene locus_tag LOCUS_39400 3214 4107 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479860.1 protein_id gnl|my_center|LOCUS_39400 >Feature sequence235 >Feature sequence236 2249 861 gene locus_tag LOCUS_39410 2249 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105656.1 protein_id gnl|my_center|LOCUS_39410 2553 2233 gene locus_tag LOCUS_39420 2553 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 3600 3265 gene locus_tag LOCUS_39430 3600 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 4144 3593 gene locus_tag LOCUS_39440 4144 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 >Feature sequence237 79 627 gene locus_tag LOCUS_39450 gene vspR 79 627 CDS product transcriptional regulator VspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVG9 protein_id gnl|my_center|LOCUS_39450 621 2000 gene locus_tag LOCUS_39460 621 2000 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106504.1 protein_id gnl|my_center|LOCUS_39460 2620 3003 gene locus_tag LOCUS_39470 2620 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 3384 3980 gene locus_tag LOCUS_39480 3384 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 >Feature sequence238 779 33 gene locus_tag LOCUS_39490 gene rlmB 779 33 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L11 protein_id gnl|my_center|LOCUS_39490 3271 776 gene locus_tag LOCUS_39500 gene rnr 3271 776 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG59 protein_id gnl|my_center|LOCUS_39500 4006 3392 gene locus_tag LOCUS_39510 4006 3392 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070716.1 protein_id gnl|my_center|LOCUS_39510 >Feature sequence239 669 1259 gene locus_tag LOCUS_39520 gene petA 669 1259 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPZ1 protein_id gnl|my_center|LOCUS_39520 1259 2524 gene locus_tag LOCUS_39530 1259 2524 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUE7 protein_id gnl|my_center|LOCUS_39530 2521 3264 gene locus_tag LOCUS_39540 2521 3264 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758871.1 protein_id gnl|my_center|LOCUS_39540 3344 3970 gene locus_tag LOCUS_39550 gene sspA 3344 3970 CDS product stringent starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707594.1 protein_id gnl|my_center|LOCUS_39550 3970 4410 gene locus_tag LOCUS_39560 gene sspB 3970 4410 CDS product stringent starvation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707593.1 protein_id gnl|my_center|LOCUS_39560 >Feature sequence240 617 1462 gene locus_tag LOCUS_39570 gene nadC 617 1462 CDS product nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707567.1 protein_id gnl|my_center|LOCUS_39570 1999 2424 gene locus_tag LOCUS_39580 gene pilE 1999 2424 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947632.1 protein_id gnl|my_center|LOCUS_39580 2440 2871 gene locus_tag LOCUS_39590 2440 2871 CDS product pilin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707568.1 protein_id gnl|my_center|LOCUS_39590 3460 2852 gene locus_tag LOCUS_39600 3460 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 >Feature sequence241 283 576 gene locus_tag LOCUS_39610 283 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 589 1110 gene locus_tag LOCUS_39620 589 1110 CDS product microcystin dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039263.1 protein_id gnl|my_center|LOCUS_39620 1122 1646 gene locus_tag LOCUS_39630 1122 1646 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_39630 1658 2191 gene locus_tag LOCUS_39640 1658 2191 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_39640 2337 3659 gene locus_tag LOCUS_39650 2337 3659 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070583.1 protein_id gnl|my_center|LOCUS_39650 >Feature sequence242 1562 555 gene locus_tag LOCUS_39660 1562 555 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KT26 protein_id gnl|my_center|LOCUS_39660 2372 1575 gene locus_tag LOCUS_39670 2372 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945980.1 protein_id gnl|my_center|LOCUS_39670 <4389 2378 gene locus_tag LOCUS_39680 <4389 2378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KRQ4:UPF0753 protein >Feature sequence243 244 648 gene locus_tag LOCUS_39690 244 648 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 protein_id gnl|my_center|LOCUS_39690 1217 747 gene locus_tag LOCUS_39700 1217 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704152.1 protein_id gnl|my_center|LOCUS_39700 2230 1418 gene locus_tag LOCUS_39710 2230 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 2467 3996 gene locus_tag LOCUS_39720 2467 3996 CDS product chemotaxis transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112293.1 protein_id gnl|my_center|LOCUS_39720 >Feature sequence244 266 865 gene locus_tag LOCUS_39730 266 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 1680 1886 gene locus_tag LOCUS_39740 1680 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 2122 2298 gene locus_tag LOCUS_39750 2122 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 2291 2581 gene locus_tag LOCUS_39760 2291 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 2684 3052 gene locus_tag LOCUS_39770 2684 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39770 3394 3209 gene locus_tag LOCUS_39780 3394 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 3865 4086 gene locus_tag LOCUS_39790 3865 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 >Feature sequence245 750 1007 gene locus_tag LOCUS_39800 750 1007 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5DZS6 protein_id gnl|my_center|LOCUS_39800 995 1294 gene locus_tag LOCUS_39810 995 1294 CDS product plasmid stabilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074235.1 protein_id gnl|my_center|LOCUS_39810 1610 2125 gene locus_tag LOCUS_39820 1610 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 2303 2425 gene locus_tag LOCUS_39830 2303 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 2675 3670 gene locus_tag LOCUS_39840 2675 3670 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208462.1 protein_id gnl|my_center|LOCUS_39840 3754 4131 gene locus_tag LOCUS_39850 3754 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 >Feature sequence246 592 942 gene locus_tag LOCUS_39860 592 942 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261014.1 protein_id gnl|my_center|LOCUS_39860 1200 3356 gene locus_tag LOCUS_39870 1200 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 >Feature sequence247 61 633 gene locus_tag LOCUS_39880 61 633 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483028.1 protein_id gnl|my_center|LOCUS_39880 742 1446 gene locus_tag LOCUS_39890 742 1446 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212157.1 protein_id gnl|my_center|LOCUS_39890 1537 3261 gene locus_tag LOCUS_39900 gene proS 1537 3261 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECI8 protein_id gnl|my_center|LOCUS_39900 >Feature sequence248 <1 1659 gene locus_tag LOCUS_39910 <1 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JKQ7:chaperone protein HscA 1671 2009 gene locus_tag LOCUS_39920 gene fdx 1671 2009 CDS product ferredoxin, 2Fe-2S type, ISC system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005299781.1 protein_id gnl|my_center|LOCUS_39920 2444 3871 gene locus_tag LOCUS_39930 2444 3871 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706799.1 protein_id gnl|my_center|LOCUS_39930 >Feature sequence249 2048 591 gene locus_tag LOCUS_39940 2048 591 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704412.1 protein_id gnl|my_center|LOCUS_39940 2972 2250 gene locus_tag LOCUS_39950 2972 2250 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706972.1 protein_id gnl|my_center|LOCUS_39950 >Feature sequence250 431 868 gene locus_tag LOCUS_39960 gene zntR 431 868 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285589.1 protein_id gnl|my_center|LOCUS_39960 865 3108 gene locus_tag LOCUS_39970 865 3108 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958271.1 protein_id gnl|my_center|LOCUS_39970 3131 3484 gene locus_tag LOCUS_39980 3131 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 >Feature sequence251 482 1549 gene locus_tag LOCUS_39990 482 1549 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168631.1 protein_id gnl|my_center|LOCUS_39990 1552 2904 gene locus_tag LOCUS_40000 1552 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 2909 3478 gene locus_tag LOCUS_40010 2909 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 >Feature sequence252 234 974 gene locus_tag LOCUS_40020 234 974 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369139.1 protein_id gnl|my_center|LOCUS_40020 1037 1861 gene locus_tag LOCUS_40030 1037 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 1912 2232 gene locus_tag LOCUS_40040 1912 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072363.1 protein_id gnl|my_center|LOCUS_40040 3114 2221 gene locus_tag LOCUS_40050 3114 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 protein_id gnl|my_center|LOCUS_40050 >Feature sequence253 827 705 gene locus_tag LOCUS_40060 827 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 1226 1092 gene locus_tag LOCUS_40070 1226 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 1443 1285 gene locus_tag LOCUS_40080 1443 1285 CDS product UPF0057 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5W9 protein_id gnl|my_center|LOCUS_40080 2071 1508 gene locus_tag LOCUS_40090 2071 1508 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478674.1 protein_id gnl|my_center|LOCUS_40090 2415 3071 gene locus_tag LOCUS_40100 2415 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950792.1 protein_id gnl|my_center|LOCUS_40100 3267 3109 gene locus_tag LOCUS_40110 3267 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 3874 3458 gene locus_tag LOCUS_40120 3874 3458 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460412.1 protein_id gnl|my_center|LOCUS_40120 >Feature sequence254 1023 3425 gene locus_tag LOCUS_40130 1023 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 >Feature sequence255 914 375 gene locus_tag LOCUS_40140 gene hscB 914 375 CDS product co-chaperone protein HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTX9 protein_id gnl|my_center|LOCUS_40140 1318 995 gene locus_tag LOCUS_40150 1318 995 CDS product iron-binding protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87S26 protein_id gnl|my_center|LOCUS_40150 1712 1329 gene locus_tag LOCUS_40160 gene iscU 1712 1329 CDS product iron-sulfur cluster assembly scaffold protein IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEU8 protein_id gnl|my_center|LOCUS_40160 2970 1753 gene locus_tag LOCUS_40170 gene iscS 2970 1753 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CNC4 protein_id gnl|my_center|LOCUS_40170 3485 2994 gene locus_tag LOCUS_40180 gene iscR 3485 2994 CDS product HTH-type transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WD07 protein_id gnl|my_center|LOCUS_40180 >Feature sequence256 37 1224 gene locus_tag LOCUS_40190 37 1224 CDS product periplasmic siderophore cleavage esterase IroE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 protein_id gnl|my_center|LOCUS_40190 1489 1893 gene locus_tag LOCUS_40200 1489 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208381.1 protein_id gnl|my_center|LOCUS_40200 1890 2831 gene locus_tag LOCUS_40210 1890 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 >Feature sequence257 1388 702 gene locus_tag LOCUS_40220 gene nfi 1388 702 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZX0 protein_id gnl|my_center|LOCUS_40220 1873 2118 gene locus_tag LOCUS_40230 1873 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 2694 3551 gene locus_tag LOCUS_40240 2694 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 >Feature sequence258 755 1060 gene locus_tag LOCUS_40250 755 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 1392 1111 gene locus_tag LOCUS_40260 1392 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 1633 2499 gene locus_tag LOCUS_40270 1633 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 2771 3535 gene locus_tag LOCUS_40280 2771 3535 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881385.1 protein_id gnl|my_center|LOCUS_40280 >Feature sequence259 1759 488 gene locus_tag LOCUS_40290 1759 488 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 protein_id gnl|my_center|LOCUS_40290 2587 1826 gene locus_tag LOCUS_40300 gene rpfD 2587 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037021.1 protein_id gnl|my_center|LOCUS_40300 >Feature sequence260 1597 2016 gene locus_tag LOCUS_40310 1597 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 2119 2451 gene locus_tag LOCUS_40320 2119 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 2466 3554 gene locus_tag LOCUS_40330 2466 3554 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208292.1 protein_id gnl|my_center|LOCUS_40330 >Feature sequence261 <1 1404 gene locus_tag LOCUS_40340 <1 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122048.1:two-component system sensor histidine kinase/response regulator 1851 1390 gene locus_tag LOCUS_40350 gene b4373 1851 1390 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WJN3 protein_id gnl|my_center|LOCUS_40350 2146 1838 gene locus_tag LOCUS_40360 2146 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 2288 2212 gene locus_tag LOCUS_t00590 2288 2212 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 <3798 2768 gene locus_tag LOCUS_40370 <3798 2768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263736.1:MATE family efflux transporter >Feature sequence262 164 577 gene locus_tag LOCUS_40380 164 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 700 1314 gene locus_tag LOCUS_40390 700 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 1837 1601 gene locus_tag LOCUS_40400 1837 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 1987 2787 gene locus_tag LOCUS_40410 1987 2787 CDS product putative acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701157.1 protein_id gnl|my_center|LOCUS_40410 3613 3158 gene locus_tag LOCUS_40420 gene yuxK 3613 3158 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_40420 >Feature sequence263 1982 2572 gene locus_tag LOCUS_40430 1982 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 2569 3684 gene locus_tag LOCUS_40440 2569 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 >Feature sequence264 1982 2572 gene locus_tag LOCUS_40450 1982 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 2569 3684 gene locus_tag LOCUS_40460 2569 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 >Feature sequence265 3 1136 gene locus_tag LOCUS_40470 gene bkdA1 3 1136 CDS product 3-methyl-2-oxobutanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072330.1 protein_id gnl|my_center|LOCUS_40470 1136 2113 gene locus_tag LOCUS_40480 gene bkdA2 1136 2113 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072331.1 protein_id gnl|my_center|LOCUS_40480 >Feature sequence266 <1 2736 gene locus_tag LOCUS_40490 <1 2736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CPC5:nuclease SbcCD subunit C 2737 2904 gene locus_tag LOCUS_40500 2737 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 3587 3108 gene locus_tag LOCUS_40510 3587 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 >Feature sequence267 1809 1567 gene locus_tag LOCUS_40520 1809 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 2897 1809 gene locus_tag LOCUS_40530 2897 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 <3646 2894 gene locus_tag LOCUS_40540 <3646 2894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001255219.1:N-acetylneuraminic acid synthase >Feature sequence268 269 1033 gene locus_tag LOCUS_40550 gene kduD 269 1033 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50842 protein_id gnl|my_center|LOCUS_40550 1057 1899 gene locus_tag LOCUS_40560 gene kduI 1057 1899 CDS product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K4 protein_id gnl|my_center|LOCUS_40560 2034 2918 gene locus_tag LOCUS_40570 2034 2918 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_40570 2928 3416 gene locus_tag LOCUS_40580 2928 3416 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001323190.1 protein_id gnl|my_center|LOCUS_40580 >Feature sequence269 402 280 gene locus_tag LOCUS_40590 402 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 943 503 gene locus_tag LOCUS_40600 943 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 2215 2066 gene locus_tag LOCUS_40610 2215 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 2810 2505 gene locus_tag LOCUS_40620 2810 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 >Feature sequence270 551 1132 gene locus_tag LOCUS_40630 551 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 1193 1567 gene locus_tag LOCUS_40640 1193 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 1681 2220 gene locus_tag LOCUS_40650 1681 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 2338 3315 gene locus_tag LOCUS_40660 2338 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 >Feature sequence271 331 960 gene locus_tag LOCUS_40670 gene degU 331 960 CDS product transcriptional regulatory protein DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13800 protein_id gnl|my_center|LOCUS_40670 947 2536 gene locus_tag LOCUS_40680 gene uhpB 947 2536 CDS product two-component system sensor histidine kinase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978420.1 protein_id gnl|my_center|LOCUS_40680 3075 2533 gene locus_tag LOCUS_40690 3075 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 >Feature sequence272 1655 1978 gene locus_tag LOCUS_40700 1655 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 2411 2220 gene locus_tag LOCUS_40710 2411 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 2905 2513 gene locus_tag LOCUS_40720 2905 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 >Feature sequence273 351 3245 gene locus_tag LOCUS_40730 gene rapA 351 3245 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LD0 protein_id gnl|my_center|LOCUS_40730 >Feature sequence274 89 2044 gene locus_tag LOCUS_40740 gene wbfY 89 2044 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073058.1 protein_id gnl|my_center|LOCUS_40740 >Feature sequence275 2986 2567 gene locus_tag LOCUS_40750 2986 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 3453 3070 gene locus_tag LOCUS_40760 3453 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263155.1 protein_id gnl|my_center|LOCUS_40760 >Feature sequence276 2993 2565 gene locus_tag LOCUS_40770 2993 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 3453 3070 gene locus_tag LOCUS_40780 3453 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263155.1 protein_id gnl|my_center|LOCUS_40780 >Feature sequence277 473 961 gene locus_tag LOCUS_40790 473 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 >Feature sequence278 <3396 1208 gene locus_tag LOCUS_40800 <3396 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072483.1:TonB-dependent receptor >Feature sequence279 360 1190 gene locus_tag LOCUS_40810 360 1190 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927682.1 protein_id gnl|my_center|LOCUS_40810 1313 1771 gene locus_tag LOCUS_40820 1313 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 1856 2320 gene locus_tag LOCUS_40830 1856 2320 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957571.1 protein_id gnl|my_center|LOCUS_40830 2688 2356 gene locus_tag LOCUS_40840 2688 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 3328 2861 gene locus_tag LOCUS_40850 3328 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40850 >Feature sequence280 852 1949 gene locus_tag LOCUS_40860 gene ftsZ 852 1949 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FWC4 protein_id gnl|my_center|LOCUS_40860 1988 2356 gene locus_tag LOCUS_40870 1988 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 2382 3047 gene locus_tag LOCUS_40880 2382 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 >Feature sequence281 2938 236 gene locus_tag LOCUS_40890 2938 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 >Feature sequence282 58 1218 gene locus_tag LOCUS_40900 58 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_40900 1224 1715 gene locus_tag LOCUS_40910 1224 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 <3328 1786 gene locus_tag LOCUS_40920 <3328 1786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JNI9:cytosine-specific methyltransferase >Feature sequence283 940 518 gene locus_tag LOCUS_40930 940 518 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225249.1 protein_id gnl|my_center|LOCUS_40930 >Feature sequence284 554 1027 gene locus_tag LOCUS_40940 554 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 1089 2441 gene locus_tag LOCUS_40950 1089 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 <3259 2621 gene locus_tag LOCUS_40960 <3259 2621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072286.1:IS630 family transposase >Feature sequence285 59 466 gene locus_tag LOCUS_40970 59 466 CDS product aldehyde-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528467.1 protein_id gnl|my_center|LOCUS_40970 1013 495 gene locus_tag LOCUS_40980 1013 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 1324 2217 gene locus_tag LOCUS_40990 1324 2217 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_40990 <3251 2226 gene locus_tag LOCUS_41000 <3251 2226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097065.1:cyanate transporter >Feature sequence286 1531 515 gene locus_tag LOCUS_41010 gene sohB 1531 515 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072837.1 protein_id gnl|my_center|LOCUS_41010 <3196 1628 gene locus_tag LOCUS_41020 <3196 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072838.1:lipase >Feature sequence287 629 39 gene locus_tag LOCUS_41030 629 39 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED46 protein_id gnl|my_center|LOCUS_41030 853 1578 gene locus_tag LOCUS_41040 853 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 1887 1633 gene locus_tag LOCUS_41050 1887 1633 CDS product DUF2999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071035.1 protein_id gnl|my_center|LOCUS_41050 2912 1950 gene locus_tag LOCUS_41060 2912 1950 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_41060 >Feature sequence288 365 886 gene locus_tag LOCUS_41070 365 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41070 1365 2255 gene locus_tag LOCUS_41080 1365 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 >Feature sequence289 267 854 gene locus_tag LOCUS_41090 267 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 1411 2736 gene locus_tag LOCUS_41100 1411 2736 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104252.1 protein_id gnl|my_center|LOCUS_41100 >Feature sequence290 493 149 gene locus_tag LOCUS_41110 493 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 1025 525 gene locus_tag LOCUS_41120 1025 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 1808 1059 gene locus_tag LOCUS_41130 1808 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 >Feature sequence291 517 314 gene locus_tag LOCUS_41140 517 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 784 2208 gene locus_tag LOCUS_41150 784 2208 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477199.1 protein_id gnl|my_center|LOCUS_41150 2205 2834 gene locus_tag LOCUS_41160 2205 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477352.1 protein_id gnl|my_center|LOCUS_41160 >Feature sequence292 819 202 gene locus_tag LOCUS_41170 819 202 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072049.1 protein_id gnl|my_center|LOCUS_41170 1114 2169 gene locus_tag LOCUS_41180 1114 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706622.1 protein_id gnl|my_center|LOCUS_41180 2169 2879 gene locus_tag LOCUS_41190 gene hda 2169 2879 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XEQ0 protein_id gnl|my_center|LOCUS_41190 >Feature sequence293 192 719 gene locus_tag LOCUS_41200 192 719 CDS product UPF0307 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRH2 protein_id gnl|my_center|LOCUS_41200 2872 1502 gene locus_tag LOCUS_41210 gene nagA 2872 1502 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_41210 >Feature sequence294 1981 407 gene locus_tag LOCUS_41220 1981 407 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261722.1 protein_id gnl|my_center|LOCUS_41220 <2900 2306 gene locus_tag LOCUS_41230 <2900 2306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478031.1:glutathione S-transferase >Feature sequence295 29 115 gene locus_tag LOCUS_t00600 29 115 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2479 1058 gene locus_tag LOCUS_41240 gene agcS-2 2479 1058 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706925.1 protein_id gnl|my_center|LOCUS_41240 >Feature sequence296 238 1110 gene locus_tag LOCUS_41250 238 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 1540 1004 gene locus_tag LOCUS_41260 1540 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 1724 2188 gene locus_tag LOCUS_41270 1724 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 <2888 2217 gene locus_tag LOCUS_41280 <2888 2217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005458327.1:endonuclease I >Feature sequence297 >Feature sequence298 26 542 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcagccccgtgagtacggggaacac 927 625 gene locus_tag LOCUS_41290 927 625 CDS product type I-E CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062282.1 protein_id gnl|my_center|LOCUS_41290 1857 937 gene locus_tag LOCUS_41300 gene ygbT 1857 937 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46896 protein_id gnl|my_center|LOCUS_41300 >Feature sequence299 777 2051 gene locus_tag LOCUS_41310 777 2051 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459079.1 protein_id gnl|my_center|LOCUS_41310 2099 2707 gene locus_tag LOCUS_41320 2099 2707 CDS product paraquat-inducible membrane protein PqiA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074296.1 protein_id gnl|my_center|LOCUS_41320 >Feature sequence300 603 1328 gene locus_tag LOCUS_41330 gene spsF 603 1328 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965489.1 protein_id gnl|my_center|LOCUS_41330 1397 2344 gene locus_tag LOCUS_41340 gene wcaG 1397 2344 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125474.1 protein_id gnl|my_center|LOCUS_41340 >Feature sequence301 111 830 gene locus_tag LOCUS_41350 111 830 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072507.1 protein_id gnl|my_center|LOCUS_41350 1034 1495 gene locus_tag LOCUS_41360 1034 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 2761 1862 gene locus_tag LOCUS_41370 2761 1862 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 protein_id gnl|my_center|LOCUS_41370 >Feature sequence302 1399 971 gene locus_tag LOCUS_41380 1399 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 2131 1859 gene locus_tag LOCUS_41390 2131 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 >Feature sequence303 253 804 gene locus_tag LOCUS_41400 253 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 2069 2662 gene locus_tag LOCUS_41410 gene trmH 2069 2662 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67577 protein_id gnl|my_center|LOCUS_41410 >Feature sequence304 194 2113 gene locus_tag LOCUS_41420 194 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 2247 2582 gene locus_tag LOCUS_41430 2247 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 >Feature sequence305 760 1365 gene locus_tag LOCUS_41440 760 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 1408 1944 gene locus_tag LOCUS_41450 1408 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 2012 2365 gene locus_tag LOCUS_41460 2012 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 >Feature sequence306 274 696 gene locus_tag LOCUS_41470 274 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 804 1535 gene locus_tag LOCUS_41480 804 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 1608 2054 gene locus_tag LOCUS_41490 1608 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 2417 2100 gene locus_tag LOCUS_41500 2417 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 2662 2417 gene locus_tag LOCUS_41510 gene ccdA 2662 2417 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817080.1 protein_id gnl|my_center|LOCUS_41510 >Feature sequence307 923 279 gene locus_tag LOCUS_41520 gene pyrE 923 279 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87T92 protein_id gnl|my_center|LOCUS_41520 1657 944 gene locus_tag LOCUS_41530 gene rph 1657 944 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9L4 protein_id gnl|my_center|LOCUS_41530 >Feature sequence308 943 188 gene locus_tag LOCUS_41540 943 188 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_41540 1029 1985 gene locus_tag LOCUS_41550 1029 1985 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099205.1 protein_id gnl|my_center|LOCUS_41550 >Feature sequence309 373 1134 gene locus_tag LOCUS_41560 373 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 1202 1750 gene locus_tag LOCUS_41570 1202 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 2055 1861 gene locus_tag LOCUS_41580 2055 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 >Feature sequence310 <2610 120 gene locus_tag LOCUS_41590 <2610 120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039035.1:TonB-dependent receptor >Feature sequence311 1073 216 gene locus_tag LOCUS_41600 gene rsmI 1073 216 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45298 protein_id gnl|my_center|LOCUS_41600 >Feature sequence312 766 11 gene locus_tag LOCUS_41610 766 11 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_41610 852 1808 gene locus_tag LOCUS_41620 852 1808 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099205.1 protein_id gnl|my_center|LOCUS_41620 >Feature sequence313 139 333 gene locus_tag LOCUS_41630 139 333 CDS product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001894924.1 protein_id gnl|my_center|LOCUS_41630 >Feature sequence314 585 265 gene locus_tag LOCUS_41640 585 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 1156 689 gene locus_tag LOCUS_41650 1156 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 1614 1261 gene locus_tag LOCUS_41660 1614 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 1931 1662 gene locus_tag LOCUS_41670 1931 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 2055 1921 gene locus_tag LOCUS_41680 2055 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41680 2422 2048 gene locus_tag LOCUS_41690 2422 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 >Feature sequence315 1659 391 gene locus_tag LOCUS_41700 1659 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 >Feature sequence316 1342 692 gene locus_tag LOCUS_41710 1342 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41710 1791 1546 gene locus_tag LOCUS_41720 1791 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_41720 >Feature sequence317 551 1219 gene locus_tag LOCUS_41730 551 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41730 2277 1498 gene locus_tag LOCUS_41740 2277 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 >Feature sequence318 1164 1700 gene locus_tag LOCUS_41750 1164 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 1774 2121 gene locus_tag LOCUS_41760 1774 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 >Feature sequence319 <1 974 gene locus_tag LOCUS_41770 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478321.1:Ktr system potassium transporter B 1823 1089 gene locus_tag LOCUS_41780 1823 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 >Feature sequence320 1093 227 gene locus_tag LOCUS_41790 1093 227 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455527.1 protein_id gnl|my_center|LOCUS_41790 1198 2085 gene locus_tag LOCUS_41800 1198 2085 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464957.1 protein_id gnl|my_center|LOCUS_41800 >Feature sequence321 2 1912 gene locus_tag LOCUS_41810 gene cad 2 1912 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181836.1 protein_id gnl|my_center|LOCUS_41810 >Feature sequence322 1018 440 gene locus_tag LOCUS_41820 1018 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 1585 1046 gene locus_tag LOCUS_41830 1585 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 1994 1707 gene locus_tag LOCUS_41840 1994 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 >Feature sequence323 >Feature sequence324 1984 1655 gene locus_tag LOCUS_41850 1984 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 >Feature sequence325 321 458 gene locus_tag LOCUS_41860 321 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 563 1141 gene locus_tag LOCUS_41870 563 1141 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071042.1 protein_id gnl|my_center|LOCUS_41870 1423 1265 gene locus_tag LOCUS_41880 1423 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 1392 1601 gene locus_tag LOCUS_41890 1392 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 >Feature sequence326 390 509 gene locus_tag LOCUS_41900 390 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 506 2182 gene locus_tag LOCUS_41910 506 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 >Feature sequence327 <1 1125 gene locus_tag LOCUS_41920 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125473.1:ADP-heptose synthase 1122 1820 gene locus_tag LOCUS_41930 gene gcd1 1122 1820 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774263.1 protein_id gnl|my_center|LOCUS_41930 >Feature sequence328 623 1939 gene locus_tag LOCUS_41940 623 1939 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483370.1 protein_id gnl|my_center|LOCUS_41940 >Feature sequence329 >Feature sequence330 <2195 1590 gene locus_tag LOCUS_41950 <2195 1590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762308.1:ABC transporter ATP-binding protein >Feature sequence331 969 46 gene locus_tag LOCUS_41960 969 46 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132828.1 protein_id gnl|my_center|LOCUS_41960 1119 2021 gene locus_tag LOCUS_41970 1119 2021 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462828.1 protein_id gnl|my_center|LOCUS_41970 >Feature sequence332 300 728 gene locus_tag LOCUS_41980 300 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 >Feature sequence333 1208 234 gene locus_tag LOCUS_41990 1208 234 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071997.1 protein_id gnl|my_center|LOCUS_41990 2097 1618 gene locus_tag LOCUS_42000 2097 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 >Feature sequence334 596 1750 gene locus_tag LOCUS_42010 596 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 >Feature sequence335 1575 511 gene locus_tag LOCUS_42020 gene tnpA 1575 511 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213218.1 protein_id gnl|my_center|LOCUS_42020 2057 1551 gene locus_tag LOCUS_42030 2057 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 >Feature sequence336 1885 1115 gene locus_tag LOCUS_42040 gene srlR 1885 1115 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005339356.1 protein_id gnl|my_center|LOCUS_42040 >Feature sequence337 216 437 gene locus_tag LOCUS_42050 216 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 527 1096 gene locus_tag LOCUS_42060 527 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 1187 1375 gene locus_tag LOCUS_42070 1187 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 <2100 1447 gene locus_tag LOCUS_42080 <2100 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263746.1:mechanosensitive ion channel protein MscS >Feature sequence338 478 1011 gene locus_tag LOCUS_42090 478 1011 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482440.1 protein_id gnl|my_center|LOCUS_42090 1063 1506 gene locus_tag LOCUS_42100 1063 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 protein_id gnl|my_center|LOCUS_42100 >Feature sequence339 786 1925 gene locus_tag LOCUS_42110 786 1925 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706804.1 protein_id gnl|my_center|LOCUS_42110 >Feature sequence340 449 985 gene locus_tag LOCUS_42120 449 985 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707386.1 protein_id gnl|my_center|LOCUS_42120 1037 1480 gene locus_tag LOCUS_42130 1037 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707384.1 protein_id gnl|my_center|LOCUS_42130 >Feature sequence341 463 1335 gene locus_tag LOCUS_42140 463 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 >Feature sequence342 1034 660 gene locus_tag LOCUS_42150 1034 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42150 >Feature sequence343 1520 261 gene locus_tag LOCUS_42160 1520 261 CDS product IS4 family transposase ISH32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289608.1 protein_id gnl|my_center|LOCUS_42160 1919 1569 gene locus_tag LOCUS_42170 1919 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 >Feature sequence344 439 1590 gene locus_tag LOCUS_42180 439 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 >Feature sequence345 >Feature sequence346 <1 898 gene locus_tag LOCUS_42190 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000680902.1:TonB-dependent receptor 1403 1531 gene locus_tag LOCUS_42200 1403 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 >Feature sequence347 359 90 gene locus_tag LOCUS_42210 359 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42210 1598 792 gene locus_tag LOCUS_42220 1598 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 >Feature sequence348 1095 766 gene locus_tag LOCUS_42230 1095 766 CDS product multidrug SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704154.1 protein_id gnl|my_center|LOCUS_42230 >Feature sequence349 <1888 326 gene locus_tag LOCUS_42240 <1888 326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q889X8:DNA-directed RNA polymerase subunit beta >Feature sequence350 1 981 gene locus_tag LOCUS_42250 1 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 994 1647 gene locus_tag LOCUS_42260 994 1647 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375180.1 protein_id gnl|my_center|LOCUS_42260 >Feature sequence351 926 630 gene locus_tag LOCUS_42270 926 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_42270 964 1128 gene locus_tag LOCUS_42280 964 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 1481 1287 gene locus_tag LOCUS_42290 1481 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 1695 1501 gene locus_tag LOCUS_42300 1695 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 >Feature sequence352 <1 558 gene locus_tag LOCUS_42310 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005456791.1:GNAT family N-acetyltransferase 1653 613 gene locus_tag LOCUS_42320 1653 613 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106354.1 protein_id gnl|my_center|LOCUS_42320 >Feature sequence353 <1 558 gene locus_tag LOCUS_42330 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005456791.1:GNAT family N-acetyltransferase 1651 611 gene locus_tag LOCUS_42340 1651 611 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106354.1 protein_id gnl|my_center|LOCUS_42340 >Feature sequence354 >Feature sequence355 1379 627 gene locus_tag LOCUS_42350 1379 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 >Feature sequence356 153 623 gene locus_tag LOCUS_42360 153 623 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890146.1 protein_id gnl|my_center|LOCUS_42360 1129 1341 gene locus_tag LOCUS_42370 1129 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 1426 1641 gene locus_tag LOCUS_42380 1426 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 >Feature sequence357 880 344 gene locus_tag LOCUS_42390 880 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 1244 864 gene locus_tag LOCUS_42400 1244 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 >Feature sequence358 1197 538 gene locus_tag LOCUS_42410 1197 538 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF82 protein_id gnl|my_center|LOCUS_42410 <1779 1194 gene locus_tag LOCUS_42420 <1779 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706206.1:methyltransferase >Feature sequence359 944 177 gene locus_tag LOCUS_42430 944 177 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547542.1 protein_id gnl|my_center|LOCUS_42430 1294 1731 gene locus_tag LOCUS_42440 1294 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 >Feature sequence360 888 631 gene locus_tag LOCUS_42450 888 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 1337 888 gene locus_tag LOCUS_42460 1337 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 1688 1344 gene locus_tag LOCUS_42470 1688 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 >Feature sequence361 1463 1098 gene locus_tag LOCUS_42480 1463 1098 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_42480 >Feature sequence362 >Feature sequence363 1272 274 gene locus_tag LOCUS_42490 1272 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 >Feature sequence364 1124 654 gene locus_tag LOCUS_42500 1124 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42500 >Feature sequence365 >Feature sequence366 189 1604 gene locus_tag LOCUS_42510 189 1604 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947831.1 protein_id gnl|my_center|LOCUS_42510 >Feature sequence367 1334 351 gene locus_tag LOCUS_42520 1334 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 >Feature sequence368 556 1413 gene locus_tag LOCUS_42530 556 1413 CDS product rhombotarget lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072488.1 protein_id gnl|my_center|LOCUS_42530 >Feature sequence369 >Feature sequence370 >Feature sequence371 >Feature sequence372 <1 1642 gene locus_tag LOCUS_42540 <1 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072936.1:TonB-dependent receptor >Feature sequence373 <1 1007 gene locus_tag LOCUS_42550 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005020302.1:polysaccharide export protein Wza 1016 1450 gene locus_tag LOCUS_42560 gene etp 1016 1450 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261020.1 protein_id gnl|my_center|LOCUS_42560 >Feature sequence374 1456 407 gene locus_tag LOCUS_42570 gene rhuM 1456 407 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964264.1 protein_id gnl|my_center|LOCUS_42570 >Feature sequence375 498 773 gene locus_tag LOCUS_42580 498 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42580 <1647 840 gene locus_tag LOCUS_42590 <1647 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097518.1:molybdate ABC transporter ATP-binding protein ModF >Feature sequence376 592 1257 gene locus_tag LOCUS_42600 gene fabG 592 1257 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194184.1 protein_id gnl|my_center|LOCUS_42600 >Feature sequence377 >Feature sequence378 1431 724 gene locus_tag LOCUS_42610 1431 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112393.1 protein_id gnl|my_center|LOCUS_42610 >Feature sequence379 7 82 gene locus_tag LOCUS_t00610 7 82 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 502 1542 gene locus_tag LOCUS_42620 gene nadA 502 1542 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEN5 protein_id gnl|my_center|LOCUS_42620 >Feature sequence380 277 591 gene locus_tag LOCUS_42630 277 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 726 1124 gene locus_tag LOCUS_42640 726 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 >Feature sequence381 1534 497 gene locus_tag LOCUS_42650 1534 497 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_42650 >Feature sequence382 285 145 gene locus_tag LOCUS_42660 285 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 364 1320 gene locus_tag LOCUS_42670 364 1320 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841995.1 protein_id gnl|my_center|LOCUS_42670 >Feature sequence383 1066 407 gene locus_tag LOCUS_42680 1066 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 1542 1063 gene locus_tag LOCUS_42690 1542 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 >Feature sequence384 782 1330 gene locus_tag LOCUS_42700 782 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 >Feature sequence385 840 151 gene locus_tag LOCUS_42710 gene yfiP 840 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_708434.2 protein_id gnl|my_center|LOCUS_42710 1587 1018 gene locus_tag LOCUS_42720 1587 1018 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477081.1 protein_id gnl|my_center|LOCUS_42720 >Feature sequence386 >Feature sequence387 949 1024 gene locus_tag LOCUS_t00620 949 1024 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1064 1139 gene locus_tag LOCUS_t00630 1064 1139 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1284 1359 gene locus_tag LOCUS_t00640 1284 1359 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence388 >Feature sequence389 >Feature sequence390 200 1024 gene locus_tag LOCUS_42730 200 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 >Feature sequence391 106 22 gene locus_tag LOCUS_t00650 106 22 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 827 213 gene locus_tag LOCUS_42740 827 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 1513 989 gene locus_tag LOCUS_42750 1513 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 >Feature sequence392 525 1325 gene locus_tag LOCUS_42760 525 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 >Feature sequence393 1003 575 gene locus_tag LOCUS_42770 1003 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 1356 1045 gene locus_tag LOCUS_42780 1356 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 >Feature sequence394 <1 1329 gene locus_tag LOCUS_42790 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003409202.1:IS66 family transposase >Feature sequence395 102 1079 gene locus_tag LOCUS_42800 gene hemB 102 1079 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EE03 protein_id gnl|my_center|LOCUS_42800 >Feature sequence396 <1507 836 gene locus_tag LOCUS_42810 <1507 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005458327.1:endonuclease I >Feature sequence397 >Feature sequence398 >Feature sequence399 224 1480 gene locus_tag LOCUS_42820 224 1480 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005047585.1 protein_id gnl|my_center|LOCUS_42820 >Feature sequence400 >Feature sequence401 725 141 gene locus_tag LOCUS_42830 725 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 975 814 gene locus_tag LOCUS_42840 975 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 >Feature sequence402 155 343 gene locus_tag LOCUS_42850 155 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 1179 967 gene locus_tag LOCUS_42860 1179 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 >Feature sequence403 824 162 gene locus_tag LOCUS_42870 824 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 1168 881 gene locus_tag LOCUS_42880 1168 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 >Feature sequence404 >Feature sequence405 491 913 gene locus_tag LOCUS_42890 491 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 >Feature sequence406 1003 593 gene locus_tag LOCUS_42900 1003 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 >Feature sequence407 802 173 gene locus_tag LOCUS_42910 802 173 CDS product tellurite resistance inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263037.1 protein_id gnl|my_center|LOCUS_42910 >Feature sequence408 1415 180 gene locus_tag LOCUS_42920 1415 180 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387846.1 protein_id gnl|my_center|LOCUS_42920 >Feature sequence409 1415 180 gene locus_tag LOCUS_42930 1415 180 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705738.1 protein_id gnl|my_center|LOCUS_42930 >Feature sequence410 >Feature sequence411 777 1382 gene locus_tag LOCUS_42940 777 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 >Feature sequence412 713 1132 gene locus_tag LOCUS_42950 713 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42950 1108 1236 gene locus_tag LOCUS_42960 1108 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 >Feature sequence413 116 295 gene locus_tag LOCUS_42970 116 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 963 409 gene locus_tag LOCUS_42980 963 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 1277 960 gene locus_tag LOCUS_42990 1277 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 >Feature sequence414 <1 927 gene locus_tag LOCUS_43000 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705342.1:HNH endonuclease >Feature sequence415 674 1363 gene locus_tag LOCUS_43010 gene cpxR 674 1363 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074105.1 protein_id gnl|my_center|LOCUS_43010 >Feature sequence416 <1 1087 gene locus_tag LOCUS_43020 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087330.1:aerotaxis receptor Aer >Feature sequence417 <1 1087 gene locus_tag LOCUS_43030 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087330.1:aerotaxis receptor Aer >Feature sequence418 <1386 431 gene locus_tag LOCUS_43040 <1386 431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105625.1:aminotransferase >Feature sequence419 423 974 gene locus_tag LOCUS_43050 423 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 >Feature sequence420 >Feature sequence421 1287 256 gene locus_tag LOCUS_43060 gene tnpA 1287 256 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073686.1 protein_id gnl|my_center|LOCUS_43060 >Feature sequence422 708 1106 gene locus_tag LOCUS_43070 708 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 >Feature sequence423 >Feature sequence424 >Feature sequence425 356 622 gene locus_tag LOCUS_43080 356 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367587.1 protein_id gnl|my_center|LOCUS_43080 1114 713 gene locus_tag LOCUS_43090 gene gloA 1114 713 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706456.1 protein_id gnl|my_center|LOCUS_43090 1353 1168 gene locus_tag LOCUS_43100 1353 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 >Feature sequence426 >Feature sequence427 >Feature sequence428 554 180 gene locus_tag LOCUS_43110 554 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 >Feature sequence429 1158 184 gene locus_tag LOCUS_43120 1158 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 >Feature sequence430 >Feature sequence431 >Feature sequence432 559 1104 gene locus_tag LOCUS_43130 559 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 >Feature sequence433 >Feature sequence434 208 522 gene locus_tag LOCUS_43140 208 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 >Feature sequence435 961 800 gene locus_tag LOCUS_43150 961 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 >Feature sequence436 >Feature sequence437 94 291 gene locus_tag LOCUS_43160 94 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 288 695 gene locus_tag LOCUS_43170 288 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 705 1010 gene locus_tag LOCUS_43180 705 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 1022 1273 gene locus_tag LOCUS_43190 1022 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 >Feature sequence438 253 1119 gene locus_tag LOCUS_43200 253 1119 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E5V2 protein_id gnl|my_center|LOCUS_43200 >Feature sequence439 <1 1171 gene locus_tag LOCUS_43210 <1 1171 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933536.1:DEAD/DEAH box helicase >Feature sequence440 >Feature sequence441 >Feature sequence442 >Feature sequence443 >Feature sequence444 >Feature sequence445 317 12 gene locus_tag LOCUS_43220 317 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 722 441 gene locus_tag LOCUS_43230 722 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 >Feature sequence446 >Feature sequence447 492 617 gene locus_tag LOCUS_43240 492 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 614 973 gene locus_tag LOCUS_43250 614 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 >Feature sequence448 >Feature sequence449 611 264 gene locus_tag LOCUS_43260 611 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 >Feature sequence450 728 1195 gene locus_tag LOCUS_43270 728 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 >Feature sequence451 >Feature sequence452 266 1132 gene locus_tag LOCUS_43280 266 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 >Feature sequence453 <1 725 gene locus_tag LOCUS_43290 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957282.1:cell filamentation protein Fic 813 950 gene locus_tag LOCUS_43300 813 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 >Feature sequence454 >Feature sequence455 >Feature sequence456 <1192 35 gene locus_tag LOCUS_43310 <1192 35 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462475.1:aminotransferase >Feature sequence457 >Feature sequence458 1119 1 gene locus_tag LOCUS_43320 gene yncI 1119 1 CDS product putative transposase YncI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X7R5 protein_id gnl|my_center|LOCUS_43320 >Feature sequence459 >Feature sequence460 <1174 182 gene locus_tag LOCUS_43330 <1174 182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E257:bifunctional purine biosynthesis protein PurH note possible pseudo, frameshifted >Feature sequence461 <1 952 gene locus_tag LOCUS_43340 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072930.1:periplasmic siderophore cleavage esterase IroE family protein >Feature sequence462 >Feature sequence463 604 224 gene locus_tag LOCUS_43350 604 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 >Feature sequence464 >Feature sequence465 >Feature sequence466 <1 531 gene locus_tag LOCUS_43360 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E828:adenylyl-sulfate kinase >Feature sequence467 287 760 gene locus_tag LOCUS_43370 287 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 >Feature sequence468 >Feature sequence469 >Feature sequence470 >Feature sequence471 250 1068 gene locus_tag LOCUS_43380 250 1068 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_43380 >Feature sequence472 647 144 gene locus_tag LOCUS_43390 647 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 960 628 gene locus_tag LOCUS_43400 960 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 >Feature sequence473 <1130 76 gene locus_tag LOCUS_43410 <1130 76 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109110.1:pectate lyase >Feature sequence474 >Feature sequence475 >Feature sequence476 919 431 gene locus_tag LOCUS_43420 919 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 >Feature sequence477 335 697 gene locus_tag LOCUS_43430 335 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 >Feature sequence478 666 139 gene locus_tag LOCUS_43440 666 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 >Feature sequence479 >Feature sequence480 61 1044 gene locus_tag LOCUS_43450 61 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 >Feature sequence481 >Feature sequence482 >Feature sequence483 311 192 gene locus_tag LOCUS_43460 311 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 >Feature sequence484 <1081 143 gene locus_tag LOCUS_43470 <1081 143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KQX0:glutamine--fructose-6-phosphate aminotransferase [isomerizing] >Feature sequence485 <1081 143 gene locus_tag LOCUS_43480 <1081 143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KQX0:glutamine--fructose-6-phosphate aminotransferase [isomerizing] >Feature sequence486 <1075 339 gene locus_tag LOCUS_43490 <1075 339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P04957:beta-glucanase >Feature sequence487 <1 645 gene locus_tag LOCUS_43500 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263746.1:mechanosensitive ion channel protein MscS >Feature sequence488 <1073 337 gene locus_tag LOCUS_43510 <1073 337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P04957:beta-glucanase >Feature sequence489 471 97 gene locus_tag LOCUS_43520 471 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 <1070 536 gene locus_tag LOCUS_43530 <1070 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E7P3:UPF0721 transmembrane protein >Feature sequence490 >Feature sequence491 921 475 gene locus_tag LOCUS_43540 921 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 >Feature sequence492 >Feature sequence493 >Feature sequence494 >Feature sequence495 470 75 gene locus_tag LOCUS_43550 470 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 >Feature sequence496 >Feature sequence497 >Feature sequence498 >Feature sequence499 91 678 gene locus_tag LOCUS_43560 gene gmhA 91 678 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SH6 protein_id gnl|my_center|LOCUS_43560 >Feature sequence500 224 415 gene locus_tag LOCUS_43570 224 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 488 721 gene locus_tag LOCUS_43580 488 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580