>Feature sequence0001 5728 1199 gene locus_tag LOCUS_00010 5728 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 14551 5747 gene locus_tag LOCUS_00020 gene srfAB 14551 5747 CDS product surfactin synthase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04747 protein_id gnl|my_center|LOCUS_00020 25096 16217 gene locus_tag LOCUS_00030 gene srfAB 25096 16217 CDS product surfactin synthase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q04747 protein_id gnl|my_center|LOCUS_00030 >Feature sequence0002 7769 4305 gene locus_tag LOCUS_00040 7769 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 17767 7787 gene locus_tag LOCUS_00050 gene srfAA 17767 7787 CDS product surfactin synthase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27206 protein_id gnl|my_center|LOCUS_00050 18002 18637 gene locus_tag LOCUS_00060 18002 18637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 19343 19684 gene locus_tag LOCUS_00070 19343 19684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 20219 20617 gene locus_tag LOCUS_00080 20219 20617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 21359 21874 gene locus_tag LOCUS_00090 21359 21874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 >Feature sequence0003 467 3895 gene locus_tag LOCUS_00100 gene pilY1-1 467 3895 CDS product pilus assembly protein PilY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941727.1 protein_id gnl|my_center|LOCUS_00100 3955 5862 gene locus_tag LOCUS_00110 3955 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 5896 8025 gene locus_tag LOCUS_00120 5896 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 9236 8016 gene locus_tag LOCUS_00130 9236 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10338 9226 gene locus_tag LOCUS_00140 10338 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879851.1 protein_id gnl|my_center|LOCUS_00140 11054 10311 gene locus_tag LOCUS_00150 11054 10311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546695.1 protein_id gnl|my_center|LOCUS_00150 11349 11155 gene locus_tag LOCUS_00160 11349 11155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 11249 12502 gene locus_tag LOCUS_00170 gene putP 11249 12502 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_00170 12546 13079 gene locus_tag LOCUS_00180 12546 13079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13090 14202 gene locus_tag LOCUS_00190 13090 14202 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_00190 14979 14221 gene locus_tag LOCUS_00200 14979 14221 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861262.1 protein_id gnl|my_center|LOCUS_00200 16604 15114 gene locus_tag LOCUS_00210 16604 15114 CDS product diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_00210 17416 16652 gene locus_tag LOCUS_00220 17416 16652 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206826.1 protein_id gnl|my_center|LOCUS_00220 18405 17413 gene locus_tag LOCUS_00230 18405 17413 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206827.1 protein_id gnl|my_center|LOCUS_00230 19316 18402 gene locus_tag LOCUS_00240 gene btuF 19316 18402 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073501.1 protein_id gnl|my_center|LOCUS_00240 >Feature sequence0004 <1 4317 gene locus_tag LOCUS_00250 <1 4317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q04747:surfactin synthase subunit 2 note possible pseudo, frameshifted 4304 17284 gene locus_tag LOCUS_00260 4304 17284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 17309 19015 gene locus_tag LOCUS_00270 17309 19015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 >Feature sequence0005 128 1480 gene locus_tag LOCUS_00280 128 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 1559 2629 gene locus_tag LOCUS_00290 1559 2629 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_00290 2657 3766 gene locus_tag LOCUS_00300 2657 3766 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249323.1 protein_id gnl|my_center|LOCUS_00300 4353 3772 gene locus_tag LOCUS_00310 4353 3772 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_00310 4585 5400 gene locus_tag LOCUS_00320 gene ispH 4585 5400 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187C6 protein_id gnl|my_center|LOCUS_00320 5393 7102 gene locus_tag LOCUS_00330 gene rpsA 5393 7102 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_00330 7099 7578 gene locus_tag LOCUS_00340 7099 7578 CDS product HIT family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_00340 7575 9173 gene locus_tag LOCUS_00350 7575 9173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 9214 10815 gene locus_tag LOCUS_00360 9214 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 10880 12631 gene locus_tag LOCUS_00370 gene aspS 10880 12631 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CS99 protein_id gnl|my_center|LOCUS_00370 13959 12715 gene locus_tag LOCUS_00380 13959 12715 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_00380 14453 14277 gene locus_tag LOCUS_00390 14453 14277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 15289 14606 gene locus_tag LOCUS_00400 gene pyrF 15289 14606 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3Z6 protein_id gnl|my_center|LOCUS_00400 16203 15286 gene locus_tag LOCUS_00410 gene pyrD 16203 15286 CDS product dihydroorotate dehydrogenase B (NAD(+)), catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB9 protein_id gnl|my_center|LOCUS_00410 16961 16191 gene locus_tag LOCUS_00420 gene pyrK 16961 16191 CDS product dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB8 protein_id gnl|my_center|LOCUS_00420 18091 17027 gene locus_tag LOCUS_00430 18091 17027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933037.1 protein_id gnl|my_center|LOCUS_00430 >Feature sequence0006 3238 17 gene locus_tag LOCUS_00440 3238 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00440 4622 3567 gene locus_tag LOCUS_00450 4622 3567 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941179.1 protein_id gnl|my_center|LOCUS_00450 5821 4646 gene locus_tag LOCUS_00460 5821 4646 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_00460 8459 5829 gene locus_tag LOCUS_00470 8459 5829 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918869.1 protein_id gnl|my_center|LOCUS_00470 9755 8571 gene locus_tag LOCUS_00480 9755 8571 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869039.1 protein_id gnl|my_center|LOCUS_00480 11588 9891 gene locus_tag LOCUS_00490 11588 9891 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404400.1 protein_id gnl|my_center|LOCUS_00490 12938 11592 gene locus_tag LOCUS_00500 gene pepP 12938 11592 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948284.1 protein_id gnl|my_center|LOCUS_00500 13880 12954 gene locus_tag LOCUS_00510 13880 12954 CDS product conjugative transfer protein GumN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583996.1 protein_id gnl|my_center|LOCUS_00510 14812 13982 gene locus_tag LOCUS_00520 14812 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 15688 14873 gene locus_tag LOCUS_00530 15688 14873 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KM26 protein_id gnl|my_center|LOCUS_00530 <17819 15692 gene locus_tag LOCUS_00540 <17819 15692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EYU4:DNA ligase >Feature sequence0007 2424 1264 gene locus_tag LOCUS_00550 2424 1264 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_00550 8007 2455 gene locus_tag LOCUS_00560 8007 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 11463 8020 gene locus_tag LOCUS_00570 11463 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 13164 11494 gene locus_tag LOCUS_00580 13164 11494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 16284 13177 gene locus_tag LOCUS_00590 16284 13177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00590 <17722 16281 gene locus_tag LOCUS_00600 <17722 16281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110104.1:non-ribosomal peptide synthetase note possible pseudo, frameshifted >Feature sequence0008 <1 9660 gene locus_tag LOCUS_00610 <1 9660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971042.1:non-ribosomal peptide synthetase note possible pseudo, internal stop codon >Feature sequence0009 <1 1173 gene locus_tag LOCUS_00620 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RKS7:phosphoenolpyruvate carboxykinase [ATP] 1 1247 1630 gene locus_tag LOCUS_00630 1247 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 2664 1627 gene locus_tag LOCUS_00640 2664 1627 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_00640 2733 3647 gene locus_tag LOCUS_00650 2733 3647 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933710.1 protein_id gnl|my_center|LOCUS_00650 3828 5114 gene locus_tag LOCUS_00660 3828 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 5124 7010 gene locus_tag LOCUS_00670 5124 7010 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_00670 7013 9031 gene locus_tag LOCUS_00680 7013 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 9230 9045 gene locus_tag LOCUS_00690 9230 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 9141 9647 gene locus_tag LOCUS_00700 9141 9647 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939369.1 protein_id gnl|my_center|LOCUS_00700 9695 9850 gene locus_tag LOCUS_00710 9695 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 10043 10192 gene locus_tag LOCUS_00720 10043 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 11179 10280 gene locus_tag LOCUS_00730 11179 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 12224 11181 gene locus_tag LOCUS_00740 12224 11181 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459416.1 protein_id gnl|my_center|LOCUS_00740 12900 12250 gene locus_tag LOCUS_00750 12900 12250 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392892.1 protein_id gnl|my_center|LOCUS_00750 13724 12903 gene locus_tag LOCUS_00760 13724 12903 CDS product DMSO reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461561.1 protein_id gnl|my_center|LOCUS_00760 14355 13726 gene locus_tag LOCUS_00770 gene dmsB 14355 13726 CDS product dimethylsulfoxide reductase, chain B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213095.1 protein_id gnl|my_center|LOCUS_00770 16772 14355 gene locus_tag LOCUS_00780 16772 14355 CDS product dimethyl sulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392899.1 protein_id gnl|my_center|LOCUS_00780 >Feature sequence0010 >Feature sequence0011 1379 2317 gene locus_tag LOCUS_00790 1379 2317 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893541.1 protein_id gnl|my_center|LOCUS_00790 2319 3353 gene locus_tag LOCUS_00800 2319 3353 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893542.1 protein_id gnl|my_center|LOCUS_00800 3355 4518 gene locus_tag LOCUS_00810 3355 4518 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 protein_id gnl|my_center|LOCUS_00810 4616 5122 gene locus_tag LOCUS_00820 4616 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 6245 5181 gene locus_tag LOCUS_00830 6245 5181 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_00830 7481 6288 gene locus_tag LOCUS_00840 7481 6288 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958343.1 protein_id gnl|my_center|LOCUS_00840 7744 9048 gene locus_tag LOCUS_00850 7744 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 9490 9107 gene locus_tag LOCUS_00860 9490 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 9707 9474 gene locus_tag LOCUS_00870 9707 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 12326 9720 gene locus_tag LOCUS_00880 12326 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 12493 13131 gene locus_tag LOCUS_00890 12493 13131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 protein_id gnl|my_center|LOCUS_00890 13204 14181 gene locus_tag LOCUS_00900 13204 14181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 14171 15280 gene locus_tag LOCUS_00910 14171 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 15908 15336 gene locus_tag LOCUS_00920 gene btuE 15908 15336 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7D9 protein_id gnl|my_center|LOCUS_00920 16526 15975 gene locus_tag LOCUS_00930 16526 15975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 >Feature sequence0012 <1 15573 gene locus_tag LOCUS_00940 <1 15573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268607.1:non-ribosomal peptide synthetase >Feature sequence0013 2414 1197 gene locus_tag LOCUS_00950 2414 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 3613 2411 gene locus_tag LOCUS_00960 3613 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 4802 3606 gene locus_tag LOCUS_00970 4802 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 5466 4789 gene locus_tag LOCUS_00980 5466 4789 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933017.1 protein_id gnl|my_center|LOCUS_00980 6692 5658 gene locus_tag LOCUS_00990 6692 5658 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHD2 protein_id gnl|my_center|LOCUS_00990 7956 6721 gene locus_tag LOCUS_01000 gene nqrF 7956 6721 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6X5 protein_id gnl|my_center|LOCUS_01000 8631 8020 gene locus_tag LOCUS_01010 gene nqrE 8631 8020 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZL0 protein_id gnl|my_center|LOCUS_01010 9253 8633 gene locus_tag LOCUS_01020 gene nqrD 9253 8633 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MA9 protein_id gnl|my_center|LOCUS_01020 10067 9246 gene locus_tag LOCUS_01030 gene nqrC 10067 9246 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK8 protein_id gnl|my_center|LOCUS_01030 11259 10054 gene locus_tag LOCUS_01040 gene nqrB 11259 10054 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZK7 protein_id gnl|my_center|LOCUS_01040 12608 11259 gene locus_tag LOCUS_01050 gene nqrA 12608 11259 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F6Y0 protein_id gnl|my_center|LOCUS_01050 13090 12800 gene locus_tag LOCUS_01060 13090 12800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 13365 13087 gene locus_tag LOCUS_01070 13365 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 13548 13766 gene locus_tag LOCUS_01080 13548 13766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 13998 14444 gene locus_tag LOCUS_01090 gene rplM 13998 14444 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728T4 protein_id gnl|my_center|LOCUS_01090 14454 14858 gene locus_tag LOCUS_01100 gene rpsI 14454 14858 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY3 protein_id gnl|my_center|LOCUS_01100 >Feature sequence0014 2559 1174 gene locus_tag LOCUS_01110 2559 1174 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861820.1 protein_id gnl|my_center|LOCUS_01110 2783 3412 gene locus_tag LOCUS_01120 2783 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 3478 4650 gene locus_tag LOCUS_01130 3478 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 5398 5060 gene locus_tag LOCUS_01140 5398 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 7873 5489 gene locus_tag LOCUS_01150 7873 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 8026 8193 gene locus_tag LOCUS_01160 8026 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 8400 9434 gene locus_tag LOCUS_01170 8400 9434 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188806.1 protein_id gnl|my_center|LOCUS_01170 10547 9435 gene locus_tag LOCUS_01180 10547 9435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 12912 10702 gene locus_tag LOCUS_01190 gene recQ 12912 10702 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681287.1 protein_id gnl|my_center|LOCUS_01190 13048 13932 gene locus_tag LOCUS_01200 13048 13932 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932511.1 protein_id gnl|my_center|LOCUS_01200 13971 14753 gene locus_tag LOCUS_01210 13971 14753 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_01210 >Feature sequence0015 <1 3600 gene locus_tag LOCUS_01220 <1 3600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895606.1:non-ribosomal peptide synthetase 3633 5321 gene locus_tag LOCUS_01230 3633 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 5332 9297 gene locus_tag LOCUS_01240 5332 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 9310 10932 gene locus_tag LOCUS_01250 9310 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 10948 14109 gene locus_tag LOCUS_01260 10948 14109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 14124 15293 gene locus_tag LOCUS_01270 14124 15293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 >Feature sequence0016 52 8787 gene locus_tag LOCUS_01280 52 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 >Feature sequence0017 12060 10969 gene locus_tag LOCUS_01290 12060 10969 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614684.1 protein_id gnl|my_center|LOCUS_01290 <14868 12090 gene locus_tag LOCUS_01300 <14868 12090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q08787:surfactin synthase subunit 3 >Feature sequence0018 382 1122 gene locus_tag LOCUS_01310 382 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 1209 1709 gene locus_tag LOCUS_01320 1209 1709 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_01320 1780 2010 gene locus_tag LOCUS_01330 1780 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 2245 2844 gene locus_tag LOCUS_01340 2245 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 4799 2823 gene locus_tag LOCUS_01350 4799 2823 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109778.1 protein_id gnl|my_center|LOCUS_01350 5491 4895 gene locus_tag LOCUS_01360 5491 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 6131 5532 gene locus_tag LOCUS_01370 6131 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 6439 6801 gene locus_tag LOCUS_01380 6439 6801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 6986 7186 gene locus_tag LOCUS_01390 6986 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 7208 7678 gene locus_tag LOCUS_01400 7208 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 7687 12084 gene locus_tag LOCUS_01410 7687 12084 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386827.1 protein_id gnl|my_center|LOCUS_01410 14371 12092 gene locus_tag LOCUS_01420 14371 12092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 >Feature sequence0019 1998 439 gene locus_tag LOCUS_01430 1998 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 2231 3163 gene locus_tag LOCUS_01440 2231 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3160 4839 gene locus_tag LOCUS_01450 3160 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5231 5980 gene locus_tag LOCUS_01460 5231 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 5967 6755 gene locus_tag LOCUS_01470 5967 6755 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811191.1 protein_id gnl|my_center|LOCUS_01470 6765 7130 gene locus_tag LOCUS_01480 6765 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 7143 8609 gene locus_tag LOCUS_01490 7143 8609 CDS product magnesium-protoporphyrin IX monomethyl ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943517.1 protein_id gnl|my_center|LOCUS_01490 9208 8606 gene locus_tag LOCUS_01500 9208 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939849.1 protein_id gnl|my_center|LOCUS_01500 10297 9230 gene locus_tag LOCUS_01510 10297 9230 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942430.1 protein_id gnl|my_center|LOCUS_01510 10994 10305 gene locus_tag LOCUS_01520 10994 10305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 12021 10978 gene locus_tag LOCUS_01530 12021 10978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_01530 13769 12018 gene locus_tag LOCUS_01540 13769 12018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 14629 13766 gene locus_tag LOCUS_01550 14629 13766 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BG7 protein_id gnl|my_center|LOCUS_01550 >Feature sequence0020 380 2767 gene locus_tag LOCUS_01560 380 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 2760 3392 gene locus_tag LOCUS_01570 2760 3392 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_01570 3710 4216 gene locus_tag LOCUS_01580 3710 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120910.1 protein_id gnl|my_center|LOCUS_01580 4736 5902 gene locus_tag LOCUS_01590 gene iscS 4736 5902 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4Z9 protein_id gnl|my_center|LOCUS_01590 5936 6310 gene locus_tag LOCUS_01600 5936 6310 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868961.1 protein_id gnl|my_center|LOCUS_01600 6349 6831 gene locus_tag LOCUS_01610 6349 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 7073 8254 gene locus_tag LOCUS_01620 7073 8254 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_01620 8255 10060 gene locus_tag LOCUS_01630 8255 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 10039 13764 gene locus_tag LOCUS_01640 10039 13764 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_01640 >Feature sequence0021 1579 95 gene locus_tag LOCUS_01650 1579 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 2148 3488 gene locus_tag LOCUS_01660 2148 3488 CDS product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 protein_id gnl|my_center|LOCUS_01660 3513 3656 gene locus_tag LOCUS_01670 3513 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3725 4789 gene locus_tag LOCUS_01680 3725 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 5805 4801 gene locus_tag LOCUS_01690 5805 4801 CDS product lantibiotic biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004937.1 protein_id gnl|my_center|LOCUS_01690 8673 5821 gene locus_tag LOCUS_01700 8673 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 8824 10350 gene locus_tag LOCUS_01710 8824 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 11279 10353 gene locus_tag LOCUS_01720 11279 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 13546 11282 gene locus_tag LOCUS_01730 13546 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence0022 1 1041 gene locus_tag LOCUS_01740 1 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 1140 1397 gene locus_tag LOCUS_01750 1140 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249868.1 protein_id gnl|my_center|LOCUS_01750 2799 1519 gene locus_tag LOCUS_01760 2799 1519 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_01760 3299 2796 gene locus_tag LOCUS_01770 3299 2796 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_01770 4557 3292 gene locus_tag LOCUS_01780 gene purD 4557 3292 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLE7 protein_id gnl|my_center|LOCUS_01780 4729 5310 gene locus_tag LOCUS_01790 4729 5310 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_01790 5311 7551 gene locus_tag LOCUS_01800 5311 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 7738 7538 gene locus_tag LOCUS_01810 7738 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940932.1 protein_id gnl|my_center|LOCUS_01810 7866 8750 gene locus_tag LOCUS_01820 7866 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 10130 8751 gene locus_tag LOCUS_01830 10130 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 10582 10145 gene locus_tag LOCUS_01840 10582 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 11362 10667 gene locus_tag LOCUS_01850 11362 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 12675 11377 gene locus_tag LOCUS_01860 12675 11377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226490.1 protein_id gnl|my_center|LOCUS_01860 <13554 12679 gene locus_tag LOCUS_01870 <13554 12679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000887601.1:capsular polysaccharide biosynthesis protein >Feature sequence0023 <1 942 gene locus_tag LOCUS_01880 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680329.1:L-threonine 3-dehydrogenase 1220 2359 gene locus_tag LOCUS_01890 1220 2359 CDS product saccharopine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_01890 2428 4737 gene locus_tag LOCUS_01900 2428 4737 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_01900 4765 5580 gene locus_tag LOCUS_01910 gene kdsA 4765 5580 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH30 protein_id gnl|my_center|LOCUS_01910 5577 6536 gene locus_tag LOCUS_01920 5577 6536 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_01920 6536 7096 gene locus_tag LOCUS_01930 gene kdsC 6536 7096 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073695.1 protein_id gnl|my_center|LOCUS_01930 7764 7105 gene locus_tag LOCUS_01940 gene gph 7764 7105 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_01940 7844 8569 gene locus_tag LOCUS_01950 gene lpxH 7844 8569 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_01950 8672 9127 gene locus_tag LOCUS_01960 gene rpoE 8672 9127 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QY01 protein_id gnl|my_center|LOCUS_01960 9124 9480 gene locus_tag LOCUS_01970 9124 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 9477 10175 gene locus_tag LOCUS_01980 9477 10175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 13240 10199 gene locus_tag LOCUS_01990 13240 10199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence0024 555 1139 gene locus_tag LOCUS_02000 555 1139 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389331.1 protein_id gnl|my_center|LOCUS_02000 1139 1423 gene locus_tag LOCUS_02010 1139 1423 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867825.1 protein_id gnl|my_center|LOCUS_02010 1413 1754 gene locus_tag LOCUS_02020 1413 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 1755 2000 gene locus_tag LOCUS_02030 1755 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 1997 2302 gene locus_tag LOCUS_02040 1997 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02040 2295 2732 gene locus_tag LOCUS_02050 2295 2732 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_02050 2725 3117 gene locus_tag LOCUS_02060 2725 3117 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_02060 3104 4600 gene locus_tag LOCUS_02070 3104 4600 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_02070 4616 6124 gene locus_tag LOCUS_02080 4616 6124 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545971.1 protein_id gnl|my_center|LOCUS_02080 6124 6348 gene locus_tag LOCUS_02090 6124 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 6335 8074 gene locus_tag LOCUS_02100 6335 8074 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967805.1 protein_id gnl|my_center|LOCUS_02100 8823 8161 gene locus_tag LOCUS_02110 8823 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 9469 8888 gene locus_tag LOCUS_02120 9469 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 10764 9508 gene locus_tag LOCUS_02130 10764 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797445.1 protein_id gnl|my_center|LOCUS_02130 12301 10757 gene locus_tag LOCUS_02140 12301 10757 CDS product radical SAM peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993584.1 protein_id gnl|my_center|LOCUS_02140 12546 12370 gene locus_tag LOCUS_02150 12546 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 >Feature sequence0025 <1 3623 gene locus_tag LOCUS_02160 <1 3623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957802.1:polyketide synthase 3624 5039 gene locus_tag LOCUS_02170 3624 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02170 >Feature sequence0026 9736 749 gene locus_tag LOCUS_02180 9736 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 <12775 9742 gene locus_tag LOCUS_02190 <12775 9742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957802.1:polyketide synthase >Feature sequence0027 <1 824 gene locus_tag LOCUS_02200 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940888.1:radical SAM protein 840 6431 gene locus_tag LOCUS_02210 840 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 6454 7827 gene locus_tag LOCUS_02220 6454 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02220 >Feature sequence0028 <1 1297 gene locus_tag LOCUS_02230 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105127.1:non-ribosomal peptide synthetase >Feature sequence0029 204 1310 gene locus_tag LOCUS_02240 204 1310 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_02240 1351 2685 gene locus_tag LOCUS_02250 1351 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 2828 5857 gene locus_tag LOCUS_02260 2828 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 5931 7004 gene locus_tag LOCUS_02270 5931 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 7014 8438 gene locus_tag LOCUS_02280 7014 8438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 8440 9951 gene locus_tag LOCUS_02290 8440 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 9951 11258 gene locus_tag LOCUS_02300 9951 11258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 11255 12409 gene locus_tag LOCUS_02310 11255 12409 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_02310 >Feature sequence0030 348 1322 gene locus_tag LOCUS_02320 348 1322 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755814.1 protein_id gnl|my_center|LOCUS_02320 1402 3045 gene locus_tag LOCUS_02330 1402 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 3145 4773 gene locus_tag LOCUS_02340 3145 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 5663 4788 gene locus_tag LOCUS_02350 5663 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 7222 5729 gene locus_tag LOCUS_02360 7222 5729 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_02360 7463 8875 gene locus_tag LOCUS_02370 7463 8875 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_02370 10115 8865 gene locus_tag LOCUS_02380 10115 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 10218 10967 gene locus_tag LOCUS_02390 10218 10967 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_02390 11930 10971 gene locus_tag LOCUS_02400 gene pdxA 11930 10971 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL57 protein_id gnl|my_center|LOCUS_02400 12359 11982 gene locus_tag LOCUS_02410 12359 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 >Feature sequence0031 16 966 gene locus_tag LOCUS_02420 16 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 1330 1151 gene locus_tag LOCUS_02430 1330 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 2575 1598 gene locus_tag LOCUS_02440 gene sbnA 2575 1598 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570807.1 protein_id gnl|my_center|LOCUS_02440 5684 2598 gene locus_tag LOCUS_02450 5684 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 7252 5696 gene locus_tag LOCUS_02460 gene glgA 7252 5696 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KPQ1 protein_id gnl|my_center|LOCUS_02460 9254 7245 gene locus_tag LOCUS_02470 9254 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 <12448 9251 gene locus_tag LOCUS_02480 <12448 9251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895613.1:non-ribosomal peptide synthetase >Feature sequence0032 147 878 gene locus_tag LOCUS_02490 gene fdhD 147 878 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJW9 protein_id gnl|my_center|LOCUS_02490 882 1487 gene locus_tag LOCUS_02500 gene mobA 882 1487 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGH6 protein_id gnl|my_center|LOCUS_02500 1921 1442 gene locus_tag LOCUS_02510 1921 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 2060 2356 gene locus_tag LOCUS_02520 2060 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 4681 2417 gene locus_tag LOCUS_02530 gene dpp4 4681 2417 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_02530 6093 4681 gene locus_tag LOCUS_02540 6093 4681 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_02540 6260 7738 gene locus_tag LOCUS_02550 6260 7738 CDS product pyridoxal-5'-phosphate-dependent protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_02550 9060 7795 gene locus_tag LOCUS_02560 gene glyA 9060 7795 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CR5 protein_id gnl|my_center|LOCUS_02560 9570 9079 gene locus_tag LOCUS_02570 9570 9079 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721284.1 protein_id gnl|my_center|LOCUS_02570 12145 9698 gene locus_tag LOCUS_02580 12145 9698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 >Feature sequence0033 499 116 gene locus_tag LOCUS_02590 499 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 1938 511 gene locus_tag LOCUS_02600 1938 511 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_02600 2195 1959 gene locus_tag LOCUS_02610 2195 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 3607 2231 gene locus_tag LOCUS_02620 3607 2231 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_02620 4324 3662 gene locus_tag LOCUS_02630 4324 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 5601 4345 gene locus_tag LOCUS_02640 5601 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 6861 5614 gene locus_tag LOCUS_02650 6861 5614 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_02650 7491 6868 gene locus_tag LOCUS_02660 7491 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 8175 7498 gene locus_tag LOCUS_02670 8175 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 8432 8214 gene locus_tag LOCUS_02680 8432 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 8766 8455 gene locus_tag LOCUS_02690 8766 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 9237 8782 gene locus_tag LOCUS_02700 gene actV 9237 8782 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227252.1 protein_id gnl|my_center|LOCUS_02700 10098 9250 gene locus_tag LOCUS_02710 10098 9250 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728711.1 protein_id gnl|my_center|LOCUS_02710 10845 10108 gene locus_tag LOCUS_02720 10845 10108 CDS product tributyrin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437771.1 protein_id gnl|my_center|LOCUS_02720 11790 10855 gene locus_tag LOCUS_02730 gene fabD 11790 10855 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEZ3 protein_id gnl|my_center|LOCUS_02730 12058 11774 gene locus_tag LOCUS_02740 12058 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 >Feature sequence0034 <1 8006 gene locus_tag LOCUS_02750 <1 8006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D 8019 8840 gene locus_tag LOCUS_02760 gene proG 8019 8840 CDS product pyrroline-5-carboxylate reductase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q00777 protein_id gnl|my_center|LOCUS_02760 10242 8833 gene locus_tag LOCUS_02770 10242 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 >Feature sequence0035 <1 9682 gene locus_tag LOCUS_02780 <1 9682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205383.1:multifunctional polyketide-peptide synthase >Feature sequence0036 959 732 gene locus_tag LOCUS_02790 959 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 2069 1140 gene locus_tag LOCUS_02800 2069 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2282 4024 gene locus_tag LOCUS_02810 2282 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 4027 4920 gene locus_tag LOCUS_02820 4027 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 6177 4936 gene locus_tag LOCUS_02830 6177 4936 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024244.1 protein_id gnl|my_center|LOCUS_02830 7091 6174 gene locus_tag LOCUS_02840 7091 6174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_02840 7603 7097 gene locus_tag LOCUS_02850 7603 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 8372 7740 gene locus_tag LOCUS_02860 8372 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 8728 11328 gene locus_tag LOCUS_02870 8728 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144184.1 protein_id gnl|my_center|LOCUS_02870 >Feature sequence0037 247 4188 gene locus_tag LOCUS_02880 247 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 4319 7339 gene locus_tag LOCUS_02890 4319 7339 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035772.1 protein_id gnl|my_center|LOCUS_02890 7359 8510 gene locus_tag LOCUS_02900 7359 8510 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063891.1 protein_id gnl|my_center|LOCUS_02900 8529 11555 gene locus_tag LOCUS_02910 gene sbcC 8529 11555 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124854.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence0038 5749 1103 gene locus_tag LOCUS_02920 5749 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 7465 5774 gene locus_tag LOCUS_02930 7465 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 <11454 7478 gene locus_tag LOCUS_02940 <11454 7478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence0039 1439 258 gene locus_tag LOCUS_02950 1439 258 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_02950 1604 1771 gene locus_tag LOCUS_02960 1604 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 1801 1959 gene locus_tag LOCUS_02970 1801 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 1988 2146 gene locus_tag LOCUS_02980 1988 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 4616 2229 gene locus_tag LOCUS_02990 4616 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 8246 4731 gene locus_tag LOCUS_03000 8246 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 11194 8381 gene locus_tag LOCUS_03010 11194 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 >Feature sequence0040 <11347 8456 gene locus_tag LOCUS_03020 <11347 8456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence0041 <1 1124 gene locus_tag LOCUS_03030 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932358.1:DNA methyltransferase 1121 2434 gene locus_tag LOCUS_03040 1121 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3432 6587 gene locus_tag LOCUS_03050 gene hsdR 3432 6587 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 protein_id gnl|my_center|LOCUS_03050 6840 9899 gene locus_tag LOCUS_03060 6840 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence0042 458 6 gene locus_tag LOCUS_03070 458 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 1243 461 gene locus_tag LOCUS_03080 gene fabG 1243 461 CDS product short-chain dehydrogenase/reductase SDR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836211.1 protein_id gnl|my_center|LOCUS_03080 1827 3014 gene locus_tag LOCUS_03090 gene aspC 1827 3014 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2S6 protein_id gnl|my_center|LOCUS_03090 3046 3435 gene locus_tag LOCUS_03100 gene oxpG 3046 3435 CDS product type II secretion system pseudopilin OxpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_03100 3451 4062 gene locus_tag LOCUS_03110 3451 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 4043 5200 gene locus_tag LOCUS_03120 gene lpxB 4043 5200 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AT9 protein_id gnl|my_center|LOCUS_03120 7350 5206 gene locus_tag LOCUS_03130 7350 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_03130 7494 9908 gene locus_tag LOCUS_03140 7494 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 <11047 9883 gene locus_tag LOCUS_03150 <11047 9883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083057.1:ATPase P >Feature sequence0043 2 814 gene locus_tag LOCUS_03160 2 814 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_03160 824 1420 gene locus_tag LOCUS_03170 824 1420 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_03170 1438 3258 gene locus_tag LOCUS_03180 1438 3258 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_03180 3279 3683 gene locus_tag LOCUS_03190 3279 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 3718 3876 gene locus_tag LOCUS_03200 3718 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_03200 3897 5009 gene locus_tag LOCUS_03210 3897 5009 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933143.1 protein_id gnl|my_center|LOCUS_03210 5068 6585 gene locus_tag LOCUS_03220 5068 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 6606 8351 gene locus_tag LOCUS_03230 6606 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 8376 9158 gene locus_tag LOCUS_03240 8376 9158 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648803.1 protein_id gnl|my_center|LOCUS_03240 9155 10240 gene locus_tag LOCUS_03250 9155 10240 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934346.1 protein_id gnl|my_center|LOCUS_03250 10265 10807 gene locus_tag LOCUS_03260 10265 10807 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_03260 >Feature sequence0044 1 2121 gene locus_tag LOCUS_03270 1 2121 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146547.1 protein_id gnl|my_center|LOCUS_03270 2140 4089 gene locus_tag LOCUS_03280 2140 4089 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965318.1 protein_id gnl|my_center|LOCUS_03280 4138 5394 gene locus_tag LOCUS_03290 4138 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 5420 6274 gene locus_tag LOCUS_03300 5420 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 6293 6826 gene locus_tag LOCUS_03310 6293 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 6828 7535 gene locus_tag LOCUS_03320 6828 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 7556 8503 gene locus_tag LOCUS_03330 7556 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 8518 10452 gene locus_tag LOCUS_03340 8518 10452 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965318.1 protein_id gnl|my_center|LOCUS_03340 >Feature sequence0045 1046 1558 gene locus_tag LOCUS_03350 1046 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 1758 1567 gene locus_tag LOCUS_03360 1758 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 2412 1804 gene locus_tag LOCUS_03370 gene cysC 2412 1804 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR04 protein_id gnl|my_center|LOCUS_03370 4323 2479 gene locus_tag LOCUS_03380 4323 2479 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948187.1 protein_id gnl|my_center|LOCUS_03380 4521 5732 gene locus_tag LOCUS_03390 4521 5732 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657813.1 protein_id gnl|my_center|LOCUS_03390 5859 6932 gene locus_tag LOCUS_03400 5859 6932 CDS product 3-phosphoserine/phosphohydroxythreonine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_03400 7618 6998 gene locus_tag LOCUS_03410 7618 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 8466 7621 gene locus_tag LOCUS_03420 8466 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 9751 8612 gene locus_tag LOCUS_03430 gene rlmL 9751 8612 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_03430 10606 9758 gene locus_tag LOCUS_03440 10606 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582978.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence0046 3 3773 gene locus_tag LOCUS_03450 3 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence0047 1967 1242 gene locus_tag LOCUS_03460 1967 1242 CDS product putative ABC transporter antibiotic-transport integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702597.1 protein_id gnl|my_center|LOCUS_03460 2668 1964 gene locus_tag LOCUS_03470 2668 1964 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258570.1 protein_id gnl|my_center|LOCUS_03470 3522 2665 gene locus_tag LOCUS_03480 3522 2665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727706.1 protein_id gnl|my_center|LOCUS_03480 4148 3519 gene locus_tag LOCUS_03490 4148 3519 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430243.1 protein_id gnl|my_center|LOCUS_03490 4634 5266 gene locus_tag LOCUS_03500 4634 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 6682 5261 gene locus_tag LOCUS_03510 6682 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 10486 6698 gene locus_tag LOCUS_03520 10486 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 >Feature sequence0048 3323 1125 gene locus_tag LOCUS_03530 3323 1125 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879109.1 protein_id gnl|my_center|LOCUS_03530 3797 4690 gene locus_tag LOCUS_03540 3797 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 6953 4683 gene locus_tag LOCUS_03550 6953 4683 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYN6 protein_id gnl|my_center|LOCUS_03550 7716 7027 gene locus_tag LOCUS_03560 7716 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 9595 7709 gene locus_tag LOCUS_03570 9595 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 <10765 9592 gene locus_tag LOCUS_03580 <10765 9592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064474.1:ATP-binding protein >Feature sequence0049 373 831 gene locus_tag LOCUS_03590 373 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 864 2498 gene locus_tag LOCUS_03600 864 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 2614 5115 gene locus_tag LOCUS_03610 2614 5115 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878946.1 protein_id gnl|my_center|LOCUS_03610 5112 5567 gene locus_tag LOCUS_03620 5112 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 5564 6319 gene locus_tag LOCUS_03630 gene pflE 5564 6319 CDS product pyruvate formate lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406170.1 protein_id gnl|my_center|LOCUS_03630 7154 6258 gene locus_tag LOCUS_03640 7154 6258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 7476 8231 gene locus_tag LOCUS_03650 gene psd 7476 8231 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FVC2 protein_id gnl|my_center|LOCUS_03650 8761 8240 gene locus_tag LOCUS_03660 8761 8240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 9338 8754 gene locus_tag LOCUS_03670 9338 8754 CDS product putative RNA polymerase sigma E protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_145450.2 protein_id gnl|my_center|LOCUS_03670 9833 9396 gene locus_tag LOCUS_03680 9833 9396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 <10693 9915 gene locus_tag LOCUS_03690 <10693 9915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UJK7:DNA polymerase IV 2 >Feature sequence0050 508 1680 gene locus_tag LOCUS_03700 508 1680 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878380.1 protein_id gnl|my_center|LOCUS_03700 2195 1677 gene locus_tag LOCUS_03710 2195 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 5369 2256 gene locus_tag LOCUS_03720 5369 2256 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_03720 8985 5377 gene locus_tag LOCUS_03730 8985 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 10106 9000 gene locus_tag LOCUS_03740 10106 9000 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072024.1 protein_id gnl|my_center|LOCUS_03740 10304 10489 gene locus_tag LOCUS_03750 10304 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 >Feature sequence0051 3366 2887 gene locus_tag LOCUS_03760 3366 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5027 3597 gene locus_tag LOCUS_03770 5027 3597 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944028.1 protein_id gnl|my_center|LOCUS_03770 5136 6377 gene locus_tag LOCUS_03780 5136 6377 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680236.1 protein_id gnl|my_center|LOCUS_03780 6374 8701 gene locus_tag LOCUS_03790 6374 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 8706 9431 gene locus_tag LOCUS_03800 8706 9431 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528194.1 protein_id gnl|my_center|LOCUS_03800 10542 9436 gene locus_tag LOCUS_03810 10542 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_03810 >Feature sequence0052 1476 1165 gene locus_tag LOCUS_03820 1476 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 2421 1609 gene locus_tag LOCUS_03830 gene nikC 2421 1609 CDS product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023387.1 protein_id gnl|my_center|LOCUS_03830 3340 2411 gene locus_tag LOCUS_03840 3340 2411 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_03840 3449 3853 gene locus_tag LOCUS_03850 3449 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4331 3888 gene locus_tag LOCUS_03860 4331 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143007.1 protein_id gnl|my_center|LOCUS_03860 5110 4358 gene locus_tag LOCUS_03870 gene spoU 5110 4358 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166692.1 protein_id gnl|my_center|LOCUS_03870 7526 5100 gene locus_tag LOCUS_03880 7526 5100 CDS product B12-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545608.1 protein_id gnl|my_center|LOCUS_03880 8592 7516 gene locus_tag LOCUS_03890 gene mrdB 8592 7516 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546334.1 protein_id gnl|my_center|LOCUS_03890 10394 8592 gene locus_tag LOCUS_03900 gene mrdA 10394 8592 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence0053 1402 170 gene locus_tag LOCUS_03910 1402 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943169.1 protein_id gnl|my_center|LOCUS_03910 3863 1596 gene locus_tag LOCUS_03920 3863 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 5104 3923 gene locus_tag LOCUS_03930 5104 3923 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047945.1 protein_id gnl|my_center|LOCUS_03930 5273 5662 gene locus_tag LOCUS_03940 5273 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 5690 6934 gene locus_tag LOCUS_03950 5690 6934 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_03950 8611 6938 gene locus_tag LOCUS_03960 gene fhs 8611 6938 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7P9 protein_id gnl|my_center|LOCUS_03960 9529 8693 gene locus_tag LOCUS_03970 gene nfo 9529 8693 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WY5 protein_id gnl|my_center|LOCUS_03970 >Feature sequence0054 2 436 gene locus_tag LOCUS_03980 2 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 548 1699 gene locus_tag LOCUS_03990 548 1699 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869494.1 protein_id gnl|my_center|LOCUS_03990 3228 1696 gene locus_tag LOCUS_04000 3228 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3485 3557 gene locus_tag LOCUS_t00010 3485 3557 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3565 3637 gene locus_tag LOCUS_t00020 3565 3637 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4565 3687 gene locus_tag LOCUS_04010 4565 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4679 6049 gene locus_tag LOCUS_04020 gene mgtE 4679 6049 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F430 protein_id gnl|my_center|LOCUS_04020 6055 6792 gene locus_tag LOCUS_04030 6055 6792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 7541 6813 gene locus_tag LOCUS_04040 7541 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 9098 7743 gene locus_tag LOCUS_04050 9098 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 9264 9470 gene locus_tag LOCUS_04060 9264 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 9460 9876 gene locus_tag LOCUS_04070 9460 9876 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680499.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence0055 1875 148 gene locus_tag LOCUS_04080 1875 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 5841 1918 gene locus_tag LOCUS_04090 5841 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 7548 5851 gene locus_tag LOCUS_04100 7548 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 <10277 7587 gene locus_tag LOCUS_04110 <10277 7587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39845:plipastatin synthase subunit A >Feature sequence0056 <10229 4049 gene locus_tag LOCUS_04120 <10229 4049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q04747:surfactin synthase subunit 2 >Feature sequence0057 <1 5645 gene locus_tag LOCUS_04130 <1 5645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D note possible pseudo, internal stop codon 5655 8957 gene locus_tag LOCUS_04140 5655 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 8969 10093 gene locus_tag LOCUS_04150 8969 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence0058 30 185 gene locus_tag LOCUS_04160 30 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 2278 242 gene locus_tag LOCUS_04170 gene htpG 2278 242 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RGH4 protein_id gnl|my_center|LOCUS_04170 2411 4525 gene locus_tag LOCUS_04180 2411 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 4616 4894 gene locus_tag LOCUS_04190 4616 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 4894 6291 gene locus_tag LOCUS_04200 gene gatA2 4894 6291 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EX8 protein_id gnl|my_center|LOCUS_04200 6301 7116 gene locus_tag LOCUS_04210 6301 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 7103 7429 gene locus_tag LOCUS_04220 gene cutA 7103 7429 CDS product divalent cation tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_04220 9854 7452 gene locus_tag LOCUS_04230 9854 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence0059 829 1551 gene locus_tag LOCUS_04240 829 1551 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939178.1 protein_id gnl|my_center|LOCUS_04240 1541 2257 gene locus_tag LOCUS_04250 1541 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939177.1 protein_id gnl|my_center|LOCUS_04250 2254 2949 gene locus_tag LOCUS_04260 2254 2949 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941968.1 protein_id gnl|my_center|LOCUS_04260 3251 4483 gene locus_tag LOCUS_04270 gene czcB 3251 4483 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037294.1 protein_id gnl|my_center|LOCUS_04270 4480 7530 gene locus_tag LOCUS_04280 4480 7530 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_04280 >Feature sequence0060 <1 1656 gene locus_tag LOCUS_04290 <1 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 1692 2642 gene locus_tag LOCUS_04300 1692 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 2656 7176 gene locus_tag LOCUS_04310 2656 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 7200 9809 gene locus_tag LOCUS_04320 7200 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence0061 <1 1152 gene locus_tag LOCUS_04330 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q836W1:DNA repair protein RecN 1218 1346 gene locus_tag LOCUS_04340 1218 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3026 1470 gene locus_tag LOCUS_04350 3026 1470 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108010.1 protein_id gnl|my_center|LOCUS_04350 3105 3776 gene locus_tag LOCUS_04360 3105 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 4751 3780 gene locus_tag LOCUS_04370 4751 3780 CDS product cell filamentation protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957282.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence0062 215 7303 gene locus_tag LOCUS_04380 215 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence0063 2973 2527 gene locus_tag LOCUS_04390 2973 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04390 <9803 2961 gene locus_tag LOCUS_04400 <9803 2961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D note possible pseudo, frameshifted >Feature sequence0064 2152 2949 gene locus_tag LOCUS_04410 2152 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2960 4117 gene locus_tag LOCUS_04420 2960 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4141 5262 gene locus_tag LOCUS_04430 4141 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 5293 5769 gene locus_tag LOCUS_04440 5293 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 6279 5848 gene locus_tag LOCUS_04450 6279 5848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 7366 6263 gene locus_tag LOCUS_04460 7366 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 7749 7414 gene locus_tag LOCUS_04470 7749 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 8664 7786 gene locus_tag LOCUS_04480 8664 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence0065 497 1339 gene locus_tag LOCUS_04490 497 1339 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357595.1 protein_id gnl|my_center|LOCUS_04490 1396 2106 gene locus_tag LOCUS_04500 gene pcm 1396 2106 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 protein_id gnl|my_center|LOCUS_04500 2811 2110 gene locus_tag LOCUS_04510 2811 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390554.1 protein_id gnl|my_center|LOCUS_04510 2914 3789 gene locus_tag LOCUS_04520 2914 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3846 4859 gene locus_tag LOCUS_04530 3846 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 5005 5271 gene locus_tag LOCUS_04540 gene groS 5005 5271 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6P7 protein_id gnl|my_center|LOCUS_04540 6025 5309 gene locus_tag LOCUS_04550 6025 5309 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_04550 7530 6022 gene locus_tag LOCUS_04560 gene gltX 7530 6022 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67271 protein_id gnl|my_center|LOCUS_04560 8623 7571 gene locus_tag LOCUS_04570 8623 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 8879 8700 gene locus_tag LOCUS_04580 8879 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence0066 <1 4398 gene locus_tag LOCUS_04590 <1 4398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973237.1:polyketide synthase 4494 6767 gene locus_tag LOCUS_04600 4494 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_04600 7043 6819 gene locus_tag LOCUS_04610 7043 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 7606 7142 gene locus_tag LOCUS_04620 7606 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 8143 7667 gene locus_tag LOCUS_04630 8143 7667 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948700.1 protein_id gnl|my_center|LOCUS_04630 <9524 8208 gene locus_tag LOCUS_04640 <9524 8208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948291.1:carbon starvation protein A >Feature sequence0067 949 1953 gene locus_tag LOCUS_04650 949 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682337.1 protein_id gnl|my_center|LOCUS_04650 1950 3815 gene locus_tag LOCUS_04660 1950 3815 CDS product TRAP transporter subunit DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682335.1 protein_id gnl|my_center|LOCUS_04660 3908 4342 gene locus_tag LOCUS_04670 3908 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 4397 5659 gene locus_tag LOCUS_04680 4397 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 6384 5668 gene locus_tag LOCUS_04690 6384 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 7527 6394 gene locus_tag LOCUS_04700 7527 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583100.1 protein_id gnl|my_center|LOCUS_04700 8893 7514 gene locus_tag LOCUS_04710 8893 7514 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870075.1 protein_id gnl|my_center|LOCUS_04710 <9484 8893 gene locus_tag LOCUS_04720 <9484 8893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868154.1:aspartate-semialdehyde dehydrogenase >Feature sequence0068 220 1425 gene locus_tag LOCUS_04730 gene pfk-2 220 1425 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFS2 protein_id gnl|my_center|LOCUS_04730 1440 1628 gene locus_tag LOCUS_04740 1440 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 1665 3077 gene locus_tag LOCUS_04750 gene xseA 1665 3077 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGR5 protein_id gnl|my_center|LOCUS_04750 3074 3319 gene locus_tag LOCUS_04760 3074 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 3802 3323 gene locus_tag LOCUS_04770 3802 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 6942 3916 gene locus_tag LOCUS_04780 gene acrB5 6942 3916 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_04780 8012 6945 gene locus_tag LOCUS_04790 8012 6945 CDS product RND family efflux transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096849.1 protein_id gnl|my_center|LOCUS_04790 9416 8016 gene locus_tag LOCUS_04800 9416 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 >Feature sequence0069 <1 3663 gene locus_tag LOCUS_04810 <1 3663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268607.1:non-ribosomal peptide synthetase 3750 6107 gene locus_tag LOCUS_04820 3750 6107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_04820 6140 9214 gene locus_tag LOCUS_04830 6140 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence0070 1240 485 gene locus_tag LOCUS_04840 1240 485 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_04840 2225 1221 gene locus_tag LOCUS_04850 2225 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 4662 2281 gene locus_tag LOCUS_04860 4662 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 5023 5346 gene locus_tag LOCUS_04870 gene trxA 5023 5346 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43785 protein_id gnl|my_center|LOCUS_04870 5367 6371 gene locus_tag LOCUS_04880 5367 6371 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_04880 8057 6387 gene locus_tag LOCUS_04890 8057 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 9039 8254 gene locus_tag LOCUS_04900 9039 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 9390 9049 gene locus_tag LOCUS_04910 9390 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence0071 262 92 gene locus_tag LOCUS_04920 262 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 1610 363 gene locus_tag LOCUS_04930 1610 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 1758 2210 gene locus_tag LOCUS_04940 1758 2210 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966930.1 protein_id gnl|my_center|LOCUS_04940 2223 3359 gene locus_tag LOCUS_04950 2223 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3369 6530 gene locus_tag LOCUS_04960 3369 6530 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_04960 6540 7856 gene locus_tag LOCUS_04970 6540 7856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence0072 >Feature sequence0073 533 1876 gene locus_tag LOCUS_04980 533 1876 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876537.1 protein_id gnl|my_center|LOCUS_04980 1881 2510 gene locus_tag LOCUS_04990 1881 2510 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L3 protein_id gnl|my_center|LOCUS_04990 3614 2520 gene locus_tag LOCUS_05000 3614 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 3694 4548 gene locus_tag LOCUS_05010 3694 4548 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091113.1 protein_id gnl|my_center|LOCUS_05010 4895 4578 gene locus_tag LOCUS_05020 4895 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 8617 5039 gene locus_tag LOCUS_05030 8617 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 >Feature sequence0074 58 729 gene locus_tag LOCUS_05040 58 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 1891 848 gene locus_tag LOCUS_05050 1891 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_05050 2856 1888 gene locus_tag LOCUS_05060 2856 1888 CDS product corrinoid/iron-sulfur protein small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_05060 3613 2834 gene locus_tag LOCUS_05070 3613 2834 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870190.1 protein_id gnl|my_center|LOCUS_05070 5436 3610 gene locus_tag LOCUS_05080 5436 3610 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392714.1 protein_id gnl|my_center|LOCUS_05080 6781 5447 gene locus_tag LOCUS_05090 6781 5447 CDS product acetyl-CoA synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_05090 9014 6798 gene locus_tag LOCUS_05100 9014 6798 CDS product acetyl-CoA decarbonylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392716.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence0075 3619 1208 gene locus_tag LOCUS_05110 3619 1208 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_05110 <9126 3669 gene locus_tag LOCUS_05120 <9126 3669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267347.1:non-ribosomal peptide synthetase >Feature sequence0076 1551 3398 gene locus_tag LOCUS_05130 gene asnB 1551 3398 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_05130 3406 4242 gene locus_tag LOCUS_05140 3406 4242 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896899.1 protein_id gnl|my_center|LOCUS_05140 4521 4745 gene locus_tag LOCUS_05150 4521 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 5091 4840 gene locus_tag LOCUS_05160 5091 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 5891 6139 gene locus_tag LOCUS_05170 5891 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 6161 6409 gene locus_tag LOCUS_05180 6161 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 6732 6974 gene locus_tag LOCUS_05190 6732 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 8123 7035 gene locus_tag LOCUS_05200 gene ahbD 8123 7035 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_05200 <9053 8120 gene locus_tag LOCUS_05210 <9053 8120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064511.1:heme biosynthesis protein >Feature sequence0077 1439 417 gene locus_tag LOCUS_05220 1439 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6771 1555 gene locus_tag LOCUS_05230 6771 1555 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973246.1 protein_id gnl|my_center|LOCUS_05230 <9046 6773 gene locus_tag LOCUS_05240 <9046 6773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084903.1:non-ribosomal peptide synthetase >Feature sequence0078 <1 3233 gene locus_tag LOCUS_05250 <1 3233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964489.1:copper transporter 3264 4310 gene locus_tag LOCUS_05260 3264 4310 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107610.1 protein_id gnl|my_center|LOCUS_05260 4310 5080 gene locus_tag LOCUS_05270 4310 5080 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_05270 5375 6925 gene locus_tag LOCUS_05280 5375 6925 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence0079 438 3119 gene locus_tag LOCUS_05290 438 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3742 3113 gene locus_tag LOCUS_05300 3742 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 4932 3739 gene locus_tag LOCUS_05310 gene mftC 4932 3739 CDS product putative mycofactocin radical SAM maturase MftC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WJ79 protein_id gnl|my_center|LOCUS_05310 6155 4929 gene locus_tag LOCUS_05320 6155 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 6388 6152 gene locus_tag LOCUS_05330 6388 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 8673 6385 gene locus_tag LOCUS_05340 8673 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence0080 <9006 5911 gene locus_tag LOCUS_05350 <9006 5911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q04747:surfactin synthase subunit 2 >Feature sequence0081 1439 18 gene locus_tag LOCUS_05360 1439 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 2303 2085 gene locus_tag LOCUS_05370 2303 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 2669 2475 gene locus_tag LOCUS_05380 2669 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 3402 3923 gene locus_tag LOCUS_05390 3402 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 5118 7784 gene locus_tag LOCUS_05400 5118 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 8217 7945 gene locus_tag LOCUS_05410 8217 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 8811 8245 gene locus_tag LOCUS_05420 8811 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence0082 21 2078 gene locus_tag LOCUS_05430 21 2078 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_05430 2221 3102 gene locus_tag LOCUS_05440 2221 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3106 4185 gene locus_tag LOCUS_05450 3106 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4194 5237 gene locus_tag LOCUS_05460 gene prpC 4194 5237 CDS product protein phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34779 protein_id gnl|my_center|LOCUS_05460 5431 6369 gene locus_tag LOCUS_05470 5431 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 7384 6374 gene locus_tag LOCUS_05480 7384 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545006.1 protein_id gnl|my_center|LOCUS_05480 7794 7381 gene locus_tag LOCUS_05490 gene yrrK 7794 7381 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34634 protein_id gnl|my_center|LOCUS_05490 8834 7791 gene locus_tag LOCUS_05500 8834 7791 CDS product D-alanine--D-alanine ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459778.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence0083 <8857 4533 gene locus_tag LOCUS_05510 <8857 4533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0084 <1 778 gene locus_tag LOCUS_05520 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O34441:UPF0701 protein YloC 768 1022 gene locus_tag LOCUS_05530 768 1022 CDS product UPF0296 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y1 protein_id gnl|my_center|LOCUS_05530 1091 1645 gene locus_tag LOCUS_05540 gene gmk 1091 1645 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYB5 protein_id gnl|my_center|LOCUS_05540 1642 2163 gene locus_tag LOCUS_05550 1642 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05550 2165 2824 gene locus_tag LOCUS_05560 2165 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05560 2833 3600 gene locus_tag LOCUS_05570 2833 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3603 5537 gene locus_tag LOCUS_05580 3603 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 6099 5497 gene locus_tag LOCUS_05590 6099 5497 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_05590 6584 6177 gene locus_tag LOCUS_05600 6584 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence0085 342 908 gene locus_tag LOCUS_05610 342 908 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_05610 924 1475 gene locus_tag LOCUS_05620 924 1475 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_05620 1554 2093 gene locus_tag LOCUS_05630 1554 2093 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_05630 2333 2662 gene locus_tag LOCUS_05640 2333 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2829 3395 gene locus_tag LOCUS_05650 2829 3395 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_05650 3414 3965 gene locus_tag LOCUS_05660 3414 3965 CDS product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 protein_id gnl|my_center|LOCUS_05660 4191 5549 gene locus_tag LOCUS_05670 4191 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 <8817 5544 gene locus_tag LOCUS_05680 <8817 5544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39847:plipastatin synthase subunit C >Feature sequence0086 <1 773 gene locus_tag LOCUS_05690 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 786 7739 gene locus_tag LOCUS_05700 786 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 >Feature sequence0087 <1 669 gene locus_tag LOCUS_05710 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KAW5:1-acyl-sn-glycerol-3-phosphate acyltransferase 786 2306 gene locus_tag LOCUS_05720 gene hutH 786 2306 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA45 protein_id gnl|my_center|LOCUS_05720 2609 4363 gene locus_tag LOCUS_05730 2609 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 5127 4456 gene locus_tag LOCUS_05740 5127 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 6474 5131 gene locus_tag LOCUS_05750 gene lpdA2 6474 5131 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_05750 7815 6517 gene locus_tag LOCUS_05760 gene bkdF 7815 6517 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749T6 protein_id gnl|my_center|LOCUS_05760 <8799 7842 gene locus_tag LOCUS_05770 <8799 7842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P75391:pyruvate dehydrogenase E1 component subunit beta >Feature sequence0088 1405 212 gene locus_tag LOCUS_05780 1405 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1650 2633 gene locus_tag LOCUS_05790 1650 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 3062 2883 gene locus_tag LOCUS_05800 3062 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 6189 3139 gene locus_tag LOCUS_05810 6189 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 7927 6317 gene locus_tag LOCUS_05820 gene pyrG 7927 6317 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BY3 protein_id gnl|my_center|LOCUS_05820 8571 7924 gene locus_tag LOCUS_05830 gene kdsB 8571 7924 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGT5 protein_id gnl|my_center|LOCUS_05830 >Feature sequence0089 <1 503 gene locus_tag LOCUS_05840 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005465083.1:threonylcarbamoyl-AMP synthase 3227 543 gene locus_tag LOCUS_05850 3227 543 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405361.1 protein_id gnl|my_center|LOCUS_05850 4265 3264 gene locus_tag LOCUS_05860 4265 3264 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971182.1 protein_id gnl|my_center|LOCUS_05860 4410 6581 gene locus_tag LOCUS_05870 4410 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 6581 7945 gene locus_tag LOCUS_05880 6581 7945 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence0090 35 793 gene locus_tag LOCUS_05890 35 793 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_05890 795 1475 gene locus_tag LOCUS_05900 795 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 1522 2799 gene locus_tag LOCUS_05910 gene glmM 1522 2799 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WSZ9 protein_id gnl|my_center|LOCUS_05910 2801 3514 gene locus_tag LOCUS_05920 gene pdxJ 2801 3514 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8C9 protein_id gnl|my_center|LOCUS_05920 3526 4899 gene locus_tag LOCUS_05930 gene lpdG 3526 4899 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I3D1 protein_id gnl|my_center|LOCUS_05930 4930 6249 gene locus_tag LOCUS_05940 4930 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 6353 7138 gene locus_tag LOCUS_05950 6353 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 7140 8489 gene locus_tag LOCUS_05960 7140 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 >Feature sequence0091 80 292 gene locus_tag LOCUS_05970 80 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 344 1138 gene locus_tag LOCUS_05980 344 1138 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219772.1 protein_id gnl|my_center|LOCUS_05980 1148 2176 gene locus_tag LOCUS_05990 1148 2176 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_05990 8703 2209 gene locus_tag LOCUS_06000 8703 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence0092 <8689 4217 gene locus_tag LOCUS_06010 <8689 4217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P40872:polyketide synthase PksM >Feature sequence0093 <1 1096 gene locus_tag LOCUS_06020 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583069.1:2-amino-3-ketobutyrate CoA ligase 1344 1123 gene locus_tag LOCUS_06030 1344 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 1716 2126 gene locus_tag LOCUS_06040 1716 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2123 3127 gene locus_tag LOCUS_06050 2123 3127 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814645.1 protein_id gnl|my_center|LOCUS_06050 3124 4371 gene locus_tag LOCUS_06060 3124 4371 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_06060 4387 5538 gene locus_tag LOCUS_06070 4387 5538 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_06070 5587 6168 gene locus_tag LOCUS_06080 gene rpoE 5587 6168 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209040.1 protein_id gnl|my_center|LOCUS_06080 6198 6680 gene locus_tag LOCUS_06090 6198 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6664 7125 gene locus_tag LOCUS_06100 6664 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 7125 7664 gene locus_tag LOCUS_06110 7125 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 <8683 7661 gene locus_tag LOCUS_06120 <8683 7661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103978.1:radical SAM domain-containing protein >Feature sequence0094 373 843 gene locus_tag LOCUS_06130 373 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 922 1191 gene locus_tag LOCUS_06140 922 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3545 1188 gene locus_tag LOCUS_06150 3545 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 3788 4189 gene locus_tag LOCUS_06160 3788 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 4261 5013 gene locus_tag LOCUS_06170 gene trmJ 4261 5013 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D44 protein_id gnl|my_center|LOCUS_06170 5010 6407 gene locus_tag LOCUS_06180 gene cysS 5010 6407 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MGC2 protein_id gnl|my_center|LOCUS_06180 6389 7483 gene locus_tag LOCUS_06190 gene hemN 6389 7483 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_06190 <8593 7491 gene locus_tag LOCUS_06200 <8593 7491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584140.1:multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase >Feature sequence0095 1 4488 gene locus_tag LOCUS_06210 1 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence0096 >Feature sequence0097 1266 133 gene locus_tag LOCUS_06220 1266 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 2504 1263 gene locus_tag LOCUS_06230 gene yfiM 2504 1263 CDS product putative transport permease YfiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94441 protein_id gnl|my_center|LOCUS_06230 3436 2501 gene locus_tag LOCUS_06240 gene sagG 3436 2501 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948245.1 protein_id gnl|my_center|LOCUS_06240 3577 5358 gene locus_tag LOCUS_06250 3577 5358 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_06250 5371 6282 gene locus_tag LOCUS_06260 5371 6282 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250959.1 protein_id gnl|my_center|LOCUS_06260 7118 6285 gene locus_tag LOCUS_06270 gene yodP 7118 6285 CDS product N-acetyltransferase YodP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34895 protein_id gnl|my_center|LOCUS_06270 8461 7118 gene locus_tag LOCUS_06280 gene kamA 8461 7118 CDS product L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX4 protein_id gnl|my_center|LOCUS_06280 >Feature sequence0098 2923 1991 gene locus_tag LOCUS_06290 2923 1991 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669950.1 protein_id gnl|my_center|LOCUS_06290 3384 2926 gene locus_tag LOCUS_06300 3384 2926 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883779.1 protein_id gnl|my_center|LOCUS_06300 3560 3381 gene locus_tag LOCUS_06310 3560 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 3865 3557 gene locus_tag LOCUS_06320 3865 3557 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775014.1 protein_id gnl|my_center|LOCUS_06320 4108 4401 gene locus_tag LOCUS_06330 4108 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 5070 4303 gene locus_tag LOCUS_06340 gene mtgA 5070 4303 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545778.1 protein_id gnl|my_center|LOCUS_06340 6328 5084 gene locus_tag LOCUS_06350 6328 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 6778 6398 gene locus_tag LOCUS_06360 gene dfx 6778 6398 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20418 protein_id gnl|my_center|LOCUS_06360 6951 7547 gene locus_tag LOCUS_06370 6951 7547 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence0099 >Feature sequence0100 <1 1250 gene locus_tag LOCUS_06380 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404499.1:glutamate:proton symporter 1368 2282 gene locus_tag LOCUS_06390 gene fabD-2 1368 2282 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS0 protein_id gnl|my_center|LOCUS_06390 2376 3593 gene locus_tag LOCUS_06400 2376 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 3600 4463 gene locus_tag LOCUS_06410 3600 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 4605 5843 gene locus_tag LOCUS_06420 4605 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_06420 5910 6821 gene locus_tag LOCUS_06430 gene folD 5910 6821 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIB4 protein_id gnl|my_center|LOCUS_06430 6839 7471 gene locus_tag LOCUS_06440 6839 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence0101 652 1911 gene locus_tag LOCUS_06450 652 1911 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198061.1 protein_id gnl|my_center|LOCUS_06450 1983 3584 gene locus_tag LOCUS_06460 1983 3584 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 protein_id gnl|my_center|LOCUS_06460 3601 4035 gene locus_tag LOCUS_06470 3601 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 4037 5182 gene locus_tag LOCUS_06480 4037 5182 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811506.1 protein_id gnl|my_center|LOCUS_06480 5260 7725 gene locus_tag LOCUS_06490 gene leuS 5260 7725 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73K81 protein_id gnl|my_center|LOCUS_06490 >Feature sequence0102 >Feature sequence0103 4 1689 gene locus_tag LOCUS_06500 4 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06500 1708 4812 gene locus_tag LOCUS_06510 1708 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06510 >Feature sequence0104 1418 405 gene locus_tag LOCUS_06520 gene obg 1418 405 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67849 protein_id gnl|my_center|LOCUS_06520 1782 1531 gene locus_tag LOCUS_06530 gene rpmA 1782 1531 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GYX1 protein_id gnl|my_center|LOCUS_06530 2294 1782 gene locus_tag LOCUS_06540 2294 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2441 3001 gene locus_tag LOCUS_06550 2441 3001 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_06550 5342 3003 gene locus_tag LOCUS_06560 5342 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 6011 5478 gene locus_tag LOCUS_06570 6011 5478 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_06570 8182 6098 gene locus_tag LOCUS_06580 8182 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence0105 >Feature sequence0106 424 1611 gene locus_tag LOCUS_06590 gene dinP 424 1611 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FZ2 protein_id gnl|my_center|LOCUS_06590 3421 1601 gene locus_tag LOCUS_06600 3421 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 4263 3433 gene locus_tag LOCUS_06610 4263 3433 CDS product ferredoxin-NADP+ reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_06610 5146 4268 gene locus_tag LOCUS_06620 5146 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 5320 6018 gene locus_tag LOCUS_06630 5320 6018 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932340.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence0107 1285 293 gene locus_tag LOCUS_06640 gene cas1 1285 293 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RED1 protein_id gnl|my_center|LOCUS_06640 1795 1295 gene locus_tag LOCUS_06650 1795 1295 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_06650 3975 1792 gene locus_tag LOCUS_06660 3975 1792 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861769.1 protein_id gnl|my_center|LOCUS_06660 4709 3975 gene locus_tag LOCUS_06670 4709 3975 CDS product type I-B CRISPR-associated protein Cas5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439785.1 protein_id gnl|my_center|LOCUS_06670 5634 4702 gene locus_tag LOCUS_06680 gene cst2 5634 4702 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544921.1 protein_id gnl|my_center|LOCUS_06680 7326 5650 gene locus_tag LOCUS_06690 7326 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 8051 7338 gene locus_tag LOCUS_06700 8051 7338 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880058.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence0108 >Feature sequence0109 162 1190 gene locus_tag LOCUS_06710 162 1190 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_06710 1215 1997 gene locus_tag LOCUS_06720 gene bacC 1215 1997 CDS product dihydroanticapsin 7-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39640 protein_id gnl|my_center|LOCUS_06720 2011 3399 gene locus_tag LOCUS_06730 2011 3399 CDS product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979226.1 protein_id gnl|my_center|LOCUS_06730 3410 4963 gene locus_tag LOCUS_06740 3410 4963 CDS product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_06740 4960 6081 gene locus_tag LOCUS_06750 4960 6081 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_06750 6103 7401 gene locus_tag LOCUS_06760 6103 7401 CDS product tripeptidyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784474.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence0110 <1 2731 gene locus_tag LOCUS_06770 <1 2731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 note possible pseudo, frameshifted >Feature sequence0111 >Feature sequence0112 <1 574 gene locus_tag LOCUS_06780 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207990.1:bifunctional pyrazinamidase/nicotinamidase 571 2025 gene locus_tag LOCUS_06790 571 2025 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_06790 2053 2259 gene locus_tag LOCUS_06800 2053 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2415 2588 gene locus_tag LOCUS_06810 2415 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 2640 2858 gene locus_tag LOCUS_06820 2640 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3509 2949 gene locus_tag LOCUS_06830 3509 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 5507 3543 gene locus_tag LOCUS_06840 5507 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 7924 5657 gene locus_tag LOCUS_06850 7924 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence0113 240 1742 gene locus_tag LOCUS_06860 240 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1985 3514 gene locus_tag LOCUS_06870 1985 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3756 5297 gene locus_tag LOCUS_06880 3756 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 5433 6953 gene locus_tag LOCUS_06890 5433 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence0114 1742 558 gene locus_tag LOCUS_06900 1742 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 1820 2353 gene locus_tag LOCUS_06910 1820 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 2350 3678 gene locus_tag LOCUS_06920 2350 3678 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765009.1 protein_id gnl|my_center|LOCUS_06920 3675 4529 gene locus_tag LOCUS_06930 3675 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 4519 7554 gene locus_tag LOCUS_06940 4519 7554 CDS product multidrug ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence0115 <1 663 gene locus_tag LOCUS_06950 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748J3:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase 666 1955 gene locus_tag LOCUS_06960 666 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2199 3578 gene locus_tag LOCUS_06970 2199 3578 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_06970 4354 3575 gene locus_tag LOCUS_06980 4354 3575 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027507.1 protein_id gnl|my_center|LOCUS_06980 5358 4348 gene locus_tag LOCUS_06990 5358 4348 CDS product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405433.1 protein_id gnl|my_center|LOCUS_06990 6213 5362 gene locus_tag LOCUS_07000 6213 5362 CDS product Fe3+-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545710.1 protein_id gnl|my_center|LOCUS_07000 6442 7068 gene locus_tag LOCUS_07010 6442 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789211.1 protein_id gnl|my_center|LOCUS_07010 7150 7695 gene locus_tag LOCUS_07020 7150 7695 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108911.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence0116 3585 2584 gene locus_tag LOCUS_07030 3585 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3739 3999 gene locus_tag LOCUS_07040 3739 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 4935 4087 gene locus_tag LOCUS_07050 4935 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 5784 5029 gene locus_tag LOCUS_07060 gene batE 5784 5029 CDS product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_07060 7556 5781 gene locus_tag LOCUS_07070 7556 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence0117 476 2974 gene locus_tag LOCUS_07080 476 2974 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_07080 3002 4354 gene locus_tag LOCUS_07090 3002 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_07090 4394 5197 gene locus_tag LOCUS_07100 4394 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_07100 5284 6558 gene locus_tag LOCUS_07110 gene pksF 5284 6558 CDS product polyketide biosynthesis malonyl-ACP decarboxylase PksF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40804 protein_id gnl|my_center|LOCUS_07110 7995 6595 gene locus_tag LOCUS_07120 7995 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence0118 7965 277 gene locus_tag LOCUS_07130 7965 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence0119 6178 5009 gene locus_tag LOCUS_07140 6178 5009 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_07140 <7941 6206 gene locus_tag LOCUS_07150 <7941 6206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence0120 1236 847 gene locus_tag LOCUS_07160 1236 847 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082705.1 protein_id gnl|my_center|LOCUS_07160 1362 2714 gene locus_tag LOCUS_07170 1362 2714 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118737.1 protein_id gnl|my_center|LOCUS_07170 2731 3216 gene locus_tag LOCUS_07180 2731 3216 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020819.1 protein_id gnl|my_center|LOCUS_07180 4089 3226 gene locus_tag LOCUS_07190 4089 3226 CDS product NAD-dependent nucleoside diphosphate-sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_07190 4907 4089 gene locus_tag LOCUS_07200 4907 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5281 4904 gene locus_tag LOCUS_07210 5281 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393712.1 protein_id gnl|my_center|LOCUS_07210 5972 5274 gene locus_tag LOCUS_07220 5972 5274 CDS product putative glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269011.1 protein_id gnl|my_center|LOCUS_07220 6394 6221 gene locus_tag LOCUS_07230 6394 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 6539 6766 gene locus_tag LOCUS_07240 6539 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251255.1 protein_id gnl|my_center|LOCUS_07240 6763 7257 gene locus_tag LOCUS_07250 6763 7257 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence0121 297 1676 gene locus_tag LOCUS_07260 297 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 3040 1682 gene locus_tag LOCUS_07270 3040 1682 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_07270 3331 3242 gene locus_tag LOCUS_t00030 3331 3242 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3776 3285 gene locus_tag LOCUS_07280 gene tadA 3776 3285 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NI97 protein_id gnl|my_center|LOCUS_07280 3992 7030 gene locus_tag LOCUS_07290 3992 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence0122 <1 1790 gene locus_tag LOCUS_07300 <1 1790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202706.1:ABC transporter permease 1900 3240 gene locus_tag LOCUS_07310 1900 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4174 3209 gene locus_tag LOCUS_07320 gene thiL 4174 3209 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747S1 protein_id gnl|my_center|LOCUS_07320 6558 4174 gene locus_tag LOCUS_07330 gene lon 6558 4174 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKD3 protein_id gnl|my_center|LOCUS_07330 6978 6577 gene locus_tag LOCUS_07340 6978 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 7433 6978 gene locus_tag LOCUS_07350 7433 6978 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459010.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence0123 635 168 gene locus_tag LOCUS_07360 635 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1927 632 gene locus_tag LOCUS_07370 1927 632 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257610.1 protein_id gnl|my_center|LOCUS_07370 2736 1930 gene locus_tag LOCUS_07380 2736 1930 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 protein_id gnl|my_center|LOCUS_07380 3472 2738 gene locus_tag LOCUS_07390 3472 2738 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544975.1 protein_id gnl|my_center|LOCUS_07390 3704 3465 gene locus_tag LOCUS_07400 3704 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07400 4706 3777 gene locus_tag LOCUS_07410 4706 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07410 5375 4821 gene locus_tag LOCUS_07420 5375 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 6078 5386 gene locus_tag LOCUS_07430 6078 5386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 6668 6090 gene locus_tag LOCUS_07440 6668 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877924.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence0124 >Feature sequence0125 <1 1560 gene locus_tag LOCUS_07450 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RLX5:protein translocase subunit SecA 1579 3051 gene locus_tag LOCUS_07460 gene guaB 1579 3051 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B47 protein_id gnl|my_center|LOCUS_07460 3070 3714 gene locus_tag LOCUS_07470 3070 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3930 3781 gene locus_tag LOCUS_07480 3930 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4139 3978 gene locus_tag LOCUS_07490 4139 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4348 4187 gene locus_tag LOCUS_07500 4348 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5825 4761 gene locus_tag LOCUS_07510 5825 4761 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_07510 7112 5988 gene locus_tag LOCUS_07520 7112 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence0126 1540 386 gene locus_tag LOCUS_07530 1540 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 3372 1537 gene locus_tag LOCUS_07540 3372 1537 CDS product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142261.1 protein_id gnl|my_center|LOCUS_07540 3902 3369 gene locus_tag LOCUS_07550 3902 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 5007 3895 gene locus_tag LOCUS_07560 5007 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 5441 5004 gene locus_tag LOCUS_07570 5441 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 5754 5449 gene locus_tag LOCUS_07580 5754 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 6832 5756 gene locus_tag LOCUS_07590 6832 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence0127 <7716 3493 gene locus_tag LOCUS_07600 <7716 3493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205383.1:multifunctional polyketide-peptide synthase >Feature sequence0128 1212 73 gene locus_tag LOCUS_07610 1212 73 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJU4 protein_id gnl|my_center|LOCUS_07610 2416 1247 gene locus_tag LOCUS_07620 2416 1247 CDS product hexosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_07620 3471 2413 gene locus_tag LOCUS_07630 3471 2413 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_07630 3595 4236 gene locus_tag LOCUS_07640 3595 4236 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_07640 4329 4493 gene locus_tag LOCUS_07650 4329 4493 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459942.1 protein_id gnl|my_center|LOCUS_07650 4517 5041 gene locus_tag LOCUS_07660 4517 5041 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_07660 5099 5173 gene locus_tag LOCUS_t00040 5099 5173 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5186 6556 gene locus_tag LOCUS_07670 5186 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 <7710 6628 gene locus_tag LOCUS_07680 <7710 6628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DP4:dihydroorotase >Feature sequence0129 >Feature sequence0130 <1 650 gene locus_tag LOCUS_07690 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759796.1:methylmalonyl-CoA mutase 808 1980 gene locus_tag LOCUS_07700 808 1980 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958343.1 protein_id gnl|my_center|LOCUS_07700 2042 3184 gene locus_tag LOCUS_07710 2042 3184 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258366.1 protein_id gnl|my_center|LOCUS_07710 3194 3856 gene locus_tag LOCUS_07720 3194 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 4113 4763 gene locus_tag LOCUS_07730 4113 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence0131 <7625 4199 gene locus_tag LOCUS_07740 <7625 4199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence0132 488 1102 gene locus_tag LOCUS_07750 488 1102 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107163.1 protein_id gnl|my_center|LOCUS_07750 1183 2295 gene locus_tag LOCUS_07760 1183 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2374 2694 gene locus_tag LOCUS_07770 2374 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 3292 2687 gene locus_tag LOCUS_07780 3292 2687 CDS product farnesyl cysteine carboxyl-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969325.1 protein_id gnl|my_center|LOCUS_07780 4065 3379 gene locus_tag LOCUS_07790 4065 3379 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870180.1 protein_id gnl|my_center|LOCUS_07790 4552 6444 gene locus_tag LOCUS_07800 4552 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 6551 7321 gene locus_tag LOCUS_07810 6551 7321 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942747.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence0133 134 2929 gene locus_tag LOCUS_07820 134 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence0134 736 1518 gene locus_tag LOCUS_07830 gene sco 736 1518 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940893.1 protein_id gnl|my_center|LOCUS_07830 1511 3136 gene locus_tag LOCUS_07840 gene coxA 1511 3136 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GM7 protein_id gnl|my_center|LOCUS_07840 3140 3736 gene locus_tag LOCUS_07850 3140 3736 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939101.1 protein_id gnl|my_center|LOCUS_07850 3752 4030 gene locus_tag LOCUS_07860 3752 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 4039 4953 gene locus_tag LOCUS_07870 gene coxB 4039 4953 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GM4 protein_id gnl|my_center|LOCUS_07870 4950 5810 gene locus_tag LOCUS_07880 gene ctaB 4950 5810 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GM3 protein_id gnl|my_center|LOCUS_07880 5836 7065 gene locus_tag LOCUS_07890 5836 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 7062 7574 gene locus_tag LOCUS_07900 7062 7574 CDS product class III cytochrome C domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence0135 <1 3295 gene locus_tag LOCUS_07910 <1 3295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 3331 4371 gene locus_tag LOCUS_07920 3331 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023522.1 protein_id gnl|my_center|LOCUS_07920 4368 6011 gene locus_tag LOCUS_07930 4368 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence0136 318 2414 gene locus_tag LOCUS_07940 318 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2424 3152 gene locus_tag LOCUS_07950 2424 3152 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AR9 protein_id gnl|my_center|LOCUS_07950 3241 4710 gene locus_tag LOCUS_07960 3241 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4759 5460 gene locus_tag LOCUS_07970 4759 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 5527 6273 gene locus_tag LOCUS_07980 gene mapB 5527 6273 CDS product methionine aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34484 protein_id gnl|my_center|LOCUS_07980 >Feature sequence0137 396 821 gene locus_tag LOCUS_07990 396 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4115 816 gene locus_tag LOCUS_08000 4115 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 4238 4504 gene locus_tag LOCUS_08010 4238 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 4586 5056 gene locus_tag LOCUS_08020 4586 5056 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 protein_id gnl|my_center|LOCUS_08020 6125 5142 gene locus_tag LOCUS_08030 6125 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6976 6122 gene locus_tag LOCUS_08040 6976 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 7458 6973 gene locus_tag LOCUS_08050 gene rpoE 7458 6973 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231056.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence0138 233 1318 gene locus_tag LOCUS_08060 233 1318 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_08060 1319 2632 gene locus_tag LOCUS_08070 1319 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2633 4123 gene locus_tag LOCUS_08080 gene putP 2633 4123 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_08080 4720 4055 gene locus_tag LOCUS_08090 4720 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 6207 4807 gene locus_tag LOCUS_08100 gene merA 6207 4807 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_08100 7098 6253 gene locus_tag LOCUS_08110 7098 6253 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence0139 132 1451 gene locus_tag LOCUS_08120 132 1451 CDS product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_08120 1458 2438 gene locus_tag LOCUS_08130 1458 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 2440 4263 gene locus_tag LOCUS_08140 2440 4263 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_08140 4279 5046 gene locus_tag LOCUS_08150 4279 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 5043 6053 gene locus_tag LOCUS_08160 5043 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 6050 7141 gene locus_tag LOCUS_08170 6050 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024333.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence0140 <1 1404 gene locus_tag LOCUS_08180 <1 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056889.1:sodium:glutamate symporter 1408 2388 gene locus_tag LOCUS_08190 1408 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2381 2845 gene locus_tag LOCUS_08200 2381 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2848 4593 gene locus_tag LOCUS_08210 gene asnB 2848 4593 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545305.1 protein_id gnl|my_center|LOCUS_08210 4590 6002 gene locus_tag LOCUS_08220 4590 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6966 5983 gene locus_tag LOCUS_08230 6966 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence0141 6921 3835 gene locus_tag LOCUS_08240 6921 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 <7476 6914 gene locus_tag LOCUS_08250 <7476 6914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0142 3870 238 gene locus_tag LOCUS_08260 3870 238 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053741.1 protein_id gnl|my_center|LOCUS_08260 5661 3895 gene locus_tag LOCUS_08270 5661 3895 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_08270 6181 5693 gene locus_tag LOCUS_08280 6181 5693 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_08280 7289 6396 gene locus_tag LOCUS_08290 7289 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence0143 461 1642 gene locus_tag LOCUS_08300 gene mdeA 461 1642 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_08300 1670 4192 gene locus_tag LOCUS_08310 1670 4192 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937681.1 protein_id gnl|my_center|LOCUS_08310 4425 4198 gene locus_tag LOCUS_08320 4425 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 4570 5418 gene locus_tag LOCUS_08330 4570 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6303 5428 gene locus_tag LOCUS_08340 6303 5428 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_08340 7265 6303 gene locus_tag LOCUS_08350 7265 6303 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435695.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence0144 436 170 gene locus_tag LOCUS_08360 436 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 739 455 gene locus_tag LOCUS_08370 739 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1028 762 gene locus_tag LOCUS_08380 1028 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1162 2247 gene locus_tag LOCUS_08390 1162 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_08390 2567 2752 gene locus_tag LOCUS_08400 2567 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2816 3430 gene locus_tag LOCUS_08410 2816 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 3406 4569 gene locus_tag LOCUS_08420 3406 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 4570 5226 gene locus_tag LOCUS_08430 4570 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 5295 5483 gene locus_tag LOCUS_08440 5295 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 5763 7055 gene locus_tag LOCUS_08450 gene pvdN 5763 7055 CDS product pyoverdine biosynthesis protein PvdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114503.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence0145 >Feature sequence0146 430 816 gene locus_tag LOCUS_08460 gene merR 430 816 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_08460 833 1645 gene locus_tag LOCUS_08470 gene rpoD 833 1645 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404684.1 protein_id gnl|my_center|LOCUS_08470 1642 2355 gene locus_tag LOCUS_08480 1642 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2365 3354 gene locus_tag LOCUS_08490 2365 3354 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_08490 3402 3842 gene locus_tag LOCUS_08500 3402 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 4175 7192 gene locus_tag LOCUS_08510 gene oar 4175 7192 CDS product Oar protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037703.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence0147 1629 373 gene locus_tag LOCUS_08520 1629 373 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_08520 3041 1626 gene locus_tag LOCUS_08530 gene aspA 3041 1626 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392787.1 protein_id gnl|my_center|LOCUS_08530 4490 3054 gene locus_tag LOCUS_08540 gene thiH 4490 3054 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865292.1 protein_id gnl|my_center|LOCUS_08540 4911 4483 gene locus_tag LOCUS_08550 4911 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08550 5547 4933 gene locus_tag LOCUS_08560 5547 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08560 6680 5556 gene locus_tag LOCUS_08570 6680 5556 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_08570 7079 6684 gene locus_tag LOCUS_08580 7079 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence0148 129 2831 gene locus_tag LOCUS_08590 129 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2982 3215 gene locus_tag LOCUS_08600 2982 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3217 4314 gene locus_tag LOCUS_08610 3217 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence0149 >Feature sequence0150 2371 1277 gene locus_tag LOCUS_08620 2371 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3582 2467 gene locus_tag LOCUS_08630 3582 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 4768 3608 gene locus_tag LOCUS_08640 4768 3608 CDS product non-catalytic member of peptidase subfamily M23B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_08640 5055 5261 gene locus_tag LOCUS_08650 5055 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 5289 6830 gene locus_tag LOCUS_08660 5289 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence0151 2395 1262 gene locus_tag LOCUS_08670 2395 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2863 2408 gene locus_tag LOCUS_08680 2863 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 3755 2964 gene locus_tag LOCUS_08690 3755 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4313 3777 gene locus_tag LOCUS_08700 4313 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 5666 4371 gene locus_tag LOCUS_08710 gene tolB 5666 4371 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H67 protein_id gnl|my_center|LOCUS_08710 6490 5666 gene locus_tag LOCUS_08720 6490 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6900 6487 gene locus_tag LOCUS_08730 6900 6487 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence0152 281 81 gene locus_tag LOCUS_08740 281 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 784 464 gene locus_tag LOCUS_08750 784 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1270 1716 gene locus_tag LOCUS_08760 1270 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2968 1709 gene locus_tag LOCUS_08770 2968 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3905 3012 gene locus_tag LOCUS_08780 3905 3012 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704312.1 protein_id gnl|my_center|LOCUS_08780 5320 3902 gene locus_tag LOCUS_08790 5320 3902 CDS product aromatic-L-amino-acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_08790 5991 5332 gene locus_tag LOCUS_08800 5991 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 7081 5996 gene locus_tag LOCUS_08810 7081 5996 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609761.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence0153 441 2798 gene locus_tag LOCUS_08820 441 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2823 3971 gene locus_tag LOCUS_08830 2823 3971 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_08830 4209 4406 gene locus_tag LOCUS_08840 4209 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 4423 4713 gene locus_tag LOCUS_08850 4423 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4722 6683 gene locus_tag LOCUS_08860 4722 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence0154 491 1396 gene locus_tag LOCUS_08870 491 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1494 2510 gene locus_tag LOCUS_08880 1494 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2607 3635 gene locus_tag LOCUS_08890 2607 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3984 4892 gene locus_tag LOCUS_08900 3984 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 5140 6054 gene locus_tag LOCUS_08910 5140 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 6215 6069 gene locus_tag LOCUS_08920 6215 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 6335 7243 gene locus_tag LOCUS_08930 6335 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence0155 1539 559 gene locus_tag LOCUS_08940 1539 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064473.1 protein_id gnl|my_center|LOCUS_08940 3315 1723 gene locus_tag LOCUS_08950 3315 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4518 3367 gene locus_tag LOCUS_08960 4518 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 4707 6041 gene locus_tag LOCUS_08970 4707 6041 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_08970 6053 7204 gene locus_tag LOCUS_08980 6053 7204 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence0156 <1 577 gene locus_tag LOCUS_08990 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029266.1:protein phosphatase 579 1418 gene locus_tag LOCUS_09000 579 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1451 2152 gene locus_tag LOCUS_09010 1451 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2597 2169 gene locus_tag LOCUS_09020 2597 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2764 3495 gene locus_tag LOCUS_09030 2764 3495 CDS product DUF4097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868254.1 protein_id gnl|my_center|LOCUS_09030 3602 4657 gene locus_tag LOCUS_09040 gene ispG 3602 4657 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (flavodoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D60 protein_id gnl|my_center|LOCUS_09040 4778 6115 gene locus_tag LOCUS_09050 4778 6115 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_09050 6842 6105 gene locus_tag LOCUS_09060 6842 6105 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080389.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence0157 1627 719 gene locus_tag LOCUS_09070 1627 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1915 3069 gene locus_tag LOCUS_09080 1915 3069 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_09080 4376 3084 gene locus_tag LOCUS_09090 gene gltA 4376 3084 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW5 protein_id gnl|my_center|LOCUS_09090 4568 5770 gene locus_tag LOCUS_09100 4568 5770 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B7K8 protein_id gnl|my_center|LOCUS_09100 5795 6883 gene locus_tag LOCUS_09110 5795 6883 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence0158 76 2298 gene locus_tag LOCUS_09120 76 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3010 2396 gene locus_tag LOCUS_09130 3010 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4378 3098 gene locus_tag LOCUS_09140 4378 3098 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203561.1 protein_id gnl|my_center|LOCUS_09140 6665 4476 gene locus_tag LOCUS_09150 6665 4476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence0159 <7134 5407 gene locus_tag LOCUS_09160 <7134 5407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence0160 <1 1075 gene locus_tag LOCUS_09170 <1 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261753.1:prolyl endopeptidase 1106 1999 gene locus_tag LOCUS_09180 1106 1999 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020666.1 protein_id gnl|my_center|LOCUS_09180 3252 1996 gene locus_tag LOCUS_09190 3252 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4027 3293 gene locus_tag LOCUS_09200 4027 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 5652 4198 gene locus_tag LOCUS_09210 5652 4198 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957233.1 protein_id gnl|my_center|LOCUS_09210 6586 5789 gene locus_tag LOCUS_09220 gene hisN 6586 5789 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence0161 228 1607 gene locus_tag LOCUS_09230 228 1607 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_09230 1625 2701 gene locus_tag LOCUS_09240 1625 2701 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_09240 2682 6110 gene locus_tag LOCUS_09250 2682 6110 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_09250 6103 6684 gene locus_tag LOCUS_09260 6103 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 6700 6921 gene locus_tag LOCUS_09270 6700 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence0162 <1 1566 gene locus_tag LOCUS_09280 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938992.1:DEAD/DEAH box helicase 3057 1591 gene locus_tag LOCUS_09290 3057 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3639 3082 gene locus_tag LOCUS_09300 3639 3082 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_09300 4047 3652 gene locus_tag LOCUS_09310 4047 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 5372 4182 gene locus_tag LOCUS_09320 gene pepC 5372 4182 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_09320 6757 5489 gene locus_tag LOCUS_09330 gene ntrC1 6757 5489 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence0163 2766 1669 gene locus_tag LOCUS_09340 2766 1669 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932560.1 protein_id gnl|my_center|LOCUS_09340 2911 3150 gene locus_tag LOCUS_09350 2911 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 3160 3480 gene locus_tag LOCUS_09360 3160 3480 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1X0 protein_id gnl|my_center|LOCUS_09360 4013 3498 gene locus_tag LOCUS_09370 4013 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5675 4107 gene locus_tag LOCUS_09380 5675 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 protein_id gnl|my_center|LOCUS_09380 5924 5679 gene locus_tag LOCUS_09390 5924 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6950 6021 gene locus_tag LOCUS_09400 gene fabH-2 6950 6021 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence0164 373 8 gene locus_tag LOCUS_09410 373 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1660 383 gene locus_tag LOCUS_09420 1660 383 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_09420 2352 1663 gene locus_tag LOCUS_09430 2352 1663 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_09430 3478 2363 gene locus_tag LOCUS_09440 3478 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4158 3475 gene locus_tag LOCUS_09450 4158 3475 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969386.1 protein_id gnl|my_center|LOCUS_09450 6698 4383 gene locus_tag LOCUS_09460 6698 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence0165 <1 1131 gene locus_tag LOCUS_09470 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005172694.1:transcriptional regulator 1158 1355 gene locus_tag LOCUS_09480 1158 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2085 1399 gene locus_tag LOCUS_09490 2085 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3189 2095 gene locus_tag LOCUS_09500 gene mraY 3189 2095 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83F26 protein_id gnl|my_center|LOCUS_09500 6968 3192 gene locus_tag LOCUS_09510 6968 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence0166 1026 547 gene locus_tag LOCUS_09520 gene hupD 1026 547 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880396.1 protein_id gnl|my_center|LOCUS_09520 2335 1034 gene locus_tag LOCUS_09530 2335 1034 CDS product hydrogenase/sulfur reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544964.1 protein_id gnl|my_center|LOCUS_09530 3084 2335 gene locus_tag LOCUS_09540 3084 2335 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546316.1 protein_id gnl|my_center|LOCUS_09540 3941 3084 gene locus_tag LOCUS_09550 3941 3084 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546652.1 protein_id gnl|my_center|LOCUS_09550 4974 3952 gene locus_tag LOCUS_09560 4974 3952 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546086.1 protein_id gnl|my_center|LOCUS_09560 5671 5201 gene locus_tag LOCUS_09570 5671 5201 CDS product HybD peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939205.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence0167 3346 89 gene locus_tag LOCUS_09580 gene valS 3346 89 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UXH9 protein_id gnl|my_center|LOCUS_09580 4985 3417 gene locus_tag LOCUS_09590 gene nadB 4985 3417 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B29 protein_id gnl|my_center|LOCUS_09590 5832 4990 gene locus_tag LOCUS_09600 5832 4990 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_09600 <7033 5849 gene locus_tag LOCUS_09610 <7033 5849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963251.1:peptidase S9 >Feature sequence0168 2453 378 gene locus_tag LOCUS_09620 gene pcrA 2453 378 CDS product ATP-dependent DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34580 protein_id gnl|my_center|LOCUS_09620 3150 2443 gene locus_tag LOCUS_09630 gene pcm 3150 2443 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 protein_id gnl|my_center|LOCUS_09630 4807 3260 gene locus_tag LOCUS_09640 4807 3260 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942254.1 protein_id gnl|my_center|LOCUS_09640 5198 6241 gene locus_tag LOCUS_09650 5198 6241 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957220.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence0169 498 163 gene locus_tag LOCUS_09660 498 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1561 653 gene locus_tag LOCUS_09670 1561 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1859 2833 gene locus_tag LOCUS_09680 1859 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2858 3946 gene locus_tag LOCUS_09690 2858 3946 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250425.1 protein_id gnl|my_center|LOCUS_09690 3943 4824 gene locus_tag LOCUS_09700 3943 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 4909 5274 gene locus_tag LOCUS_09710 4909 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5275 5610 gene locus_tag LOCUS_09720 5275 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 5656 6942 gene locus_tag LOCUS_09730 gene eno 5656 6942 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q815K8 protein_id gnl|my_center|LOCUS_09730 >Feature sequence0170 2608 614 gene locus_tag LOCUS_09740 2608 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3618 2605 gene locus_tag LOCUS_09750 gene galE 3618 2605 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880665.1 protein_id gnl|my_center|LOCUS_09750 4439 3732 gene locus_tag LOCUS_09760 4439 3732 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK48 protein_id gnl|my_center|LOCUS_09760 6198 4459 gene locus_tag LOCUS_09770 6198 4459 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC0 protein_id gnl|my_center|LOCUS_09770 6590 6195 gene locus_tag LOCUS_09780 6590 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 6962 6606 gene locus_tag LOCUS_09790 6962 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence0171 5123 1980 gene locus_tag LOCUS_09800 5123 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09800 6930 5137 gene locus_tag LOCUS_09810 6930 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence0172 4998 3307 gene locus_tag LOCUS_09820 4998 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 <6918 5002 gene locus_tag LOCUS_09830 <6918 5002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39847:plipastatin synthase subunit C >Feature sequence0173 <1 805 gene locus_tag LOCUS_09840 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963977.1:radical SAM protein 802 1587 gene locus_tag LOCUS_09850 802 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1687 2982 gene locus_tag LOCUS_09860 1687 2982 CDS product Cys-rich peptide radical SAM maturase CcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860654.1 protein_id gnl|my_center|LOCUS_09860 2979 3779 gene locus_tag LOCUS_09870 2979 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 3818 3973 gene locus_tag LOCUS_09880 3818 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4217 4522 gene locus_tag LOCUS_09890 4217 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 4789 4601 gene locus_tag LOCUS_09900 4789 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 5106 4918 gene locus_tag LOCUS_09910 5106 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 5425 5237 gene locus_tag LOCUS_09920 5425 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5646 5458 gene locus_tag LOCUS_09930 5646 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 5862 5677 gene locus_tag LOCUS_09940 5862 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6071 5889 gene locus_tag LOCUS_09950 6071 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence0174 <6902 263 gene locus_tag LOCUS_09960 <6902 263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q04747:surfactin synthase subunit 2 >Feature sequence0175 1636 428 gene locus_tag LOCUS_09970 gene add 1636 428 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403444.1 protein_id gnl|my_center|LOCUS_09970 2199 1633 gene locus_tag LOCUS_09980 2199 1633 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_09980 2868 2236 gene locus_tag LOCUS_09990 gene udk 2868 2236 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MWK2 protein_id gnl|my_center|LOCUS_09990 3055 5238 gene locus_tag LOCUS_10000 3055 5238 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence0176 292 1383 gene locus_tag LOCUS_10010 292 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1532 4882 gene locus_tag LOCUS_10020 1532 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 5060 5764 gene locus_tag LOCUS_10030 gene fklB 5060 5764 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ2 protein_id gnl|my_center|LOCUS_10030 5930 6130 gene locus_tag LOCUS_10040 5930 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 6145 6474 gene locus_tag LOCUS_10050 6145 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence0177 1147 329 gene locus_tag LOCUS_10060 gene deoD 1147 329 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE80 protein_id gnl|my_center|LOCUS_10060 2338 1166 gene locus_tag LOCUS_10070 gene deoB 2338 1166 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RID0 protein_id gnl|my_center|LOCUS_10070 2447 2857 gene locus_tag LOCUS_10080 gene cdd 2447 2857 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_10080 2875 4218 gene locus_tag LOCUS_10090 gene deoA 2875 4218 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964854.1 protein_id gnl|my_center|LOCUS_10090 5770 4175 gene locus_tag LOCUS_10100 5770 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 <6858 5796 gene locus_tag LOCUS_10110 <6858 5796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036001.1:nucleoside transporter >Feature sequence0178 1200 2276 gene locus_tag LOCUS_10120 1200 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence0179 <1 3259 gene locus_tag LOCUS_10130 <1 3259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014640143.1:autotransporter outer membrane protein >Feature sequence0180 1266 763 gene locus_tag LOCUS_10140 gene defA 1266 763 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I068 protein_id gnl|my_center|LOCUS_10140 2286 1267 gene locus_tag LOCUS_10150 gene purM 2286 1267 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P12043 protein_id gnl|my_center|LOCUS_10150 3719 2361 gene locus_tag LOCUS_10160 3719 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3821 6550 gene locus_tag LOCUS_10170 3821 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence0181 2000 372 gene locus_tag LOCUS_10180 2000 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4037 2166 gene locus_tag LOCUS_10190 4037 2166 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460040.1 protein_id gnl|my_center|LOCUS_10190 5228 4206 gene locus_tag LOCUS_10200 gene mtnA 5228 4206 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Y8 protein_id gnl|my_center|LOCUS_10200 5897 5334 gene locus_tag LOCUS_10210 5897 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence0182 147 1439 gene locus_tag LOCUS_10220 147 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2391 1498 gene locus_tag LOCUS_10230 2391 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2563 3405 gene locus_tag LOCUS_10240 2563 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931967.1 protein_id gnl|my_center|LOCUS_10240 4266 3409 gene locus_tag LOCUS_10250 4266 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 5328 4318 gene locus_tag LOCUS_10260 5328 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 5481 6701 gene locus_tag LOCUS_10270 5481 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence0183 >Feature sequence0184 835 173 gene locus_tag LOCUS_10280 835 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2683 935 gene locus_tag LOCUS_10290 2683 935 CDS product lipid A ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257959.1 protein_id gnl|my_center|LOCUS_10290 4388 2676 gene locus_tag LOCUS_10300 4388 2676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_10300 5525 4407 gene locus_tag LOCUS_10310 gene bshA 5525 4407 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42982 protein_id gnl|my_center|LOCUS_10310 6247 5522 gene locus_tag LOCUS_10320 6247 5522 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence0185 <1 1314 gene locus_tag LOCUS_10330 <1 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545329.1:ribonucleotide-diphosphate reductase subunit alpha 1424 2698 gene locus_tag LOCUS_10340 1424 2698 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_10340 2781 3026 gene locus_tag LOCUS_10350 2781 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2950 4047 gene locus_tag LOCUS_10360 2950 4047 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405412.1 protein_id gnl|my_center|LOCUS_10360 4059 5477 gene locus_tag LOCUS_10370 4059 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence0186 256 2175 gene locus_tag LOCUS_10380 256 2175 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003348.1 protein_id gnl|my_center|LOCUS_10380 3228 2170 gene locus_tag LOCUS_10390 gene mutY 3228 2170 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_10390 3379 4461 gene locus_tag LOCUS_10400 3379 4461 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376722.1 protein_id gnl|my_center|LOCUS_10400 4458 5684 gene locus_tag LOCUS_10410 4458 5684 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481670.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence0187 <1 942 gene locus_tag LOCUS_10420 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941506.1:histidine kinase 970 1365 gene locus_tag LOCUS_10430 970 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1437 2849 gene locus_tag LOCUS_10440 1437 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10440 2904 3515 gene locus_tag LOCUS_10450 2904 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10450 4607 3594 gene locus_tag LOCUS_10460 4607 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 4806 6332 gene locus_tag LOCUS_10470 gene yidK 4806 6332 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence0188 >Feature sequence0189 238 3288 gene locus_tag LOCUS_10480 238 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 3301 5001 gene locus_tag LOCUS_10490 3301 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence0190 <1 5162 gene locus_tag LOCUS_10500 <1 5162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence0191 569 1453 gene locus_tag LOCUS_10510 569 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1459 2565 gene locus_tag LOCUS_10520 gene ribD 1459 2565 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66534 protein_id gnl|my_center|LOCUS_10520 2573 3151 gene locus_tag LOCUS_10530 gene ribE 2573 3151 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_10530 3238 4392 gene locus_tag LOCUS_10540 gene ribA 3238 4392 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI3 protein_id gnl|my_center|LOCUS_10540 4392 5132 gene locus_tag LOCUS_10550 4392 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5177 5845 gene locus_tag LOCUS_10560 5177 5845 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_10560 <6601 5849 gene locus_tag LOCUS_10570 <6601 5849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583646.1:lipoprotein >Feature sequence0192 716 1342 gene locus_tag LOCUS_10580 716 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1753 3372 gene locus_tag LOCUS_10590 1753 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 3461 5032 gene locus_tag LOCUS_10600 3461 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 6330 5098 gene locus_tag LOCUS_10610 6330 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence0193 7 1092 gene locus_tag LOCUS_10620 7 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence0194 760 1311 gene locus_tag LOCUS_10630 gene dcd 760 1311 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHV4 protein_id gnl|my_center|LOCUS_10630 1459 1289 gene locus_tag LOCUS_10640 1459 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1409 2620 gene locus_tag LOCUS_10650 1409 2620 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_10650 2692 2898 gene locus_tag LOCUS_10660 2692 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3404 3550 gene locus_tag LOCUS_10670 3404 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3584 3724 gene locus_tag LOCUS_10680 3584 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3913 5052 gene locus_tag LOCUS_10690 3913 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 5139 5288 gene locus_tag LOCUS_10700 5139 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 5419 5571 gene locus_tag LOCUS_10710 5419 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 5634 5783 gene locus_tag LOCUS_10720 5634 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 5846 6004 gene locus_tag LOCUS_10730 5846 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence0195 1905 232 gene locus_tag LOCUS_10740 1905 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2128 2580 gene locus_tag LOCUS_10750 2128 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3229 2666 gene locus_tag LOCUS_10760 3229 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3378 6128 gene locus_tag LOCUS_10770 3378 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence0196 1475 39 gene locus_tag LOCUS_10780 1475 39 CDS product Cys-rich peptide radical SAM maturase CcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860654.1 protein_id gnl|my_center|LOCUS_10780 1643 1503 gene locus_tag LOCUS_10790 1643 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 3420 1819 gene locus_tag LOCUS_10800 3420 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3867 4046 gene locus_tag LOCUS_10810 3867 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 4071 4466 gene locus_tag LOCUS_10820 4071 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 5474 4479 gene locus_tag LOCUS_10830 5474 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6292 5474 gene locus_tag LOCUS_10840 6292 5474 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB29 protein_id gnl|my_center|LOCUS_10840 >Feature sequence0197 2 1339 gene locus_tag LOCUS_10850 2 1339 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_10850 1361 1657 gene locus_tag LOCUS_10860 1361 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1763 2230 gene locus_tag LOCUS_10870 1763 2230 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_10870 2249 3931 gene locus_tag LOCUS_10880 2249 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 3947 4885 gene locus_tag LOCUS_10890 3947 4885 CDS product glutamate formiminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_10890 6238 4901 gene locus_tag LOCUS_10900 6238 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 6471 6328 gene locus_tag LOCUS_10910 6471 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence0198 718 799 gene locus_tag LOCUS_t00050 718 799 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 863 2029 gene locus_tag LOCUS_10920 863 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2030 2179 gene locus_tag LOCUS_10930 2030 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2180 2323 gene locus_tag LOCUS_10940 2180 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2470 2640 gene locus_tag LOCUS_10950 2470 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 5237 2730 gene locus_tag LOCUS_10960 5237 2730 CDS product subtilisin proteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124090.1 protein_id gnl|my_center|LOCUS_10960 5827 5234 gene locus_tag LOCUS_10970 5827 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence0199 211 35 gene locus_tag LOCUS_10980 211 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2302 362 gene locus_tag LOCUS_10990 gene feoB2 2302 362 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFQ7 protein_id gnl|my_center|LOCUS_10990 2584 2306 gene locus_tag LOCUS_11000 2584 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 3124 2693 gene locus_tag LOCUS_11010 3124 2693 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_11010 3260 3853 gene locus_tag LOCUS_11020 gene rpsD 3260 3853 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3E9J8 protein_id gnl|my_center|LOCUS_11020 3925 4728 gene locus_tag LOCUS_11030 3925 4728 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619789.1 protein_id gnl|my_center|LOCUS_11030 6096 4735 gene locus_tag LOCUS_11040 6096 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence0200 3892 2210 gene locus_tag LOCUS_11050 3892 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4302 4703 gene locus_tag LOCUS_11060 4302 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4684 5385 gene locus_tag LOCUS_11070 4684 5385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6350 5379 gene locus_tag LOCUS_11080 6350 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence0201 1660 92 gene locus_tag LOCUS_11090 1660 92 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_11090 2915 1698 gene locus_tag LOCUS_11100 2915 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 3009 4280 gene locus_tag LOCUS_11110 3009 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4273 5574 gene locus_tag LOCUS_11120 4273 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 <6453 5561 gene locus_tag LOCUS_11130 <6453 5561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388502.1:2-nitropropane dioxygenase >Feature sequence0202 <1 4731 gene locus_tag LOCUS_11140 <1 4731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39846:plipastatin synthase subunit B note possible pseudo, internal stop codon >Feature sequence0203 <1 3306 gene locus_tag LOCUS_11150 <1 3306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39847:plipastatin synthase subunit C >Feature sequence0204 2531 744 gene locus_tag LOCUS_11160 2531 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 3842 2535 gene locus_tag LOCUS_11170 3842 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5061 3871 gene locus_tag LOCUS_11180 5061 3871 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181926.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence0205 2046 565 gene locus_tag LOCUS_11190 2046 565 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_11190 2620 2051 gene locus_tag LOCUS_11200 gene tdk 2620 2051 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88UT1 protein_id gnl|my_center|LOCUS_11200 4122 2671 gene locus_tag LOCUS_11210 4122 2671 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_11210 4337 4119 gene locus_tag LOCUS_11220 4337 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence0206 <6402 3344 gene locus_tag LOCUS_11230 <6402 3344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0207 6345 1690 gene locus_tag LOCUS_11240 6345 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence0208 1774 1073 gene locus_tag LOCUS_11250 1774 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_11250 2866 1784 gene locus_tag LOCUS_11260 2866 1784 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_11260 4115 2889 gene locus_tag LOCUS_11270 4115 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107436.1 protein_id gnl|my_center|LOCUS_11270 4693 4229 gene locus_tag LOCUS_11280 4693 4229 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878502.1 protein_id gnl|my_center|LOCUS_11280 4827 5585 gene locus_tag LOCUS_11290 4827 5585 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence0209 29 3538 gene locus_tag LOCUS_11300 29 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence0210 2624 1593 gene locus_tag LOCUS_11310 2624 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2958 2590 gene locus_tag LOCUS_11320 2958 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3781 2960 gene locus_tag LOCUS_11330 3781 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 4666 3794 gene locus_tag LOCUS_11340 4666 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5322 4663 gene locus_tag LOCUS_11350 5322 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6251 5349 gene locus_tag LOCUS_11360 6251 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence0211 2096 2983 gene locus_tag LOCUS_11370 2096 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 4321 2987 gene locus_tag LOCUS_11380 gene norM 4321 2987 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence0212 920 2965 gene locus_tag LOCUS_11390 920 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence0213 >Feature sequence0214 959 558 gene locus_tag LOCUS_11400 959 558 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546312.1 protein_id gnl|my_center|LOCUS_11400 1002 2417 gene locus_tag LOCUS_11410 1002 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3706 2408 gene locus_tag LOCUS_11420 gene asnS 3706 2408 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E184 protein_id gnl|my_center|LOCUS_11420 5133 3775 gene locus_tag LOCUS_11430 5133 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 <6181 5162 gene locus_tag LOCUS_11440 <6181 5162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766931.1:zinc protease >Feature sequence0215 5890 4745 gene locus_tag LOCUS_11450 5890 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence0216 <1 5742 gene locus_tag LOCUS_11460 <1 5742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122194.1:alpha-2-macroglobulin >Feature sequence0217 1437 19 gene locus_tag LOCUS_11470 1437 19 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070381.1 protein_id gnl|my_center|LOCUS_11470 4139 1434 gene locus_tag LOCUS_11480 gene ppdK 4139 1434 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_11480 5939 4224 gene locus_tag LOCUS_11490 5939 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence0218 61 2046 gene locus_tag LOCUS_11500 61 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2241 3023 gene locus_tag LOCUS_11510 2241 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3768 2992 gene locus_tag LOCUS_11520 3768 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4305 3901 gene locus_tag LOCUS_11530 4305 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4614 5525 gene locus_tag LOCUS_11540 4614 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence0219 5046 2641 gene locus_tag LOCUS_11550 5046 2641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_11550 <6080 5150 gene locus_tag LOCUS_11560 <6080 5150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249822.1:ornithine carbamoyltransferase >Feature sequence0220 767 1198 gene locus_tag LOCUS_11570 767 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2151 1444 gene locus_tag LOCUS_11580 2151 1444 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1A0 protein_id gnl|my_center|LOCUS_11580 3276 2161 gene locus_tag LOCUS_11590 gene dnaJ 3276 2161 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q725M6 protein_id gnl|my_center|LOCUS_11590 5095 3281 gene locus_tag LOCUS_11600 gene dnaK 5095 3281 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_11600 5781 5098 gene locus_tag LOCUS_11610 5781 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 6056 5784 gene locus_tag LOCUS_11620 6056 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence0221 1 303 gene locus_tag LOCUS_11630 1 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 354 1682 gene locus_tag LOCUS_11640 354 1682 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_11640 1739 2458 gene locus_tag LOCUS_11650 1739 2458 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_11650 2674 4182 gene locus_tag LOCUS_11660 2674 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 4179 5021 gene locus_tag LOCUS_11670 4179 5021 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence0222 2253 2035 gene locus_tag LOCUS_11680 2253 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2206 2784 gene locus_tag LOCUS_11690 2206 2784 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_11690 2948 4885 gene locus_tag LOCUS_11700 2948 4885 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933422.1 protein_id gnl|my_center|LOCUS_11700 4885 5904 gene locus_tag LOCUS_11710 4885 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence0223 <1 675 gene locus_tag LOCUS_11720 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545652.1:aldehyde ferredoxin oxidoreductase 742 1137 gene locus_tag LOCUS_11730 742 1137 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110359.1 protein_id gnl|my_center|LOCUS_11730 1152 1949 gene locus_tag LOCUS_11740 1152 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1936 3618 gene locus_tag LOCUS_11750 1936 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 3785 5692 gene locus_tag LOCUS_11760 3785 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence0224 5114 1380 gene locus_tag LOCUS_11770 5114 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5666 5469 gene locus_tag LOCUS_11780 5666 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence0225 190 2280 gene locus_tag LOCUS_11790 gene fusA2 190 2280 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_11790 2391 3290 gene locus_tag LOCUS_11800 2391 3290 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405402.1 protein_id gnl|my_center|LOCUS_11800 3424 3792 gene locus_tag LOCUS_11810 3424 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_11810 3817 4551 gene locus_tag LOCUS_11820 3817 4551 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880615.1 protein_id gnl|my_center|LOCUS_11820 4556 5473 gene locus_tag LOCUS_11830 4556 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence0226 3290 72 gene locus_tag LOCUS_11840 3290 72 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747J9 protein_id gnl|my_center|LOCUS_11840 3938 3738 gene locus_tag LOCUS_11850 3938 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4456 3977 gene locus_tag LOCUS_11860 4456 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 5886 4450 gene locus_tag LOCUS_11870 5886 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence0227 2473 1046 gene locus_tag LOCUS_11880 2473 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2942 4066 gene locus_tag LOCUS_11890 2942 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 4238 4077 gene locus_tag LOCUS_11900 4238 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 4482 4895 gene locus_tag LOCUS_11910 4482 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 4914 5945 gene locus_tag LOCUS_11920 4914 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence0228 >Feature sequence0229 427 245 gene locus_tag LOCUS_11930 427 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 341 1003 gene locus_tag LOCUS_11940 341 1003 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_11940 1098 2708 gene locus_tag LOCUS_11950 gene hcp 1098 2708 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31101 protein_id gnl|my_center|LOCUS_11950 3273 2785 gene locus_tag LOCUS_11960 3273 2785 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938003.1 protein_id gnl|my_center|LOCUS_11960 3458 5176 gene locus_tag LOCUS_11970 3458 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 <5983 5227 gene locus_tag LOCUS_11980 <5983 5227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108017.1:peptidase S9 >Feature sequence0230 314 1945 gene locus_tag LOCUS_11990 314 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2037 3227 gene locus_tag LOCUS_12000 2037 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3240 3665 gene locus_tag LOCUS_12010 3240 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3694 4185 gene locus_tag LOCUS_12020 3694 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4355 4182 gene locus_tag LOCUS_12030 4355 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4276 5442 gene locus_tag LOCUS_12040 4276 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence0231 <1 1869 gene locus_tag LOCUS_12050 <1 1869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942876.1:GTP pyrophosphokinase 2470 1862 gene locus_tag LOCUS_12060 2470 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3741 2449 gene locus_tag LOCUS_12070 3741 2449 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_12070 4701 3763 gene locus_tag LOCUS_12080 gene thrB 4701 3763 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_12080 5062 5949 gene locus_tag LOCUS_12090 5062 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence0232 2757 475 gene locus_tag LOCUS_12100 gene tex 2757 475 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_12100 2995 3885 gene locus_tag LOCUS_12110 2995 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_12110 3882 5438 gene locus_tag LOCUS_12120 3882 5438 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence0233 >Feature sequence0234 737 1558 gene locus_tag LOCUS_12130 737 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1545 2291 gene locus_tag LOCUS_12140 1545 2291 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545308.1 protein_id gnl|my_center|LOCUS_12140 2773 2297 gene locus_tag LOCUS_12150 2773 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 3430 2774 gene locus_tag LOCUS_12160 3430 2774 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249096.1 protein_id gnl|my_center|LOCUS_12160 3788 3456 gene locus_tag LOCUS_12170 3788 3456 CDS product putative HIT-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66536 protein_id gnl|my_center|LOCUS_12170 5088 3829 gene locus_tag LOCUS_12180 gene murA 5088 3829 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63Q84 protein_id gnl|my_center|LOCUS_12180 5861 5337 gene locus_tag LOCUS_12190 5861 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence0235 <1 883 gene locus_tag LOCUS_12200 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0236 <1 630 gene locus_tag LOCUS_12210 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39846:plipastatin synthase subunit B 657 2342 gene locus_tag LOCUS_12220 657 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence0237 370 1710 gene locus_tag LOCUS_12230 370 1710 CDS product putative zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67776 protein_id gnl|my_center|LOCUS_12230 3188 1743 gene locus_tag LOCUS_12240 3188 1743 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203470.1 protein_id gnl|my_center|LOCUS_12240 3385 4746 gene locus_tag LOCUS_12250 3385 4746 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942656.1 protein_id gnl|my_center|LOCUS_12250 4739 5059 gene locus_tag LOCUS_12260 4739 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence0238 3048 2893 gene locus_tag LOCUS_12270 3048 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3349 4512 gene locus_tag LOCUS_12280 3349 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence0239 <1 914 gene locus_tag LOCUS_12290 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933616.1:magnesium-protoporphyrin IX monomethyl ester cyclase >Feature sequence0240 2911 140 gene locus_tag LOCUS_12300 2911 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 3379 2981 gene locus_tag LOCUS_12310 3379 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_12310 3943 3392 gene locus_tag LOCUS_12320 3943 3392 CDS product AMMECR1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496635.1 protein_id gnl|my_center|LOCUS_12320 4304 3936 gene locus_tag LOCUS_12330 4304 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 5297 4353 gene locus_tag LOCUS_12340 5297 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_12340 <5831 5301 gene locus_tag LOCUS_12350 <5831 5301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459962.1:CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase >Feature sequence0241 2851 1682 gene locus_tag LOCUS_12360 2851 1682 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_12360 <5824 2838 gene locus_tag LOCUS_12370 <5824 2838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39845:plipastatin synthase subunit A >Feature sequence0242 635 2560 gene locus_tag LOCUS_12380 635 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2648 4108 gene locus_tag LOCUS_12390 2648 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 4194 5120 gene locus_tag LOCUS_12400 4194 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence0243 <1 1013 gene locus_tag LOCUS_12410 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973127.1:oxidoreductase 1026 2090 gene locus_tag LOCUS_12420 1026 2090 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729427.1 protein_id gnl|my_center|LOCUS_12420 2092 2970 gene locus_tag LOCUS_12430 2092 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3024 3527 gene locus_tag LOCUS_12440 3024 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3625 4128 gene locus_tag LOCUS_12450 3625 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 5024 4407 gene locus_tag LOCUS_12460 5024 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 <5779 5265 gene locus_tag LOCUS_12470 <5779 5265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000875702.1:thermolysin >Feature sequence0244 <1 1803 gene locus_tag LOCUS_12480 <1 1803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964341.1:transporter 1800 3392 gene locus_tag LOCUS_12490 1800 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 4964 3402 gene locus_tag LOCUS_12500 4964 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 <5778 5046 gene locus_tag LOCUS_12510 <5778 5046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022343.1:ATP-dependent DNA helicase >Feature sequence0245 1272 2480 gene locus_tag LOCUS_12520 1272 2480 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020737.1 protein_id gnl|my_center|LOCUS_12520 2859 2509 gene locus_tag LOCUS_12530 2859 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3794 3045 gene locus_tag LOCUS_12540 3794 3045 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679291.1 protein_id gnl|my_center|LOCUS_12540 4957 3878 gene locus_tag LOCUS_12550 4957 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861987.1 protein_id gnl|my_center|LOCUS_12550 5763 4969 gene locus_tag LOCUS_12560 gene ansA 5763 4969 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence0246 >Feature sequence0247 109 489 gene locus_tag LOCUS_12570 109 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 2903 510 gene locus_tag LOCUS_12580 2903 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 3243 3431 gene locus_tag LOCUS_12590 3243 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 4648 3632 gene locus_tag LOCUS_12600 4648 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 <5740 4632 gene locus_tag LOCUS_12610 <5740 4632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O31827:plipastatin synthase subunit E >Feature sequence0248 >Feature sequence0249 280 813 gene locus_tag LOCUS_12620 280 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1689 2645 gene locus_tag LOCUS_12630 1689 2645 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_12630 2693 3343 gene locus_tag LOCUS_12640 2693 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3350 4282 gene locus_tag LOCUS_12650 3350 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence0250 1413 583 gene locus_tag LOCUS_12660 1413 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2655 1438 gene locus_tag LOCUS_12670 2655 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3144 2662 gene locus_tag LOCUS_12680 3144 2662 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704034.1 protein_id gnl|my_center|LOCUS_12680 4180 3146 gene locus_tag LOCUS_12690 4180 3146 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_12690 5295 4183 gene locus_tag LOCUS_12700 5295 4183 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence0251 <5703 1563 gene locus_tag LOCUS_12710 <5703 1563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence0252 >Feature sequence0253 1833 1006 gene locus_tag LOCUS_12720 1833 1006 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110492.1 protein_id gnl|my_center|LOCUS_12720 4178 1893 gene locus_tag LOCUS_12730 4178 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144294.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence0254 2091 400 gene locus_tag LOCUS_12740 2091 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 <5674 2118 gene locus_tag LOCUS_12750 <5674 2118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39845:plipastatin synthase subunit A >Feature sequence0255 1895 780 gene locus_tag LOCUS_12760 1895 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2581 1892 gene locus_tag LOCUS_12770 2581 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 3569 2568 gene locus_tag LOCUS_12780 3569 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112783.1 protein_id gnl|my_center|LOCUS_12780 4329 3559 gene locus_tag LOCUS_12790 4329 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 5104 4319 gene locus_tag LOCUS_12800 5104 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918457.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence0256 1273 2040 gene locus_tag LOCUS_12810 1273 2040 CDS product sulfohydrolase/glycosulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890732.1 protein_id gnl|my_center|LOCUS_12810 2163 3467 gene locus_tag LOCUS_12820 2163 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_12820 4933 3488 gene locus_tag LOCUS_12830 4933 3488 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_12830 5651 4926 gene locus_tag LOCUS_12840 5651 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence0257 925 71 gene locus_tag LOCUS_12850 gene lpqC 925 71 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_12850 1160 945 gene locus_tag LOCUS_12860 1160 945 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123276.1 protein_id gnl|my_center|LOCUS_12860 1858 1229 gene locus_tag LOCUS_12870 1858 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_12870 2922 1915 gene locus_tag LOCUS_12880 2922 1915 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_12880 3254 2922 gene locus_tag LOCUS_12890 3254 2922 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811834.1 protein_id gnl|my_center|LOCUS_12890 3501 4013 gene locus_tag LOCUS_12900 3501 4013 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGE6 protein_id gnl|my_center|LOCUS_12900 4016 4753 gene locus_tag LOCUS_12910 4016 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence0258 825 37 gene locus_tag LOCUS_12920 825 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545134.1 protein_id gnl|my_center|LOCUS_12920 1047 1424 gene locus_tag LOCUS_12930 1047 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3262 1475 gene locus_tag LOCUS_12940 gene sglT 3262 1475 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_12940 <5654 3274 gene locus_tag LOCUS_12950 <5654 3274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202542.1:beta-mannosidase >Feature sequence0259 1626 3194 gene locus_tag LOCUS_12960 1626 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 3427 4686 gene locus_tag LOCUS_12970 3427 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227271.1 protein_id gnl|my_center|LOCUS_12970 <5645 4687 gene locus_tag LOCUS_12980 <5645 4687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941216.1:B12-binding domain-containing radical SAM protein >Feature sequence0260 1791 10 gene locus_tag LOCUS_12990 1791 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 3742 1922 gene locus_tag LOCUS_13000 3742 1922 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 protein_id gnl|my_center|LOCUS_13000 4295 3939 gene locus_tag LOCUS_13010 4295 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785477.1 protein_id gnl|my_center|LOCUS_13010 <5625 4412 gene locus_tag LOCUS_13020 <5625 4412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250730.1:oligopeptide transporter, OPT family >Feature sequence0261 480 1388 gene locus_tag LOCUS_13030 480 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1513 1953 gene locus_tag LOCUS_13040 1513 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3322 2204 gene locus_tag LOCUS_13050 3322 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 3606 3472 gene locus_tag LOCUS_13060 3606 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 4875 3718 gene locus_tag LOCUS_13070 4875 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 5591 5259 gene locus_tag LOCUS_13080 5591 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence0262 48 1817 gene locus_tag LOCUS_13090 48 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_13090 1826 3853 gene locus_tag LOCUS_13100 1826 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3879 5042 gene locus_tag LOCUS_13110 gene sucC 3879 5042 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEX9 protein_id gnl|my_center|LOCUS_13110 >Feature sequence0263 106 525 gene locus_tag LOCUS_13120 106 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1566 538 gene locus_tag LOCUS_13130 gene ruvB 1566 538 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650B4 protein_id gnl|my_center|LOCUS_13130 2150 1563 gene locus_tag LOCUS_13140 gene ruvA 2150 1563 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K1A2 protein_id gnl|my_center|LOCUS_13140 2634 2134 gene locus_tag LOCUS_13150 gene ruvC 2634 2134 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_13150 3383 2631 gene locus_tag LOCUS_13160 3383 2631 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_13160 4243 3386 gene locus_tag LOCUS_13170 4243 3386 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_13170 5528 4254 gene locus_tag LOCUS_13180 gene thiC1 5528 4254 CDS product phosphomethylpyrimidine synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIM5 protein_id gnl|my_center|LOCUS_13180 >Feature sequence0264 678 64 gene locus_tag LOCUS_13190 gene rutR 678 64 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226204.1 protein_id gnl|my_center|LOCUS_13190 945 2015 gene locus_tag LOCUS_13200 gene ilvE 945 2015 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_13200 2261 4114 gene locus_tag LOCUS_13210 gene asnB 2261 4114 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_13210 4395 4111 gene locus_tag LOCUS_13220 4395 4111 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061274.1 protein_id gnl|my_center|LOCUS_13220 5409 4411 gene locus_tag LOCUS_13230 gene nadE 5409 4411 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UHL2 protein_id gnl|my_center|LOCUS_13230 >Feature sequence0265 <1 552 gene locus_tag LOCUS_13240 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764140.1:maltose O-acetyltransferase 3604 584 gene locus_tag LOCUS_13250 3604 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence0266 93 245 gene locus_tag LOCUS_13260 93 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 280 432 gene locus_tag LOCUS_13270 280 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 466 633 gene locus_tag LOCUS_13280 466 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 719 886 gene locus_tag LOCUS_13290 719 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 909 1064 gene locus_tag LOCUS_13300 909 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1083 1241 gene locus_tag LOCUS_13310 1083 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1602 1757 gene locus_tag LOCUS_13320 1602 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 2165 2317 gene locus_tag LOCUS_13330 2165 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 2388 2546 gene locus_tag LOCUS_13340 2388 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2663 3388 gene locus_tag LOCUS_13350 2663 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903867.1 protein_id gnl|my_center|LOCUS_13350 3607 3780 gene locus_tag LOCUS_13360 3607 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3868 5160 gene locus_tag LOCUS_13370 3868 5160 CDS product Cys-rich peptide radical SAM maturase CcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860654.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence0267 3035 723 gene locus_tag LOCUS_13380 3035 723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_13380 3768 3079 gene locus_tag LOCUS_13390 3768 3079 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_13390 5049 3793 gene locus_tag LOCUS_13400 5049 3793 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence0268 196 753 gene locus_tag LOCUS_13410 196 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1024 1587 gene locus_tag LOCUS_13420 1024 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1605 3962 gene locus_tag LOCUS_13430 1605 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 4070 4936 gene locus_tag LOCUS_13440 4070 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence0269 115 3453 gene locus_tag LOCUS_13450 115 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3596 4060 gene locus_tag LOCUS_13460 3596 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 4199 5203 gene locus_tag LOCUS_13470 4199 5203 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence0270 2062 1160 gene locus_tag LOCUS_13480 2062 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3362 2049 gene locus_tag LOCUS_13490 gene hemN 3362 2049 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_13490 4726 3353 gene locus_tag LOCUS_13500 4726 3353 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_13500 <5488 4723 gene locus_tag LOCUS_13510 <5488 4723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868017.1:SAM-dependent methyltransferase >Feature sequence0271 1215 574 gene locus_tag LOCUS_13520 1215 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2692 1292 gene locus_tag LOCUS_13530 gene aspA 2692 1292 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902984.1 protein_id gnl|my_center|LOCUS_13530 3585 2773 gene locus_tag LOCUS_13540 3585 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3762 4520 gene locus_tag LOCUS_13550 3762 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence0272 >Feature sequence0273 5466 3328 gene locus_tag LOCUS_13560 5466 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence0274 905 2731 gene locus_tag LOCUS_13570 905 2731 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932615.1 protein_id gnl|my_center|LOCUS_13570 2796 3617 gene locus_tag LOCUS_13580 2796 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence0275 607 2109 gene locus_tag LOCUS_13590 607 2109 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWB6 protein_id gnl|my_center|LOCUS_13590 2099 3073 gene locus_tag LOCUS_13600 2099 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 3089 4207 gene locus_tag LOCUS_13610 3089 4207 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_13610 5092 4214 gene locus_tag LOCUS_13620 5092 4214 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942049.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence0276 1911 1318 gene locus_tag LOCUS_13630 1911 1318 CDS product ubiquinone biosynthesis protein UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_13630 2453 1932 gene locus_tag LOCUS_13640 2453 1932 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_13640 4306 2450 gene locus_tag LOCUS_13650 4306 2450 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203640.1 protein_id gnl|my_center|LOCUS_13650 5038 4619 gene locus_tag LOCUS_13660 5038 4619 CDS product putative nickel-responsive regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748M1 protein_id gnl|my_center|LOCUS_13660 5460 5155 gene locus_tag LOCUS_13670 5460 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence0277 156 2888 gene locus_tag LOCUS_13680 156 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143241.1 protein_id gnl|my_center|LOCUS_13680 3377 2901 gene locus_tag LOCUS_13690 3377 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193599.1 protein_id gnl|my_center|LOCUS_13690 3503 5125 gene locus_tag LOCUS_13700 3503 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 5455 5252 gene locus_tag LOCUS_13710 5455 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence0278 710 1696 gene locus_tag LOCUS_13720 710 1696 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483085.1 protein_id gnl|my_center|LOCUS_13720 3092 1701 gene locus_tag LOCUS_13730 3092 1701 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202535.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence0279 1328 75 gene locus_tag LOCUS_13740 1328 75 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_13740 <5446 1338 gene locus_tag LOCUS_13750 <5446 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545209.1:phosphoenolpyruvate synthase/pyruvate phosphate dikinase >Feature sequence0280 1003 1470 gene locus_tag LOCUS_13760 1003 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1506 3020 gene locus_tag LOCUS_13770 1506 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142959.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence0281 2254 884 gene locus_tag LOCUS_13780 2254 884 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777343.1 protein_id gnl|my_center|LOCUS_13780 3338 2358 gene locus_tag LOCUS_13790 3338 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3530 3874 gene locus_tag LOCUS_13800 3530 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3935 5101 gene locus_tag LOCUS_13810 3935 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546326.1 protein_id gnl|my_center|LOCUS_13810 5119 5352 gene locus_tag LOCUS_13820 5119 5352 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence0282 2722 491 gene locus_tag LOCUS_13830 2722 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_13830 3527 2838 gene locus_tag LOCUS_13840 3527 2838 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_13840 4684 3524 gene locus_tag LOCUS_13850 4684 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 4926 5087 gene locus_tag LOCUS_13860 4926 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5150 5329 gene locus_tag LOCUS_13870 5150 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence0283 <1 2628 gene locus_tag LOCUS_13880 <1 2628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence0284 >Feature sequence0285 <1 3204 gene locus_tag LOCUS_13890 <1 3204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272602.1:phosphoribosylformylglycinamidine synthase 3205 4497 gene locus_tag LOCUS_13900 gene rarA 3205 4497 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_13900 4871 4509 gene locus_tag LOCUS_13910 4871 4509 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545378.1 protein_id gnl|my_center|LOCUS_13910 <5383 4852 gene locus_tag LOCUS_13920 <5383 4852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266825.1:PAS domain-containing sensor histidine kinase >Feature sequence0286 >Feature sequence0287 133 2871 gene locus_tag LOCUS_13930 133 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4825 3335 gene locus_tag LOCUS_13940 4825 3335 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence0288 2323 1034 gene locus_tag LOCUS_13950 gene miaB 2323 1034 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKW2 protein_id gnl|my_center|LOCUS_13950 4613 2421 gene locus_tag LOCUS_13960 4613 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 <5340 4642 gene locus_tag LOCUS_13970 <5340 4642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001015947.1:peptidase inhibitor >Feature sequence0289 1629 736 gene locus_tag LOCUS_13980 1629 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 2940 1714 gene locus_tag LOCUS_13990 2940 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3773 3039 gene locus_tag LOCUS_14000 3773 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4291 3785 gene locus_tag LOCUS_14010 4291 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 4404 4709 gene locus_tag LOCUS_14020 gene ytxJ 4404 4709 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985617.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence0290 46 1437 gene locus_tag LOCUS_14030 46 1437 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 protein_id gnl|my_center|LOCUS_14030 1440 2390 gene locus_tag LOCUS_14040 1440 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 2393 3292 gene locus_tag LOCUS_14050 2393 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3276 3947 gene locus_tag LOCUS_14060 3276 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3951 4691 gene locus_tag LOCUS_14070 3951 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence0291 1912 551 gene locus_tag LOCUS_14080 1912 551 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249433.1 protein_id gnl|my_center|LOCUS_14080 2598 1915 gene locus_tag LOCUS_14090 2598 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3147 2602 gene locus_tag LOCUS_14100 3147 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4481 3144 gene locus_tag LOCUS_14110 4481 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 5282 4494 gene locus_tag LOCUS_14120 5282 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence0292 >Feature sequence0293 1481 1408 gene locus_tag LOCUS_t00060 1481 1408 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2640 1648 gene locus_tag LOCUS_14130 2640 1648 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_14130 3030 2659 gene locus_tag LOCUS_14140 gene panD 3030 2659 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66773 protein_id gnl|my_center|LOCUS_14140 3877 3032 gene locus_tag LOCUS_14150 gene panC 3877 3032 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0G6 protein_id gnl|my_center|LOCUS_14150 4719 3874 gene locus_tag LOCUS_14160 gene panB 4719 3874 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C32 protein_id gnl|my_center|LOCUS_14160 <5306 4706 gene locus_tag LOCUS_14170 <5306 4706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403716.1:deoxyadenosine kinase >Feature sequence0294 1523 132 gene locus_tag LOCUS_14180 1523 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2989 1520 gene locus_tag LOCUS_14190 2989 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 5256 3019 gene locus_tag LOCUS_14200 5256 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence0295 <5284 1986 gene locus_tag LOCUS_14210 <5284 1986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268607.1:non-ribosomal peptide synthetase >Feature sequence0296 346 146 gene locus_tag LOCUS_14220 346 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 712 404 gene locus_tag LOCUS_14230 712 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1780 713 gene locus_tag LOCUS_14240 1780 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2373 3371 gene locus_tag LOCUS_14250 2373 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 3706 4446 gene locus_tag LOCUS_14260 3706 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405233.1 protein_id gnl|my_center|LOCUS_14260 5120 4626 gene locus_tag LOCUS_14270 gene rflB 5120 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073933.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence0297 138 1313 gene locus_tag LOCUS_14280 138 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1472 2497 gene locus_tag LOCUS_14290 1472 2497 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143449.1 protein_id gnl|my_center|LOCUS_14290 2654 2854 gene locus_tag LOCUS_14300 2654 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 3701 2937 gene locus_tag LOCUS_14310 3701 2937 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_14310 5002 3698 gene locus_tag LOCUS_14320 5002 3698 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence0298 <5260 1487 gene locus_tag LOCUS_14330 <5260 1487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39846:plipastatin synthase subunit B >Feature sequence0299 <1 1359 gene locus_tag LOCUS_14340 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HG38:transketolase 1829 1368 gene locus_tag LOCUS_14350 1829 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2941 1826 gene locus_tag LOCUS_14360 2941 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 3083 3544 gene locus_tag LOCUS_14370 3083 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989756.1 protein_id gnl|my_center|LOCUS_14370 3558 4076 gene locus_tag LOCUS_14380 3558 4076 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_14380 <5246 4134 gene locus_tag LOCUS_14390 <5246 4134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258461.1:amidohydrolase >Feature sequence0300 268 2640 gene locus_tag LOCUS_14400 268 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence0301 <5239 4478 gene locus_tag LOCUS_14410 <5239 4478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103865.1:non-ribosomal peptide synthetase >Feature sequence0302 >Feature sequence0303 991 683 gene locus_tag LOCUS_14420 991 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2175 991 gene locus_tag LOCUS_14430 2175 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3245 2301 gene locus_tag LOCUS_14440 3245 2301 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_14440 3947 3273 gene locus_tag LOCUS_14450 3947 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 <5232 3955 gene locus_tag LOCUS_14460 <5232 3955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X1B6:alanine--tRNA ligase >Feature sequence0304 1532 822 gene locus_tag LOCUS_14470 1532 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2717 1542 gene locus_tag LOCUS_14480 2717 1542 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890857.1 protein_id gnl|my_center|LOCUS_14480 <5218 2756 gene locus_tag LOCUS_14490 <5218 2756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110104.1:non-ribosomal peptide synthetase >Feature sequence0305 1492 518 gene locus_tag LOCUS_14500 1492 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_14500 2383 1499 gene locus_tag LOCUS_14510 gene xerD 2383 1499 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FKG3 protein_id gnl|my_center|LOCUS_14510 3696 2359 gene locus_tag LOCUS_14520 gene trmFO 3696 2359 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y7K1 protein_id gnl|my_center|LOCUS_14520 <5217 3689 gene locus_tag LOCUS_14530 <5217 3689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97I68:DNA topoisomerase 1 >Feature sequence0306 >Feature sequence0307 <1 752 gene locus_tag LOCUS_14540 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KEQ0:protein TolB 756 1724 gene locus_tag LOCUS_14550 756 1724 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021206.1 protein_id gnl|my_center|LOCUS_14550 3592 1790 gene locus_tag LOCUS_14560 3592 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence0308 1784 828 gene locus_tag LOCUS_14570 1784 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337458.1 protein_id gnl|my_center|LOCUS_14570 2751 1771 gene locus_tag LOCUS_14580 2751 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4687 2735 gene locus_tag LOCUS_14590 gene asnB 4687 2735 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545305.1 protein_id gnl|my_center|LOCUS_14590 <5201 4691 gene locus_tag LOCUS_14600 <5201 4691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461034.1:glycosyl transferase >Feature sequence0309 34 1050 gene locus_tag LOCUS_14610 34 1050 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175128.1 protein_id gnl|my_center|LOCUS_14610 1763 1062 gene locus_tag LOCUS_14620 1763 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1934 3385 gene locus_tag LOCUS_14630 1934 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 3616 4110 gene locus_tag LOCUS_14640 3616 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence0310 796 611 gene locus_tag LOCUS_14650 796 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1034 1513 gene locus_tag LOCUS_14660 1034 1513 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023960.1 protein_id gnl|my_center|LOCUS_14660 1598 2284 gene locus_tag LOCUS_14670 1598 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2296 2559 gene locus_tag LOCUS_14680 2296 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2782 3213 gene locus_tag LOCUS_14690 2782 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 3236 3943 gene locus_tag LOCUS_14700 3236 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence0311 1328 198 gene locus_tag LOCUS_14710 1328 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2261 1368 gene locus_tag LOCUS_14720 2261 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2917 2279 gene locus_tag LOCUS_14730 2917 2279 CDS product corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_14730 3645 2920 gene locus_tag LOCUS_14740 3645 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 5116 3653 gene locus_tag LOCUS_14750 gene mttB 5116 3653 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_14750 >Feature sequence0312 252 64 gene locus_tag LOCUS_14760 252 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 490 969 gene locus_tag LOCUS_14770 490 969 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_14770 971 1480 gene locus_tag LOCUS_14780 971 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1473 1961 gene locus_tag LOCUS_14790 1473 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1954 2142 gene locus_tag LOCUS_14800 1954 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 2139 3332 gene locus_tag LOCUS_14810 2139 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 3408 4274 gene locus_tag LOCUS_14820 gene mtnP 3408 4274 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_14820 >Feature sequence0313 <1 961 gene locus_tag LOCUS_14830 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462310.1:thioether cross-link-forming SCIFF peptide maturase 1036 1443 gene locus_tag LOCUS_14840 gene mceE 1036 1443 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_14840 1482 3563 gene locus_tag LOCUS_14850 1482 3563 CDS product amylopullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545008.1 protein_id gnl|my_center|LOCUS_14850 <5153 3577 gene locus_tag LOCUS_14860 <5153 3577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O31526:rhamnogalacturonan endolyase YesW >Feature sequence0314 <1 1450 gene locus_tag LOCUS_14870 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D note possible pseudo, frameshifted 1447 4617 gene locus_tag LOCUS_14880 1447 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14880 >Feature sequence0315 12 1010 gene locus_tag LOCUS_14890 12 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1293 997 gene locus_tag LOCUS_14900 1293 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 2431 1280 gene locus_tag LOCUS_14910 2431 1280 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_14910 3041 2415 gene locus_tag LOCUS_14920 3041 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3581 3060 gene locus_tag LOCUS_14930 3581 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14930 3790 3596 gene locus_tag LOCUS_14940 3790 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 4985 3801 gene locus_tag LOCUS_14950 4985 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence0316 <1 729 gene locus_tag LOCUS_14960 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226719.1:oxidoreductase 780 3041 gene locus_tag LOCUS_14970 780 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence0317 <1 1427 gene locus_tag LOCUS_14980 <1 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975035.1:CCA tRNA nucleotidyltransferase 2674 1424 gene locus_tag LOCUS_14990 2674 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3838 2753 gene locus_tag LOCUS_15000 3838 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 <5121 3831 gene locus_tag LOCUS_15010 <5121 3831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546582.1:two-component sensor histidine kinase >Feature sequence0318 <1 3995 gene locus_tag LOCUS_15020 <1 3995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024196.1:cell surface protein 4166 4372 gene locus_tag LOCUS_15030 4166 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4532 4936 gene locus_tag LOCUS_15040 4532 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence0319 242 721 gene locus_tag LOCUS_15050 242 721 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584034.1 protein_id gnl|my_center|LOCUS_15050 718 1965 gene locus_tag LOCUS_15060 718 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1978 4710 gene locus_tag LOCUS_15070 1978 4710 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence0320 <1 627 gene locus_tag LOCUS_15080 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZH5:aldose 1-epimerase 2384 711 gene locus_tag LOCUS_15090 2384 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 3164 2397 gene locus_tag LOCUS_15100 3164 2397 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563574.1 protein_id gnl|my_center|LOCUS_15100 4841 3330 gene locus_tag LOCUS_15110 4841 3330 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403783.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence0321 1958 1023 gene locus_tag LOCUS_15120 gene dus 1958 1023 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XW84 protein_id gnl|my_center|LOCUS_15120 2669 1974 gene locus_tag LOCUS_15130 2669 1974 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921110.1 protein_id gnl|my_center|LOCUS_15130 3118 2666 gene locus_tag LOCUS_15140 gene mosC 3118 2666 CDS product molybdenum cofactor sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943767.1 protein_id gnl|my_center|LOCUS_15140 3635 3144 gene locus_tag LOCUS_15150 3635 3144 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817323.1 protein_id gnl|my_center|LOCUS_15150 4074 3622 gene locus_tag LOCUS_15160 4074 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15160 4829 4206 gene locus_tag LOCUS_15170 4829 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence0322 127 1083 gene locus_tag LOCUS_15180 127 1083 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877608.1 protein_id gnl|my_center|LOCUS_15180 1108 1872 gene locus_tag LOCUS_15190 1108 1872 CDS product molybdenum ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877607.1 protein_id gnl|my_center|LOCUS_15190 1869 2882 gene locus_tag LOCUS_15200 1869 2882 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020340.1 protein_id gnl|my_center|LOCUS_15200 2897 4066 gene locus_tag LOCUS_15210 2897 4066 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257970.1 protein_id gnl|my_center|LOCUS_15210 4050 4856 gene locus_tag LOCUS_15220 gene moaA 4050 4856 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747W9 protein_id gnl|my_center|LOCUS_15220 >Feature sequence0323 412 206 gene locus_tag LOCUS_15230 412 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 736 536 gene locus_tag LOCUS_15240 736 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1510 1142 gene locus_tag LOCUS_15250 1510 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1840 2892 gene locus_tag LOCUS_15260 gene dmt 1840 2892 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_15260 2864 4036 gene locus_tag LOCUS_15270 2864 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence0324 1006 2442 gene locus_tag LOCUS_15280 1006 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2643 5042 gene locus_tag LOCUS_15290 2643 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence0325 <1 2273 gene locus_tag LOCUS_15300 <1 2273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39846:plipastatin synthase subunit B >Feature sequence0326 2451 1810 gene locus_tag LOCUS_15310 2451 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2611 3816 gene locus_tag LOCUS_15320 2611 3816 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O54099 protein_id gnl|my_center|LOCUS_15320 >Feature sequence0327 <1 640 gene locus_tag LOCUS_15330 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105268.1:lipopolysaccharide heptosyltransferase II 612 1781 gene locus_tag LOCUS_15340 612 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1778 2767 gene locus_tag LOCUS_15350 gene rfaE 1778 2767 CDS product RfaE bifunctional protein, domain I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_15350 2988 3707 gene locus_tag LOCUS_15360 2988 3707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546539.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence0328 610 1650 gene locus_tag LOCUS_15370 610 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1791 4976 gene locus_tag LOCUS_15380 1791 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence0329 48 962 gene locus_tag LOCUS_15390 48 962 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462401.1 protein_id gnl|my_center|LOCUS_15390 973 2829 gene locus_tag LOCUS_15400 973 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2847 4964 gene locus_tag LOCUS_15410 2847 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence0330 2388 856 gene locus_tag LOCUS_15420 2388 856 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 protein_id gnl|my_center|LOCUS_15420 3395 2394 gene locus_tag LOCUS_15430 3395 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4827 3445 gene locus_tag LOCUS_15440 4827 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 >Feature sequence0331 <5017 2672 gene locus_tag LOCUS_15450 <5017 2672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760378.1:hybrid sensor histidine kinase/response regulator >Feature sequence0332 2559 1135 gene locus_tag LOCUS_15460 gene gltX 2559 1135 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0A6 protein_id gnl|my_center|LOCUS_15460 >Feature sequence0333 <1 2259 gene locus_tag LOCUS_15470 <1 2259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895613.1:non-ribosomal peptide synthetase 347 261 gene locus_tag LOCUS_t00070 347 261 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2246 3634 gene locus_tag LOCUS_15480 2246 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence0334 1146 181 gene locus_tag LOCUS_15490 1146 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 2213 1254 gene locus_tag LOCUS_15500 2213 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 4176 2191 gene locus_tag LOCUS_15510 4176 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence0335 287 1507 gene locus_tag LOCUS_15520 287 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1578 2813 gene locus_tag LOCUS_15530 1578 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence0336 159 1394 gene locus_tag LOCUS_15540 159 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2843 1461 gene locus_tag LOCUS_15550 2843 1461 CDS product glutamyl-tRNA(Gln) amidotransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_15550 4828 2843 gene locus_tag LOCUS_15560 4828 2843 CDS product glutamyl-tRNA(Gln) amidotransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence0337 <1 895 gene locus_tag LOCUS_15570 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004291480.1:ATPase 1481 1074 gene locus_tag LOCUS_15580 1481 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1633 3246 gene locus_tag LOCUS_15590 1633 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4504 3317 gene locus_tag LOCUS_15600 4504 3317 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence0338 1638 106 gene locus_tag LOCUS_15610 1638 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1729 2970 gene locus_tag LOCUS_15620 1729 2970 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065079.1 protein_id gnl|my_center|LOCUS_15620 3561 3034 gene locus_tag LOCUS_15630 3561 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 4263 3727 gene locus_tag LOCUS_15640 4263 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 4864 4331 gene locus_tag LOCUS_15650 4864 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence0339 >Feature sequence0340 <1 973 gene locus_tag LOCUS_15660 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87QX5:glycogen synthase >Feature sequence0341 262 2277 gene locus_tag LOCUS_15670 gene uvrd 262 2277 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S575 protein_id gnl|my_center|LOCUS_15670 >Feature sequence0342 1203 85 gene locus_tag LOCUS_15680 1203 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 2266 1196 gene locus_tag LOCUS_15690 2266 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3246 2284 gene locus_tag LOCUS_15700 3246 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 4113 3256 gene locus_tag LOCUS_15710 4113 3256 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017012.1 protein_id gnl|my_center|LOCUS_15710 <4929 4103 gene locus_tag LOCUS_15720 <4929 4103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973141.1:glycosyl transferase >Feature sequence0343 37 480 gene locus_tag LOCUS_15730 37 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 480 1628 gene locus_tag LOCUS_15740 480 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1665 2489 gene locus_tag LOCUS_15750 1665 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3716 2514 gene locus_tag LOCUS_15760 3716 2514 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053636.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence0344 610 1416 gene locus_tag LOCUS_15770 610 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1430 3673 gene locus_tag LOCUS_15780 1430 3673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 3676 4380 gene locus_tag LOCUS_15790 3676 4380 CDS product chemotaxis protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545014.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence0345 27 641 gene locus_tag LOCUS_15800 27 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 757 2589 gene locus_tag LOCUS_15810 757 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 2662 4032 gene locus_tag LOCUS_15820 2662 4032 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence0346 3681 2236 gene locus_tag LOCUS_15830 gene rtcB 3681 2236 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHE5 protein_id gnl|my_center|LOCUS_15830 4172 3735 gene locus_tag LOCUS_15840 4172 3735 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869516.1 protein_id gnl|my_center|LOCUS_15840 4623 4357 gene locus_tag LOCUS_15850 4623 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence0347 <1 2991 gene locus_tag LOCUS_15860 <1 2991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39845:plipastatin synthase subunit A >Feature sequence0348 159 1529 gene locus_tag LOCUS_15870 159 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 1545 4607 gene locus_tag LOCUS_15880 1545 4607 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941497.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence0349 2751 37 gene locus_tag LOCUS_15890 2751 37 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404851.1 protein_id gnl|my_center|LOCUS_15890 3166 4455 gene locus_tag LOCUS_15900 3166 4455 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence0350 797 1318 gene locus_tag LOCUS_15910 797 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 1318 2544 gene locus_tag LOCUS_15920 1318 2544 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267770.1 protein_id gnl|my_center|LOCUS_15920 2562 2987 gene locus_tag LOCUS_15930 2562 2987 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402649.1 protein_id gnl|my_center|LOCUS_15930 2988 4043 gene locus_tag LOCUS_15940 2988 4043 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267771.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence0351 <1 1493 gene locus_tag LOCUS_15950 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030494.1:alpha-galactosidase 1867 1439 gene locus_tag LOCUS_15960 1867 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1979 2725 gene locus_tag LOCUS_15970 1979 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15970 4444 2777 gene locus_tag LOCUS_15980 gene rhlB 4444 2777 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FT4 protein_id gnl|my_center|LOCUS_15980 >Feature sequence0352 >Feature sequence0353 196 123 gene locus_tag LOCUS_t00080 196 123 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 911 255 gene locus_tag LOCUS_15990 911 255 CDS product 3'-exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938381.1 protein_id gnl|my_center|LOCUS_15990 1142 2053 gene locus_tag LOCUS_16000 1142 2053 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940340.1 protein_id gnl|my_center|LOCUS_16000 2456 2040 gene locus_tag LOCUS_16010 2456 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_16010 3431 2472 gene locus_tag LOCUS_16020 3431 2472 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404721.1 protein_id gnl|my_center|LOCUS_16020 4367 3441 gene locus_tag LOCUS_16030 4367 3441 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence0354 >Feature sequence0355 68 1480 gene locus_tag LOCUS_16040 68 1480 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763623.1 protein_id gnl|my_center|LOCUS_16040 1446 2651 gene locus_tag LOCUS_16050 1446 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877864.1 protein_id gnl|my_center|LOCUS_16050 4255 2732 gene locus_tag LOCUS_16060 gene hutH1 4255 2732 CDS product histidine ammonia-lyase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFC2 protein_id gnl|my_center|LOCUS_16060 4622 4461 gene locus_tag LOCUS_16070 4622 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence0356 309 1136 gene locus_tag LOCUS_16080 309 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1140 1985 gene locus_tag LOCUS_16090 1140 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1998 2738 gene locus_tag LOCUS_16100 1998 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2755 3543 gene locus_tag LOCUS_16110 2755 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence0357 >Feature sequence0358 >Feature sequence0359 >Feature sequence0360 959 588 gene locus_tag LOCUS_16120 959 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1420 956 gene locus_tag LOCUS_16130 1420 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1642 2037 gene locus_tag LOCUS_16140 1642 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 2528 2034 gene locus_tag LOCUS_16150 2528 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 3556 2525 gene locus_tag LOCUS_16160 gene recA 3556 2525 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58254 protein_id gnl|my_center|LOCUS_16160 4099 3608 gene locus_tag LOCUS_16170 4099 3608 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_16170 4414 4103 gene locus_tag LOCUS_16180 4414 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence0361 >Feature sequence0362 4364 858 gene locus_tag LOCUS_16190 4364 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence0363 3 1508 gene locus_tag LOCUS_16200 3 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1539 2063 gene locus_tag LOCUS_16210 gene dcd 1539 2063 CDS product deoxycytidine triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267773.1 protein_id gnl|my_center|LOCUS_16210 2074 4116 gene locus_tag LOCUS_16220 2074 4116 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267774.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence0364 >Feature sequence0365 <1 885 gene locus_tag LOCUS_16230 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760595.1:hemolysin D 882 4130 gene locus_tag LOCUS_16240 882 4130 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072023.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence0366 793 503 gene locus_tag LOCUS_16250 793 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 1003 2967 gene locus_tag LOCUS_16260 1003 2967 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108263.1 protein_id gnl|my_center|LOCUS_16260 2964 4760 gene locus_tag LOCUS_16270 2964 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence0367 676 2784 gene locus_tag LOCUS_16280 676 2784 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_16280 3762 2788 gene locus_tag LOCUS_16290 3762 2788 CDS product corrinoid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_16290 4517 3762 gene locus_tag LOCUS_16300 4517 3762 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901765.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence0368 3076 257 gene locus_tag LOCUS_16310 3076 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3804 3559 gene locus_tag LOCUS_16320 3804 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3947 4675 gene locus_tag LOCUS_16330 3947 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence0369 738 4076 gene locus_tag LOCUS_16340 738 4076 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957290.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence0370 87 1004 gene locus_tag LOCUS_16350 87 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 1458 2519 gene locus_tag LOCUS_16360 gene prfB 1458 2519 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1R5 protein_id gnl|my_center|LOCUS_16360 >Feature sequence0371 1096 146 gene locus_tag LOCUS_16370 1096 146 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP3 protein_id gnl|my_center|LOCUS_16370 1892 1077 gene locus_tag LOCUS_16380 gene lgt 1892 1077 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66627 protein_id gnl|my_center|LOCUS_16380 2350 1910 gene locus_tag LOCUS_16390 gene lspA 2350 1910 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Y0 protein_id gnl|my_center|LOCUS_16390 <4743 2382 gene locus_tag LOCUS_16400 <4743 2382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YJT1:isoleucine--tRNA ligase >Feature sequence0372 263 463 gene locus_tag LOCUS_16410 263 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1732 548 gene locus_tag LOCUS_16420 1732 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3506 1689 gene locus_tag LOCUS_16430 3506 1689 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161615.1 protein_id gnl|my_center|LOCUS_16430 3762 3598 gene locus_tag LOCUS_16440 3762 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4052 3891 gene locus_tag LOCUS_16450 4052 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence0373 341 1996 gene locus_tag LOCUS_16460 341 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2721 1993 gene locus_tag LOCUS_16470 2721 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2916 2843 gene locus_tag LOCUS_t00090 2916 2843 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3061 3804 gene locus_tag LOCUS_16480 3061 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence0374 >Feature sequence0375 >Feature sequence0376 <4724 2522 gene locus_tag LOCUS_16490 <4724 2522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O31782:polyketide synthase PksN >Feature sequence0377 2453 1860 gene locus_tag LOCUS_16500 2453 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2992 2501 gene locus_tag LOCUS_16510 2992 2501 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938003.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence0378 62 2176 gene locus_tag LOCUS_16520 gene bfeA 62 2176 CDS product outer membrane receptor FepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931191.1 protein_id gnl|my_center|LOCUS_16520 2498 3328 gene locus_tag LOCUS_16530 2498 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 3309 4391 gene locus_tag LOCUS_16540 3309 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080873.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence0379 1497 559 gene locus_tag LOCUS_16550 1497 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2254 1499 gene locus_tag LOCUS_16560 2254 1499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938541.1 protein_id gnl|my_center|LOCUS_16560 3328 2255 gene locus_tag LOCUS_16570 3328 2255 CDS product toluene ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531885.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence0380 2661 2089 gene locus_tag LOCUS_16580 2661 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 3221 2658 gene locus_tag LOCUS_16590 3221 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 4314 3193 gene locus_tag LOCUS_16600 4314 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence0381 2017 2241 gene locus_tag LOCUS_16610 2017 2241 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760626.1 protein_id gnl|my_center|LOCUS_16610 2253 3311 gene locus_tag LOCUS_16620 2253 3311 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_16620 3322 4080 gene locus_tag LOCUS_16630 3322 4080 CDS product 2-oxoglutarate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786495.1 protein_id gnl|my_center|LOCUS_16630 4092 4631 gene locus_tag LOCUS_16640 4092 4631 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence0382 >Feature sequence0383 1598 591 gene locus_tag LOCUS_16650 1598 591 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268559.1 protein_id gnl|my_center|LOCUS_16650 2581 1595 gene locus_tag LOCUS_16660 2581 1595 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946498.1 protein_id gnl|my_center|LOCUS_16660 3763 2585 gene locus_tag LOCUS_16670 3763 2585 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966332.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence0384 1410 724 gene locus_tag LOCUS_16680 1410 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1636 3621 gene locus_tag LOCUS_16690 1636 3621 CDS product DMSO reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459173.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence0385 143 1513 gene locus_tag LOCUS_16700 143 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1514 2455 gene locus_tag LOCUS_16710 1514 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031495.1 protein_id gnl|my_center|LOCUS_16710 2430 3809 gene locus_tag LOCUS_16720 2430 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence0386 <4653 3067 gene locus_tag LOCUS_16730 <4653 3067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0387 >Feature sequence0388 2178 958 gene locus_tag LOCUS_16740 2178 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3310 2225 gene locus_tag LOCUS_16750 3310 2225 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_16750 <4634 3331 gene locus_tag LOCUS_16760 <4634 3331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057486.1:ABC transporter ATP-binding protein >Feature sequence0389 <1 1100 gene locus_tag LOCUS_16770 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020134.1:inositol-3-phosphate synthase 1105 2844 gene locus_tag LOCUS_16780 1105 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2841 4103 gene locus_tag LOCUS_16790 2841 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 <4634 4096 gene locus_tag LOCUS_16800 <4634 4096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6UBM7:2-amino-3-ketobutyrate coenzyme A ligase >Feature sequence0390 >Feature sequence0391 1376 291 gene locus_tag LOCUS_16810 1376 291 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_16810 2635 1445 gene locus_tag LOCUS_16820 2635 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 3927 2734 gene locus_tag LOCUS_16830 3927 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence0392 639 133 gene locus_tag LOCUS_16840 639 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 804 1226 gene locus_tag LOCUS_16850 804 1226 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957569.1 protein_id gnl|my_center|LOCUS_16850 1813 1295 gene locus_tag LOCUS_16860 1813 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 3010 1925 gene locus_tag LOCUS_16870 gene ychF 3010 1925 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEV1 protein_id gnl|my_center|LOCUS_16870 3613 3038 gene locus_tag LOCUS_16880 3613 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3936 3850 gene locus_tag LOCUS_t00100 3936 3850 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <4598 3947 gene locus_tag LOCUS_16890 <4598 3947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545721.1:integrase >Feature sequence0393 <1 1039 gene locus_tag LOCUS_16900 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141291.1:Mg-protoporphyrin IX monomethyl ester oxidative cyclase >Feature sequence0394 2526 1402 gene locus_tag LOCUS_16910 2526 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3129 2542 gene locus_tag LOCUS_16920 3129 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 3799 3122 gene locus_tag LOCUS_16930 3799 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 4490 3807 gene locus_tag LOCUS_16940 4490 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence0395 4571 4410 gene locus_tag LOCUS_16950 4571 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence0396 1580 354 gene locus_tag LOCUS_16960 1580 354 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941549.1 protein_id gnl|my_center|LOCUS_16960 1894 2397 gene locus_tag LOCUS_16970 1894 2397 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812063.1 protein_id gnl|my_center|LOCUS_16970 <4568 2415 gene locus_tag LOCUS_16980 <4568 2415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790471.1:phosphoenolpyruvate synthase >Feature sequence0397 48 422 gene locus_tag LOCUS_16990 48 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 422 883 gene locus_tag LOCUS_17000 422 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 889 1227 gene locus_tag LOCUS_17010 889 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987057.1 protein_id gnl|my_center|LOCUS_17010 1227 2453 gene locus_tag LOCUS_17020 1227 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2450 3727 gene locus_tag LOCUS_17030 2450 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence0398 667 278 gene locus_tag LOCUS_17040 667 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1234 1584 gene locus_tag LOCUS_17050 1234 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1912 1574 gene locus_tag LOCUS_17060 1912 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2243 2848 gene locus_tag LOCUS_17070 2243 2848 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_17070 2845 3591 gene locus_tag LOCUS_17080 2845 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence0399 645 466 gene locus_tag LOCUS_17090 645 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2320 746 gene locus_tag LOCUS_17100 2320 746 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017113.1 protein_id gnl|my_center|LOCUS_17100 3534 2317 gene locus_tag LOCUS_17110 3534 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 4170 3574 gene locus_tag LOCUS_17120 4170 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence0400 1181 405 gene locus_tag LOCUS_17130 1181 405 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198263.1 protein_id gnl|my_center|LOCUS_17130 1976 1203 gene locus_tag LOCUS_17140 gene pksH 1976 1203 CDS product putative polyketide biosynthesis enoyl-CoA hydratase PksH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40805 protein_id gnl|my_center|LOCUS_17140 3258 1981 gene locus_tag LOCUS_17150 gene pksG 3258 1981 CDS product polyketide biosynthesis 3-hydroxy-3-methylglutaryl-ACP synthase PksG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40830 protein_id gnl|my_center|LOCUS_17150 3490 3251 gene locus_tag LOCUS_17160 3490 3251 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198264.1 protein_id gnl|my_center|LOCUS_17160 4523 3516 gene locus_tag LOCUS_17170 4523 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence0401 60 425 gene locus_tag LOCUS_17180 60 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 422 1321 gene locus_tag LOCUS_17190 422 1321 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082725.1 protein_id gnl|my_center|LOCUS_17190 1325 2269 gene locus_tag LOCUS_17200 1325 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082729.1 protein_id gnl|my_center|LOCUS_17200 2386 3822 gene locus_tag LOCUS_17210 2386 3822 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868031.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence0402 1 435 gene locus_tag LOCUS_17220 1 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 441 1289 gene locus_tag LOCUS_17230 gene glyQ 441 1289 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67081 protein_id gnl|my_center|LOCUS_17230 1291 3354 gene locus_tag LOCUS_17240 gene glyS 1291 3354 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182B8 protein_id gnl|my_center|LOCUS_17240 >Feature sequence0403 >Feature sequence0404 251 1570 gene locus_tag LOCUS_17250 251 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1545 2795 gene locus_tag LOCUS_17260 gene aroA 1545 2795 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187E3 protein_id gnl|my_center|LOCUS_17260 2788 3759 gene locus_tag LOCUS_17270 2788 3759 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867581.1 protein_id gnl|my_center|LOCUS_17270 3858 4256 gene locus_tag LOCUS_17280 3858 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence0405 >Feature sequence0406 <1 1094 gene locus_tag LOCUS_17290 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004203365.1:B12-binding domain-containing radical SAM protein 1105 1872 gene locus_tag LOCUS_17300 1105 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1874 3157 gene locus_tag LOCUS_17310 1874 3157 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence0407 1555 44 gene locus_tag LOCUS_17320 1555 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 3331 1820 gene locus_tag LOCUS_17330 3331 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 3613 4341 gene locus_tag LOCUS_17340 gene smuG1 3613 4341 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_17340 4485 4351 gene locus_tag LOCUS_17350 4485 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence0408 1021 3966 gene locus_tag LOCUS_17360 1021 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4431 3973 gene locus_tag LOCUS_17370 4431 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence0409 2234 393 gene locus_tag LOCUS_17380 2234 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence0410 1387 284 gene locus_tag LOCUS_17390 1387 284 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262044.1 protein_id gnl|my_center|LOCUS_17390 3496 1457 gene locus_tag LOCUS_17400 3496 1457 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640383.1 protein_id gnl|my_center|LOCUS_17400 4277 3975 gene locus_tag LOCUS_17410 4277 3975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence0411 >Feature sequence0412 933 46 gene locus_tag LOCUS_17420 933 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1010 1564 gene locus_tag LOCUS_17430 1010 1564 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189B1 protein_id gnl|my_center|LOCUS_17430 2572 1541 gene locus_tag LOCUS_17440 2572 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3240 2569 gene locus_tag LOCUS_17450 3240 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 4342 3344 gene locus_tag LOCUS_17460 4342 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence0413 3117 73 gene locus_tag LOCUS_17470 3117 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence0414 580 32 gene locus_tag LOCUS_17480 580 32 CDS product nucleoside-triphosphatase THEP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WXP3 protein_id gnl|my_center|LOCUS_17480 1718 624 gene locus_tag LOCUS_17490 1718 624 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061731.1 protein_id gnl|my_center|LOCUS_17490 2137 1778 gene locus_tag LOCUS_17500 2137 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 <4449 2548 gene locus_tag LOCUS_17510 <4449 2548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814652.1:DNA polymerase III subunit alpha >Feature sequence0415 <1 2636 gene locus_tag LOCUS_17520 <1 2636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391709.1:ATP-dependent Clp protease ATP-binding subunit ClpC 2653 3987 gene locus_tag LOCUS_17530 2653 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence0416 >Feature sequence0417 2385 1315 gene locus_tag LOCUS_17540 2385 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2554 2369 gene locus_tag LOCUS_17550 2554 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 3054 3479 gene locus_tag LOCUS_17560 3054 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence0418 <1 728 gene locus_tag LOCUS_17570 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460040.1:molecular chaperone HtpG 882 2405 gene locus_tag LOCUS_17580 882 2405 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI85 protein_id gnl|my_center|LOCUS_17580 2477 4174 gene locus_tag LOCUS_17590 gene ggtB 2477 4174 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_17590 4324 4400 gene locus_tag LOCUS_t00110 4324 4400 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0419 1105 473 gene locus_tag LOCUS_17600 1105 473 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_17600 4340 1098 gene locus_tag LOCUS_17610 4340 1098 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence0420 2104 380 gene locus_tag LOCUS_17620 2104 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2914 2162 gene locus_tag LOCUS_17630 2914 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 3117 3935 gene locus_tag LOCUS_17640 3117 3935 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973653.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence0421 2347 2598 gene locus_tag LOCUS_17650 2347 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3239 2595 gene locus_tag LOCUS_17660 3239 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence0422 176 976 gene locus_tag LOCUS_17670 176 976 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM6 protein_id gnl|my_center|LOCUS_17670 981 1943 gene locus_tag LOCUS_17680 981 1943 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940727.1 protein_id gnl|my_center|LOCUS_17680 2014 2289 gene locus_tag LOCUS_17690 2014 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2352 4127 gene locus_tag LOCUS_17700 2352 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence0423 85 1389 gene locus_tag LOCUS_17710 85 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17710 1413 4010 gene locus_tag LOCUS_17720 1413 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence0424 <1 1623 gene locus_tag LOCUS_17730 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000847259.1:sulfatase 2033 1626 gene locus_tag LOCUS_17740 2033 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2232 3143 gene locus_tag LOCUS_17750 gene serA 2232 3143 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253655.1 protein_id gnl|my_center|LOCUS_17750 3165 3962 gene locus_tag LOCUS_17760 3165 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 3979 4203 gene locus_tag LOCUS_17770 3979 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence0425 361 2703 gene locus_tag LOCUS_17780 361 2703 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459887.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence0426 2 3478 gene locus_tag LOCUS_17790 gene smc 2 3478 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIF1 protein_id gnl|my_center|LOCUS_17790 3494 4027 gene locus_tag LOCUS_17800 3494 4027 CDS product cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015829.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence0427 286 2946 gene locus_tag LOCUS_17810 286 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3269 4243 gene locus_tag LOCUS_17820 3269 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence0428 155 877 gene locus_tag LOCUS_17830 155 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 882 1556 gene locus_tag LOCUS_17840 gene rpe1 882 1556 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182R3 protein_id gnl|my_center|LOCUS_17840 1553 2389 gene locus_tag LOCUS_17850 1553 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2376 3938 gene locus_tag LOCUS_17860 gene uvrC 2376 3938 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU8 protein_id gnl|my_center|LOCUS_17860 4009 4182 gene locus_tag LOCUS_17870 4009 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence0429 2673 4133 gene locus_tag LOCUS_17880 2673 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence0430 1632 3581 gene locus_tag LOCUS_17890 1632 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence0431 <1 1695 gene locus_tag LOCUS_17900 <1 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D 1834 3504 gene locus_tag LOCUS_17910 1834 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence0432 108 533 gene locus_tag LOCUS_17920 gene glmS 108 533 CDS product glutamate mutase sigma subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0H6 protein_id gnl|my_center|LOCUS_17920 562 2016 gene locus_tag LOCUS_17930 gene glmE 562 2016 CDS product glutamate mutase epsilon subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0H4 protein_id gnl|my_center|LOCUS_17930 2085 3518 gene locus_tag LOCUS_17940 2085 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460942.1 protein_id gnl|my_center|LOCUS_17940 3787 4209 gene locus_tag LOCUS_17950 3787 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence0433 >Feature sequence0434 282 1517 gene locus_tag LOCUS_17960 282 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1970 1554 gene locus_tag LOCUS_17970 1970 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868374.1 protein_id gnl|my_center|LOCUS_17970 2365 1970 gene locus_tag LOCUS_17980 2365 1970 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867143.1 protein_id gnl|my_center|LOCUS_17980 3301 2486 gene locus_tag LOCUS_17990 3301 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 3730 3341 gene locus_tag LOCUS_18000 3730 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence0435 <1 938 gene locus_tag LOCUS_18010 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979599.1:peptidase U32 951 1745 gene locus_tag LOCUS_18020 951 1745 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence0436 414 947 gene locus_tag LOCUS_18030 gene pyrE 414 947 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727B2 protein_id gnl|my_center|LOCUS_18030 1997 1017 gene locus_tag LOCUS_18040 1997 1017 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_18040 2303 3436 gene locus_tag LOCUS_18050 2303 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3505 3678 gene locus_tag LOCUS_18060 3505 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence0437 <1 919 gene locus_tag LOCUS_18070 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942285.1:cytochrome ubiquinol oxidase subunit I 281 370 gene locus_tag LOCUS_t00120 281 370 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 932 1927 gene locus_tag LOCUS_18080 932 1927 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461541.1 protein_id gnl|my_center|LOCUS_18080 2023 2949 gene locus_tag LOCUS_18090 2023 2949 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738027.1 protein_id gnl|my_center|LOCUS_18090 2942 3847 gene locus_tag LOCUS_18100 2942 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence0438 1 2796 gene locus_tag LOCUS_18110 1 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence0439 <1 3019 gene locus_tag LOCUS_18120 <1 3019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 3056 3973 gene locus_tag LOCUS_18130 3056 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890818.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence0440 2495 1788 gene locus_tag LOCUS_18140 2495 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 2898 2446 gene locus_tag LOCUS_18150 2898 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 3084 3572 gene locus_tag LOCUS_18160 3084 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 <4246 3576 gene locus_tag LOCUS_18170 <4246 3576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66874:penicillin-binding protein 1A >Feature sequence0441 159 2264 gene locus_tag LOCUS_18180 gene lptD 159 2264 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EB96 protein_id gnl|my_center|LOCUS_18180 2308 3198 gene locus_tag LOCUS_18190 2308 3198 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence0442 2115 898 gene locus_tag LOCUS_18200 2115 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 3000 2197 gene locus_tag LOCUS_18210 3000 2197 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016715.1 protein_id gnl|my_center|LOCUS_18210 3354 3443 gene locus_tag LOCUS_t00130 3354 3443 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4235 3501 gene locus_tag LOCUS_18220 4235 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence0443 2697 1162 gene locus_tag LOCUS_18230 2697 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3263 2694 gene locus_tag LOCUS_18240 3263 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 4210 3260 gene locus_tag LOCUS_18250 4210 3260 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence0444 <1 1502 gene locus_tag LOCUS_18260 <1 1502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KFZ5:GMP synthase [glutamine-hydrolyzing] >Feature sequence0445 830 1429 gene locus_tag LOCUS_18270 830 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1993 3567 gene locus_tag LOCUS_18280 1993 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence0446 227 1165 gene locus_tag LOCUS_18290 227 1165 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942637.1 protein_id gnl|my_center|LOCUS_18290 <4214 1204 gene locus_tag LOCUS_18300 <4214 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039298.1:Oar protein >Feature sequence0447 383 1504 gene locus_tag LOCUS_18310 383 1504 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_18310 2436 1501 gene locus_tag LOCUS_18320 2436 1501 CDS product cysteine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023152.1 protein_id gnl|my_center|LOCUS_18320 3100 2552 gene locus_tag LOCUS_18330 3100 2552 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868967.1 protein_id gnl|my_center|LOCUS_18330 3234 4136 gene locus_tag LOCUS_18340 3234 4136 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986545.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence0448 277 1008 gene locus_tag LOCUS_18350 277 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1120 2631 gene locus_tag LOCUS_18360 1120 2631 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065873.1 protein_id gnl|my_center|LOCUS_18360 2634 3257 gene locus_tag LOCUS_18370 2634 3257 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_18370 3270 4196 gene locus_tag LOCUS_18380 gene xerD 3270 4196 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ2 protein_id gnl|my_center|LOCUS_18380 >Feature sequence0449 4205 807 gene locus_tag LOCUS_18390 4205 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence0450 1493 861 gene locus_tag LOCUS_18400 1493 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2727 1501 gene locus_tag LOCUS_18410 2727 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 4016 2727 gene locus_tag LOCUS_18420 4016 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence0451 <1 1883 gene locus_tag LOCUS_18430 <1 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008659317.1:ABC transporter permease 2000 3946 gene locus_tag LOCUS_18440 2000 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 >Feature sequence0452 >Feature sequence0453 3755 2070 gene locus_tag LOCUS_18450 3755 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 4178 3795 gene locus_tag LOCUS_18460 4178 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence0454 <1 1360 gene locus_tag LOCUS_18470 <1 1360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546673.1:outer membrane protein, OMP85 family 1350 2036 gene locus_tag LOCUS_18480 1350 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 2033 2998 gene locus_tag LOCUS_18490 gene yhaM 2033 2998 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07521 protein_id gnl|my_center|LOCUS_18490 3010 3318 gene locus_tag LOCUS_18500 3010 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence0455 <4167 84 gene locus_tag LOCUS_18510 <4167 84 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P40872:polyketide synthase PksM >Feature sequence0456 1973 1275 gene locus_tag LOCUS_18520 gene menG 1973 1275 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH76 protein_id gnl|my_center|LOCUS_18520 2825 2064 gene locus_tag LOCUS_18530 2825 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 4113 2827 gene locus_tag LOCUS_18540 4113 2827 CDS product Cys-rich peptide radical SAM maturase CcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860654.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence0457 375 746 gene locus_tag LOCUS_18550 375 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 772 1380 gene locus_tag LOCUS_18560 772 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence0458 <1 636 gene locus_tag LOCUS_18570 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67908:CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase 626 994 gene locus_tag LOCUS_18580 626 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 987 1886 gene locus_tag LOCUS_18590 987 1886 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461526.1 protein_id gnl|my_center|LOCUS_18590 2927 1968 gene locus_tag LOCUS_18600 2927 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 4061 2946 gene locus_tag LOCUS_18610 4061 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence0459 >Feature sequence0460 3652 2246 gene locus_tag LOCUS_18620 3652 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4057 3674 gene locus_tag LOCUS_18630 4057 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence0461 1853 498 gene locus_tag LOCUS_18640 gene gdhA 1853 498 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVJ7 protein_id gnl|my_center|LOCUS_18640 2040 2612 gene locus_tag LOCUS_18650 gene gmhA 2040 2612 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJT7 protein_id gnl|my_center|LOCUS_18650 >Feature sequence0462 3838 2471 gene locus_tag LOCUS_18660 3838 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence0463 <1 3941 gene locus_tag LOCUS_18670 <1 3941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108776.1:hybrid sensor histidine kinase/response regulator >Feature sequence0464 1638 412 gene locus_tag LOCUS_18680 1638 412 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_18680 2863 1649 gene locus_tag LOCUS_18690 2863 1649 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_18690 3630 2866 gene locus_tag LOCUS_18700 3630 2866 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_18700 4129 3680 gene locus_tag LOCUS_18710 4129 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence0465 4124 3138 gene locus_tag LOCUS_18720 4124 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence0466 <4119 1491 gene locus_tag LOCUS_18730 <4119 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D note possible pseudo, internal stop codon, frameshifted >Feature sequence0467 1005 631 gene locus_tag LOCUS_18740 1005 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1337 2659 gene locus_tag LOCUS_18750 1337 2659 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_18750 2756 3673 gene locus_tag LOCUS_18760 2756 3673 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence0468 992 225 gene locus_tag LOCUS_18770 992 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18770 1645 989 gene locus_tag LOCUS_18780 1645 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18780 2652 1645 gene locus_tag LOCUS_18790 gene gapA 2652 1645 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CP4 protein_id gnl|my_center|LOCUS_18790 >Feature sequence0469 >Feature sequence0470 <1 940 gene locus_tag LOCUS_18800 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D 944 1957 gene locus_tag LOCUS_18810 944 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1954 2796 gene locus_tag LOCUS_18820 1954 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence0471 >Feature sequence0472 <1 733 gene locus_tag LOCUS_18830 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207017.1:2,3-diaminopropionate biosynthesis protein SbnA <4085 730 gene locus_tag LOCUS_18840 <4085 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181858.1:methionine synthase >Feature sequence0473 1250 267 gene locus_tag LOCUS_18850 1250 267 CDS product NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544981.1 protein_id gnl|my_center|LOCUS_18850 1812 1261 gene locus_tag LOCUS_18860 1812 1261 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545481.1 protein_id gnl|my_center|LOCUS_18860 4029 1822 gene locus_tag LOCUS_18870 4029 1822 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_18870 >Feature sequence0474 747 352 gene locus_tag LOCUS_18880 747 352 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_18880 941 2956 gene locus_tag LOCUS_18890 gene hutU 941 2956 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B987 protein_id gnl|my_center|LOCUS_18890 2975 3919 gene locus_tag LOCUS_18900 2975 3919 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727553.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence0475 335 2302 gene locus_tag LOCUS_18910 335 2302 CDS product retaining alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L0 protein_id gnl|my_center|LOCUS_18910 3178 2321 gene locus_tag LOCUS_18920 3178 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4060 3200 gene locus_tag LOCUS_18930 4060 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence0476 <1 2805 gene locus_tag LOCUS_18940 <1 2805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence0477 1252 344 gene locus_tag LOCUS_18950 1252 344 CDS product uptake hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811615.1 protein_id gnl|my_center|LOCUS_18950 1497 1754 gene locus_tag LOCUS_18960 1497 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392926.1 protein_id gnl|my_center|LOCUS_18960 1968 2291 gene locus_tag LOCUS_18970 1968 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2300 3151 gene locus_tag LOCUS_18980 2300 3151 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_18980 3138 4007 gene locus_tag LOCUS_18990 3138 4007 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545247.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence0478 1112 225 gene locus_tag LOCUS_19000 gene rfbA 1112 225 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y2R7 protein_id gnl|my_center|LOCUS_19000 1652 1263 gene locus_tag LOCUS_19010 1652 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3015 1699 gene locus_tag LOCUS_19020 3015 1699 CDS product channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266478.1 protein_id gnl|my_center|LOCUS_19020 3320 3150 gene locus_tag LOCUS_19030 3320 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 3857 3375 gene locus_tag LOCUS_19040 3857 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence0479 <1 1419 gene locus_tag LOCUS_19050 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887458.1:serine protease 1476 2708 gene locus_tag LOCUS_19060 gene pepT 1476 2708 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KH9 protein_id gnl|my_center|LOCUS_19060 >Feature sequence0480 <1 2426 gene locus_tag LOCUS_19070 <1 2426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A753:phosphoglycerate kinase 2446 3354 gene locus_tag LOCUS_19080 2446 3354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_19080 >Feature sequence0481 1383 1201 gene locus_tag LOCUS_19090 1383 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2132 1677 gene locus_tag LOCUS_19100 2132 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 3660 2089 gene locus_tag LOCUS_19110 gene nnr 3660 2089 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIM0 protein_id gnl|my_center|LOCUS_19110 >Feature sequence0482 1928 213 gene locus_tag LOCUS_19120 1928 213 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_19120 2626 1931 gene locus_tag LOCUS_19130 2626 1931 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941396.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence0483 >Feature sequence0484 903 310 gene locus_tag LOCUS_19140 903 310 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T35 protein_id gnl|my_center|LOCUS_19140 1486 887 gene locus_tag LOCUS_19150 1486 887 CDS product electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T34 protein_id gnl|my_center|LOCUS_19150 2453 1479 gene locus_tag LOCUS_19160 2453 1479 CDS product electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA46 protein_id gnl|my_center|LOCUS_19160 3790 2450 gene locus_tag LOCUS_19170 3790 2450 CDS product electron transport complex subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA47 protein_id gnl|my_center|LOCUS_19170 >Feature sequence0485 2253 1015 gene locus_tag LOCUS_19180 2253 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082638.1 protein_id gnl|my_center|LOCUS_19180 2514 3968 gene locus_tag LOCUS_19190 2514 3968 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022613.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence0486 46 741 gene locus_tag LOCUS_19200 46 741 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942049.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19200 781 957 gene locus_tag LOCUS_19210 781 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 1544 954 gene locus_tag LOCUS_19220 gene pth 1544 954 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73Q01 protein_id gnl|my_center|LOCUS_19220 1592 2158 gene locus_tag LOCUS_19230 1592 2158 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937344.1 protein_id gnl|my_center|LOCUS_19230 2879 2139 gene locus_tag LOCUS_19240 gene cutC 2879 2139 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZG1 protein_id gnl|my_center|LOCUS_19240 <3990 2876 gene locus_tag LOCUS_19250 <3990 2876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704211.1:beta-N-acetylhexosaminidase >Feature sequence0487 2658 1555 gene locus_tag LOCUS_19260 2658 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021093.1 protein_id gnl|my_center|LOCUS_19260 <3978 2669 gene locus_tag LOCUS_19270 <3978 2669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021092.1:capsular polysaccharide biosynthesis protein >Feature sequence0488 621 1160 gene locus_tag LOCUS_19280 621 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1233 1616 gene locus_tag LOCUS_19290 1233 1616 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925584.1 protein_id gnl|my_center|LOCUS_19290 2602 1625 gene locus_tag LOCUS_19300 2602 1625 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986893.1 protein_id gnl|my_center|LOCUS_19300 2958 2647 gene locus_tag LOCUS_19310 2958 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811823.1 protein_id gnl|my_center|LOCUS_19310 3233 3757 gene locus_tag LOCUS_19320 3233 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence0489 <1 1667 gene locus_tag LOCUS_19330 <1 1667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108607.1:hybrid sensor histidine kinase/response regulator 1725 2789 gene locus_tag LOCUS_19340 1725 2789 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550405.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence0490 2062 716 gene locus_tag LOCUS_19350 2062 716 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDZ6 protein_id gnl|my_center|LOCUS_19350 3108 2059 gene locus_tag LOCUS_19360 3108 2059 CDS product phosphate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932577.1 protein_id gnl|my_center|LOCUS_19360 <3956 3243 gene locus_tag LOCUS_19370 <3956 3243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932575.1:phosphate ABC transporter substrate-binding protein >Feature sequence0491 <1 989 gene locus_tag LOCUS_19380 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958440.1:ATPase 1067 2629 gene locus_tag LOCUS_19390 1067 2629 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037766.1 protein_id gnl|my_center|LOCUS_19390 2629 3009 gene locus_tag LOCUS_19400 2629 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence0492 529 131 gene locus_tag LOCUS_19410 529 131 CDS product penicillinase repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257725.1 protein_id gnl|my_center|LOCUS_19410 3262 734 gene locus_tag LOCUS_19420 3262 734 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405440.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence0493 431 249 gene locus_tag LOCUS_19430 431 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 1768 443 gene locus_tag LOCUS_19440 1768 443 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388548.1 protein_id gnl|my_center|LOCUS_19440 2529 1765 gene locus_tag LOCUS_19450 2529 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 3332 2532 gene locus_tag LOCUS_19460 3332 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 <3945 3322 gene locus_tag LOCUS_19470 <3945 3322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391922.1:ketoisovalerate ferredoxin oxidoreductase subunit beta >Feature sequence0494 1005 85 gene locus_tag LOCUS_19480 1005 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 1399 1037 gene locus_tag LOCUS_19490 1399 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1567 2637 gene locus_tag LOCUS_19500 1567 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67300 protein_id gnl|my_center|LOCUS_19500 2654 3205 gene locus_tag LOCUS_19510 2654 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence0495 <1 2545 gene locus_tag LOCUS_19520 <1 2545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103873.1:non-ribosomal peptide synthetase >Feature sequence0496 1348 1833 gene locus_tag LOCUS_19530 1348 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1830 2900 gene locus_tag LOCUS_19540 1830 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2915 3217 gene locus_tag LOCUS_19550 2915 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence0497 <1 768 gene locus_tag LOCUS_19560 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460477.1:carbon monoxide dehydrogenase 758 2698 gene locus_tag LOCUS_19570 gene cooS 758 2698 CDS product carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_19570 2700 3212 gene locus_tag LOCUS_19580 gene yiaI 2700 3212 CDS product electron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602576.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence0498 2 1342 gene locus_tag LOCUS_19590 gene ahcY 2 1342 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EH1 protein_id gnl|my_center|LOCUS_19590 1503 2588 gene locus_tag LOCUS_19600 1503 2588 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_19600 2756 3397 gene locus_tag LOCUS_19610 2756 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence0499 1096 389 gene locus_tag LOCUS_19620 1096 389 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195517.1 protein_id gnl|my_center|LOCUS_19620 2070 1102 gene locus_tag LOCUS_19630 gene ocd2 2070 1102 CDS product 2,3-diaminopropionate biosynthesis protein SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115662.1 protein_id gnl|my_center|LOCUS_19630 <3925 2122 gene locus_tag LOCUS_19640 <3925 2122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545305.1:asparagine synthetase B >Feature sequence0500 <1 1411 gene locus_tag LOCUS_19650 <1 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0501 1399 3213 gene locus_tag LOCUS_19660 1399 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_19660 <3914 3252 gene locus_tag LOCUS_19670 <3914 3252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941675.1:lytic transglycosylase >Feature sequence0502 <3913 1655 gene locus_tag LOCUS_19680 <3913 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39845:plipastatin synthase subunit A >Feature sequence0503 1785 1402 gene locus_tag LOCUS_19690 1785 1402 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403077.1 protein_id gnl|my_center|LOCUS_19690 <3911 2046 gene locus_tag LOCUS_19700 <3911 2046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939406.1:hybrid sensor histidine kinase/response regulator >Feature sequence0504 <3902 309 gene locus_tag LOCUS_19710 <3902 309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q04747:surfactin synthase subunit 2 >Feature sequence0505 >Feature sequence0506 >Feature sequence0507 46 729 gene locus_tag LOCUS_19720 46 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 740 2212 gene locus_tag LOCUS_19730 gene lysS 740 2212 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37477 protein_id gnl|my_center|LOCUS_19730 2209 3426 gene locus_tag LOCUS_19740 2209 3426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence0508 42 3002 gene locus_tag LOCUS_19750 42 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202205.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence0509 <1 501 gene locus_tag LOCUS_19760 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392004.1:ABC transporter permease 498 1343 gene locus_tag LOCUS_19770 498 1343 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970689.1 protein_id gnl|my_center|LOCUS_19770 1345 2208 gene locus_tag LOCUS_19780 1345 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence0510 3517 1121 gene locus_tag LOCUS_19790 3517 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence0511 133 804 gene locus_tag LOCUS_19800 gene phoU 133 804 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UP22 protein_id gnl|my_center|LOCUS_19800 850 1569 gene locus_tag LOCUS_19810 gene phoB 850 1569 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880155.1 protein_id gnl|my_center|LOCUS_19810 1566 3302 gene locus_tag LOCUS_19820 gene phoR 1566 3302 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_19820 <3865 3291 gene locus_tag LOCUS_19830 <3865 3291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932560.1:metallophosphoesterase >Feature sequence0512 >Feature sequence0513 1672 857 gene locus_tag LOCUS_19840 1672 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1792 2451 gene locus_tag LOCUS_19850 1792 2451 CDS product phosphorylated carbohydrates phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0Y1 protein_id gnl|my_center|LOCUS_19850 2494 3420 gene locus_tag LOCUS_19860 2494 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 >Feature sequence0514 352 164 gene locus_tag LOCUS_19870 352 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2334 364 gene locus_tag LOCUS_19880 2334 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 3848 2361 gene locus_tag LOCUS_19890 3848 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence0515 3647 3186 gene locus_tag LOCUS_19900 3647 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence0516 >Feature sequence0517 727 1788 gene locus_tag LOCUS_19910 727 1788 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880750.1 protein_id gnl|my_center|LOCUS_19910 1853 2758 gene locus_tag LOCUS_19920 1853 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2755 3714 gene locus_tag LOCUS_19930 2755 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence0518 <1 814 gene locus_tag LOCUS_19940 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IWD2:histidine--tRNA ligase 2709 913 gene locus_tag LOCUS_19950 2709 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108823.1 protein_id gnl|my_center|LOCUS_19950 >Feature sequence0519 68 1096 gene locus_tag LOCUS_19960 gene sbcD 68 1096 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBP0 protein_id gnl|my_center|LOCUS_19960 1214 3328 gene locus_tag LOCUS_19970 1214 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 <3834 3335 gene locus_tag LOCUS_19980 <3834 3335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706473.1:thioredoxin family protein >Feature sequence0520 >Feature sequence0521 1 123 gene locus_tag LOCUS_19990 1 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 133 834 gene locus_tag LOCUS_20000 133 834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393975.1 protein_id gnl|my_center|LOCUS_20000 1312 872 gene locus_tag LOCUS_20010 gene thi3 1312 872 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207653.1 protein_id gnl|my_center|LOCUS_20010 2637 1450 gene locus_tag LOCUS_20020 2637 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3114 2824 gene locus_tag LOCUS_20030 3114 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3530 3111 gene locus_tag LOCUS_20040 3530 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence0522 <1 856 gene locus_tag LOCUS_20050 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979599.1:peptidase U32 865 2295 gene locus_tag LOCUS_20060 865 2295 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_20060 2292 3731 gene locus_tag LOCUS_20070 2292 3731 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence0523 72 1937 gene locus_tag LOCUS_20080 72 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 >Feature sequence0524 >Feature sequence0525 2023 1936 gene locus_tag LOCUS_t00140 2023 1936 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3809 2190 gene locus_tag LOCUS_20090 3809 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence0526 621 205 gene locus_tag LOCUS_20100 gene speD 621 205 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D4YW51 protein_id gnl|my_center|LOCUS_20100 933 2855 gene locus_tag LOCUS_20110 gene dnaK 933 2855 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C922 protein_id gnl|my_center|LOCUS_20110 >Feature sequence0527 1406 1747 gene locus_tag LOCUS_20120 1406 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 3024 1744 gene locus_tag LOCUS_20130 gene hutI 3024 1744 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFF1 protein_id gnl|my_center|LOCUS_20130 <3809 3017 gene locus_tag LOCUS_20140 <3809 3017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748E1:cell division protein FtsZ >Feature sequence0528 65 550 gene locus_tag LOCUS_20150 65 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 547 2337 gene locus_tag LOCUS_20160 547 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 2334 3398 gene locus_tag LOCUS_20170 2334 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence0529 1897 533 gene locus_tag LOCUS_20180 1897 533 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_20180 2831 1890 gene locus_tag LOCUS_20190 2831 1890 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461580.1 protein_id gnl|my_center|LOCUS_20190 2960 3772 gene locus_tag LOCUS_20200 gene zupT 2960 3772 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AU0 protein_id gnl|my_center|LOCUS_20200 >Feature sequence0530 <1 756 gene locus_tag LOCUS_20210 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858560.1:2-oxoglutarate synthase subunit alpha 753 1619 gene locus_tag LOCUS_20220 gene oorB 753 1619 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885323.1 protein_id gnl|my_center|LOCUS_20220 1616 2161 gene locus_tag LOCUS_20230 gene oorC 1616 2161 CDS product 2-oxoglutarate:acceptor oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864641.1 protein_id gnl|my_center|LOCUS_20230 2288 3568 gene locus_tag LOCUS_20240 gene tyrS 2288 3568 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K7 protein_id gnl|my_center|LOCUS_20240 >Feature sequence0531 32 625 gene locus_tag LOCUS_20250 32 625 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963139.1 protein_id gnl|my_center|LOCUS_20250 783 1823 gene locus_tag LOCUS_20260 783 1823 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435926.1 protein_id gnl|my_center|LOCUS_20260 1858 2967 gene locus_tag LOCUS_20270 1858 2967 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876803.1 protein_id gnl|my_center|LOCUS_20270 2996 3670 gene locus_tag LOCUS_20280 2996 3670 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084072.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence0532 425 634 gene locus_tag LOCUS_20290 425 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 701 2239 gene locus_tag LOCUS_20300 701 2239 CDS product radical SAM peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993584.1 protein_id gnl|my_center|LOCUS_20300 2232 3524 gene locus_tag LOCUS_20310 2232 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203565.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence0533 15 812 gene locus_tag LOCUS_20320 gene ywqE 15 812 CDS product tyrosine-protein phosphatase YwqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96717 protein_id gnl|my_center|LOCUS_20320 818 2170 gene locus_tag LOCUS_20330 818 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2195 3610 gene locus_tag LOCUS_20340 2195 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 >Feature sequence0534 2374 62 gene locus_tag LOCUS_20350 gene lon 2374 62 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2J0 protein_id gnl|my_center|LOCUS_20350 3594 2371 gene locus_tag LOCUS_20360 gene clpX 3594 2371 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6W0 protein_id gnl|my_center|LOCUS_20360 >Feature sequence0535 267 566 gene locus_tag LOCUS_20370 267 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2690 567 gene locus_tag LOCUS_20380 2690 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence0536 1 714 gene locus_tag LOCUS_20390 1 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 1486 692 gene locus_tag LOCUS_20400 1486 692 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942276.1 protein_id gnl|my_center|LOCUS_20400 2193 1522 gene locus_tag LOCUS_20410 2193 1522 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_20410 3471 2233 gene locus_tag LOCUS_20420 3471 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 3752 3588 gene locus_tag LOCUS_20430 3752 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence0537 512 1057 gene locus_tag LOCUS_20440 512 1057 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081962.1 protein_id gnl|my_center|LOCUS_20440 1121 2200 gene locus_tag LOCUS_20450 1121 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 <3746 2197 gene locus_tag LOCUS_20460 <3746 2197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941478.1:PAS domain-containing sensor histidine kinase >Feature sequence0538 <1 739 gene locus_tag LOCUS_20470 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942422.1:type II secretion system protein 1790 810 gene locus_tag LOCUS_20480 1790 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence0539 282 1910 gene locus_tag LOCUS_20490 gene pruA 282 1910 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_20490 2073 2645 gene locus_tag LOCUS_20500 2073 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2661 2939 gene locus_tag LOCUS_20510 2661 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3506 2952 gene locus_tag LOCUS_20520 3506 2952 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022735.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence0540 3580 3101 gene locus_tag LOCUS_20530 3580 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence0541 2269 1160 gene locus_tag LOCUS_20540 2269 1160 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 protein_id gnl|my_center|LOCUS_20540 3238 2291 gene locus_tag LOCUS_20550 3238 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940235.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence0542 1945 1334 gene locus_tag LOCUS_20560 gene jag 1945 1334 CDS product DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001256122.1 protein_id gnl|my_center|LOCUS_20560 3630 1942 gene locus_tag LOCUS_20570 gene yidC 3630 1942 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLC7 protein_id gnl|my_center|LOCUS_20570 >Feature sequence0543 2719 1073 gene locus_tag LOCUS_20580 2719 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 <3718 2899 gene locus_tag LOCUS_20590 <3718 2899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249027.1:tungsten-containing oxidoreductase >Feature sequence0544 2231 1395 gene locus_tag LOCUS_20600 2231 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3109 2228 gene locus_tag LOCUS_20610 3109 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 3212 3093 gene locus_tag LOCUS_20620 3212 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence0545 981 22 gene locus_tag LOCUS_20630 981 22 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_20630 1595 2938 gene locus_tag LOCUS_20640 1595 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence0546 >Feature sequence0547 695 1546 gene locus_tag LOCUS_20650 695 1546 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878017.1 protein_id gnl|my_center|LOCUS_20650 1943 1551 gene locus_tag LOCUS_20660 1943 1551 CDS product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_20660 2608 1949 gene locus_tag LOCUS_20670 2608 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence0548 463 143 gene locus_tag LOCUS_20680 463 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1038 3548 gene locus_tag LOCUS_20690 1038 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence0549 706 1158 gene locus_tag LOCUS_20700 gene dtd 706 1158 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDC0 protein_id gnl|my_center|LOCUS_20700 2561 1185 gene locus_tag LOCUS_20710 gene trpB-2 2561 1185 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFX8 protein_id gnl|my_center|LOCUS_20710 2976 2671 gene locus_tag LOCUS_20720 2976 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence0550 1172 450 gene locus_tag LOCUS_20730 gene ste14 1172 450 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_20730 2222 1179 gene locus_tag LOCUS_20740 2222 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 3048 2320 gene locus_tag LOCUS_20750 gene lipM 3048 2320 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818P0 protein_id gnl|my_center|LOCUS_20750 3474 3124 gene locus_tag LOCUS_20760 3474 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 >Feature sequence0551 2391 358 gene locus_tag LOCUS_20770 gene recG 2391 358 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4S3 protein_id gnl|my_center|LOCUS_20770 2955 2401 gene locus_tag LOCUS_20780 2955 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 3491 2952 gene locus_tag LOCUS_20790 gene purN 3491 2952 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK81 protein_id gnl|my_center|LOCUS_20790 >Feature sequence0552 1795 926 gene locus_tag LOCUS_20800 1795 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172854.1 protein_id gnl|my_center|LOCUS_20800 1932 2837 gene locus_tag LOCUS_20810 1932 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence0553 1095 1880 gene locus_tag LOCUS_20820 gene ate 1095 1880 CDS product putative arginyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDW7 protein_id gnl|my_center|LOCUS_20820 2106 1951 gene locus_tag LOCUS_20830 2106 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 3490 2174 gene locus_tag LOCUS_20840 3490 2174 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121952.1 protein_id gnl|my_center|LOCUS_20840 >Feature sequence0554 >Feature sequence0555 >Feature sequence0556 34 690 gene locus_tag LOCUS_20850 gene rex1 34 690 CDS product redox-sensing transcriptional repressor Rex 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY16 protein_id gnl|my_center|LOCUS_20850 715 1992 gene locus_tag LOCUS_20860 715 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047968.1 protein_id gnl|my_center|LOCUS_20860 2002 2454 gene locus_tag LOCUS_20870 gene smpB 2002 2454 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228068.1 protein_id gnl|my_center|LOCUS_20870 <3646 2455 gene locus_tag LOCUS_20880 <3646 2455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q729K1:alpha-1,4 glucan phosphorylase >Feature sequence0557 1676 591 gene locus_tag LOCUS_20890 1676 591 CDS product DNA protecting protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948297.1 protein_id gnl|my_center|LOCUS_20890 2547 1660 gene locus_tag LOCUS_20900 2547 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2827 2549 gene locus_tag LOCUS_20910 gene hup 2827 2549 CDS product DNA-binding protein HU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57144 protein_id gnl|my_center|LOCUS_20910 >Feature sequence0558 <3630 781 gene locus_tag LOCUS_20920 <3630 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0559 564 2606 gene locus_tag LOCUS_20930 gene ptrB 564 2606 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence0560 3622 917 gene locus_tag LOCUS_20940 3622 917 CDS product Fe-S-cluster-containing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence0561 <3620 2981 gene locus_tag LOCUS_20950 <3620 2981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267817.1:non-ribosomal peptide synthetase >Feature sequence0562 778 1719 gene locus_tag LOCUS_20960 778 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1754 3121 gene locus_tag LOCUS_20970 1754 3121 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence0563 96 896 gene locus_tag LOCUS_20980 96 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 1095 2390 gene locus_tag LOCUS_20990 1095 2390 CDS product Cys-rich peptide radical SAM maturase CcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860654.1 protein_id gnl|my_center|LOCUS_20990 2387 3208 gene locus_tag LOCUS_21000 2387 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 3218 3379 gene locus_tag LOCUS_21010 3218 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence0564 940 3255 gene locus_tag LOCUS_21020 940 3255 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035312.1 protein_id gnl|my_center|LOCUS_21020 3581 3261 gene locus_tag LOCUS_21030 3581 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence0565 146 700 gene locus_tag LOCUS_21040 146 700 CDS product deoxycytidine triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410416.1 protein_id gnl|my_center|LOCUS_21040 697 1692 gene locus_tag LOCUS_21050 697 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 1817 2617 gene locus_tag LOCUS_21060 1817 2617 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IYR8 protein_id gnl|my_center|LOCUS_21060 2692 3081 gene locus_tag LOCUS_21070 2692 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence0566 >Feature sequence0567 2 229 gene locus_tag LOCUS_21080 2 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 263 463 gene locus_tag LOCUS_21090 263 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2602 521 gene locus_tag LOCUS_21100 2602 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence0568 <3594 1734 gene locus_tag LOCUS_21110 <3594 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0569 1174 380 gene locus_tag LOCUS_21120 1174 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 2375 1206 gene locus_tag LOCUS_21130 2375 1206 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938041.1 protein_id gnl|my_center|LOCUS_21130 3121 2375 gene locus_tag LOCUS_21140 3121 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence0570 <1 601 gene locus_tag LOCUS_21150 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P34750:fimbrial assembly protein PilQ 611 1198 gene locus_tag LOCUS_21160 611 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 2261 3271 gene locus_tag LOCUS_21170 2261 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence0571 50 286 gene locus_tag LOCUS_21180 50 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 297 602 gene locus_tag LOCUS_21190 297 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 787 1581 gene locus_tag LOCUS_21200 787 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2414 1503 gene locus_tag LOCUS_21210 2414 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 <3567 2439 gene locus_tag LOCUS_21220 <3567 2439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072930.1:periplasmic siderophore cleavage esterase IroE family protein >Feature sequence0572 243 1211 gene locus_tag LOCUS_21230 243 1211 CDS product ADP-heptose--LPS heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_21230 1229 1792 gene locus_tag LOCUS_21240 1229 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2852 1854 gene locus_tag LOCUS_21250 gene argF 2852 1854 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87LF9 protein_id gnl|my_center|LOCUS_21250 >Feature sequence0573 <1 2683 gene locus_tag LOCUS_21260 <1 2683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E083:UvrABC system protein A 2731 3084 gene locus_tag LOCUS_21270 2731 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 3109 3336 gene locus_tag LOCUS_21280 3109 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence0574 1823 726 gene locus_tag LOCUS_21290 gene pfkA 1823 726 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHQ0 protein_id gnl|my_center|LOCUS_21290 2494 1823 gene locus_tag LOCUS_21300 2494 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938961.1 protein_id gnl|my_center|LOCUS_21300 <3551 2472 gene locus_tag LOCUS_21310 <3551 2472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941790.1:acetoacetate metabolism regulatory protein AtoC >Feature sequence0575 1207 311 gene locus_tag LOCUS_21320 gene purC 1207 311 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F9Q8 protein_id gnl|my_center|LOCUS_21320 <3534 1360 gene locus_tag LOCUS_21330 <3534 1360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A294:putative K(+)-stimulated pyrophosphate-energized sodium pump >Feature sequence0576 2294 945 gene locus_tag LOCUS_21340 gene gcvPA 2294 945 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818M4 protein_id gnl|my_center|LOCUS_21340 2677 2297 gene locus_tag LOCUS_21350 gene gcvH 2677 2297 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CPW8 protein_id gnl|my_center|LOCUS_21350 <3533 2694 gene locus_tag LOCUS_21360 <3533 2694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460676.1:aminomethyltransferase >Feature sequence0577 599 66 gene locus_tag LOCUS_21370 gene ppiB 599 66 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC26 protein_id gnl|my_center|LOCUS_21370 751 1263 gene locus_tag LOCUS_21380 751 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1274 1618 gene locus_tag LOCUS_21390 1274 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 3012 1627 gene locus_tag LOCUS_21400 3012 1627 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_21400 3453 3112 gene locus_tag LOCUS_21410 3453 3112 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943824.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence0578 <1 808 gene locus_tag LOCUS_21420 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67125:DNA polymerase III subunit alpha 1851 811 gene locus_tag LOCUS_21430 1851 811 CDS product UPF0118 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51039 protein_id gnl|my_center|LOCUS_21430 2212 1844 gene locus_tag LOCUS_21440 2212 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 3163 2237 gene locus_tag LOCUS_21450 3163 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence0579 227 1078 gene locus_tag LOCUS_21460 227 1078 CDS product citrate lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212068.1 protein_id gnl|my_center|LOCUS_21460 1109 1636 gene locus_tag LOCUS_21470 1109 1636 CDS product dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957534.1 protein_id gnl|my_center|LOCUS_21470 1649 2629 gene locus_tag LOCUS_21480 1649 2629 CDS product NAD(P)H quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705777.1 protein_id gnl|my_center|LOCUS_21480 2767 3477 gene locus_tag LOCUS_21490 2767 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence0580 1108 200 gene locus_tag LOCUS_21500 1108 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1480 3126 gene locus_tag LOCUS_21510 1480 3126 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence0581 1413 103 gene locus_tag LOCUS_21520 1413 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1531 2736 gene locus_tag LOCUS_21530 1531 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence0582 2 187 gene locus_tag LOCUS_21540 2 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 190 729 gene locus_tag LOCUS_21550 190 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 1854 736 gene locus_tag LOCUS_21560 1854 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 2724 1882 gene locus_tag LOCUS_21570 2724 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence0583 3 239 gene locus_tag LOCUS_21580 3 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 337 1632 gene locus_tag LOCUS_21590 337 1632 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258492.1 protein_id gnl|my_center|LOCUS_21590 3243 1699 gene locus_tag LOCUS_21600 3243 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 3507 3301 gene locus_tag LOCUS_21610 3507 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence0584 953 333 gene locus_tag LOCUS_21620 953 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 1026 1247 gene locus_tag LOCUS_21630 1026 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2501 1263 gene locus_tag LOCUS_21640 2501 1263 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266685.1 protein_id gnl|my_center|LOCUS_21640 3281 2562 gene locus_tag LOCUS_21650 3281 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence0585 89 997 gene locus_tag LOCUS_21660 gene lipA 89 997 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XQ0 protein_id gnl|my_center|LOCUS_21660 994 1731 gene locus_tag LOCUS_21670 994 1731 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583447.1 protein_id gnl|my_center|LOCUS_21670 1743 2780 gene locus_tag LOCUS_21680 1743 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence0586 <1 661 gene locus_tag LOCUS_21690 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119486.1:transposase 1228 1082 gene locus_tag LOCUS_21700 1228 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 1717 1463 gene locus_tag LOCUS_21710 1717 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2174 1893 gene locus_tag LOCUS_21720 2174 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2871 2524 gene locus_tag LOCUS_21730 2871 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3456 3121 gene locus_tag LOCUS_21740 3456 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence0587 798 3206 gene locus_tag LOCUS_21750 798 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence0588 >Feature sequence0589 >Feature sequence0590 326 2146 gene locus_tag LOCUS_21760 326 2146 CDS product dihydroxyacetone kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939228.1 protein_id gnl|my_center|LOCUS_21760 2170 2946 gene locus_tag LOCUS_21770 2170 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence0591 204 2885 gene locus_tag LOCUS_21780 gene polA 204 2885 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FR5 protein_id gnl|my_center|LOCUS_21780 3341 2895 gene locus_tag LOCUS_21790 3341 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence0592 <3465 2764 gene locus_tag LOCUS_21800 <3465 2764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400414.1:inositol monophosphatase >Feature sequence0593 1225 3423 gene locus_tag LOCUS_21810 1225 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence0594 144 656 gene locus_tag LOCUS_21820 144 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1358 1999 gene locus_tag LOCUS_21830 1358 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 2782 2003 gene locus_tag LOCUS_21840 gene rsmA 2782 2003 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM60 protein_id gnl|my_center|LOCUS_21840 >Feature sequence0595 1932 274 gene locus_tag LOCUS_21850 1932 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2579 1932 gene locus_tag LOCUS_21860 gene trmD 2579 1932 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2G4 protein_id gnl|my_center|LOCUS_21860 3070 2576 gene locus_tag LOCUS_21870 3070 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3319 3077 gene locus_tag LOCUS_21880 3319 3077 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK95 protein_id gnl|my_center|LOCUS_21880 >Feature sequence0596 <1 623 gene locus_tag LOCUS_21890 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P55474:nodulation protein NolNO >Feature sequence0597 492 1184 gene locus_tag LOCUS_21900 492 1184 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_21900 1824 1195 gene locus_tag LOCUS_21910 1824 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1962 2195 gene locus_tag LOCUS_21920 1962 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2185 2583 gene locus_tag LOCUS_21930 gene vapC2 2185 2583 CDS product ribonuclease VapC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71363 protein_id gnl|my_center|LOCUS_21930 >Feature sequence0598 1633 260 gene locus_tag LOCUS_21940 1633 260 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545100.1 protein_id gnl|my_center|LOCUS_21940 3212 1635 gene locus_tag LOCUS_21950 3212 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence0599 3420 811 gene locus_tag LOCUS_21960 3420 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence0600 294 1922 gene locus_tag LOCUS_21970 294 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 2223 3074 gene locus_tag LOCUS_21980 2223 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence0601 99 338 gene locus_tag LOCUS_21990 99 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 579 406 gene locus_tag LOCUS_22000 579 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 843 2990 gene locus_tag LOCUS_22010 gene recD2 843 2990 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DN4 protein_id gnl|my_center|LOCUS_22010 >Feature sequence0602 <3414 2839 gene locus_tag LOCUS_22020 <3414 2839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0603 1488 382 gene locus_tag LOCUS_22030 1488 382 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH90 protein_id gnl|my_center|LOCUS_22030 2603 1485 gene locus_tag LOCUS_22040 2603 1485 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97E48 protein_id gnl|my_center|LOCUS_22040 <3411 2590 gene locus_tag LOCUS_22050 <3411 2590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482690.1:ABC transporter ATP-binding protein >Feature sequence0604 24 308 gene locus_tag LOCUS_22060 24 308 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393715.1 protein_id gnl|my_center|LOCUS_22060 506 1153 gene locus_tag LOCUS_22070 506 1153 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082850.1 protein_id gnl|my_center|LOCUS_22070 2615 1986 gene locus_tag LOCUS_22080 2615 1986 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765580.1 protein_id gnl|my_center|LOCUS_22080 <3408 2721 gene locus_tag LOCUS_22090 <3408 2721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403534.1:esterase >Feature sequence0605 >Feature sequence0606 >Feature sequence0607 502 188 gene locus_tag LOCUS_22100 502 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2811 544 gene locus_tag LOCUS_22110 gene pksE 2811 544 CDS product polyketide biosynthesis protein PksE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34787 protein_id gnl|my_center|LOCUS_22110 3245 2895 gene locus_tag LOCUS_22120 3245 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence0608 1421 864 gene locus_tag LOCUS_22130 gene rplI 1421 864 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67830 protein_id gnl|my_center|LOCUS_22130 1690 1424 gene locus_tag LOCUS_22140 gene rpsR 1690 1424 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0J0 protein_id gnl|my_center|LOCUS_22140 2117 1680 gene locus_tag LOCUS_22150 2117 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2846 2205 gene locus_tag LOCUS_22160 gene ctc 2846 2205 CDS product general stress protein CTC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P14194 protein_id gnl|my_center|LOCUS_22160 <3380 2859 gene locus_tag LOCUS_22170 <3380 2859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YG56:ribose-phosphate pyrophosphokinase >Feature sequence0609 <1 761 gene locus_tag LOCUS_22180 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QUV5:putative S-adenosylmethionine-dependent methyltransferase 758 1984 gene locus_tag LOCUS_22190 758 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1993 3093 gene locus_tag LOCUS_22200 1993 3093 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence0610 717 998 gene locus_tag LOCUS_22210 717 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1295 2263 gene locus_tag LOCUS_22220 1295 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2273 2962 gene locus_tag LOCUS_22230 2273 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence0611 581 312 gene locus_tag LOCUS_22240 581 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 1939 599 gene locus_tag LOCUS_22250 1939 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2472 1930 gene locus_tag LOCUS_22260 2472 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence0612 >Feature sequence0613 <1 2845 gene locus_tag LOCUS_22270 <1 2845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0614 2457 1615 gene locus_tag LOCUS_22280 2457 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 3263 2454 gene locus_tag LOCUS_22290 3263 2454 CDS product maritimacin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZP2 protein_id gnl|my_center|LOCUS_22290 >Feature sequence0615 1993 32 gene locus_tag LOCUS_22300 1993 32 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018338.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence0616 3 2567 gene locus_tag LOCUS_22310 3 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence0617 >Feature sequence0618 3144 1456 gene locus_tag LOCUS_22320 3144 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence0619 <3323 1322 gene locus_tag LOCUS_22330 <3323 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405148.1:peptidyl-prolyl cis-trans isomerase >Feature sequence0620 1 126 gene locus_tag LOCUS_22340 1 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 130 492 gene locus_tag LOCUS_22350 130 492 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5K3 protein_id gnl|my_center|LOCUS_22350 511 1545 gene locus_tag LOCUS_22360 gene galT 511 1545 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_22360 769 857 gene locus_tag LOCUS_t00150 769 857 tRNA product tRNA-Pyl inference COORDINATES:profile:Aragorn:1.2.38 2885 1530 gene locus_tag LOCUS_22370 2885 1530 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451023.1 protein_id gnl|my_center|LOCUS_22370 3058 3131 gene locus_tag LOCUS_t00160 3058 3131 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0621 567 2057 gene locus_tag LOCUS_22380 567 2057 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081192.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence0622 386 955 gene locus_tag LOCUS_22390 386 955 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496438.1 protein_id gnl|my_center|LOCUS_22390 1701 958 gene locus_tag LOCUS_22400 1701 958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938918.1 protein_id gnl|my_center|LOCUS_22400 2793 1702 gene locus_tag LOCUS_22410 2793 1702 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence0623 2795 1599 gene locus_tag LOCUS_22420 2795 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 <3304 2792 gene locus_tag LOCUS_22430 <3304 2792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCA5:ribonuclease PH >Feature sequence0624 30 356 gene locus_tag LOCUS_22440 30 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 502 2709 gene locus_tag LOCUS_22450 502 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence0625 486 1232 gene locus_tag LOCUS_22460 486 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1441 3231 gene locus_tag LOCUS_22470 1441 3231 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence0626 <1 3060 gene locus_tag LOCUS_22480 <1 3060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225536.1:hybrid non-ribosomal peptide synthetase/type I polyketide synthase >Feature sequence0627 1762 1511 gene locus_tag LOCUS_22490 1762 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 2796 1759 gene locus_tag LOCUS_22500 2796 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 >Feature sequence0628 2685 343 gene locus_tag LOCUS_22510 2685 343 CDS product beta-lactam antibiotic acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence0629 <1 2260 gene locus_tag LOCUS_22520 <1 2260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861320.1:sensor histidine kinase >Feature sequence0630 762 208 gene locus_tag LOCUS_22530 762 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 1754 762 gene locus_tag LOCUS_22540 gene ispB 1754 762 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204136.1 protein_id gnl|my_center|LOCUS_22540 1792 2217 gene locus_tag LOCUS_22550 1792 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022301.1 protein_id gnl|my_center|LOCUS_22550 <3277 2209 gene locus_tag LOCUS_22560 <3277 2209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384114.1:alanine racemase >Feature sequence0631 143 1210 gene locus_tag LOCUS_22570 143 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 3170 1449 gene locus_tag LOCUS_22580 3170 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence0632 90 1637 gene locus_tag LOCUS_22590 gene ycf46 90 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_22590 1637 2038 gene locus_tag LOCUS_22600 1637 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2062 2274 gene locus_tag LOCUS_22610 2062 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 2246 2788 gene locus_tag LOCUS_22620 2246 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 >Feature sequence0633 >Feature sequence0634 1777 842 gene locus_tag LOCUS_22630 1777 842 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_22630 3166 1913 gene locus_tag LOCUS_22640 3166 1913 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence0635 2595 1435 gene locus_tag LOCUS_22650 gene aspC 2595 1435 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CJ7 protein_id gnl|my_center|LOCUS_22650 >Feature sequence0636 570 79 gene locus_tag LOCUS_22660 570 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 1118 567 gene locus_tag LOCUS_22670 1118 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 2063 1305 gene locus_tag LOCUS_22680 2063 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881421.1 protein_id gnl|my_center|LOCUS_22680 2956 2060 gene locus_tag LOCUS_22690 gene scbA 2956 2060 CDS product adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881422.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence0637 1999 983 gene locus_tag LOCUS_22700 gene rlmN 1999 983 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66732 protein_id gnl|my_center|LOCUS_22700 2181 2966 gene locus_tag LOCUS_22710 2181 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence0638 1119 478 gene locus_tag LOCUS_22720 1119 478 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865355.1 protein_id gnl|my_center|LOCUS_22720 2088 1135 gene locus_tag LOCUS_22730 gene menA 2088 1135 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBE2 protein_id gnl|my_center|LOCUS_22730 2454 2185 gene locus_tag LOCUS_22740 2454 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 <3252 2606 gene locus_tag LOCUS_22750 <3252 2606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000034322.1:penicillin-binding protein >Feature sequence0639 411 2972 gene locus_tag LOCUS_22760 411 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence0640 1637 555 gene locus_tag LOCUS_22770 1637 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2959 1634 gene locus_tag LOCUS_22780 2959 1634 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932440.1 protein_id gnl|my_center|LOCUS_22780 >Feature sequence0641 1751 429 gene locus_tag LOCUS_22790 1751 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2527 1763 gene locus_tag LOCUS_22800 2527 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 3243 2593 gene locus_tag LOCUS_22810 3243 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence0642 1062 1955 gene locus_tag LOCUS_22820 1062 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2509 1979 gene locus_tag LOCUS_22830 2509 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence0643 606 1379 gene locus_tag LOCUS_22840 606 1379 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941929.1 protein_id gnl|my_center|LOCUS_22840 1449 2036 gene locus_tag LOCUS_22850 1449 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2874 2053 gene locus_tag LOCUS_22860 2874 2053 CDS product phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956669.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence0644 408 2303 gene locus_tag LOCUS_22870 408 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 2425 2580 gene locus_tag LOCUS_22880 2425 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 2760 2948 gene locus_tag LOCUS_22890 2760 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence0645 >Feature sequence0646 807 1796 gene locus_tag LOCUS_22900 807 1796 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_22900 3016 1793 gene locus_tag LOCUS_22910 3016 1793 CDS product menaquinol oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272193.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence0647 >Feature sequence0648 1238 2869 gene locus_tag LOCUS_22920 1238 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence0649 16 1857 gene locus_tag LOCUS_22930 16 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2310 1924 gene locus_tag LOCUS_22940 2310 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 2994 2320 gene locus_tag LOCUS_22950 2994 2320 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393667.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence0650 >Feature sequence0651 2018 678 gene locus_tag LOCUS_22960 2018 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2651 2022 gene locus_tag LOCUS_22970 2651 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2988 2668 gene locus_tag LOCUS_22980 2988 2668 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence0652 265 957 gene locus_tag LOCUS_22990 265 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 2317 1049 gene locus_tag LOCUS_23000 2317 1049 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD3 protein_id gnl|my_center|LOCUS_23000 2563 2321 gene locus_tag LOCUS_23010 gene acpP 2563 2321 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SL79 protein_id gnl|my_center|LOCUS_23010 <3214 2645 gene locus_tag LOCUS_23020 <3214 2645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P51831:3-oxoacyl-[acyl-carrier-protein] reductase FabG >Feature sequence0653 19 237 gene locus_tag LOCUS_23030 19 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 787 1995 gene locus_tag LOCUS_23040 787 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence0654 1460 213 gene locus_tag LOCUS_23050 gene kbl 1460 213 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FTU5 protein_id gnl|my_center|LOCUS_23050 1729 1478 gene locus_tag LOCUS_23060 1729 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 <3211 1754 gene locus_tag LOCUS_23070 <3211 1754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000862095.1:acetate--CoA ligase >Feature sequence0655 127 933 gene locus_tag LOCUS_23080 127 933 CDS product adenine nucleotide alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896918.1 protein_id gnl|my_center|LOCUS_23080 1003 1275 gene locus_tag LOCUS_23090 gene rpsT 1003 1275 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2A8 protein_id gnl|my_center|LOCUS_23090 1287 2054 gene locus_tag LOCUS_23100 1287 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence0656 2288 1152 gene locus_tag LOCUS_23110 2288 1152 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 protein_id gnl|my_center|LOCUS_23110 2655 2290 gene locus_tag LOCUS_23120 2655 2290 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531148.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence0657 1279 3099 gene locus_tag LOCUS_23130 1279 3099 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932067.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence0658 345 2477 gene locus_tag LOCUS_23140 345 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072809.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence0659 3096 2140 gene locus_tag LOCUS_23150 gene pksD 3096 2140 CDS product polyketide biosynthesis acyltransferase PksD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34877 protein_id gnl|my_center|LOCUS_23150 >Feature sequence0660 741 1385 gene locus_tag LOCUS_23160 741 1385 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812889.1 protein_id gnl|my_center|LOCUS_23160 1375 1773 gene locus_tag LOCUS_23170 1375 1773 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010633018.1 protein_id gnl|my_center|LOCUS_23170 1859 2002 gene locus_tag LOCUS_23180 1859 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2136 2279 gene locus_tag LOCUS_23190 2136 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 >Feature sequence0661 2054 2545 gene locus_tag LOCUS_23200 2054 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545067.1 protein_id gnl|my_center|LOCUS_23200 2594 3178 gene locus_tag LOCUS_23210 2594 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence0662 49 1440 gene locus_tag LOCUS_23220 49 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 1464 2417 gene locus_tag LOCUS_23230 gene fcl 1464 2417 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_23230 2617 2414 gene locus_tag LOCUS_23240 2617 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 <3186 2648 gene locus_tag LOCUS_23250 <3186 2648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005803433.1:flavin reductase >Feature sequence0663 284 1600 gene locus_tag LOCUS_23260 284 1600 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_23260 1603 2991 gene locus_tag LOCUS_23270 1603 2991 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence0664 8 1135 gene locus_tag LOCUS_23280 8 1135 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_23280 2150 1125 gene locus_tag LOCUS_23290 2150 1125 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895580.1 protein_id gnl|my_center|LOCUS_23290 <3182 2162 gene locus_tag LOCUS_23300 <3182 2162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053632.1:sarcosine oxidase subunit beta >Feature sequence0665 >Feature sequence0666 300 1130 gene locus_tag LOCUS_23310 300 1130 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943898.1 protein_id gnl|my_center|LOCUS_23310 1111 1896 gene locus_tag LOCUS_23320 1111 1896 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_23320 1874 2653 gene locus_tag LOCUS_23330 1874 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2662 2913 gene locus_tag LOCUS_23340 2662 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence0667 >Feature sequence0668 >Feature sequence0669 <1 756 gene locus_tag LOCUS_23350 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267822.1:ATP-binding protein 753 2504 gene locus_tag LOCUS_23360 753 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence0670 871 227 gene locus_tag LOCUS_23370 871 227 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_23370 988 2280 gene locus_tag LOCUS_23380 988 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2451 2828 gene locus_tag LOCUS_23390 2451 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence0671 1074 757 gene locus_tag LOCUS_23400 1074 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 1295 2416 gene locus_tag LOCUS_23410 gene alr 1295 2416 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EX97 protein_id gnl|my_center|LOCUS_23410 >Feature sequence0672 <1 2100 gene locus_tag LOCUS_23420 <1 2100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0673 917 1249 gene locus_tag LOCUS_23430 917 1249 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272217.1 protein_id gnl|my_center|LOCUS_23430 1336 2664 gene locus_tag LOCUS_23440 1336 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence0674 >Feature sequence0675 129 1283 gene locus_tag LOCUS_23450 129 1283 CDS product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404668.1 protein_id gnl|my_center|LOCUS_23450 1293 2000 gene locus_tag LOCUS_23460 1293 2000 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_23460 2213 2968 gene locus_tag LOCUS_23470 2213 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence0676 1750 1007 gene locus_tag LOCUS_23480 1750 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence0677 347 505 gene locus_tag LOCUS_23490 347 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 529 777 gene locus_tag LOCUS_23500 529 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 936 1574 gene locus_tag LOCUS_23510 936 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021157.1 protein_id gnl|my_center|LOCUS_23510 1596 2390 gene locus_tag LOCUS_23520 gene merR 1596 2390 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123119.1 protein_id gnl|my_center|LOCUS_23520 <3148 2377 gene locus_tag LOCUS_23530 <3148 2377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B1MJ33:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence0678 218 745 gene locus_tag LOCUS_23540 gene idi 218 745 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_23540 2346 742 gene locus_tag LOCUS_23550 2346 742 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence0679 <1 1606 gene locus_tag LOCUS_23560 <1 1606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202267.1:ATPase AAA 1702 2067 gene locus_tag LOCUS_23570 1702 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2064 3005 gene locus_tag LOCUS_23580 2064 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 >Feature sequence0680 >Feature sequence0681 64 387 gene locus_tag LOCUS_23590 64 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 533 2164 gene locus_tag LOCUS_23600 gene groL 533 2164 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJN3 protein_id gnl|my_center|LOCUS_23600 2351 2425 gene locus_tag LOCUS_t00170 2351 2425 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2453 2527 gene locus_tag LOCUS_t00180 2453 2527 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0682 >Feature sequence0683 1295 387 gene locus_tag LOCUS_23610 1295 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23610 <3123 1305 gene locus_tag LOCUS_23620 <3123 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39845:plipastatin synthase subunit A note possible pseudo, internal stop codon >Feature sequence0684 1973 1140 gene locus_tag LOCUS_23630 gene prmC 1973 1140 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J2B7 protein_id gnl|my_center|LOCUS_23630 3080 1974 gene locus_tag LOCUS_23640 gene prfA 3080 1974 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E003 protein_id gnl|my_center|LOCUS_23640 >Feature sequence0685 1955 612 gene locus_tag LOCUS_23650 gene accC 1955 612 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_038245.2 protein_id gnl|my_center|LOCUS_23650 2437 1961 gene locus_tag LOCUS_23660 gene accB 2437 1961 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931852.1 protein_id gnl|my_center|LOCUS_23660 3014 2604 gene locus_tag LOCUS_23670 3014 2604 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680077.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence0686 1983 442 gene locus_tag LOCUS_23680 1983 442 CDS product Cys-rich peptide radical SAM maturase CcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860654.1 protein_id gnl|my_center|LOCUS_23680 2306 2175 gene locus_tag LOCUS_23690 2306 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2484 2335 gene locus_tag LOCUS_23700 2484 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence0687 >Feature sequence0688 250 996 gene locus_tag LOCUS_23710 250 996 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJH7 protein_id gnl|my_center|LOCUS_23710 2274 1021 gene locus_tag LOCUS_23720 gene glgC 2274 1021 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_23720 2922 2359 gene locus_tag LOCUS_23730 gene efp 2922 2359 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CP34 protein_id gnl|my_center|LOCUS_23730 >Feature sequence0689 2676 397 gene locus_tag LOCUS_23740 2676 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence0690 >Feature sequence0691 1278 1475 gene locus_tag LOCUS_23750 1278 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2620 1625 gene locus_tag LOCUS_23760 gene ilvC 2620 1625 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ20 protein_id gnl|my_center|LOCUS_23760 >Feature sequence0692 3066 2107 gene locus_tag LOCUS_23770 3066 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence0693 339 881 gene locus_tag LOCUS_23780 339 881 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_23780 874 1476 gene locus_tag LOCUS_23790 gene plsY 874 1476 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60926 protein_id gnl|my_center|LOCUS_23790 1469 2464 gene locus_tag LOCUS_23800 gene gpsA 1469 2464 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61740 protein_id gnl|my_center|LOCUS_23800 >Feature sequence0694 <1 2574 gene locus_tag LOCUS_23810 <1 2574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0695 216 1391 gene locus_tag LOCUS_23820 216 1391 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965651.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence0696 2684 1173 gene locus_tag LOCUS_23830 gene hsdM 2684 1173 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_23830 >Feature sequence0697 1285 731 gene locus_tag LOCUS_23840 gene hslV 1285 731 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3Q4 protein_id gnl|my_center|LOCUS_23840 1446 2672 gene locus_tag LOCUS_23850 1446 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence0698 1361 393 gene locus_tag LOCUS_23860 gene arcB 1361 393 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0P2 protein_id gnl|my_center|LOCUS_23860 2204 1770 gene locus_tag LOCUS_23870 2204 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence0699 513 76 gene locus_tag LOCUS_23880 513 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 1147 515 gene locus_tag LOCUS_23890 1147 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 1761 1147 gene locus_tag LOCUS_23900 1761 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2332 1856 gene locus_tag LOCUS_23910 2332 1856 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_23910 3003 2329 gene locus_tag LOCUS_23920 3003 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence0700 <1 2178 gene locus_tag LOCUS_23930 <1 2178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to I7EPD8:DNA-directed RNA polymerase subunit beta' 2789 2208 gene locus_tag LOCUS_23940 gene folE 2789 2208 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLE7 protein_id gnl|my_center|LOCUS_23940 >Feature sequence0701 >Feature sequence0702 1991 1509 gene locus_tag LOCUS_23950 1991 1509 CDS product NADH dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_23950 2649 2023 gene locus_tag LOCUS_23960 gene rex 2649 2023 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FLY5 protein_id gnl|my_center|LOCUS_23960 >Feature sequence0703 948 1598 gene locus_tag LOCUS_23970 948 1598 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933700.1 protein_id gnl|my_center|LOCUS_23970 1585 2316 gene locus_tag LOCUS_23980 1585 2316 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence0704 95 319 gene locus_tag LOCUS_23990 95 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 322 594 gene locus_tag LOCUS_24000 322 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922754.1 protein_id gnl|my_center|LOCUS_24000 675 884 gene locus_tag LOCUS_24010 675 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 1901 897 gene locus_tag LOCUS_24020 1901 897 CDS product protein HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73N23 protein_id gnl|my_center|LOCUS_24020 2887 1898 gene locus_tag LOCUS_24030 2887 1898 CDS product HflK protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence0705 >Feature sequence0706 <1 2698 gene locus_tag LOCUS_24040 <1 2698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203715.1:hybrid sensor histidine kinase/response regulator >Feature sequence0707 2876 303 gene locus_tag LOCUS_24050 gene clpB 2876 303 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YI87 protein_id gnl|my_center|LOCUS_24050 >Feature sequence0708 139 2946 gene locus_tag LOCUS_24060 139 2946 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918809.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence0709 2844 1987 gene locus_tag LOCUS_24070 2844 1987 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272317.1 protein_id gnl|my_center|LOCUS_24070 2943 2871 gene locus_tag LOCUS_t00190 2943 2871 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0710 >Feature sequence0711 2030 966 gene locus_tag LOCUS_24080 gene aspG 2030 966 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405364.1 protein_id gnl|my_center|LOCUS_24080 2228 2464 gene locus_tag LOCUS_24090 2228 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence0712 739 1695 gene locus_tag LOCUS_24100 739 1695 CDS product phosphate starvation-inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence0713 >Feature sequence0714 128 601 gene locus_tag LOCUS_24110 gene def 128 601 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIL7 protein_id gnl|my_center|LOCUS_24110 595 1554 gene locus_tag LOCUS_24120 gene fmt 595 1554 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y676 protein_id gnl|my_center|LOCUS_24120 1551 2903 gene locus_tag LOCUS_24130 gene rsmB 1551 2903 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45679 protein_id gnl|my_center|LOCUS_24130 >Feature sequence0715 2059 413 gene locus_tag LOCUS_24140 2059 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2774 2031 gene locus_tag LOCUS_24150 2774 2031 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868133.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence0716 64 249 gene locus_tag LOCUS_24160 64 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 262 534 gene locus_tag LOCUS_24170 262 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 539 808 gene locus_tag LOCUS_24180 539 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 808 1299 gene locus_tag LOCUS_24190 808 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 1296 2054 gene locus_tag LOCUS_24200 1296 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence0717 1944 346 gene locus_tag LOCUS_24210 1944 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 <2959 1957 gene locus_tag LOCUS_24220 <2959 1957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942139.1:type II secretion system protein F >Feature sequence0718 <1 1524 gene locus_tag LOCUS_24230 <1 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942422.1:type II secretion system protein 1528 2472 gene locus_tag LOCUS_24240 1528 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence0719 >Feature sequence0720 968 132 gene locus_tag LOCUS_24250 968 132 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_24250 2906 1119 gene locus_tag LOCUS_24260 2906 1119 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence0721 >Feature sequence0722 2785 1805 gene locus_tag LOCUS_24270 gene sppA 2785 1805 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682856.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence0723 2197 704 gene locus_tag LOCUS_24280 gene murE 2197 704 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK84 protein_id gnl|my_center|LOCUS_24280 <2934 2194 gene locus_tag LOCUS_24290 <2934 2194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545621.1:stage V sporulation protein D >Feature sequence0724 1570 188 gene locus_tag LOCUS_24300 1570 188 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_24300 2908 1583 gene locus_tag LOCUS_24310 2908 1583 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence0725 534 1589 gene locus_tag LOCUS_24320 534 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 1601 2389 gene locus_tag LOCUS_24330 1601 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence0726 2539 113 gene locus_tag LOCUS_24340 2539 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 >Feature sequence0727 <2927 1917 gene locus_tag LOCUS_24350 <2927 1917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056205.1:DEAD/DEAH box helicase >Feature sequence0728 784 2484 gene locus_tag LOCUS_24360 784 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence0729 >Feature sequence0730 <1 937 gene locus_tag LOCUS_24370 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057738.1:ABC transporter ATP-binding protein 934 1698 gene locus_tag LOCUS_24380 934 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_24380 1695 2537 gene locus_tag LOCUS_24390 1695 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence0731 1110 1997 gene locus_tag LOCUS_24400 1110 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_24400 2443 2147 gene locus_tag LOCUS_24410 2443 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2514 2876 gene locus_tag LOCUS_24420 2514 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence0732 119 442 gene locus_tag LOCUS_24430 119 442 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869962.1 protein_id gnl|my_center|LOCUS_24430 596 2143 gene locus_tag LOCUS_24440 gene secD 596 2143 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749X5 protein_id gnl|my_center|LOCUS_24440 >Feature sequence0733 2325 286 gene locus_tag LOCUS_24450 2325 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence0734 1851 1261 gene locus_tag LOCUS_24460 gene rnhB 1851 1261 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZH54 protein_id gnl|my_center|LOCUS_24460 2339 1851 gene locus_tag LOCUS_24470 2339 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence0735 33 1457 gene locus_tag LOCUS_24480 gene putP 33 1457 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263649.1 protein_id gnl|my_center|LOCUS_24480 1457 2809 gene locus_tag LOCUS_24490 1457 2809 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121176.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence0736 1374 736 gene locus_tag LOCUS_24500 1374 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 2514 1438 gene locus_tag LOCUS_24510 gene msrA 2514 1438 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCX9 protein_id gnl|my_center|LOCUS_24510 2824 2621 gene locus_tag LOCUS_24520 2824 2621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence0737 >Feature sequence0738 >Feature sequence0739 1817 1413 gene locus_tag LOCUS_24530 1817 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence0740 120 587 gene locus_tag LOCUS_24540 120 587 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017192.1 protein_id gnl|my_center|LOCUS_24540 580 1503 gene locus_tag LOCUS_24550 gene hprK 580 1503 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34483 protein_id gnl|my_center|LOCUS_24550 1503 1922 gene locus_tag LOCUS_24560 1503 1922 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938923.1 protein_id gnl|my_center|LOCUS_24560 1903 2172 gene locus_tag LOCUS_24570 gene ptsH 1903 2172 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771768.1 protein_id gnl|my_center|LOCUS_24570 >Feature sequence0741 <2891 1019 gene locus_tag LOCUS_24580 <2891 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence0742 >Feature sequence0743 1799 2707 gene locus_tag LOCUS_24590 1799 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence0744 1440 169 gene locus_tag LOCUS_24600 1440 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2815 1535 gene locus_tag LOCUS_24610 2815 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence0745 1132 491 gene locus_tag LOCUS_24620 1132 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2826 1906 gene locus_tag LOCUS_24630 2826 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence0746 892 8 gene locus_tag LOCUS_24640 892 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 1814 906 gene locus_tag LOCUS_24650 1814 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 <2863 1838 gene locus_tag LOCUS_24660 <2863 1838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942140.1:PAS domain-containing sensor histidine kinase >Feature sequence0747 <2863 993 gene locus_tag LOCUS_24670 <2863 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272644.1:phosphoenolpyruvate synthase >Feature sequence0748 1518 1003 gene locus_tag LOCUS_24680 1518 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 1703 2365 gene locus_tag LOCUS_24690 1703 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence0749 >Feature sequence0750 942 1583 gene locus_tag LOCUS_24700 942 1583 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence0751 <1 2487 gene locus_tag LOCUS_24710 <1 2487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057486.1:ABC transporter ATP-binding protein >Feature sequence0752 159 1142 gene locus_tag LOCUS_24720 159 1142 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_24720 2056 1193 gene locus_tag LOCUS_24730 2056 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 <2851 2053 gene locus_tag LOCUS_24740 <2851 2053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RUV5:serine--tRNA ligase >Feature sequence0753 2308 836 gene locus_tag LOCUS_24750 2308 836 CDS product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_24750 2844 2383 gene locus_tag LOCUS_24760 2844 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence0754 1947 13 gene locus_tag LOCUS_24770 1947 13 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_24770 <2843 2037 gene locus_tag LOCUS_24780 <2843 2037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023256.1:excinuclease ABC subunit C >Feature sequence0755 <2842 1755 gene locus_tag LOCUS_24790 <2842 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053636.1:aminotransferase >Feature sequence0756 1464 292 gene locus_tag LOCUS_24800 1464 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 <2839 1479 gene locus_tag LOCUS_24810 <2839 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943428.1:cytochrome c >Feature sequence0757 <1 942 gene locus_tag LOCUS_24820 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YFV8:DNA-directed RNA polymerase subunit beta >Feature sequence0758 14 2098 gene locus_tag LOCUS_24830 14 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 <2833 2153 gene locus_tag LOCUS_24840 <2833 2153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895564.1:diguanylate cyclase response regulator >Feature sequence0759 1381 1061 gene locus_tag LOCUS_24850 1381 1061 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_24850 2542 1391 gene locus_tag LOCUS_24860 gene pntA 2542 1391 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence0760 <1 1523 gene locus_tag LOCUS_24870 <1 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence0761 >Feature sequence0762 <1 2399 gene locus_tag LOCUS_24880 <1 2399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760378.1:hybrid sensor histidine kinase/response regulator >Feature sequence0763 <1 632 gene locus_tag LOCUS_24890 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_010691.2:ATP-dependent protease 1658 702 gene locus_tag LOCUS_24900 1658 702 CDS product K+-dependent Na+/Ca+ exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_24900 <2816 1694 gene locus_tag LOCUS_24910 <2816 1694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545078.1:ATPase >Feature sequence0764 <1 1687 gene locus_tag LOCUS_24920 <1 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P61667:DNA mismatch repair protein MutS >Feature sequence0765 >Feature sequence0766 >Feature sequence0767 2623 2534 gene locus_tag LOCUS_t00200 2623 2534 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2732 2649 gene locus_tag LOCUS_t00210 2732 2649 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0768 >Feature sequence0769 336 1229 gene locus_tag LOCUS_24930 336 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence0770 301 2 gene locus_tag LOCUS_24940 301 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 714 532 gene locus_tag LOCUS_24950 714 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2006 1518 gene locus_tag LOCUS_24960 2006 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 >Feature sequence0771 156 2294 gene locus_tag LOCUS_24970 156 2294 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence0772 >Feature sequence0773 1851 520 gene locus_tag LOCUS_24980 1851 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 >Feature sequence0774 >Feature sequence0775 282 764 gene locus_tag LOCUS_24990 282 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 986 1282 gene locus_tag LOCUS_25000 gene eutM 986 1282 CDS product ethanolamine utilization protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0ABF4 protein_id gnl|my_center|LOCUS_25000 1312 1599 gene locus_tag LOCUS_25010 1312 1599 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_25010 >Feature sequence0776 783 178 gene locus_tag LOCUS_25020 783 178 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_25020 1030 791 gene locus_tag LOCUS_25030 1030 791 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943901.1 protein_id gnl|my_center|LOCUS_25030 1161 1361 gene locus_tag LOCUS_25040 1161 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 <2767 1379 gene locus_tag LOCUS_25050 <2767 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005777343.1:ATPase >Feature sequence0777 676 278 gene locus_tag LOCUS_25060 676 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 1035 673 gene locus_tag LOCUS_25070 1035 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 2007 1093 gene locus_tag LOCUS_25080 2007 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 <2762 2043 gene locus_tag LOCUS_25090 <2762 2043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803940.1:PDK repeat-containing protein >Feature sequence0778 >Feature sequence0779 <2760 380 gene locus_tag LOCUS_25100 <2760 380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q04747:surfactin synthase subunit 2 >Feature sequence0780 413 985 gene locus_tag LOCUS_25110 413 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 982 1200 gene locus_tag LOCUS_25120 982 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 <2755 1130 gene locus_tag LOCUS_25130 <2755 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q04747:surfactin synthase subunit 2 >Feature sequence0781 309 79 gene locus_tag LOCUS_25140 309 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2613 463 gene locus_tag LOCUS_25150 2613 463 CDS product dipeptidyl peptidase S46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence0782 43 795 gene locus_tag LOCUS_25160 43 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 810 1790 gene locus_tag LOCUS_25170 810 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 2668 1901 gene locus_tag LOCUS_25180 2668 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence0783 >Feature sequence0784 663 157 gene locus_tag LOCUS_25190 663 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_25190 1829 783 gene locus_tag LOCUS_25200 1829 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 2266 1826 gene locus_tag LOCUS_25210 2266 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence0785 <1 2259 gene locus_tag LOCUS_25220 <1 2259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057486.1:ABC transporter ATP-binding protein >Feature sequence0786 <1 853 gene locus_tag LOCUS_25230 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962811.1:peptidase M28 >Feature sequence0787 1605 52 gene locus_tag LOCUS_25240 1605 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_25240 <2725 1602 gene locus_tag LOCUS_25250 <2725 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18B36:acetate kinase >Feature sequence0788 2 799 gene locus_tag LOCUS_25260 2 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 796 1692 gene locus_tag LOCUS_25270 796 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 1689 2414 gene locus_tag LOCUS_25280 1689 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence0789 1597 1274 gene locus_tag LOCUS_25290 1597 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2086 1610 gene locus_tag LOCUS_25300 2086 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 2446 2093 gene locus_tag LOCUS_25310 2446 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence0790 47 1390 gene locus_tag LOCUS_25320 47 1390 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_25320 >Feature sequence0791 <1 2186 gene locus_tag LOCUS_25330 <1 2186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001702991.1:putative polyketide synthase >Feature sequence0792 >Feature sequence0793 853 95 gene locus_tag LOCUS_25340 gene tpiA 853 95 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52633 protein_id gnl|my_center|LOCUS_25340 1652 867 gene locus_tag LOCUS_25350 1652 867 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_25350 2318 1665 gene locus_tag LOCUS_25360 2318 1665 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124702.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence0794 >Feature sequence0795 >Feature sequence0796 2322 184 gene locus_tag LOCUS_25370 2322 184 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072247.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence0797 205 1461 gene locus_tag LOCUS_25380 205 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 2496 1474 gene locus_tag LOCUS_25390 2496 1474 CDS product His-Xaa-Ser system radical SAM maturase HxsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106270.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence0798 >Feature sequence0799 447 1238 gene locus_tag LOCUS_25400 447 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence0800 <2695 597 gene locus_tag LOCUS_25410 <2695 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140762.1:peptidase >Feature sequence0801 <1 2608 gene locus_tag LOCUS_25420 <1 2608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39846:plipastatin synthase subunit B >Feature sequence0802 288 1043 gene locus_tag LOCUS_25430 288 1043 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331279.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence0803 424 1437 gene locus_tag LOCUS_25440 424 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25440 1480 1920 gene locus_tag LOCUS_25450 1480 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25450 1981 2466 gene locus_tag LOCUS_25460 1981 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942947.1 protein_id gnl|my_center|LOCUS_25460 >Feature sequence0804 1508 90 gene locus_tag LOCUS_25470 1508 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1906 1832 gene locus_tag LOCUS_t00220 1906 1832 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0805 1338 412 gene locus_tag LOCUS_25480 1338 412 CDS product heparan sulfate glucosamine 3-O-sulfotransferase 3B1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887312.1 protein_id gnl|my_center|LOCUS_25480 >Feature sequence0806 305 108 gene locus_tag LOCUS_25490 305 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 668 2299 gene locus_tag LOCUS_25500 668 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 >Feature sequence0807 124 2139 gene locus_tag LOCUS_25510 124 2139 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072247.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence0808 572 48 gene locus_tag LOCUS_25520 572 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 1556 612 gene locus_tag LOCUS_25530 1556 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1818 2489 gene locus_tag LOCUS_25540 1818 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence0809 1214 2002 gene locus_tag LOCUS_25550 1214 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence0810 84 821 gene locus_tag LOCUS_25560 gene wbmP 84 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064741.1 protein_id gnl|my_center|LOCUS_25560 824 1453 gene locus_tag LOCUS_25570 824 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546497.1 protein_id gnl|my_center|LOCUS_25570 1465 2103 gene locus_tag LOCUS_25580 1465 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence0811 1895 288 gene locus_tag LOCUS_25590 1895 288 CDS product indolepyruvate oxidoreductase subunit IorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN4 protein_id gnl|my_center|LOCUS_25590 2163 2432 gene locus_tag LOCUS_25600 gene acyP 2163 2432 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSA4 protein_id gnl|my_center|LOCUS_25600 >Feature sequence0812 <1 850 gene locus_tag LOCUS_25610 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203241.1:sensor histidine kinase 1143 1496 gene locus_tag LOCUS_25620 1143 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 1725 2612 gene locus_tag LOCUS_25630 1725 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 >Feature sequence0813 379 1923 gene locus_tag LOCUS_25640 379 1923 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence0814 1915 986 gene locus_tag LOCUS_25650 1915 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence0815 541 155 gene locus_tag LOCUS_25660 gene crcB 541 155 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6Q4 protein_id gnl|my_center|LOCUS_25660 1650 634 gene locus_tag LOCUS_25670 1650 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence0816 >Feature sequence0817 <1 944 gene locus_tag LOCUS_25680 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence0818 1023 193 gene locus_tag LOCUS_25690 1023 193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885529.1 protein_id gnl|my_center|LOCUS_25690 <2621 1121 gene locus_tag LOCUS_25700 <2621 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784237.1:MFS transporter >Feature sequence0819 >Feature sequence0820 1564 635 gene locus_tag LOCUS_25710 1564 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 1762 2145 gene locus_tag LOCUS_25720 1762 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 >Feature sequence0821 1729 1010 gene locus_tag LOCUS_25730 1729 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943348.1 protein_id gnl|my_center|LOCUS_25730 <2615 1726 gene locus_tag LOCUS_25740 <2615 1726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XW8:UDP-3-O-acylglucosamine N-acyltransferase >Feature sequence0822 427 1302 gene locus_tag LOCUS_25750 427 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence0823 50 1195 gene locus_tag LOCUS_25760 50 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence0824 1020 721 gene locus_tag LOCUS_25770 1020 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 <2613 1152 gene locus_tag LOCUS_25780 <2613 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001890356.1:peptidase >Feature sequence0825 <2610 720 gene locus_tag LOCUS_25790 <2610 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A666:phosphate transporter >Feature sequence0826 >Feature sequence0827 374 1480 gene locus_tag LOCUS_25800 374 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1477 1794 gene locus_tag LOCUS_25810 1477 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence0828 594 175 gene locus_tag LOCUS_25820 594 175 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546098.1 protein_id gnl|my_center|LOCUS_25820 1251 700 gene locus_tag LOCUS_25830 1251 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence0829 1821 385 gene locus_tag LOCUS_25840 1821 385 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0P8 protein_id gnl|my_center|LOCUS_25840 2176 1877 gene locus_tag LOCUS_25850 2176 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 >Feature sequence0830 <2604 76 gene locus_tag LOCUS_25860 <2604 76 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001254999.1:protein kinase >Feature sequence0831 <1 1741 gene locus_tag LOCUS_25870 <1 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986674.1:type III-B CRISPR-associated protein Cas10/Cmr2 >Feature sequence0832 1663 467 gene locus_tag LOCUS_25880 1663 467 CDS product sodium ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986712.1 protein_id gnl|my_center|LOCUS_25880 2439 1660 gene locus_tag LOCUS_25890 gene natA 2439 1660 CDS product sodium ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_25890 >Feature sequence0833 2597 219 gene locus_tag LOCUS_25900 2597 219 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence0834 2418 1222 gene locus_tag LOCUS_25910 gene pilT-1 2418 1222 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_25910 >Feature sequence0835 2 622 gene locus_tag LOCUS_25920 2 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 612 1976 gene locus_tag LOCUS_25930 gene murD 612 1976 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK81 protein_id gnl|my_center|LOCUS_25930 >Feature sequence0836 338 1804 gene locus_tag LOCUS_25940 338 1804 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence0837 >Feature sequence0838 2031 535 gene locus_tag LOCUS_25950 2031 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence0839 2096 276 gene locus_tag LOCUS_25960 2096 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 2564 2097 gene locus_tag LOCUS_25970 2564 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence0840 1959 2462 gene locus_tag LOCUS_25980 1959 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 >Feature sequence0841 >Feature sequence0842 >Feature sequence0843 134 1969 gene locus_tag LOCUS_25990 gene metF-2 134 1969 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence0844 1644 229 gene locus_tag LOCUS_26000 gene gatB 1644 229 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 protein_id gnl|my_center|LOCUS_26000 2397 1648 gene locus_tag LOCUS_26010 2397 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_26010 2494 2421 gene locus_tag LOCUS_t00230 2494 2421 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0845 134 808 gene locus_tag LOCUS_26020 134 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680496.1 protein_id gnl|my_center|LOCUS_26020 811 1569 gene locus_tag LOCUS_26030 811 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 1569 2144 gene locus_tag LOCUS_26040 1569 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2509 2141 gene locus_tag LOCUS_26050 2509 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 >Feature sequence0846 441 94 gene locus_tag LOCUS_26060 441 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 1392 595 gene locus_tag LOCUS_26070 1392 595 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_26070 >Feature sequence0847 <1 2453 gene locus_tag LOCUS_26080 <1 2453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0848 1264 254 gene locus_tag LOCUS_26090 1264 254 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868892.1 protein_id gnl|my_center|LOCUS_26090 2108 1245 gene locus_tag LOCUS_26100 gene srtN 2108 1245 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 protein_id gnl|my_center|LOCUS_26100 >Feature sequence0849 226 762 gene locus_tag LOCUS_26110 226 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 766 2133 gene locus_tag LOCUS_26120 766 2133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021434.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence0850 2132 1098 gene locus_tag LOCUS_26130 2132 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 2517 2176 gene locus_tag LOCUS_26140 2517 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 >Feature sequence0851 2342 642 gene locus_tag LOCUS_26150 2342 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 >Feature sequence0852 >Feature sequence0853 1 1056 gene locus_tag LOCUS_26160 1 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 1159 1569 gene locus_tag LOCUS_26170 1159 1569 CDS product formate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546772.1 protein_id gnl|my_center|LOCUS_26170 >Feature sequence0854 1552 668 gene locus_tag LOCUS_26180 1552 668 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674209.1 protein_id gnl|my_center|LOCUS_26180 2428 1553 gene locus_tag LOCUS_26190 2428 1553 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728922.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence0855 101 337 gene locus_tag LOCUS_26200 101 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 790 1140 gene locus_tag LOCUS_26210 790 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence0856 >Feature sequence0857 723 935 gene locus_tag LOCUS_26220 723 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 1178 1017 gene locus_tag LOCUS_26230 1178 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1407 1252 gene locus_tag LOCUS_26240 1407 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 1751 1596 gene locus_tag LOCUS_26250 1751 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 >Feature sequence0858 >Feature sequence0859 <1 885 gene locus_tag LOCUS_26260 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B7L6:acetylornithine aminotransferase 904 1830 gene locus_tag LOCUS_26270 904 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 1848 2465 gene locus_tag LOCUS_26280 gene coaE 1848 2465 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67792 protein_id gnl|my_center|LOCUS_26280 >Feature sequence0860 <2504 1039 gene locus_tag LOCUS_26290 <2504 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence0861 557 1174 gene locus_tag LOCUS_26300 557 1174 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877575.1 protein_id gnl|my_center|LOCUS_26300 2502 1171 gene locus_tag LOCUS_26310 2502 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 >Feature sequence0862 <1 1192 gene locus_tag LOCUS_26320 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141291.1:Mg-protoporphyrin IX monomethyl ester oxidative cyclase >Feature sequence0863 2493 799 gene locus_tag LOCUS_26330 2493 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence0864 226 1761 gene locus_tag LOCUS_26340 gene pulE 226 1761 CDS product type II secretion system ATPase PulE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence0865 <2495 72 gene locus_tag LOCUS_26350 <2495 72 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WEP2:CRISPR-associated endonuclease Cas1 >Feature sequence0866 <1 1201 gene locus_tag LOCUS_26360 <1 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941857.1:30S ribosomal protein S1 1210 2013 gene locus_tag LOCUS_26370 gene thiD 1210 2013 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368307.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence0867 >Feature sequence0868 >Feature sequence0869 >Feature sequence0870 1141 74 gene locus_tag LOCUS_26380 1141 74 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFG0 protein_id gnl|my_center|LOCUS_26380 1409 1906 gene locus_tag LOCUS_26390 1409 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence0871 >Feature sequence0872 605 1879 gene locus_tag LOCUS_26400 605 1879 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_26400 >Feature sequence0873 225 1358 gene locus_tag LOCUS_26410 225 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 <2476 1373 gene locus_tag LOCUS_26420 <2476 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939406.1:hybrid sensor histidine kinase/response regulator >Feature sequence0874 >Feature sequence0875 510 19 gene locus_tag LOCUS_26430 510 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 2194 788 gene locus_tag LOCUS_26440 2194 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 >Feature sequence0876 <2463 237 gene locus_tag LOCUS_26450 <2463 237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108846.1:hybrid sensor histidine kinase/response regulator >Feature sequence0877 >Feature sequence0878 1319 912 gene locus_tag LOCUS_26460 1319 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1543 1322 gene locus_tag LOCUS_26470 1543 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 2396 1638 gene locus_tag LOCUS_26480 gene lepB 2396 1638 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DP9 protein_id gnl|my_center|LOCUS_26480 >Feature sequence0879 >Feature sequence0880 776 372 gene locus_tag LOCUS_26490 776 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 909 1607 gene locus_tag LOCUS_26500 909 1607 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228179.1 protein_id gnl|my_center|LOCUS_26500 1721 2218 gene locus_tag LOCUS_26510 1721 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence0881 571 729 gene locus_tag LOCUS_26520 571 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 2433 775 gene locus_tag LOCUS_26530 2433 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 >Feature sequence0882 803 33 gene locus_tag LOCUS_26540 803 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 965 2170 gene locus_tag LOCUS_26550 965 2170 CDS product L-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109373.1 protein_id gnl|my_center|LOCUS_26550 >Feature sequence0883 897 1301 gene locus_tag LOCUS_26560 897 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 1298 1915 gene locus_tag LOCUS_26570 1298 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence0884 2440 35 gene locus_tag LOCUS_26580 2440 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence0885 21 737 gene locus_tag LOCUS_26590 21 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 749 2068 gene locus_tag LOCUS_26600 749 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence0886 <2433 107 gene locus_tag LOCUS_26610 <2433 107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011971088.1:type VI secretion protein >Feature sequence0887 1516 104 gene locus_tag LOCUS_26620 1516 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 <2432 1650 gene locus_tag LOCUS_26630 <2432 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031095.1:metallophosphoesterase >Feature sequence0888 1658 162 gene locus_tag LOCUS_26640 1658 162 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720970.1 protein_id gnl|my_center|LOCUS_26640 >Feature sequence0889 <1 1109 gene locus_tag LOCUS_26650 <1 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 1370 2287 gene locus_tag LOCUS_26660 1370 2287 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence0890 >Feature sequence0891 >Feature sequence0892 >Feature sequence0893 >Feature sequence0894 1484 735 gene locus_tag LOCUS_26670 1484 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 <2416 1498 gene locus_tag LOCUS_26680 <2416 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975247.1:ABC transporter >Feature sequence0895 333 1925 gene locus_tag LOCUS_26690 333 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence0896 >Feature sequence0897 1391 912 gene locus_tag LOCUS_26700 1391 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 2084 1470 gene locus_tag LOCUS_26710 2084 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence0898 237 1928 gene locus_tag LOCUS_26720 237 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2255 1962 gene locus_tag LOCUS_26730 2255 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence0899 <1 808 gene locus_tag LOCUS_26740 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810293.1:NADH dehydrogenase 805 1362 gene locus_tag LOCUS_26750 805 1362 CDS product propanediol utilization: polyhedral bodies pduT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868841.1 protein_id gnl|my_center|LOCUS_26750 1376 1684 gene locus_tag LOCUS_26760 1376 1684 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_26760 1689 1967 gene locus_tag LOCUS_26770 1689 1967 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence0900 >Feature sequence0901 <2403 969 gene locus_tag LOCUS_26780 <2403 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E280:DNA mismatch repair protein MutL >Feature sequence0902 >Feature sequence0903 1283 1065 gene locus_tag LOCUS_26790 1283 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 2296 1352 gene locus_tag LOCUS_26800 gene rfbB 2296 1352 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73MR6 protein_id gnl|my_center|LOCUS_26800 >Feature sequence0904 223 2361 gene locus_tag LOCUS_26810 223 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence0905 279 491 gene locus_tag LOCUS_26820 279 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 869 2251 gene locus_tag LOCUS_26830 869 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence0906 1208 162 gene locus_tag LOCUS_26840 gene plsX 1208 162 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CS2 protein_id gnl|my_center|LOCUS_26840 1907 1398 gene locus_tag LOCUS_26850 1907 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence0907 548 294 gene locus_tag LOCUS_26860 548 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 1196 687 gene locus_tag LOCUS_26870 1196 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 1536 1733 gene locus_tag LOCUS_26880 1536 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence0908 1048 1809 gene locus_tag LOCUS_26890 1048 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2222 1806 gene locus_tag LOCUS_26900 2222 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence0909 >Feature sequence0910 <1 1097 gene locus_tag LOCUS_26910 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942298.1:two-component system response regulator 1536 1090 gene locus_tag LOCUS_26920 gene rimI 1536 1090 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CP1 protein_id gnl|my_center|LOCUS_26920 2243 1533 gene locus_tag LOCUS_26930 2243 1533 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence0911 2155 1214 gene locus_tag LOCUS_26940 gene etfA 2155 1214 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 protein_id gnl|my_center|LOCUS_26940 >Feature sequence0912 197 1480 gene locus_tag LOCUS_26950 197 1480 CDS product iron hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811612.1 protein_id gnl|my_center|LOCUS_26950 1686 2036 gene locus_tag LOCUS_26960 1686 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 >Feature sequence0913 <1 900 gene locus_tag LOCUS_26970 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048068.1:alginate O-acetyltransferase 875 1939 gene locus_tag LOCUS_26980 875 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence0914 <2362 635 gene locus_tag LOCUS_26990 <2362 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205578.1:hybrid non-ribosomal peptide synthetase/type I polyketide synthase >Feature sequence0915 >Feature sequence0916 375 1223 gene locus_tag LOCUS_27000 375 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 1226 2077 gene locus_tag LOCUS_27010 gene mutM 1226 2077 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHE9 protein_id gnl|my_center|LOCUS_27010 2348 2034 gene locus_tag LOCUS_27020 2348 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence0917 957 94 gene locus_tag LOCUS_27030 957 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812228.1 protein_id gnl|my_center|LOCUS_27030 1101 2015 gene locus_tag LOCUS_27040 1101 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258947.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence0918 892 2037 gene locus_tag LOCUS_27050 892 2037 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence0919 >Feature sequence0920 70 1428 gene locus_tag LOCUS_27060 70 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 1425 1811 gene locus_tag LOCUS_27070 1425 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 >Feature sequence0921 1714 1553 gene locus_tag LOCUS_27080 1714 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence0922 <2338 285 gene locus_tag LOCUS_27090 <2338 285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048172.1:glycyl radical enzyme >Feature sequence0923 7 708 gene locus_tag LOCUS_27100 7 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 >Feature sequence0924 >Feature sequence0925 321 1094 gene locus_tag LOCUS_27110 321 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence0926 >Feature sequence0927 1287 508 gene locus_tag LOCUS_27120 1287 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence0928 >Feature sequence0929 >Feature sequence0930 140 1651 gene locus_tag LOCUS_27130 140 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence0931 <1 763 gene locus_tag LOCUS_27140 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A1A0:rhamnulose-1-phosphate aldolase 982 2178 gene locus_tag LOCUS_27150 982 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence0932 1377 130 gene locus_tag LOCUS_27160 1377 130 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202532.1 protein_id gnl|my_center|LOCUS_27160 1615 2136 gene locus_tag LOCUS_27170 1615 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence0933 54 1037 gene locus_tag LOCUS_27180 54 1037 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_27180 1144 1611 gene locus_tag LOCUS_27190 1144 1611 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_27190 1844 1689 gene locus_tag LOCUS_27200 1844 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 2118 1966 gene locus_tag LOCUS_27210 2118 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 >Feature sequence0934 93 1139 gene locus_tag LOCUS_27220 93 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence0935 306 1232 gene locus_tag LOCUS_27230 306 1232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_27230 1236 2024 gene locus_tag LOCUS_27240 1236 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 >Feature sequence0936 26 1708 gene locus_tag LOCUS_27250 gene sppA 26 1708 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence0937 <1 1298 gene locus_tag LOCUS_27260 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080165.1:aldo/keto reductase >Feature sequence0938 >Feature sequence0939 2307 1420 gene locus_tag LOCUS_27270 2307 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 >Feature sequence0940 >Feature sequence0941 >Feature sequence0942 >Feature sequence0943 132 1427 gene locus_tag LOCUS_27280 gene folC 132 1427 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048156.1 protein_id gnl|my_center|LOCUS_27280 1414 2211 gene locus_tag LOCUS_27290 1414 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence0944 715 1026 gene locus_tag LOCUS_27300 715 1026 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814C9 protein_id gnl|my_center|LOCUS_27300 1019 1636 gene locus_tag LOCUS_27310 gene recR 1019 1636 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXS8 protein_id gnl|my_center|LOCUS_27310 1654 2226 gene locus_tag LOCUS_27320 gene porC 1654 2226 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05650 protein_id gnl|my_center|LOCUS_27320 >Feature sequence0945 >Feature sequence0946 <1 1546 gene locus_tag LOCUS_27330 <1 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546207.1:hybrid sensor histidine kinase/response regulator <2290 1494 gene locus_tag LOCUS_27340 <2290 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938977.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence0947 <1 747 gene locus_tag LOCUS_27350 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9WZW0:tRNA pseudouridine synthase B 1413 769 gene locus_tag LOCUS_27360 1413 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 2234 1410 gene locus_tag LOCUS_27370 gene dapF 2234 1410 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZX7 protein_id gnl|my_center|LOCUS_27370 >Feature sequence0948 >Feature sequence0949 1477 32 gene locus_tag LOCUS_27380 1477 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 1970 1521 gene locus_tag LOCUS_27390 1970 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence0950 1969 1283 gene locus_tag LOCUS_27400 1969 1283 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence0951 <1 744 gene locus_tag LOCUS_27410 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000854514.1:capsular polysaccharide biosynthesis protein >Feature sequence0952 >Feature sequence0953 1490 2212 gene locus_tag LOCUS_27420 1490 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 >Feature sequence0954 430 1386 gene locus_tag LOCUS_27430 gene sbnA 430 1386 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570807.1 protein_id gnl|my_center|LOCUS_27430 >Feature sequence0955 1321 437 gene locus_tag LOCUS_27440 1321 437 CDS product rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965609.1 protein_id gnl|my_center|LOCUS_27440 2118 1354 gene locus_tag LOCUS_27450 2118 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence0956 65 2254 gene locus_tag LOCUS_27460 65 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence0957 513 19 gene locus_tag LOCUS_27470 513 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 <2269 683 gene locus_tag LOCUS_27480 <2269 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence0958 160 1455 gene locus_tag LOCUS_27490 160 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 1459 2076 gene locus_tag LOCUS_27500 1459 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence0959 1231 71 gene locus_tag LOCUS_27510 1231 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 1947 1294 gene locus_tag LOCUS_27520 gene aat 1947 1294 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRL0 protein_id gnl|my_center|LOCUS_27520 >Feature sequence0960 1786 161 gene locus_tag LOCUS_27530 1786 161 CDS product NDP-sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403375.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence0961 1804 251 gene locus_tag LOCUS_27540 1804 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence0962 369 220 gene locus_tag LOCUS_27550 369 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 2068 461 gene locus_tag LOCUS_27560 2068 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence0963 >Feature sequence0964 >Feature sequence0965 <1 2153 gene locus_tag LOCUS_27570 <1 2153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:polyketide synthase >Feature sequence0966 <1 1072 gene locus_tag LOCUS_27580 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939260.1:pyridine nucleotide-disulfide oxidoreductase 1069 1929 gene locus_tag LOCUS_27590 1069 1929 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939259.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence0967 997 101 gene locus_tag LOCUS_27600 997 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1418 1068 gene locus_tag LOCUS_27610 1418 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 2173 1439 gene locus_tag LOCUS_27620 gene atpB 2173 1439 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GB2 protein_id gnl|my_center|LOCUS_27620 >Feature sequence0968 >Feature sequence0969 174 1121 gene locus_tag LOCUS_27630 174 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256555.1 protein_id gnl|my_center|LOCUS_27630 1573 1148 gene locus_tag LOCUS_27640 1573 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 1866 1591 gene locus_tag LOCUS_27650 1866 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 2231 1863 gene locus_tag LOCUS_27660 2231 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956716.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence0970 >Feature sequence0971 959 573 gene locus_tag LOCUS_27670 959 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 2212 1064 gene locus_tag LOCUS_27680 2212 1064 CDS product acetoacetate metabolism regulatory protein AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_27680 >Feature sequence0972 365 2125 gene locus_tag LOCUS_27690 365 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 >Feature sequence0973 220 65 gene locus_tag LOCUS_27700 220 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 493 332 gene locus_tag LOCUS_27710 493 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 817 656 gene locus_tag LOCUS_27720 817 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 980 1459 gene locus_tag LOCUS_27730 980 1459 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA86 protein_id gnl|my_center|LOCUS_27730 1522 1746 gene locus_tag LOCUS_27740 1522 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2066 1866 gene locus_tag LOCUS_27750 2066 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence0974 1712 345 gene locus_tag LOCUS_27760 1712 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence0975 <1 720 gene locus_tag LOCUS_27770 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010993584.1:radical SAM peptide maturase 713 1984 gene locus_tag LOCUS_27780 713 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797445.1 protein_id gnl|my_center|LOCUS_27780 >Feature sequence0976 <1 1992 gene locus_tag LOCUS_27790 <1 1992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E2W3:histidine kinase >Feature sequence0977 465 2135 gene locus_tag LOCUS_27800 465 2135 CDS product type II secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113395.1 protein_id gnl|my_center|LOCUS_27800 >Feature sequence0978 >Feature sequence0979 1215 403 gene locus_tag LOCUS_27810 gene lpxA 1215 403 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHC0 protein_id gnl|my_center|LOCUS_27810 1653 1216 gene locus_tag LOCUS_27820 gene fabZ 1653 1216 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814Y7 protein_id gnl|my_center|LOCUS_27820 2166 1660 gene locus_tag LOCUS_27830 2166 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66547 protein_id gnl|my_center|LOCUS_27830 >Feature sequence0980 >Feature sequence0981 <2212 368 gene locus_tag LOCUS_27840 <2212 368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107802.1:ABC transporter permease >Feature sequence0982 <1 1455 gene locus_tag LOCUS_27850 <1 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462224.1:DNA topoisomerase III 1530 2018 gene locus_tag LOCUS_27860 1530 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328395.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence0983 1 2025 gene locus_tag LOCUS_27870 1 2025 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_27870 >Feature sequence0984 <1 583 gene locus_tag LOCUS_27880 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940776.1:cell polarity determinant GTPase MglA 580 1833 gene locus_tag LOCUS_27890 580 1833 CDS product homoaconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870106.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence0985 173 721 gene locus_tag LOCUS_27900 173 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44014 protein_id gnl|my_center|LOCUS_27900 >Feature sequence0986 2 217 gene locus_tag LOCUS_27910 2 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 266 1651 gene locus_tag LOCUS_27920 gene mpl 266 1651 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_27920 1759 1968 gene locus_tag LOCUS_27930 1759 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence0987 >Feature sequence0988 802 1653 gene locus_tag LOCUS_27940 802 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence0989 268 1521 gene locus_tag LOCUS_27950 268 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887318.1 protein_id gnl|my_center|LOCUS_27950 >Feature sequence0990 >Feature sequence0991 >Feature sequence0992 >Feature sequence0993 2130 778 gene locus_tag LOCUS_27960 2130 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence0994 87 428 gene locus_tag LOCUS_27970 87 428 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67020 protein_id gnl|my_center|LOCUS_27970 535 1077 gene locus_tag LOCUS_27980 gene queE 535 1077 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67826 protein_id gnl|my_center|LOCUS_27980 1590 1081 gene locus_tag LOCUS_27990 1590 1081 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_27990 >Feature sequence0995 >Feature sequence0996 >Feature sequence0997 2160 472 gene locus_tag LOCUS_28000 2160 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence0998 361 275 gene locus_tag LOCUS_t00240 361 275 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <2167 432 gene locus_tag LOCUS_28010 <2167 432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546207.1:hybrid sensor histidine kinase/response regulator >Feature sequence0999 >Feature sequence1000 1156 95 gene locus_tag LOCUS_28020 1156 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 1817 1170 gene locus_tag LOCUS_28030 1817 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 2155 1814 gene locus_tag LOCUS_28040 2155 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence1001 716 240 gene locus_tag LOCUS_28050 716 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 1762 713 gene locus_tag LOCUS_28060 1762 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence1002 386 1321 gene locus_tag LOCUS_28070 386 1321 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404003.1 protein_id gnl|my_center|LOCUS_28070 1323 2027 gene locus_tag LOCUS_28080 1323 2027 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence1003 332 2083 gene locus_tag LOCUS_28090 gene dnaK 332 2083 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH59 protein_id gnl|my_center|LOCUS_28090 >Feature sequence1004 1101 1796 gene locus_tag LOCUS_28100 1101 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355974.1 protein_id gnl|my_center|LOCUS_28100 >Feature sequence1005 >Feature sequence1006 >Feature sequence1007 <1 556 gene locus_tag LOCUS_28110 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YJT4:NAD kinase >Feature sequence1008 <2136 778 gene locus_tag LOCUS_28120 <2136 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P61679:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence1009 1535 1002 gene locus_tag LOCUS_28130 1535 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 2022 1525 gene locus_tag LOCUS_28140 2022 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 >Feature sequence1010 134 331 gene locus_tag LOCUS_28150 134 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 333 1331 gene locus_tag LOCUS_28160 333 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 <2133 1343 gene locus_tag LOCUS_28170 <2133 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403661.1:sodium-dependent transporter >Feature sequence1011 >Feature sequence1012 >Feature sequence1013 191 1069 gene locus_tag LOCUS_28180 191 1069 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986672.1 protein_id gnl|my_center|LOCUS_28180 1066 1533 gene locus_tag LOCUS_28190 1066 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence1014 >Feature sequence1015 >Feature sequence1016 >Feature sequence1017 <1 1009 gene locus_tag LOCUS_28200 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061038.1:disulfide reductase 1014 1439 gene locus_tag LOCUS_28210 1014 1439 CDS product methyl viologen-reducing hydrogenase subunit delta FlpD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_28210 >Feature sequence1018 >Feature sequence1019 21 1052 gene locus_tag LOCUS_28220 gene mreB-1 21 1052 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_28220 1052 1864 gene locus_tag LOCUS_28230 gene mreC 1052 1864 CDS product cell shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I681 protein_id gnl|my_center|LOCUS_28230 >Feature sequence1020 2004 874 gene locus_tag LOCUS_28240 gene iadA 2004 874 CDS product isoaspartyl dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7G0 protein_id gnl|my_center|LOCUS_28240 >Feature sequence1021 1337 519 gene locus_tag LOCUS_28250 1337 519 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_28250 1599 1961 gene locus_tag LOCUS_28260 1599 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence1022 >Feature sequence1023 905 177 gene locus_tag LOCUS_28270 905 177 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172947.1 protein_id gnl|my_center|LOCUS_28270 1448 966 gene locus_tag LOCUS_28280 1448 966 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088110.1 protein_id gnl|my_center|LOCUS_28280 1548 1847 gene locus_tag LOCUS_28290 1548 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 1948 2022 gene locus_tag LOCUS_t00250 1948 2022 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1024 >Feature sequence1025 687 1700 gene locus_tag LOCUS_28300 687 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence1026 1055 426 gene locus_tag LOCUS_28310 1055 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence1027 >Feature sequence1028 1355 168 gene locus_tag LOCUS_28320 gene sat 1355 168 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE30 protein_id gnl|my_center|LOCUS_28320 >Feature sequence1029 >Feature sequence1030 <2077 848 gene locus_tag LOCUS_28330 <2077 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793798.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence1031 >Feature sequence1032 >Feature sequence1033 1923 1651 gene locus_tag LOCUS_28340 1923 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence1034 619 371 gene locus_tag LOCUS_28350 619 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 1723 683 gene locus_tag LOCUS_28360 1723 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226588.1 protein_id gnl|my_center|LOCUS_28360 2062 1748 gene locus_tag LOCUS_28370 2062 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 >Feature sequence1035 <2063 948 gene locus_tag LOCUS_28380 <2063 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867693.1:glutamate dehydrogenase >Feature sequence1036 <1 917 gene locus_tag LOCUS_28390 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3MEU4:glucose-1-phosphate thymidylyltransferase 907 2037 gene locus_tag LOCUS_28400 gene rfbB 907 2037 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73MR6 protein_id gnl|my_center|LOCUS_28400 >Feature sequence1037 456 1187 gene locus_tag LOCUS_28410 456 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 >Feature sequence1038 38 406 gene locus_tag LOCUS_28420 38 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence1039 141 1052 gene locus_tag LOCUS_28430 gene ybhG 141 1052 CDS product UPF0194 membrane protein YbhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z879 protein_id gnl|my_center|LOCUS_28430 1062 1973 gene locus_tag LOCUS_28440 1062 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence1040 >Feature sequence1041 1083 637 gene locus_tag LOCUS_28450 1083 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1255 1962 gene locus_tag LOCUS_28460 gene aaxB 1255 1962 CDS product pyruvoyl-dependent arginine decarboxylase AaxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84378 protein_id gnl|my_center|LOCUS_28460 >Feature sequence1042 <1 718 gene locus_tag LOCUS_28470 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18CD2:proline--tRNA ligase 1 930 1121 gene locus_tag LOCUS_28480 930 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1175 1357 gene locus_tag LOCUS_28490 1175 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1498 1698 gene locus_tag LOCUS_28500 1498 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1726 1908 gene locus_tag LOCUS_28510 1726 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 >Feature sequence1043 <1 1990 gene locus_tag LOCUS_28520 <1 1990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D0J2:protein translocase subunit SecA >Feature sequence1044 550 1992 gene locus_tag LOCUS_28530 550 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 >Feature sequence1045 1197 865 gene locus_tag LOCUS_28540 1197 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence1046 <1 1189 gene locus_tag LOCUS_28550 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266869.1:peptide transporter >Feature sequence1047 1 840 gene locus_tag LOCUS_28560 1 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 >Feature sequence1048 1237 431 gene locus_tag LOCUS_28570 1237 431 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021858.1 protein_id gnl|my_center|LOCUS_28570 2001 1234 gene locus_tag LOCUS_28580 gene bla 2001 1234 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFY5 protein_id gnl|my_center|LOCUS_28580 >Feature sequence1049 505 1791 gene locus_tag LOCUS_28590 505 1791 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_28590 >Feature sequence1050 >Feature sequence1051 26 1621 gene locus_tag LOCUS_28600 gene pgi 26 1621 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTL8 protein_id gnl|my_center|LOCUS_28600 >Feature sequence1052 302 853 gene locus_tag LOCUS_28610 302 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28610 869 1291 gene locus_tag LOCUS_28620 869 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28620 >Feature sequence1053 468 1172 gene locus_tag LOCUS_28630 468 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence1054 >Feature sequence1055 <1 1703 gene locus_tag LOCUS_28640 <1 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942578.1:elongation factor G >Feature sequence1056 1997 462 gene locus_tag LOCUS_28650 1997 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence1057 1229 528 gene locus_tag LOCUS_28660 1229 528 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006715.1 protein_id gnl|my_center|LOCUS_28660 1839 1222 gene locus_tag LOCUS_28670 1839 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 >Feature sequence1058 <1 742 gene locus_tag LOCUS_28680 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533116.1:aminotransferase DegT 735 1358 gene locus_tag LOCUS_28690 735 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence1059 49 1866 gene locus_tag LOCUS_28700 49 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 >Feature sequence1060 >Feature sequence1061 1827 1414 gene locus_tag LOCUS_28710 1827 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence1062 636 1961 gene locus_tag LOCUS_28720 636 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence1063 >Feature sequence1064 <1 827 gene locus_tag LOCUS_28730 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461019.1:undecaprenyl-phosphate glucose phosphotransferase >Feature sequence1065 141 1133 gene locus_tag LOCUS_28740 141 1133 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_28740 1936 1139 gene locus_tag LOCUS_28750 1936 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 >Feature sequence1066 <2000 560 gene locus_tag LOCUS_28760 <2000 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327432.1:sodium:sulfate symporter >Feature sequence1067 >Feature sequence1068 <1 919 gene locus_tag LOCUS_28770 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229746.1:cation diffusion facilitator transporter 1088 1960 gene locus_tag LOCUS_28780 gene ispA 1088 1960 CDS product geranyltranstransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254385.1 protein_id gnl|my_center|LOCUS_28780 >Feature sequence1069 526 1986 gene locus_tag LOCUS_28790 526 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence1070 1731 250 gene locus_tag LOCUS_28800 1731 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence1071 >Feature sequence1072 >Feature sequence1073 1720 1226 gene locus_tag LOCUS_28810 1720 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1974 1822 gene locus_tag LOCUS_28820 1974 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence1074 <1 1925 gene locus_tag LOCUS_28830 <1 1925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481254.1:peptidase >Feature sequence1075 672 812 gene locus_tag LOCUS_28840 672 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 1159 1296 gene locus_tag LOCUS_28850 1159 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 1340 1483 gene locus_tag LOCUS_28860 1340 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence1076 >Feature sequence1077 >Feature sequence1078 >Feature sequence1079 242 1510 gene locus_tag LOCUS_28870 242 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1880 1954 gene locus_tag LOCUS_t00260 1880 1954 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1080 1301 414 gene locus_tag LOCUS_28880 gene era 1301 414 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42182 protein_id gnl|my_center|LOCUS_28880 <1962 1285 gene locus_tag LOCUS_28890 <1962 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017189.1:membrane protein >Feature sequence1081 <1 1731 gene locus_tag LOCUS_28900 <1 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066875.1:adenylate cyclase >Feature sequence1082 16 252 gene locus_tag LOCUS_28910 16 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 300 536 gene locus_tag LOCUS_28920 300 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 561 791 gene locus_tag LOCUS_28930 561 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 >Feature sequence1083 1447 1851 gene locus_tag LOCUS_28940 1447 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 >Feature sequence1084 200 1111 gene locus_tag LOCUS_28950 200 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143763.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence1085 <1 1118 gene locus_tag LOCUS_28960 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250181.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) >Feature sequence1086 1932 430 gene locus_tag LOCUS_28970 1932 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 >Feature sequence1087 >Feature sequence1088 946 353 gene locus_tag LOCUS_28980 946 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 1944 1057 gene locus_tag LOCUS_28990 1944 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 >Feature sequence1089 42 245 gene locus_tag LOCUS_29000 42 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 1793 309 gene locus_tag LOCUS_29010 1793 309 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768803.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence1090 1430 753 gene locus_tag LOCUS_29020 gene ftsE 1430 753 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_29020 1818 1516 gene locus_tag LOCUS_29030 1818 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence1091 <1939 199 gene locus_tag LOCUS_29040 <1939 199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:hybrid sensor histidine kinase/response regulator >Feature sequence1092 751 158 gene locus_tag LOCUS_29050 751 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 1001 786 gene locus_tag LOCUS_29060 1001 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 1937 1035 gene locus_tag LOCUS_29070 1937 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence1093 >Feature sequence1094 276 136 gene locus_tag LOCUS_29080 276 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 568 278 gene locus_tag LOCUS_29090 568 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 <1935 579 gene locus_tag LOCUS_29100 <1935 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143441.1:sodium:proline symporter >Feature sequence1095 >Feature sequence1096 <1 938 gene locus_tag LOCUS_29110 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529171.1:metalloprotease >Feature sequence1097 >Feature sequence1098 >Feature sequence1099 <1927 710 gene locus_tag LOCUS_29120 <1927 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510922.1:polysaccharide biosynthesis protein >Feature sequence1100 315 437 gene locus_tag LOCUS_29130 315 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 <1926 508 gene locus_tag LOCUS_29140 <1926 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UIA9:glutamine--fructose-6-phosphate aminotransferase [isomerizing] >Feature sequence1101 372 232 gene locus_tag LOCUS_29150 372 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 697 473 gene locus_tag LOCUS_29160 697 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 <1925 812 gene locus_tag LOCUS_29170 <1925 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763756.1:ATPase AAA >Feature sequence1102 1860 49 gene locus_tag LOCUS_29180 1860 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 >Feature sequence1103 >Feature sequence1104 <1 722 gene locus_tag LOCUS_29190 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RM55:type III pantothenate kinase 719 1285 gene locus_tag LOCUS_29200 719 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 >Feature sequence1105 >Feature sequence1106 163 1032 gene locus_tag LOCUS_29210 163 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 >Feature sequence1107 1799 1125 gene locus_tag LOCUS_29220 1799 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023187.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence1108 1610 195 gene locus_tag LOCUS_29230 gene ooxA 1610 195 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886766.1 protein_id gnl|my_center|LOCUS_29230 1884 1585 gene locus_tag LOCUS_29240 1884 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29240 >Feature sequence1109 >Feature sequence1110 >Feature sequence1111 >Feature sequence1112 >Feature sequence1113 692 540 gene locus_tag LOCUS_29250 692 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 1897 998 gene locus_tag LOCUS_29260 1897 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence1114 <1 1548 gene locus_tag LOCUS_29270 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:tetratricopeptide repeat domain protein >Feature sequence1115 >Feature sequence1116 <1 950 gene locus_tag LOCUS_29280 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920059.1:peptidase M1 961 1272 gene locus_tag LOCUS_29290 961 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 1273 1833 gene locus_tag LOCUS_29300 1273 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 >Feature sequence1117 958 206 gene locus_tag LOCUS_29310 958 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 1749 988 gene locus_tag LOCUS_29320 1749 988 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198263.1 protein_id gnl|my_center|LOCUS_29320 >Feature sequence1118 1738 134 gene locus_tag LOCUS_29330 1738 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 >Feature sequence1119 204 527 gene locus_tag LOCUS_29340 gene clpS 204 527 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I31 protein_id gnl|my_center|LOCUS_29340 >Feature sequence1120 <1 837 gene locus_tag LOCUS_29350 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67274:tRNA-specific 2-thiouridylase MnmA <1883 841 gene locus_tag LOCUS_29360 <1883 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065752.1:Cl- channel voltage-gated family protein >Feature sequence1121 475 1791 gene locus_tag LOCUS_29370 475 1791 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889588.1 protein_id gnl|my_center|LOCUS_29370 >Feature sequence1122 83 274 gene locus_tag LOCUS_29380 83 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 290 1189 gene locus_tag LOCUS_29390 290 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence1123 >Feature sequence1124 1645 407 gene locus_tag LOCUS_29400 1645 407 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_29400 >Feature sequence1125 >Feature sequence1126 >Feature sequence1127 >Feature sequence1128 713 1381 gene locus_tag LOCUS_29410 713 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 >Feature sequence1129 186 1742 gene locus_tag LOCUS_29420 186 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 >Feature sequence1130 <1866 895 gene locus_tag LOCUS_29430 <1866 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143698.1:lipopolysaccharide biosynthesis protein >Feature sequence1131 >Feature sequence1132 566 1777 gene locus_tag LOCUS_29440 566 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence1133 <1 765 gene locus_tag LOCUS_29450 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D >Feature sequence1134 <1861 337 gene locus_tag LOCUS_29460 <1861 337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence1135 500 348 gene locus_tag LOCUS_29470 500 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 1603 578 gene locus_tag LOCUS_29480 1603 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 >Feature sequence1136 1796 759 gene locus_tag LOCUS_29490 1796 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence1137 <1 1129 gene locus_tag LOCUS_29500 <1 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085082.1:alkaline protease >Feature sequence1138 <1851 352 gene locus_tag LOCUS_29510 <1851 352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94459:plipastatin synthase subunit D note possible pseudo, internal stop codon, frameshifted >Feature sequence1139 808 969 gene locus_tag LOCUS_29520 808 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 1290 1574 gene locus_tag LOCUS_29530 1290 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 >Feature sequence1140 >Feature sequence1141 >Feature sequence1142 357 1055 gene locus_tag LOCUS_29540 gene dsbD 357 1055 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence1143 1 489 gene locus_tag LOCUS_29550 1 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 544 1548 gene locus_tag LOCUS_29560 gene hypE 544 1548 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_29560 >Feature sequence1144 <1840 78 gene locus_tag LOCUS_29570 <1840 78 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268607.1:non-ribosomal peptide synthetase >Feature sequence1145 >Feature sequence1146 >Feature sequence1147 >Feature sequence1148 >Feature sequence1149 19 195 gene locus_tag LOCUS_29580 19 195 CDS product UPF0339 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73PH3 protein_id gnl|my_center|LOCUS_29580 1011 196 gene locus_tag LOCUS_29590 1011 196 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784764.1 protein_id gnl|my_center|LOCUS_29590 1787 1014 gene locus_tag LOCUS_29600 1787 1014 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108713.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence1150 <1 1442 gene locus_tag LOCUS_29610 <1 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963532.1:O-acyltransferase >Feature sequence1151 106 181 gene locus_tag LOCUS_t00270 106 181 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 286 1050 gene locus_tag LOCUS_29620 gene surE 286 1050 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ6 protein_id gnl|my_center|LOCUS_29620 1051 1671 gene locus_tag LOCUS_29630 1051 1671 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_29630 >Feature sequence1152 <1 1304 gene locus_tag LOCUS_29640 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942137.1:type IV-A pilus assembly ATPase PilB >Feature sequence1153 >Feature sequence1154 475 1722 gene locus_tag LOCUS_29650 gene leuC 475 1722 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6F6 protein_id gnl|my_center|LOCUS_29650 >Feature sequence1155 <1 1415 gene locus_tag LOCUS_29660 <1 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203283.1:dihydrofolate reductase >Feature sequence1156 1375 152 gene locus_tag LOCUS_29670 1375 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence1157 212 1195 gene locus_tag LOCUS_29680 212 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 >Feature sequence1158 >Feature sequence1159 1495 608 gene locus_tag LOCUS_29690 1495 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence1160 >Feature sequence1161 >Feature sequence1162 1516 272 gene locus_tag LOCUS_29700 1516 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence1163 >Feature sequence1164 >Feature sequence1165 >Feature sequence1166 >Feature sequence1167 93 599 gene locus_tag LOCUS_29710 93 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence1168 >Feature sequence1169 >Feature sequence1170 <1 1577 gene locus_tag LOCUS_29720 <1 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q08787:surfactin synthase subunit 3 >Feature sequence1171 1802 360 gene locus_tag LOCUS_29730 1802 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 >Feature sequence1172 >Feature sequence1173 >Feature sequence1174 >Feature sequence1175 490 59 gene locus_tag LOCUS_29740 490 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 1619 483 gene locus_tag LOCUS_29750 1619 483 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933540.1 protein_id gnl|my_center|LOCUS_29750 >Feature sequence1176 >Feature sequence1177 1200 748 gene locus_tag LOCUS_29760 1200 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 <1787 1197 gene locus_tag LOCUS_29770 <1787 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393343.1:sigma-24 >Feature sequence1178 <1782 654 gene locus_tag LOCUS_29780 <1782 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761753.1:N-acetyltransferase >Feature sequence1179 541 65 gene locus_tag LOCUS_29790 gene pgpA 541 65 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GV2 protein_id gnl|my_center|LOCUS_29790 1779 538 gene locus_tag LOCUS_29800 gene rimO 1779 538 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67016 protein_id gnl|my_center|LOCUS_29800 >Feature sequence1180 >Feature sequence1181 660 1679 gene locus_tag LOCUS_29810 660 1679 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJG7 protein_id gnl|my_center|LOCUS_29810 >Feature sequence1182 770 1126 gene locus_tag LOCUS_29820 770 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 >Feature sequence1183 >Feature sequence1184 1120 155 gene locus_tag LOCUS_29830 1120 155 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_29830 1440 1120 gene locus_tag LOCUS_29840 gene rbfA 1440 1120 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097322.1 protein_id gnl|my_center|LOCUS_29840 1724 1443 gene locus_tag LOCUS_29850 1724 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047972.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence1185 <1772 435 gene locus_tag LOCUS_29860 <1772 435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880094.1:transcriptional regulator >Feature sequence1186 >Feature sequence1187 95 1423 gene locus_tag LOCUS_29870 gene der 95 1423 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ID7 protein_id gnl|my_center|LOCUS_29870 >Feature sequence1188 >Feature sequence1189 2 1147 gene locus_tag LOCUS_29880 2 1147 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_29880 >Feature sequence1190 >Feature sequence1191 91 753 gene locus_tag LOCUS_29890 91 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 841 1332 gene locus_tag LOCUS_29900 841 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 >Feature sequence1192 1507 749 gene locus_tag LOCUS_29910 1507 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 >Feature sequence1193 45 1337 gene locus_tag LOCUS_29920 gene kynU 45 1337 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HHX7 protein_id gnl|my_center|LOCUS_29920 >Feature sequence1194 88 1551 gene locus_tag LOCUS_29930 88 1551 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_29930 1562 1696 gene locus_tag LOCUS_29940 1562 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence1195 1137 202 gene locus_tag LOCUS_29950 gene pyrB 1137 202 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK43 protein_id gnl|my_center|LOCUS_29950 1689 1138 gene locus_tag LOCUS_29960 gene pyrR 1689 1138 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK44 protein_id gnl|my_center|LOCUS_29960 >Feature sequence1196 116 1219 gene locus_tag LOCUS_29970 gene kdtA 116 1219 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_29970 >Feature sequence1197 <1 614 gene locus_tag LOCUS_29980 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5I7Z3:replicative DNA helicase 694 1290 gene locus_tag LOCUS_29990 694 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 1247 1597 gene locus_tag LOCUS_30000 1247 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 >Feature sequence1198 >Feature sequence1199 >Feature sequence1200 >Feature sequence1201 1 1041 gene locus_tag LOCUS_30010 gene pksG 1 1041 CDS product polyketide biosynthesis 3-hydroxy-3-methylglutaryl-ACP synthase PksG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40830 protein_id gnl|my_center|LOCUS_30010 >Feature sequence1202 >Feature sequence1203 1028 213 gene locus_tag LOCUS_30020 gene nadE 1028 213 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF7 protein_id gnl|my_center|LOCUS_30020 <1737 1021 gene locus_tag LOCUS_30030 <1737 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941312.1:carbon-nitrogen hydrolase >Feature sequence1204 >Feature sequence1205 150 356 gene locus_tag LOCUS_30040 150 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence1206 >Feature sequence1207 1523 1657 gene locus_tag LOCUS_30050 1523 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 >Feature sequence1208 >Feature sequence1209 >Feature sequence1210 <1725 100 gene locus_tag LOCUS_30060 <1725 100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943644.1:metalloprotease >Feature sequence1211 >Feature sequence1212 >Feature sequence1213 <1 1096 gene locus_tag LOCUS_30070 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942076.1:sodium/solute symporter serine/threonine phosphatase >Feature sequence1214 <1718 58 gene locus_tag LOCUS_30080 <1718 58 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RMD6:pyruvate-flavodoxin oxidoreductase >Feature sequence1215 >Feature sequence1216 368 1228 gene locus_tag LOCUS_30090 368 1228 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257988.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence1217 >Feature sequence1218 >Feature sequence1219 >Feature sequence1220 1510 548 gene locus_tag LOCUS_30100 1510 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence1221 >Feature sequence1222 >Feature sequence1223 310 1560 gene locus_tag LOCUS_30110 310 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 >Feature sequence1224 <1698 657 gene locus_tag LOCUS_30120 <1698 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q04747:surfactin synthase subunit 2 >Feature sequence1225 1357 26 gene locus_tag LOCUS_30130 gene ffh 1357 26 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2VI90 protein_id gnl|my_center|LOCUS_30130 >Feature sequence1226 776 1537 gene locus_tag LOCUS_30140 776 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 >Feature sequence1227 >Feature sequence1228 1235 1161 gene locus_tag LOCUS_t00280 1235 1161 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1229 1264 1608 gene locus_tag LOCUS_30150 1264 1608 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081748.1 protein_id gnl|my_center|LOCUS_30150 >Feature sequence1230 597 755 gene locus_tag LOCUS_30160 597 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence1231 >Feature sequence1232 >Feature sequence1233 >Feature sequence1234 >Feature sequence1235 >Feature sequence1236 >Feature sequence1237 >Feature sequence1238 402 1619 gene locus_tag LOCUS_30170 402 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545901.1 protein_id gnl|my_center|LOCUS_30170 >Feature sequence1239 >Feature sequence1240 >Feature sequence1241 >Feature sequence1242 >Feature sequence1243 >Feature sequence1244 >Feature sequence1245 <1 1410 gene locus_tag LOCUS_30180 <1 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TJ3:tricorn protease 1494 1649 gene locus_tag LOCUS_30190 1494 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 >Feature sequence1246 <1652 762 gene locus_tag LOCUS_30200 <1652 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence1247 >Feature sequence1248 718 245 gene locus_tag LOCUS_30210 718 245 CDS product TspO/MBR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_30210 >Feature sequence1249 >Feature sequence1250 >Feature sequence1251 >Feature sequence1252 898 500 gene locus_tag LOCUS_30220 898 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 1440 1039 gene locus_tag LOCUS_30230 1440 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 >Feature sequence1253 <1640 105 gene locus_tag LOCUS_30240 <1640 105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038609.1:aminopeptidase >Feature sequence1254 >Feature sequence1255 958 527 gene locus_tag LOCUS_30250 958 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038368.1 protein_id gnl|my_center|LOCUS_30250 1584 940 gene locus_tag LOCUS_30260 gene pcm 1584 940 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJY2 protein_id gnl|my_center|LOCUS_30260 >Feature sequence1256 >Feature sequence1257 >Feature sequence1258 >Feature sequence1259 <1 1152 gene locus_tag LOCUS_30270 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256869.1:lytic transglycosylase >Feature sequence1260 668 910 gene locus_tag LOCUS_30280 668 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 >Feature sequence1261 >Feature sequence1262 <1 520 gene locus_tag LOCUS_30290 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266377.1:fimbrial protein 706 1224 gene locus_tag LOCUS_30300 gene aroK 706 1224 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX01 protein_id gnl|my_center|LOCUS_30300 >Feature sequence1263 9 134 gene locus_tag LOCUS_30310 9 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 131 1078 gene locus_tag LOCUS_30320 131 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 <1628 1075 gene locus_tag LOCUS_30330 <1628 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786228.1:peptidase C69 >Feature sequence1264 >Feature sequence1265 >Feature sequence1266 >Feature sequence1267 446 1105 gene locus_tag LOCUS_30340 446 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 1624 1118 gene locus_tag LOCUS_30350 1624 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 >Feature sequence1268 55 1524 gene locus_tag LOCUS_30360 55 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence1269 1504 833 gene locus_tag LOCUS_30370 1504 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 >Feature sequence1270 53 1573 gene locus_tag LOCUS_30380 53 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 >Feature sequence1271 <1 1038 gene locus_tag LOCUS_30390 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545995.1:two-component sensor histidine kinase >Feature sequence1272 >Feature sequence1273 >Feature sequence1274 3 293 gene locus_tag LOCUS_30400 3 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 1193 306 gene locus_tag LOCUS_30410 1193 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_30410 >Feature sequence1275 903 154 gene locus_tag LOCUS_30420 903 154 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329295.1 protein_id gnl|my_center|LOCUS_30420 >Feature sequence1276 >Feature sequence1277 >Feature sequence1278 993 4 gene locus_tag LOCUS_30430 993 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 >Feature sequence1279 280 1284 gene locus_tag LOCUS_30440 280 1284 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583155.1 protein_id gnl|my_center|LOCUS_30440 >Feature sequence1280 1522 392 gene locus_tag LOCUS_30450 1522 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 >Feature sequence1281 327 578 gene locus_tag LOCUS_30460 327 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 646 948 gene locus_tag LOCUS_30470 646 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 961 1422 gene locus_tag LOCUS_30480 961 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 >Feature sequence1282 >Feature sequence1283 1393 656 gene locus_tag LOCUS_30490 1393 656 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence1284 >Feature sequence1285 1086 190 gene locus_tag LOCUS_30500 1086 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 1246 1539 gene locus_tag LOCUS_30510 1246 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence1286 1044 151 gene locus_tag LOCUS_30520 1044 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_30520 >Feature sequence1287 >Feature sequence1288 <1563 84 gene locus_tag LOCUS_30530 <1563 84 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765304.1:dipeptidyl carboxypeptidase II >Feature sequence1289 >Feature sequence1290 >Feature sequence1291 88 423 gene locus_tag LOCUS_30540 88 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 1178 1522 gene locus_tag LOCUS_30550 1178 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence1292 >Feature sequence1293 >Feature sequence1294 >Feature sequence1295 >Feature sequence1296 102 1052 gene locus_tag LOCUS_30560 gene omcK 102 1052 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942843.1 protein_id gnl|my_center|LOCUS_30560 >Feature sequence1297 179 967 gene locus_tag LOCUS_30570 179 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 1082 1273 gene locus_tag LOCUS_30580 gene rpmB 1082 1273 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2D8 protein_id gnl|my_center|LOCUS_30580 >Feature sequence1298 34 933 gene locus_tag LOCUS_30590 34 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 >Feature sequence1299 719 3 gene locus_tag LOCUS_30600 gene pyrH 719 3 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y0 protein_id gnl|my_center|LOCUS_30600 1320 721 gene locus_tag LOCUS_30610 gene tsf 1320 721 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Y1 protein_id gnl|my_center|LOCUS_30610 >Feature sequence1300 >Feature sequence1301 >Feature sequence1302 >Feature sequence1303 <1 859 gene locus_tag LOCUS_30620 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O05432:ATP synthase gamma chain >Feature sequence1304 564 244 gene locus_tag LOCUS_30630 564 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 839 1003 gene locus_tag LOCUS_30640 839 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence1305 1240 14 gene locus_tag LOCUS_30650 1240 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 >Feature sequence1306 <1536 691 gene locus_tag LOCUS_30660 <1536 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125283.1:acetoacetate metabolism regulatory protein AtoC >Feature sequence1307 <1 673 gene locus_tag LOCUS_30670 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932342.1:PAS domain-containing sensor histidine kinase 666 1355 gene locus_tag LOCUS_30680 666 1355 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865376.1 protein_id gnl|my_center|LOCUS_30680 >Feature sequence1308 >Feature sequence1309 <1 746 gene locus_tag LOCUS_30690 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947657.1:acyl-CoA dehydrogenase 1303 758 gene locus_tag LOCUS_30700 1303 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 1532 1287 gene locus_tag LOCUS_30710 1532 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence1310 >Feature sequence1311 1485 10 gene locus_tag LOCUS_30720 1485 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 >Feature sequence1312 552 1211 gene locus_tag LOCUS_30730 552 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence1313 258 611 gene locus_tag LOCUS_30740 258 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 1006 620 gene locus_tag LOCUS_30750 1006 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 1137 1496 gene locus_tag LOCUS_30760 1137 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 >Feature sequence1314 1187 171 gene locus_tag LOCUS_30770 1187 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 >Feature sequence1315 1525 179 gene locus_tag LOCUS_30780 1525 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence1316 >Feature sequence1317 562 230 gene locus_tag LOCUS_30790 562 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 536 799 gene locus_tag LOCUS_30800 536 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 >Feature sequence1318 >Feature sequence1319 >Feature sequence1320 1076 471 gene locus_tag LOCUS_30810 1076 471 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_30810 1519 1157 gene locus_tag LOCUS_30820 1519 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 >Feature sequence1321 413 183 gene locus_tag LOCUS_30830 413 183 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545802.1 protein_id gnl|my_center|LOCUS_30830 1433 528 gene locus_tag LOCUS_30840 gene nadA 1433 528 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJJ2 protein_id gnl|my_center|LOCUS_30840 >Feature sequence1322 1314 91 gene locus_tag LOCUS_30850 1314 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 >Feature sequence1323 >Feature sequence1324 >Feature sequence1325 1438 494 gene locus_tag LOCUS_30860 1438 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence1326 221 892 gene locus_tag LOCUS_30870 221 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 <1501 877 gene locus_tag LOCUS_30880 <1501 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941563.1:protein 3-oxoalanine-generating enzyme family protein >Feature sequence1327 <1 1290 gene locus_tag LOCUS_30890 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O31526:rhamnogalacturonan endolyase YesW >Feature sequence1328 203 808 gene locus_tag LOCUS_30900 203 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 >Feature sequence1329 >Feature sequence1330 1044 1334 gene locus_tag LOCUS_30910 gene frx-1 1044 1334 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942087.1 protein_id gnl|my_center|LOCUS_30910 >Feature sequence1331 1051 8 gene locus_tag LOCUS_30920 1051 8 CDS product toxin Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_30920 1400 1260 gene locus_tag LOCUS_30930 1400 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 >Feature sequence1332 1074 559 gene locus_tag LOCUS_30940 1074 559 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_30940 >Feature sequence1333 >Feature sequence1334 >Feature sequence1335 >Feature sequence1336 >Feature sequence1337 414 292 gene locus_tag LOCUS_30950 414 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 1006 557 gene locus_tag LOCUS_30960 1006 557 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904077.1 protein_id gnl|my_center|LOCUS_30960 >Feature sequence1338 188 1075 gene locus_tag LOCUS_30970 188 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 >Feature sequence1339 <1 818 gene locus_tag LOCUS_30980 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HEZ3:phosphatidate cytidylyltransferase >Feature sequence1340 >Feature sequence1341 >Feature sequence1342 <1 1372 gene locus_tag LOCUS_30990 <1 1372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109162.1:peptidase S9 >Feature sequence1343 >Feature sequence1344 133 1473 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcaaatctcaccatagtggaatgtaaag >Feature sequence1345 1199 762 gene locus_tag LOCUS_31000 1199 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 >Feature sequence1346 >Feature sequence1347 >Feature sequence1348 >Feature sequence1349 >Feature sequence1350 <1465 385 gene locus_tag LOCUS_31010 <1465 385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108603.1:toxin Fic >Feature sequence1351 >Feature sequence1352 >Feature sequence1353 >Feature sequence1354 887 87 gene locus_tag LOCUS_31020 887 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 <1459 880 gene locus_tag LOCUS_31030 <1459 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975510.1:glycosyl transferase family 1 >Feature sequence1355 >Feature sequence1356 >Feature sequence1357 165 25 gene locus_tag LOCUS_31040 165 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 239 967 gene locus_tag LOCUS_31050 239 967 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939322.1 protein_id gnl|my_center|LOCUS_31050 >Feature sequence1358 1052 111 gene locus_tag LOCUS_31060 1052 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 >Feature sequence1359 163 1089 gene locus_tag LOCUS_31070 163 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 >Feature sequence1360 1009 764 gene locus_tag LOCUS_31080 1009 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 >Feature sequence1361 >Feature sequence1362 <1447 747 gene locus_tag LOCUS_31090 <1447 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048109.1:UDP-N-acetyl glucosamine 2-epimerase >Feature sequence1363 >Feature sequence1364 <1 1255 gene locus_tag LOCUS_31100 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941535.1:B12-binding domain-containing radical SAM protein >Feature sequence1365 >Feature sequence1366 <1429 270 gene locus_tag LOCUS_31110 <1429 270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940860.1:MFS transporter >Feature sequence1367 >Feature sequence1368 <1428 78 gene locus_tag LOCUS_31120 <1428 78 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EDX2:methionine--tRNA ligase >Feature sequence1369 812 1066 gene locus_tag LOCUS_31130 812 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 >Feature sequence1370 >Feature sequence1371 <1 718 gene locus_tag LOCUS_31140 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786228.1:peptidase C69 <1426 765 gene locus_tag LOCUS_31150 <1426 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958239.1:ATPase >Feature sequence1372 >Feature sequence1373 >Feature sequence1374 <1 941 gene locus_tag LOCUS_31160 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545721.1:integrase >Feature sequence1375 >Feature sequence1376 >Feature sequence1377 726 64 gene locus_tag LOCUS_31170 gene omcE 726 64 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence1378 >Feature sequence1379 1204 125 gene locus_tag LOCUS_31180 1204 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 >Feature sequence1380 439 1098 gene locus_tag LOCUS_31190 439 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 1095 1361 gene locus_tag LOCUS_31200 1095 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence1381 1002 136 gene locus_tag LOCUS_31210 1002 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 1202 1005 gene locus_tag LOCUS_31220 1202 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 >Feature sequence1382 >Feature sequence1383 >Feature sequence1384 889 53 gene locus_tag LOCUS_31230 889 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141492.1 protein_id gnl|my_center|LOCUS_31230 >Feature sequence1385 370 705 gene locus_tag LOCUS_31240 370 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 >Feature sequence1386 >Feature sequence1387 >Feature sequence1388 836 90 gene locus_tag LOCUS_31250 gene fabG 836 90 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence1389 >Feature sequence1390 <1390 641 gene locus_tag LOCUS_31260 <1390 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090392.1:methyltransferase >Feature sequence1391 >Feature sequence1392 <1388 551 gene locus_tag LOCUS_31270 <1388 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q04747:surfactin synthase subunit 2 >Feature sequence1393 >Feature sequence1394 >Feature sequence1395 >Feature sequence1396 >Feature sequence1397 >Feature sequence1398 >Feature sequence1399 457 906 gene locus_tag LOCUS_31280 457 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 >Feature sequence1400 >Feature sequence1401 <1371 662 gene locus_tag LOCUS_31290 <1371 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942612.1:nucleotidyltransferase >Feature sequence1402 >Feature sequence1403 >Feature sequence1404 1162 5 gene locus_tag LOCUS_31300 gene metK 1162 5 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F85 protein_id gnl|my_center|LOCUS_31300 >Feature sequence1405 >Feature sequence1406 >Feature sequence1407 <1 1185 gene locus_tag LOCUS_31310 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940320.1:histidine kinase >Feature sequence1408 102 1361 gene locus_tag LOCUS_31320 102 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence1409 >Feature sequence1410 934 1173 gene locus_tag LOCUS_31330 934 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31330 >Feature sequence1411 600 767 gene locus_tag LOCUS_31340 600 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence1412 >Feature sequence1413 >Feature sequence1414 >Feature sequence1415 617 1171 gene locus_tag LOCUS_31350 617 1171 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence1416 <1 651 gene locus_tag LOCUS_31360 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941784.1:MBL fold metallo-hydrolase >Feature sequence1417 442 269 gene locus_tag LOCUS_31370 442 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 >Feature sequence1418 >Feature sequence1419 58 909 gene locus_tag LOCUS_31380 58 909 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_31380 >Feature sequence1420 >Feature sequence1421 >Feature sequence1422 <1 1163 gene locus_tag LOCUS_31390 <1 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P27206:surfactin synthase subunit 1 >Feature sequence1423 415 636 gene locus_tag LOCUS_31400 415 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence1424 >Feature sequence1425 >Feature sequence1426 <1341 358 gene locus_tag LOCUS_31410 <1341 358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089280.1:oxidoreductase >Feature sequence1427 1290 187 gene locus_tag LOCUS_31420 1290 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence1428 >Feature sequence1429 >Feature sequence1430 600 148 gene locus_tag LOCUS_31430 600 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 <1335 597 gene locus_tag LOCUS_31440 <1335 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086278.1:pilus assembly protein CpaF >Feature sequence1431 >Feature sequence1432 <1335 198 gene locus_tag LOCUS_31450 <1335 198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000833199.1:3-oxoacyl-ACP synthase >Feature sequence1433 708 505 gene locus_tag LOCUS_31460 708 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1310 738 gene locus_tag LOCUS_31470 1310 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 >Feature sequence1434 >Feature sequence1435 >Feature sequence1436 >Feature sequence1437 >Feature sequence1438 >Feature sequence1439 >Feature sequence1440 >Feature sequence1441 105 1082 gene locus_tag LOCUS_31480 105 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 >Feature sequence1442 >Feature sequence1443 >Feature sequence1444 >Feature sequence1445 >Feature sequence1446 >Feature sequence1447 1125 64 gene locus_tag LOCUS_31490 1125 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 >Feature sequence1448 3 455 gene locus_tag LOCUS_31500 3 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 870 421 gene locus_tag LOCUS_31510 870 421 CDS product UPF0260 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89QM1 protein_id gnl|my_center|LOCUS_31510 >Feature sequence1449 >Feature sequence1450 >Feature sequence1451 1199 654 gene locus_tag LOCUS_31520 1199 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 >Feature sequence1452 >Feature sequence1453 >Feature sequence1454 1244 36 gene locus_tag LOCUS_31530 1244 36 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016899.1 protein_id gnl|my_center|LOCUS_31530 >Feature sequence1455 431 811 gene locus_tag LOCUS_31540 431 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 827 1279 gene locus_tag LOCUS_31550 827 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 >Feature sequence1456 1140 751 gene locus_tag LOCUS_31560 1140 751 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081702.1 protein_id gnl|my_center|LOCUS_31560 >Feature sequence1457 1240 26 gene locus_tag LOCUS_31570 1240 26 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence1458 322 80 gene locus_tag LOCUS_31580 322 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 845 348 gene locus_tag LOCUS_31590 845 348 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974912.1 protein_id gnl|my_center|LOCUS_31590 >Feature sequence1459 <1 656 gene locus_tag LOCUS_31600 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766163.1:acriflavine resistance protein B 957 769 gene locus_tag LOCUS_31610 957 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 >Feature sequence1460 >Feature sequence1461 <1 1182 gene locus_tag LOCUS_31620 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707389.1:twitching motility protein PilT >Feature sequence1462 32 856 gene locus_tag LOCUS_31630 32 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 >Feature sequence1463 222 587 gene locus_tag LOCUS_31640 222 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 589 1224 gene locus_tag LOCUS_31650 gene adk 589 1224 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EJ9 protein_id gnl|my_center|LOCUS_31650 >Feature sequence1464 >Feature sequence1465 <1 583 gene locus_tag LOCUS_31660 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q188Z4:protease PrsW <1280 580 gene locus_tag LOCUS_31670 <1280 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877962.1:NADH oxidase >Feature sequence1466 1064 156 gene locus_tag LOCUS_31680 gene accA 1064 156 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DB5 protein_id gnl|my_center|LOCUS_31680 >Feature sequence1467 1176 178 gene locus_tag LOCUS_31690 1176 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 >Feature sequence1468 310 8 gene locus_tag LOCUS_31700 310 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 343 759 gene locus_tag LOCUS_31710 343 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 1197 766 gene locus_tag LOCUS_31720 1197 766 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869593.1 protein_id gnl|my_center|LOCUS_31720 >Feature sequence1469 >Feature sequence1470 >Feature sequence1471 >Feature sequence1472 1222 110 gene locus_tag LOCUS_31730 1222 110 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_31730 >Feature sequence1473 >Feature sequence1474 <1 754 gene locus_tag LOCUS_31740 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476260.1:alpha-glycosidase >Feature sequence1475 <1 684 gene locus_tag LOCUS_31750 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546185.1:two-component system response regulator >Feature sequence1476 <1265 165 gene locus_tag LOCUS_31760 <1265 165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837690.1:type II secretion system protein F >Feature sequence1477 >Feature sequence1478 >Feature sequence1479 560 832 gene locus_tag LOCUS_31770 560 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402964.1 protein_id gnl|my_center|LOCUS_31770 >Feature sequence1480 >Feature sequence1481 911 183 gene locus_tag LOCUS_31780 911 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 >Feature sequence1482 1106 786 gene locus_tag LOCUS_31790 1106 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 >Feature sequence1483 >Feature sequence1484 1167 163 gene locus_tag LOCUS_31800 1167 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 >Feature sequence1485 1 747 gene locus_tag LOCUS_31810 1 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence1486 1249 26 gene locus_tag LOCUS_31820 1249 26 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_31820 >Feature sequence1487 >Feature sequence1488 >Feature sequence1489 >Feature sequence1490 <1249 228 gene locus_tag LOCUS_31830 <1249 228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140084.1:alpha-mannosidase >Feature sequence1491 36 176 gene locus_tag LOCUS_31840 36 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 154 492 gene locus_tag LOCUS_31850 154 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 1248 502 gene locus_tag LOCUS_31860 1248 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 >Feature sequence1492 >Feature sequence1493 >Feature sequence1494 >Feature sequence1495 >Feature sequence1496 >Feature sequence1497 539 54 gene locus_tag LOCUS_31870 539 54 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_31870 <1242 567 gene locus_tag LOCUS_31880 <1242 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P71089:putative peptidase YgaJ >Feature sequence1498 >Feature sequence1499 <1 957 gene locus_tag LOCUS_31890 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O31788:serine protease AprX >Feature sequence1500 1235 114 gene locus_tag LOCUS_31900 1235 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence1501 >Feature sequence1502 >Feature sequence1503 >Feature sequence1504 >Feature sequence1505 202 1086 gene locus_tag LOCUS_31910 gene rsmH 202 1086 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67721 protein_id gnl|my_center|LOCUS_31910 >Feature sequence1506 >Feature sequence1507 201 905 gene locus_tag LOCUS_31920 201 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404272.1 protein_id gnl|my_center|LOCUS_31920 >Feature sequence1508 >Feature sequence1509 >Feature sequence1510 >Feature sequence1511 >Feature sequence1512 75 809 gene locus_tag LOCUS_31930 75 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 >Feature sequence1513 <1220 204 gene locus_tag LOCUS_31940 <1220 204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E3K6:phosphoenolpyruvate-protein phosphotransferase >Feature sequence1514 280 837 gene locus_tag LOCUS_31950 280 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 >Feature sequence1515 967 89 gene locus_tag LOCUS_31960 967 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence1516 >Feature sequence1517 343 597 gene locus_tag LOCUS_31970 343 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 >Feature sequence1518 >Feature sequence1519 <1 1198 gene locus_tag LOCUS_31980 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000790944.1:alkaline serine protease >Feature sequence1520 >Feature sequence1521 <1 625 gene locus_tag LOCUS_31990 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E2E1:transcription-repair-coupling factor >Feature sequence1522 <1206 260 gene locus_tag LOCUS_32000 <1206 260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393256.1:K+ transporter Trk >Feature sequence1523 368 156 gene locus_tag LOCUS_32010 368 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 250 1143 gene locus_tag LOCUS_32020 250 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence1524 >Feature sequence1525 >Feature sequence1526 >Feature sequence1527 >Feature sequence1528 >Feature sequence1529 46 1065 gene locus_tag LOCUS_32030 46 1065 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545721.1 protein_id gnl|my_center|LOCUS_32030 >Feature sequence1530 <1200 29 gene locus_tag LOCUS_32040 <1200 29 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5NFM8:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG >Feature sequence1531 >Feature sequence1532 551 772 gene locus_tag LOCUS_32050 551 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 >Feature sequence1533 >Feature sequence1534 >Feature sequence1535 56 226 gene locus_tag LOCUS_32060 56 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 <1198 354 gene locus_tag LOCUS_32070 <1198 354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426511.1:mannose-1-phosphate guanylyltransferase >Feature sequence1536 <1 838 gene locus_tag LOCUS_32080 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q820V9:CCA-adding enzyme >Feature sequence1537 1115 138 gene locus_tag LOCUS_32090 1115 138 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_32090 >Feature sequence1538 93 515 gene locus_tag LOCUS_32100 93 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32100 516 860 gene locus_tag LOCUS_32110 516 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32110 >Feature sequence1539 510 94 gene locus_tag LOCUS_32120 510 94 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_32120 983 510 gene locus_tag LOCUS_32130 983 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 >Feature sequence1540 >Feature sequence1541 728 1075 gene locus_tag LOCUS_32140 728 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence1542 >Feature sequence1543 647 42 gene locus_tag LOCUS_32150 647 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 >Feature sequence1544 >Feature sequence1545 >Feature sequence1546 >Feature sequence1547 >Feature sequence1548 107 982 gene locus_tag LOCUS_32160 107 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 >Feature sequence1549 >Feature sequence1550 >Feature sequence1551 >Feature sequence1552 877 488 gene locus_tag LOCUS_32170 877 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 >Feature sequence1553 >Feature sequence1554 >Feature sequence1555 >Feature sequence1556 <1 728 gene locus_tag LOCUS_32180 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790471.1:phosphoenolpyruvate synthase >Feature sequence1557 1024 23 gene locus_tag LOCUS_32190 gene hypE 1024 23 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940978.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence1558 >Feature sequence1559 >Feature sequence1560 >Feature sequence1561 <1 537 gene locus_tag LOCUS_32200 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39846:plipastatin synthase subunit B >Feature sequence1562 >Feature sequence1563 >Feature sequence1564 >Feature sequence1565 >Feature sequence1566 >Feature sequence1567 >Feature sequence1568 >Feature sequence1569 318 932 gene locus_tag LOCUS_32210 gene plsY 318 932 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUJ7 protein_id gnl|my_center|LOCUS_32210 >Feature sequence1570 >Feature sequence1571 >Feature sequence1572 >Feature sequence1573 >Feature sequence1574 392 24 gene locus_tag LOCUS_32220 392 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 763 990 gene locus_tag LOCUS_32230 763 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 >Feature sequence1575 1153 455 gene locus_tag LOCUS_32240 1153 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 >Feature sequence1576 >Feature sequence1577 1153 68 gene locus_tag LOCUS_32250 1153 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 >Feature sequence1578 >Feature sequence1579 >Feature sequence1580 >Feature sequence1581 >Feature sequence1582 >Feature sequence1583 915 649 gene locus_tag LOCUS_32260 915 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 >Feature sequence1584 >Feature sequence1585 >Feature sequence1586 >Feature sequence1587 >Feature sequence1588 >Feature sequence1589 >Feature sequence1590 >Feature sequence1591 >Feature sequence1592 1041 304 gene locus_tag LOCUS_32270 1041 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence1593 <1 960 gene locus_tag LOCUS_32280 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083312.1:FAD-binding protein >Feature sequence1594 1134 697 gene locus_tag LOCUS_32290 1134 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 >Feature sequence1595 848 315 gene locus_tag LOCUS_32300 848 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 >Feature sequence1596 >Feature sequence1597 >Feature sequence1598 >Feature sequence1599 >Feature sequence1600 <1 1103 gene locus_tag LOCUS_32310 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938960.1:ABC transporter ATP-binding protein >Feature sequence1601 >Feature sequence1602 >Feature sequence1603 >Feature sequence1604 >Feature sequence1605 <1124 514 gene locus_tag LOCUS_32320 <1124 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392779.1:D-aminopeptidase DppA >Feature sequence1606 >Feature sequence1607 <1 715 gene locus_tag LOCUS_32330 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073686.1:IS110 family transposase >Feature sequence1608 1103 585 gene locus_tag LOCUS_32340 1103 585 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275600.1 protein_id gnl|my_center|LOCUS_32340 >Feature sequence1609 42 944 gene locus_tag LOCUS_32350 42 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 >Feature sequence1610 >Feature sequence1611 301 1047 gene locus_tag LOCUS_32360 gene rnc 301 1047 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51648 protein_id gnl|my_center|LOCUS_32360 >Feature sequence1612 >Feature sequence1613 >Feature sequence1614 >Feature sequence1615 >Feature sequence1616 1032 370 gene locus_tag LOCUS_32370 1032 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 >Feature sequence1617 >Feature sequence1618 990 76 gene locus_tag LOCUS_32380 990 76 CDS product sphingosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226710.1 protein_id gnl|my_center|LOCUS_32380 >Feature sequence1619 <1 624 gene locus_tag LOCUS_32390 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021204.1:hexosyltransferase >Feature sequence1620 >Feature sequence1621 <1106 284 gene locus_tag LOCUS_32400 <1106 284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228866.1:two-component sensor histidine kinase >Feature sequence1622 >Feature sequence1623 >Feature sequence1624 <1106 208 gene locus_tag LOCUS_32410 <1106 208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941563.1:protein 3-oxoalanine-generating enzyme family protein >Feature sequence1625 920 9 gene locus_tag LOCUS_32420 920 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 >Feature sequence1626 >Feature sequence1627 >Feature sequence1628 >Feature sequence1629 864 553 gene locus_tag LOCUS_32430 864 553 CDS product 2-oxoacid:acceptor oxidoreductase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391920.1 protein_id gnl|my_center|LOCUS_32430 >Feature sequence1630 >Feature sequence1631 >Feature sequence1632 1098 25 gene locus_tag LOCUS_32440 1098 25 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941040.1 protein_id gnl|my_center|LOCUS_32440 >Feature sequence1633 >Feature sequence1634 >Feature sequence1635 291 587 gene locus_tag LOCUS_32450 291 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 656 787 gene locus_tag LOCUS_32460 656 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence1636 >Feature sequence1637 >Feature sequence1638 >Feature sequence1639 790 957 gene locus_tag LOCUS_32470 790 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 >Feature sequence1640 3 134 gene locus_tag LOCUS_32480 3 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 145 564 gene locus_tag LOCUS_32490 145 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 566 988 gene locus_tag LOCUS_32500 566 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence1641 >Feature sequence1642 >Feature sequence1643 >Feature sequence1644 >Feature sequence1645 >Feature sequence1646 >Feature sequence1647 >Feature sequence1648 >Feature sequence1649 >Feature sequence1650 1050 544 gene locus_tag LOCUS_32510 1050 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence1651 >Feature sequence1652 >Feature sequence1653 399 800 gene locus_tag LOCUS_32520 399 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 >Feature sequence1654 >Feature sequence1655 >Feature sequence1656 >Feature sequence1657 >Feature sequence1658 >Feature sequence1659 89 313 gene locus_tag LOCUS_32530 89 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence1660 >Feature sequence1661 >Feature sequence1662 991 182 gene locus_tag LOCUS_32540 991 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 >Feature sequence1663 >Feature sequence1664 131 289 gene locus_tag LOCUS_32550 131 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 324 491 gene locus_tag LOCUS_32560 324 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 645 806 gene locus_tag LOCUS_32570 645 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence1665 >Feature sequence1666 >Feature sequence1667 >Feature sequence1668 >Feature sequence1669 <1067 6 gene locus_tag LOCUS_32580 <1067 6 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942141.1:acetoacetate metabolism regulatory protein AtoC >Feature sequence1670 541 155 gene locus_tag LOCUS_32590 541 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence1671 >Feature sequence1672 405 785 gene locus_tag LOCUS_32600 405 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063921.1 protein_id gnl|my_center|LOCUS_32600 >Feature sequence1673 >Feature sequence1674 <1 916 gene locus_tag LOCUS_32610 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787920.1:membrane protein >Feature sequence1675 >Feature sequence1676 >Feature sequence1677 <1061 272 gene locus_tag LOCUS_32620 <1061 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KNG5:thiamine-monophosphate kinase >Feature sequence1678 <1 751 gene locus_tag LOCUS_32630 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583596.1:histidine kinase >Feature sequence1679 >Feature sequence1680 1058 744 gene locus_tag LOCUS_32640 1058 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 >Feature sequence1681 >Feature sequence1682 >Feature sequence1683 572 669 gene locus_tag LOCUS_t00290 572 669 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1684 >Feature sequence1685 >Feature sequence1686 <1 852 gene locus_tag LOCUS_32650 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392647.1:1,2-diacylglycerol 3-glucosyltransferase >Feature sequence1687 569 267 gene locus_tag LOCUS_32660 569 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 >Feature sequence1688 >Feature sequence1689 >Feature sequence1690 >Feature sequence1691 <1 992 gene locus_tag LOCUS_32670 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584135.1:protein kinase >Feature sequence1692 >Feature sequence1693 >Feature sequence1694 >Feature sequence1695 400 636 gene locus_tag LOCUS_32680 400 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 >Feature sequence1696 >Feature sequence1697 >Feature sequence1698 >Feature sequence1699 >Feature sequence1700 >Feature sequence1701 >Feature sequence1702 1 279 gene locus_tag LOCUS_32690 1 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence1703 >Feature sequence1704 >Feature sequence1705 >Feature sequence1706 >Feature sequence1707 >Feature sequence1708 262 801 gene locus_tag LOCUS_32700 262 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 >Feature sequence1709 22 774 gene locus_tag LOCUS_32710 gene ybgI 22 774 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EDX0 protein_id gnl|my_center|LOCUS_32710 >Feature sequence1710 >Feature sequence1711 917 21 gene locus_tag LOCUS_32720 917 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 >Feature sequence1712 906 436 gene locus_tag LOCUS_32730 gene rpsG 906 436 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1C9 protein_id gnl|my_center|LOCUS_32730 >Feature sequence1713 <1032 175 gene locus_tag LOCUS_32740 <1032 175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257013.1:adenylate cyclase >Feature sequence1714 >Feature sequence1715 >Feature sequence1716 3 605 gene locus_tag LOCUS_32750 3 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 >Feature sequence1717 >Feature sequence1718 >Feature sequence1719 >Feature sequence1720 >Feature sequence1721 841 290 gene locus_tag LOCUS_32760 841 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence1722 523 56 gene locus_tag LOCUS_32770 523 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 993 541 gene locus_tag LOCUS_32780 993 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 protein_id gnl|my_center|LOCUS_32780 >Feature sequence1723 >Feature sequence1724 460 74 gene locus_tag LOCUS_32790 460 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 578 964 gene locus_tag LOCUS_32800 578 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 >Feature sequence1725 441 650 gene locus_tag LOCUS_32810 441 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence1726 >Feature sequence1727 >Feature sequence1728 >Feature sequence1729 <1017 84 gene locus_tag LOCUS_32820 <1017 84 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963506.1:beta-glucosidase >Feature sequence1730 >Feature sequence1731 >Feature sequence1732 334 262 gene locus_tag LOCUS_t00300 334 262 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 441 369 gene locus_tag LOCUS_t00310 441 369 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 556 473 gene locus_tag LOCUS_t00320 556 473 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 645 573 gene locus_tag LOCUS_t00330 645 573 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1733 >Feature sequence1734 469 122 gene locus_tag LOCUS_32830 469 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529308.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence1735 >Feature sequence1736 <1 750 gene locus_tag LOCUS_32840 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546576.1:ATPase >Feature sequence1737 >Feature sequence1738 >Feature sequence1739 >Feature sequence1740 563 730 gene locus_tag LOCUS_32850 563 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence1741 2 304 gene locus_tag LOCUS_32860 2 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 371 670 gene locus_tag LOCUS_32870 371 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 >Feature sequence1742 303 728 gene locus_tag LOCUS_32880 303 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140970.1 protein_id gnl|my_center|LOCUS_32880 1006 794 gene locus_tag LOCUS_32890 1006 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 >Feature sequence1743 253 756 gene locus_tag LOCUS_32900 253 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 >Feature sequence1744 >Feature sequence1745 >Feature sequence1746 >Feature sequence1747 >Feature sequence1748 >Feature sequence1749